#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PHACTR4	65979	hgsc.bcm.edu	37	1	28800653	28800653	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:28800653A>T	ENST00000373839.3	+	7	1672	c.1411A>T	c.(1411-1413)Atg>Ttg	p.M471L	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.M481L	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	471					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		CACTATTGAAATGCTAAAAGT	0.413																																					p.M481L		Atlas-SNP	.											.	PHACTR4	64	.	0			c.A1441T						PASS	.						102.0	103.0	103.0					1																	28800653		1898	4120	6018	SO:0001583	missense	65979	exon6			ATTGAAATGCTAA	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1411A>T	chr1.hg19:g.28800653A>T	ENSP00000362945:p.Met471Leu	211.0	0.0	.		214.0	19.0	.	NM_023923	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	hg19	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	A	4.322	0.059030	0.08339	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.21191	2.02;2.02	5.75	4.55	0.56014	.	0.347042	0.36134	N	0.002762	T	0.13286	0.0322	N	0.20401	0.57	0.30856	N	0.734034	B;B	0.19073	0.033;0.009	B;B	0.18871	0.023;0.004	T	0.06972	-1.0797	10	0.27785	T	0.31	-6.0179	10.959	0.47374	0.7173:0.2827:0.0:0.0	.	481;471	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	L	471;481;470	ENSP00000362945:M471L;ENSP00000362942:M481L	ENSP00000362942:M481L	M	+	1	0	PHACTR4	28673240	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.932000	0.56537	2.190000	0.69967	0.533000	0.62120	ATG	.	.	.	none		0.413	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
FAM151A	338094	hgsc.bcm.edu	37	1	55077293	55077293	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:55077293A>C	ENST00000302250.2	-	6	1086	c.926T>G	c.(925-927)tTc>tGc	p.F309C	FAM151A_ENST00000371304.2_Intron|ACOT11_ENST00000371316.3_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	309						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CAGCTGCTTGAACTGTGACAG	0.567																																					p.F309C		Atlas-SNP	.											.	FAM151A	58	.	0			c.T926G						PASS	.						127.0	111.0	116.0					1																	55077293		2203	4300	6503	SO:0001583	missense	338094	exon6			TGCTTGAACTGTG	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.926T>G	chr1.hg19:g.55077293A>C	ENSP00000306888:p.Phe309Cys	137.0	0.0	.		157.0	9.0	.	NM_176782	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	ENST00000302250.2	hg19	CCDS594.1	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560447	0.65538	.	.	ENSG00000162391	ENST00000302250	T	0.15017	2.46	4.59	4.59	0.56863	.	0.064498	0.64402	D	0.000009	T	0.30198	0.0757	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.03413	-1.1039	10	0.87932	D	0	-31.1715	13.3708	0.60711	1.0:0.0:0.0:0.0	.	309	Q8WW52	F151A_HUMAN	C	309	ENSP00000306888:F309C	ENSP00000306888:F309C	F	-	2	0	FAM151A	54849881	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.952000	0.75989	2.039000	0.60335	0.533000	0.62120	TTC	.	.	.	none		0.567	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782	
SSX2IP	117178	hgsc.bcm.edu	37	1	85121610	85121610	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:85121610G>A	ENST00000342203.3	-	11	1557	c.1294C>T	c.(1294-1296)Ctc>Ttc	p.L432F	SSX2IP_ENST00000437941.2_Missense_Mutation_p.L405F|SSX2IP_ENST00000605755.1_Missense_Mutation_p.L405F|SSX2IP_ENST00000370612.4_Missense_Mutation_p.L432F|SSX2IP_ENST00000603677.1_Intron	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	432					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTTCTTTGAGACGTTCCTTT	0.388																																					p.L432F		Atlas-SNP	.											.	SSX2IP	53	.	0			c.C1294T						PASS	.						86.0	85.0	86.0					1																	85121610		2203	4300	6503	SO:0001583	missense	117178	exon11			CTTTGAGACGTTC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1294C>T	chr1.hg19:g.85121610G>A	ENSP00000340279:p.Leu432Phe	81.0	0.0	.		82.0	6.0	.	NM_001166293	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	hg19	CCDS699.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495910	0.85069	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.67345	-0.21;-0.26	5.07	5.07	0.68467	.	0.116998	0.64402	D	0.000014	T	0.71392	0.3334	M	0.62723	1.935	0.49798	D	0.999822	D;D;D	0.67145	0.996;0.987;0.987	P;P;P	0.56474	0.799;0.635;0.635	T	0.72064	-0.4403	10	0.49607	T	0.09	-20.4465	18.6376	0.91384	0.0:0.0:1.0:0.0	.	428;432;405	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	F	432;405;428;432	ENSP00000340279:L432F;ENSP00000412781:L405F	ENSP00000340279:L432F	L	-	1	0	SSX2IP	84894198	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.237000	0.65360	2.648000	0.89879	0.591000	0.81541	CTC	.	.	.	none		0.388	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
TXNIP	10628	hgsc.bcm.edu	37	1	145439917	145439917	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:145439917G>A	ENST00000369317.4	+	3	797	c.463G>A	c.(463-465)Gat>Aat	p.D155N	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	155					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAATACCCCTGATTTAATGGT	0.428																																					p.D155N		Atlas-SNP	.											.	TXNIP	51	.	0			c.G463A						PASS	.						86.0	92.0	90.0					1																	145439917		2202	4299	6501	SO:0001583	missense	10628	exon3			ACCCCTGATTTAA	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.463G>A	chr1.hg19:g.145439917G>A	ENSP00000358323:p.Asp155Asn	206.0	0.0	.		171.0	19.0	.	NM_006472	B4E3D3|Q16226|Q6PML0|Q9BXG9	Missense_Mutation	SNP	ENST00000369317.4	hg19	CCDS913.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529556	0.64860	.	.	ENSG00000117289	ENST00000369317;ENST00000425134	T;T	0.11169	3.17;2.8	5.27	5.27	0.74061	Immunoglobulin E-set (1);	0.048081	0.85682	D	0.000000	T	0.06371	0.0164	N	0.25485	0.75	0.80722	D	1	P;P	0.51791	0.938;0.948	P;P	0.49528	0.532;0.614	T	0.46034	-0.9220	10	0.15499	T	0.54	-0.5065	16.4254	0.83813	0.0:0.0:1.0:0.0	.	100;155	B4E3D3;Q9H3M7	.;TXNIP_HUMAN	N	155;100	ENSP00000358323:D155N;ENSP00000396322:D100N	ENSP00000358323:D155N	D	+	1	0	TXNIP	144151274	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.243000	0.78219	2.753000	0.94483	0.651000	0.88453	GAT	.	.	.	none		0.428	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472	
PYHIN1	149628	hgsc.bcm.edu	37	1	158912063	158912063	+	Silent	SNP	T	T	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:158912063T>G	ENST00000368140.1	+	5	1121	c.876T>G	c.(874-876)gcT>gcG	p.A292A	PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000368138.3_Silent_p.A283A|PYHIN1_ENST00000392252.3_Silent_p.A283A|PYHIN1_ENST00000392254.2_Silent_p.A292A	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	292	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TATCTGAAGCTGGTCCTGACC	0.353																																					p.A292A		Atlas-SNP	.											.	PYHIN1	208	.	0			c.T876G						PASS	.						49.0	50.0	50.0					1																	158912063		2203	4298	6501	SO:0001819	synonymous_variant	149628	exon5			TGAAGCTGGTCCT	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.876T>G	chr1.hg19:g.158912063T>G		78.0	0.0	.		72.0	8.0	.	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	ENST00000368140.1	hg19	CCDS1178.1																																																																																			.	.	.	none		0.353	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
OBSCN	84033	hgsc.bcm.edu	37	1	228491399	228491399	+	Intron	SNP	G	G	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:228491399G>A	ENST00000422127.1	+	44	11703				OBSCN_ENST00000366707.4_Missense_Mutation_p.D1278N|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_3'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.D4588N|OBSCN_ENST00000366709.4_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ATTCATAGAAGATGTGAGAAA	0.567																																					p.D4588N		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G13762A						PASS	.						127.0	116.0	119.0					1																	228491399		876	1991	2867	SO:0001627	intron_variant	84033	exon52			ATAGAAGATGTGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11660-2674G>A	chr1.hg19:g.228491399G>A		90.0	0.0	.		117.0	14.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785132	0.70222	.	.	ENSG00000154358	ENST00000366707	T	0.66638	-0.22	4.34	1.41	0.22369	.	.	.	.	.	T	0.51736	0.1692	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36986	-0.9725	6	0.17369	T	0.5	.	9.7011	0.40187	0.2312:0.0:0.7688:0.0	.	.	.	.	N	1278	ENSP00000355668:D1278N	ENSP00000355668:D1278N	D	+	1	0	OBSCN	226558022	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.534000	0.06150	0.117000	0.18138	-0.266000	0.10368	GAT	.	.	.	none		0.567	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ZP4	57829	hgsc.bcm.edu	37	1	238053765	238053765	+	Silent	SNP	A	A	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr1:238053765A>T	ENST00000366570.4	-	1	329	c.171T>A	c.(169-171)gcT>gcA	p.A57A	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	57					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ACTTACCCCAAGCTATTAGTA	0.478																																					p.A57A	NSCLC(166;160 2029 11600 18754 19936)	Atlas-SNP	.											.	ZP4	161	.	0			c.T171A						PASS	.						68.0	67.0	67.0					1																	238053765		2203	4300	6503	SO:0001819	synonymous_variant	57829	exon1			ACCCCAAGCTATT	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.171T>A	chr1.hg19:g.238053765A>T		61.0	0.0	.		89.0	9.0	.	NM_021186	B2RAE1	Silent	SNP	ENST00000366570.4	hg19	CCDS1615.1																																																																																			.	.	.	none		0.478	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
CRIM1	51232	hgsc.bcm.edu	37	2	36583678	36583678	+	Nonsense_Mutation	SNP	C	C	G	rs369487866		TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:36583678C>G	ENST00000280527.2	+	1	610	c.243C>G	c.(241-243)taC>taG	p.Y81*	RP11-490M8.1_ENST00000565283.1_lincRNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	81	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TCGGGATTTACGGAACCTGCG	0.682																																					p.Y81X		Atlas-SNP	.											.	CRIM1	88	.	0			c.C243G						PASS	.						40.0	42.0	41.0					2																	36583678		2202	4298	6500	SO:0001587	stop_gained	51232	exon1			GATTTACGGAACC	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.243C>G	chr2.hg19:g.36583678C>G	ENSP00000280527:p.Tyr81*	68.0	0.0	.		72.0	8.0	.	NM_016441	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Nonsense_Mutation	SNP	ENST00000280527.2	hg19	CCDS1783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	36|36	5.673833|5.673833	0.96764|0.96764	.|.	.|.	ENSG00000150938|ENSG00000150938	ENST00000428774|ENST00000280527;ENST00000426856	.|.	.|.	.|.	3.26|3.26	-0.383|-0.383	0.12477|0.12477	.|.	.|0.313844	.|0.28790	.|N	.|0.014130	T|.	0.13157|.	0.0319|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34527|.	-0.9825|.	3|.	.|0.02654	.|T	.|1	-0.0216|-0.0216	4.367|4.367	0.11228|0.11228	0.0:0.4434:0.1693:0.3873|0.0:0.4434:0.1693:0.3873	.|.	.|.	.|.	.|.	R|X	22|81;31	.|.	.|ENSP00000280527:Y81X	T|Y	+|+	2|3	0|2	CRIM1|CRIM1	36437182|36437182	0.988000|0.988000	0.35896|0.35896	0.948000|0.948000	0.38648|0.38648	0.105000|0.105000	0.19272|0.19272	0.433000|0.433000	0.21477|0.21477	-0.053000|-0.053000	0.13289|0.13289	-0.132000|-0.132000	0.14878|0.14878	ACG|TAC	.	.	.	alt		0.682	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
SRBD1	55133	hgsc.bcm.edu	37	2	45647009	45647009	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:45647009T>C	ENST00000263736.4	-	17	2136	c.2074A>G	c.(2074-2076)Aag>Gag	p.K692E	SRBD1_ENST00000535761.1_Missense_Mutation_p.K211E|SRBD1_ENST00000490133.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	692					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AGTGTTGCCTTGAGTAAAGTC	0.383																																					p.K692E		Atlas-SNP	.											.	SRBD1	107	.	0			c.A2074G						PASS	.						151.0	136.0	141.0					2																	45647009		2203	4300	6503	SO:0001583	missense	55133	exon17			TTGCCTTGAGTAA	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2074A>G	chr2.hg19:g.45647009T>C	ENSP00000263736:p.Lys692Glu	111.0	0.0	.		170.0	19.0	.	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	hg19	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.029717	0.54790	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.32272	1.83;1.46	5.74	5.74	0.90152	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40372	0.1114	L	0.39020	1.185	0.46336	D	0.998999	D	0.67145	0.996	P	0.60609	0.877	T	0.08994	-1.0695	10	0.14656	T	0.56	.	16.0363	0.80631	0.0:0.0:0.0:1.0	.	692	Q8N5C6	SRBD1_HUMAN	E	692;211	ENSP00000263736:K692E;ENSP00000441272:K211E	ENSP00000263736:K692E	K	-	1	0	SRBD1	45500513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.193000	0.70182	0.460000	0.39030	AAG	.	.	.	none		0.383	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
EIF5B	9669	hgsc.bcm.edu	37	2	99978207	99978207	+	Silent	SNP	A	A	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:99978207A>T	ENST00000289371.6	+	4	1045	c.843A>T	c.(841-843)gtA>gtT	p.V281V		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	281					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAGAAACTGTAAAATCCAAAG	0.388																																					p.V281V	Colon(162;2388 2567 2705 3444)	Atlas-SNP	.											EIF5B,colon,carcinoma,0,1	EIF5B	95	.	0			c.A843T						PASS	.						98.0	97.0	97.0					2																	99978207		1836	4081	5917	SO:0001819	synonymous_variant	9669	exon4			AACTGTAAAATCC	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.843A>T	chr2.hg19:g.99978207A>T		185.0	0.0	.		187.0	15.0	.	NM_015904	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	ENST00000289371.6	hg19	CCDS42721.1																																																																																			.	.	.	none		0.388	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330364.2	NM_015904	
SLC20A1	6574	hgsc.bcm.edu	37	2	113404533	113404533	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:113404533A>T	ENST00000272542.3	+	2	667	c.128A>T	c.(127-129)gAt>gTt	p.D43V	AC079922.3_ENST00000457336.1_lincRNA	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	43					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						GGAGCCAATGATGTAGCAAAT	0.502																																					p.D43V		Atlas-SNP	.											.	SLC20A1	59	.	0			c.A128T						PASS	.						110.0	104.0	106.0					2																	113404533		2203	4300	6503	SO:0001583	missense	6574	exon2			CCAATGATGTAGC		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.128A>T	chr2.hg19:g.113404533A>T	ENSP00000272542:p.Asp43Val	96.0	0.0	.		97.0	10.0	.	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	hg19	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542663	0.85917	.	.	ENSG00000144136	ENST00000272542	D	0.95412	-3.7	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.98557	0.9518	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99372	1.0920	10	0.87932	D	0	3.1498	13.0754	0.59083	1.0:0.0:0.0:0.0	.	43	Q8WUM9	S20A1_HUMAN	V	43	ENSP00000272542:D43V	ENSP00000272542:D43V	D	+	2	0	SLC20A1	113121004	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.283000	0.95860	2.036000	0.60181	0.482000	0.46254	GAT	.	.	.	none		0.502	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
ERCC3	2071	hgsc.bcm.edu	37	2	128050232	128050232	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:128050232T>A	ENST00000285398.2	-	3	519	c.425A>T	c.(424-426)aAg>aTg	p.K142M	ERCC3_ENST00000493187.2_Missense_Mutation_p.K78M	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	142					7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CTTGCTGAGCTTCCTGAGGTA	0.493			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.K142M		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	.	ERCC3	73	.	0			c.A425T						PASS	.						102.0	92.0	95.0					2																	128050232		2203	4300	6503	SO:0001583	missense	2071	exon3	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTGAGCTTCCTGA	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.425A>T	chr2.hg19:g.128050232T>A	ENSP00000285398:p.Lys142Met	110.0	0.0	.		116.0	12.0	.	NM_000122	Q53QM0	Missense_Mutation	SNP	ENST00000285398.2	hg19	CCDS2144.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485972	0.84854	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.73363	-0.74;-0.74	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.81356	0.4805	L	0.57536	1.79	0.80722	D	1	B	0.24576	0.106	P	0.46208	0.507	T	0.81722	-0.0803	10	0.72032	D	0.01	-32.2621	14.8747	0.70485	0.0:0.0:0.0:1.0	.	142	P19447	ERCC3_HUMAN	M	142;78	ENSP00000285398:K142M;ENSP00000444796:K78M	ENSP00000285398:K142M	K	-	2	0	ERCC3	127766702	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	1.916000	0.55485	0.528000	0.53228	AAG	.	.	.	none		0.493	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331028.1	NM_000122	
UGT1A1	54658	hgsc.bcm.edu	37	2	234669022	234669022	+	Missense_Mutation	SNP	T	T	C	rs375204962		TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr2:234669022T>C	ENST00000608383.1	+	1	89	c.89T>C	c.(88-90)aTa>aCa	p.I30T	UGT1A1_ENST00000608381.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000360418.3_Missense_Mutation_p.I30T|UGT1A1_ENST00000609767.1_Intron|UGT1A8_ENST00000305208.5_Missense_Mutation_p.I30T			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	30					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	GCTGGGAAGATACTGTTGATC	0.612																																					p.I30T		Atlas-SNP	.											UGT1A1,NS,carcinoma,0,1	UGT1A1	81	.	0			c.T89C						PASS	.	T	THR/ILE,,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	66.0	52.0	57.0		89,,,,,,,,,	6.1	0.1	2		57	0,8600		0,0,4300	no	missense,intron,intron,intron,intron,intron,intron,intron,intron,intron	UGT1A10,UGT1A8,UGT1A7,UGT1A6,UGT1A5,UGT1A9,UGT1A4,UGT1A1,UGT1A3	NM_000463.2,NM_001072.3,NM_007120.2,NM_019075.2,NM_019076.4,NM_019077.2,NM_019078.1,NM_019093.2,NM_021027.2,NM_205862.1	89,,,,,,,,,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign,,,,,,,,,	30/534,,,,,,,,,	234669022	1,13005	2203	4300	6503	SO:0001583	missense	54658	exon1			GGAAGATACTGTT	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.89T>C	chr2.hg19:g.234669022T>C	ENSP00000476741:p.Ile30Thr	44.0	1.0	.		52.0	5.0	.	NM_000463	A6NJC3|B8K286	Missense_Mutation	SNP	ENST00000608383.1	hg19	CCDS2510.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425296	0.62733	2.27E-4	0.0	ENSG00000241635	ENST00000305208;ENST00000360418	T;T	0.71103	-0.54;-0.54	6.07	6.07	0.98685	.	.	.	.	.	T	0.80076	0.4557	L	0.55990	1.75	0.31696	N	0.641215	P;P	0.46952	0.887;0.537	P;B	0.58266	0.836;0.158	T	0.82948	-0.0204	9	0.87932	D	0	.	16.6277	0.84984	0.0:0.0:0.0:1.0	.	30;30	A6NJC3;P22309	.;UD11_HUMAN	T	30	ENSP00000304845:I30T;ENSP00000353593:I30T	ENSP00000304845:I30T	I	+	2	0	UGT1A1	234333761	0.998000	0.40836	0.056000	0.19401	0.047000	0.14425	8.001000	0.88508	2.330000	0.79161	0.528000	0.53228	ATA	.	.	.	weak		0.612	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	protein_coding			
PLCXD2	257068	hgsc.bcm.edu	37	3	111432757	111432757	+	Silent	SNP	C	C	T	rs372815872		TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr3:111432757C>T	ENST00000477665.1	+	3	972	c.648C>T	c.(646-648)ccC>ccT	p.P216P	PLCXD2_ENST00000393934.3_Silent_p.P216P	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	216					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.P216P(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						ACCACTGTCCCTTCTACAAGC	0.443																																					p.P216P		Atlas-SNP	.											.	PLCXD2	36	.	1	Substitution - coding silent(1)	lung(1)	c.C648T						PASS	.	C	,	1,4405	2.1+/-5.4	0,1,2202	83.0	82.0	82.0		648,648	3.5	1.0	3		82	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PLCXD2	NM_001185106.1,NM_153268.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	216/306,216/305	111432757	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	257068	exon3			CTGTCCCTTCTAC	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.648C>T	chr3.hg19:g.111432757C>T		142.0	0.0	.		111.0	13.0	.	NM_001185106	Q96N12	Silent	SNP	ENST00000477665.1	hg19	CCDS54619.1																																																																																			.	.	.	weak		0.443	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
OTUD4	54726	hgsc.bcm.edu	37	4	146076795	146076795	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr4:146076795C>A	ENST00000447906.2	-	9	921	c.734G>T	c.(733-735)aGa>aTa	p.R245I	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000454497.2_Missense_Mutation_p.R180I			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	245					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AAGAACCTTTCTAGACAAAGG	0.358																																					p.R180I		Atlas-SNP	.											.	OTUD4	120	.	0			c.G539T						PASS	.						106.0	105.0	105.0					4																	146076795		2203	4300	6503	SO:0001583	missense	54726	exon9			ACCTTTCTAGACA		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.734G>T	chr4.hg19:g.146076795C>A	ENSP00000395487:p.Arg245Ile	212.0	0.0	.		176.0	11.0	.	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	hg19		.	.	.	.	.	.	.	.	.	.	C	16.36	3.101779	0.56183	.	.	ENSG00000164164	ENST00000454497;ENST00000447906;ENST00000514973	T;T;T	0.32753	1.44;1.44;1.45	5.37	5.37	0.77165	.	0.077530	0.56097	D	0.000034	T	0.40448	0.1117	L	0.60455	1.87	0.80722	D	1	D;D	0.65815	0.995;0.985	P;P	0.52217	0.693;0.578	T	0.18777	-1.0326	10	0.54805	T	0.06	-19.7161	11.4953	0.50404	0.0:0.9095:0.0:0.0905	.	245;244	G3V0I6;Q01804	.;OTUD4_HUMAN	I	180;245;179	ENSP00000409279:R180I;ENSP00000395487:R245I;ENSP00000425972:R179I	ENSP00000395487:R245I	R	-	2	0	OTUD4	146296245	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	0.964000	0.29306	2.669000	0.90835	0.655000	0.94253	AGA	.	.	.	none		0.358	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
ARAP3	64411	hgsc.bcm.edu	37	5	141033934	141033934	+	Silent	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr5:141033934T>C	ENST00000239440.4	-	33	4283	c.4218A>G	c.(4216-4218)ccA>ccG	p.P1406P	ARAP3_ENST00000512390.1_5'UTR|FCHSD1_ENST00000522783.1_5'Flank|ARAP3_ENST00000513878.1_Silent_p.P1055P|FCHSD1_ENST00000435817.2_5'Flank|ARAP3_ENST00000508305.1_Silent_p.P1237P|FCHSD1_ENST00000519800.1_5'Flank	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1406					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CCTCATACACTGGCTCCTCGT	0.577																																					p.P1406P		Atlas-SNP	.											.	ARAP3	139	.	0			c.A4218G						PASS	.						106.0	105.0	105.0					5																	141033934		2203	4300	6503	SO:0001819	synonymous_variant	64411	exon33			ATACACTGGCTCC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4218A>G	chr5.hg19:g.141033934T>C		128.0	0.0	.		144.0	15.0	.	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	hg19	CCDS4266.1																																																																																			.	.	.	none		0.577	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
RBM27	54439	hgsc.bcm.edu	37	5	145613182	145613182	+	Silent	SNP	C	C	T	rs531339624		TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr5:145613182C>T	ENST00000265271.5	+	7	1186	c.1020C>T	c.(1018-1020)ggC>ggT	p.G340G	RBM27_ENST00000506502.1_Silent_p.G340G	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	340	Pro-rich.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			caggtccaggcccaggcccgg	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		12582	0.0		0.001	False		,,,				2504	0.0				p.G340G		Atlas-SNP	.											.	RBM27	119	.	0			c.C1020T						PASS	.						72.0	69.0	70.0					5																	145613182		1568	3582	5150	SO:0001819	synonymous_variant	54439	exon7			TCCAGGCCCAGGC	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1020C>T	chr5.hg19:g.145613182C>T		101.0	0.0	.		83.0	4.0	.	NM_018989	Q8IYW9	Silent	SNP	ENST00000265271.5	hg19	CCDS43378.1																																																																																			.	.	.	none		0.622	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
FBXO38	81545	hgsc.bcm.edu	37	5	147781650	147781650	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr5:147781650A>G	ENST00000340253.5	+	4	536	c.368A>G	c.(367-369)cAt>cGt	p.H123R	FBXO38_ENST00000296701.6_Missense_Mutation_p.H123R|FBXO38_ENST00000394370.3_Missense_Mutation_p.H123R|FBXO38_ENST00000509699.2_3'UTR|FBXO38_ENST00000513826.1_Missense_Mutation_p.H123R			Q6PIJ6	FBX38_HUMAN	F-box protein 38	123					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAAGGGGCCATGAGGCTTTT	0.458																																					p.H123R		Atlas-SNP	.											.	FBXO38	115	.	0			c.A368G						PASS	.						143.0	136.0	139.0					5																	147781650		2203	4299	6502	SO:0001583	missense	81545	exon4			GGGGCCATGAGGC	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.368A>G	chr5.hg19:g.147781650A>G	ENSP00000342023:p.His123Arg	147.0	0.0	.		143.0	19.0	.	NM_001271723	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	hg19		.	.	.	.	.	.	.	.	.	.	A	15.58	2.876042	0.51695	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.29917	1.55;1.56;1.55;1.56	5.77	5.77	0.91146	F-box domain, Skp2-like (1);	0.152919	0.64402	D	0.000014	T	0.20373	0.0490	L	0.27053	0.805	0.42393	D	0.992538	B;B;P	0.47677	0.038;0.053;0.899	B;B;B	0.41036	0.023;0.022;0.346	T	0.05683	-1.0870	10	0.02654	T	1	-12.0661	15.2058	0.73177	1.0:0.0:0.0:0.0	.	123;123;123	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	R	123	ENSP00000342023:H123R;ENSP00000296701:H123R;ENSP00000377895:H123R;ENSP00000426410:H123R	ENSP00000296701:H123R	H	+	2	0	FBXO38	147761843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.793000	0.69060	2.326000	0.78906	0.533000	0.62120	CAT	.	.	.	none		0.458	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
RFX6	222546	hgsc.bcm.edu	37	6	117241541	117241541	+	Silent	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr6:117241541T>C	ENST00000332958.2	+	12	1267	c.1251T>C	c.(1249-1251)gaT>gaC	p.D417D		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	417					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AAAGGGTTGATTTGAACAGCA	0.418																																					p.D417D		Atlas-SNP	.											.	RFX6	141	.	0			c.T1251C						PASS	.						221.0	197.0	205.0					6																	117241541		2203	4300	6503	SO:0001819	synonymous_variant	222546	exon12			GGTTGATTTGAAC	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1251T>C	chr6.hg19:g.117241541T>C		236.0	0.0	.		264.0	22.0	.	NM_173560	Q5T6B3	Silent	SNP	ENST00000332958.2	hg19	CCDS5113.1																																																																																			.	.	.	none		0.418	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
MAD1L1	8379	hgsc.bcm.edu	37	7	1855740	1855740	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr7:1855740G>A	ENST00000406869.1	-	19	2680	c.2123C>T	c.(2122-2124)aCc>aTc	p.T708I	MAD1L1_ENST00000402746.1_Missense_Mutation_p.T616I|MAD1L1_ENST00000399654.2_Missense_Mutation_p.T708I|MAD1L1_ENST00000265854.7_Missense_Mutation_p.T708I			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	708					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GAGCTCGAGGGTGAGCGAGCT	0.667																																					p.T708I		Atlas-SNP	.											.	MAD1L1	81	.	0			c.C2123T						PASS	.						28.0	35.0	33.0					7																	1855740		2040	4207	6247	SO:0001583	missense	8379	exon19			TCGAGGGTGAGCG	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.2123C>T	chr7.hg19:g.1855740G>A	ENSP00000385334:p.Thr708Ile	47.0	0.0	.		81.0	15.0	.	NM_003550	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	ENST00000406869.1	hg19	CCDS43539.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679536	0.88542	.	.	ENSG00000002822	ENST00000402746;ENST00000399654;ENST00000406869;ENST00000442131;ENST00000265854;ENST00000450235	T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57	3.98	3.98	0.46160	.	.	.	.	.	T	0.73628	0.3611	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79671	-0.1706	9	0.87932	D	0	-6.9772	16.1426	0.81536	0.0:0.0:1.0:0.0	.	616;708	B3KR41;Q9Y6D9	.;MD1L1_HUMAN	I	616;708;708;259;708;259	ENSP00000384155:T616I;ENSP00000382562:T708I;ENSP00000385334:T708I;ENSP00000265854:T708I;ENSP00000394886:T259I	ENSP00000265854:T708I	T	-	2	0	MAD1L1	1822266	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.338000	0.90038	1.787000	0.52448	0.456000	0.33151	ACC	.	.	.	none		0.667	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550	
GLI3	2737	hgsc.bcm.edu	37	7	42004728	42004728	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr7:42004728G>T	ENST00000395925.3	-	15	4027	c.3943C>A	c.(3943-3945)Cag>Aag	p.Q1315K	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1315					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						ACTGGGTCCTGGTTCTGCATG	0.652									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.Q1315K		Atlas-SNP	.											.	GLI3	312	.	0			c.C3943A						PASS	.						37.0	36.0	36.0					7																	42004728		2203	4300	6503	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	GGTCCTGGTTCTG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3943C>A	chr7.hg19:g.42004728G>T	ENSP00000379258:p.Gln1315Lys	69.0	0.0	.		89.0	5.0	.	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681803	0.47991	.	.	ENSG00000106571	ENST00000395925	T	0.12569	2.67	5.65	5.65	0.86999	.	0.741669	0.13841	N	0.359041	T	0.09024	0.0223	N	0.22421	0.69	0.23150	N	0.998213	B	0.13145	0.007	B	0.10450	0.005	T	0.34900	-0.9810	10	0.10377	T	0.69	.	9.7991	0.40753	0.0:0.1247:0.6842:0.1911	.	1315	P10071	GLI3_HUMAN	K	1315	ENSP00000379258:Q1315K	ENSP00000379258:Q1315K	Q	-	1	0	GLI3	41971253	0.977000	0.34250	0.012000	0.15200	0.777000	0.43975	2.070000	0.41491	2.655000	0.90218	0.655000	0.94253	CAG	.	.	.	none		0.652	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
CALCR	799	hgsc.bcm.edu	37	7	93055856	93055856	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr7:93055856A>G	ENST00000394441.1	-	13	1552	c.1237T>C	c.(1237-1239)Tgg>Cgg	p.W413R	CALCR_ENST00000421592.1_Missense_Mutation_p.W429R|CALCR_ENST00000360249.4_Missense_Mutation_p.W429R|CALCR_ENST00000426151.1_Missense_Mutation_p.W413R|CALCR_ENST00000359558.2_Missense_Mutation_p.W447R	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	447					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CGCTGGTTCCACTGAATTTTG	0.542																																					p.W447R		Atlas-SNP	.											.	CALCR	200	.	0			c.T1339C						PASS	.						46.0	51.0	50.0					7																	93055856		2203	4300	6503	SO:0001583	missense	799	exon16			GGTTCCACTGAAT	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1237T>C	chr7.hg19:g.93055856A>G	ENSP00000377959:p.Trp413Arg	154.0	0.0	.		142.0	15.0	.	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	hg19	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823645	0.71143	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	4.57	4.57	0.56435	.	.	.	.	.	T	0.68659	0.3025	L	0.45228	1.405	0.51482	D	0.999925	D;P	0.71674	0.998;0.613	D;B	0.72075	0.976;0.248	T	0.66106	-0.6006	9	0.33141	T	0.24	.	10.4932	0.44762	1.0:0.0:0.0:0.0	.	447;413	F5H605;A4D1G6	.;.	R	447;429;429;413;413	ENSP00000352561:W447R;ENSP00000353385:W429R;ENSP00000399552:W429R;ENSP00000377959:W413R;ENSP00000389295:W413R	ENSP00000352561:W447R	W	-	1	0	CALCR	92893792	1.000000	0.71417	0.495000	0.27527	0.014000	0.08584	6.514000	0.73746	2.055000	0.61198	0.477000	0.44152	TGG	.	.	.	none		0.542	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
EPHB6	2051	hgsc.bcm.edu	37	7	142562311	142562311	+	Silent	SNP	G	G	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr7:142562311G>T	ENST00000392957.2	+	7	1540	c.753G>T	c.(751-753)ggG>ggT	p.G251G	EPHB6_ENST00000442129.1_Silent_p.G251G|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	251	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GTGGGGCTGGGGGGGCCTCCC	0.682																																					p.G251G		Atlas-SNP	.											.	EPHB6	168	.	0			c.G753T						PASS	.						47.0	59.0	55.0					7																	142562311		2184	4281	6465	SO:0001819	synonymous_variant	2051	exon7			GGCTGGGGGGGCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.753G>T	chr7.hg19:g.142562311G>T		212.0	0.0	.		233.0	37.0	.	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.	.	none		0.682	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
PDP1	54704	hgsc.bcm.edu	37	8	94935503	94935503	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr8:94935503T>A	ENST00000297598.4	+	2	1485	c.1216T>A	c.(1216-1218)Tta>Ata	p.L406I	PDP1_ENST00000520728.1_Missense_Mutation_p.L406I|PDP1_ENST00000396200.3_Missense_Mutation_p.L431I|PDP1_ENST00000517764.1_Missense_Mutation_p.L406I	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	406					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						TTACCACCGATTAAGGCCACA	0.458																																					p.L431I		Atlas-SNP	.											.	PDP1	97	.	0			c.T1291A						PASS	.						124.0	120.0	121.0					8																	94935503		2203	4300	6503	SO:0001583	missense	54704	exon3			CACCGATTAAGGC	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.1216T>A	chr8.hg19:g.94935503T>A	ENSP00000297598:p.Leu406Ile	144.0	0.0	.		171.0	13.0	.	NM_001161780	B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	ENST00000297598.4	hg19	CCDS6259.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.847623	0.32606	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	6.03	2.5	0.30297	Protein phosphatase 2C-like (5);	0.072136	0.56097	D	0.000026	T	0.20129	0.0484	L	0.28608	0.87	0.58432	D	0.999998	D;P	0.56287	0.975;0.932	P;P	0.57502	0.822;0.725	T	0.02004	-1.1231	10	0.27082	T	0.32	-7.6451	9.7831	0.40660	0.0:0.1882:0.0:0.8118	.	457;406	B4DYX8;Q9P0J1	.;PDP1_HUMAN	I	406;406;431;406	ENSP00000297598:L406I;ENSP00000428317:L406I;ENSP00000379503:L431I;ENSP00000430380:L406I	ENSP00000297598:L406I	L	+	1	2	PDP1	95004679	0.732000	0.28121	1.000000	0.80357	0.993000	0.82548	1.160000	0.31761	1.108000	0.41662	0.533000	0.62120	TTA	.	.	.	none		0.458	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
STAM	8027	hgsc.bcm.edu	37	10	17735224	17735225	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr10:17735224_17735225GC>AA	ENST00000377524.3	+	6	663_664	c.448_449GC>AA	c.(448-450)GCa>AAa	p.A150K	RP11-390B4.3_ENST00000445235.1_RNA|STAM_ENST00000540523.1_Missense_Mutation_p.A39K	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	150					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						TTGTTAGGCTGCAGAACAAGCA	0.406																																					p.A150T|p.A150E		Atlas-SNP	.											.	STAM	60	.	0			c.G448A|c.C449A						PASS	.																																			SO:0001583	missense	8027	exon6			TAGGCTGCAGAAC|AGGCTGCAGAACA	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	Exception_encountered	chr10.hg19:g.17735224_17735225delinsAA	ENSP00000366746:p.Ala150Lys	154.0	0.0	.		124.0|122.0	10.0	.	NM_003473	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	hg19	CCDS7122.1																																																																																			.	.	.	none		0.406	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
MUC2	4583	hgsc.bcm.edu	37	11	1092909	1092909	+	Silent	SNP	C	C	T	rs111487794		TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr11:1092909C>T	ENST00000441003.2	+	30	4755	c.4728C>T	c.(4726-4728)acC>acT	p.T1576T	MUC2_ENST00000359061.5_Silent_p.T1577T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	caacacccaccggcacacaga	0.637																																					p.T1576T		Atlas-SNP	.											.	MUC2	614	.	0			c.C4728T						PASS	.						89.0	132.0	117.0					11																	1092909		1939	3607	5546	SO:0001819	synonymous_variant	4583	exon30			ACCCACCGGCACA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4728C>T	chr11.hg19:g.1092909C>T		0.0	0.0	.		143.0	13.0	.	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	C|0.500;T|0.500	0.500	weak		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KAT5	10524	hgsc.bcm.edu	37	11	65480307	65480307	+	Splice_Site	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr11:65480307T>A	ENST00000377046.3	+	3	420		c.e3+2		KAT5_ENST00000534650.1_Splice_Site|KAT5_ENST00000530446.1_Splice_Site|KAT5_ENST00000525204.1_Splice_Site|KAT5_ENST00000341318.4_Splice_Site|KAT5_ENST00000352980.4_Splice_Site	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5						androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						ACATTGACTGTGAGTTCTGGG	0.547																																					.		Atlas-SNP	.											.	KAT5	36	.	0			c.247+2T>A						PASS	.						123.0	117.0	119.0					11																	65480307		2201	4297	6498	SO:0001630	splice_region_variant	10524	exon2			TGACTGTGAGTTC	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.148+2T>A	chr11.hg19:g.65480307T>A		83.0	0.0	.		117.0	8.0	.	NM_001206833	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Splice_Site	SNP	ENST00000377046.3	hg19	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	t	17.79	3.475097	0.63737	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000530605;ENST00000528198;ENST00000531880	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4329	0.50052	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KAT5	65236883	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.458000	0.66679	1.822000	0.53115	0.459000	0.35465	.	.	.	.	none		0.547	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	Intron
NDUFV1	4723	hgsc.bcm.edu	37	11	67379406	67379406	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr11:67379406C>A	ENST00000322776.6	+	8	1272	c.1119C>A	c.(1117-1119)ttC>ttA	p.F373L	NDUFV1_ENST00000532303.1_Missense_Mutation_p.F272L|NDUFV1_ENST00000415352.2_Missense_Mutation_p.F366L|NDUFV1_ENST00000526169.1_3'UTR|DOC2GP_ENST00000495263.1_RNA|NDUFV1_ENST00000529927.1_Missense_Mutation_p.F364L	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	373					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						TCATTGAGTTCTATAAGCACG	0.612																																					p.F373L		Atlas-SNP	.											.	NDUFV1	30	.	0			c.C1119A						PASS	.						130.0	117.0	122.0					11																	67379406		2200	4294	6494	SO:0001583	missense	4723	exon8			TGAGTTCTATAAG	AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.1119C>A	chr11.hg19:g.67379406C>A	ENSP00000322450:p.Phe373Leu	96.0	0.0	.		124.0	12.0	.	NM_007103	O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Missense_Mutation	SNP	ENST00000322776.6	hg19	CCDS8173.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834500	0.91036	.	.	ENSG00000167792	ENST00000322776;ENST00000532303;ENST00000529927;ENST00000415352;ENST00000453836	D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08	4.89	3.98	0.46160	NADH ubiquinone oxidoreductase, F subunit, iron sulphur binding (2);	0.000000	0.85682	D	0.000000	D	0.97495	0.9180	H	0.98370	4.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.999	D	0.97852	1.0275	10	0.87932	D	0	-20.1332	12.1898	0.54264	0.0:0.9151:0.0:0.0849	.	366;364;373	G3V0I5;P49821-2;P49821	.;.;NDUV1_HUMAN	L	373;272;364;366;244	ENSP00000322450:F373L;ENSP00000432015:F272L;ENSP00000436766:F364L;ENSP00000395368:F366L	ENSP00000322450:F373L	F	+	3	2	NDUFV1	67135982	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.801000	0.55545	1.189000	0.43028	0.491000	0.48974	TTC	.	.	.	none		0.612	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388406.1	NM_007103	
HYLS1	219844	hgsc.bcm.edu	37	11	125769383	125769383	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr11:125769383G>T	ENST00000425380.2	+	3	901	c.120G>T	c.(118-120)agG>agT	p.R40S	PUS3_ENST00000227474.3_Intron|HYLS1_ENST00000526028.1_Missense_Mutation_p.R40S|HYLS1_ENST00000356438.3_Missense_Mutation_p.R40S	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	40						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		GAGATGTCAGGAGAGAAGCCC	0.488																																					p.R40S	Esophageal Squamous(172;2590 2636 8884 10471)	Atlas-SNP	.											HYLS1,NS,carcinoma,0,1	HYLS1	25	.	0			c.G120T						PASS	.						88.0	79.0	82.0					11																	125769383		2201	4299	6500	SO:0001583	missense	219844	exon3			TGTCAGGAGAGAA	AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.120G>T	chr11.hg19:g.125769383G>T	ENSP00000414884:p.Arg40Ser	57.0	0.0	.		81.0	5.0	.	NM_001134793	B3KXI8|Q96BX9	Missense_Mutation	SNP	ENST00000425380.2	hg19	CCDS8467.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446536	0.25987	.	.	ENSG00000198331	ENST00000356438;ENST00000425380;ENST00000526028	T;T;T	0.63580	-0.05;-0.05;-0.05	6.17	1.81	0.25067	.	0.207432	0.29501	N	0.011979	T	0.42854	0.1221	L	0.44542	1.39	0.29443	N	0.859016	P	0.41848	0.763	B	0.31101	0.124	T	0.40905	-0.9538	10	0.40728	T	0.16	.	6.3201	0.21213	0.3191:0.162:0.5189:0.0	.	40	Q96M11	HYLS1_HUMAN	S	40	ENSP00000348815:R40S;ENSP00000414884:R40S;ENSP00000436833:R40S	ENSP00000348815:R40S	R	+	3	2	HYLS1	125274593	0.982000	0.34865	0.982000	0.44146	0.989000	0.77384	0.896000	0.28377	0.507000	0.28148	0.655000	0.94253	AGG	.	.	.	none		0.488	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386733.1	NM_145014	
SLC26A10	65012	hgsc.bcm.edu	37	12	58016635	58016635	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr12:58016635T>C	ENST00000320442.4	+	6	1168	c.857T>C	c.(856-858)aTt>aCt	p.I286T	SLC26A10_ENST00000379218.2_Missense_Mutation_p.I286T	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	286						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					TCGCTGCCCATTGCACTGGTT	0.572																																					p.I286T		Atlas-SNP	.											.	SLC26A10	89	.	0			c.T857C						PASS	.						110.0	91.0	98.0					12																	58016635		2203	4300	6503	SO:0001583	missense	65012	exon6			TGCCCATTGCACT		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.857T>C	chr12.hg19:g.58016635T>C	ENSP00000320217:p.Ile286Thr	88.0	0.0	.		114.0	15.0	.	NM_133489	A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	hg19	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	14.38	2.518982	0.44866	.	.	ENSG00000135502	ENST00000320442;ENST00000379218	D;D	0.93547	-3.24;-3.24	3.76	3.76	0.43208	Sulphate transporter (1);	.	.	.	.	D	0.94850	0.8336	M	0.91090	3.175	0.42787	D	0.993885	P	0.45283	0.855	P	0.46685	0.524	D	0.94723	0.7902	9	0.45353	T	0.12	.	11.1297	0.48339	0.0:0.0:0.0:1.0	.	286	Q8NG04	S2610_HUMAN	T	286	ENSP00000320217:I286T;ENSP00000368520:I286T	ENSP00000320217:I286T	I	+	2	0	SLC26A10	56302902	0.996000	0.38824	0.902000	0.35471	0.457000	0.32468	6.621000	0.74228	1.941000	0.56285	0.523000	0.50628	ATT	.	.	.	none		0.572	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2		
ZMYM5	9205	hgsc.bcm.edu	37	13	20398872	20398872	+	Silent	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr13:20398872T>C	ENST00000337963.4	-	8	2019	c.1755A>G	c.(1753-1755)aaA>aaG	p.K585K		NM_001142684.1	NP_001136156.1	Q9UJ78	ZMYM5_HUMAN	zinc finger, MYM-type 5	585						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			kidney(1)|large_intestine(5)|lung(9)	15		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		acacagaatcttttgaggttg	0.333																																					p.K585K		Atlas-SNP	.											.	ZMYM5	73	.	0			c.A1755G						PASS	.						27.0	23.0	24.0					13																	20398872		1567	3581	5148	SO:0001819	synonymous_variant	9205	exon8			AGAATCTTTTGAG	AF161535	CCDS31942.1, CCDS31943.1	13q12	2013-01-08	2005-09-12	2005-09-12	ENSG00000132950	ENSG00000132950		"""Zinc fingers, MYM type"""	13029	protein-coding gene	gene with protein product			"""zinc finger protein 237"""	ZNF237			Standard	NM_001039650		Approved	ZNF198L1, MYM	uc010tcn.1	Q9UJ78	OTTHUMG00000016504	ENST00000337963.4:c.1755A>G	chr13.hg19:g.20398872T>C		22.0	0.0	.		35.0	4.0	.	NM_001142684	B2R6V1|Q5T6E1|Q5T6E2|Q5T6E4|Q96IY6|Q9NZY5|Q9UBW0|Q9UJ77	Silent	SNP	ENST00000337963.4	hg19																																																																																				.	.	.	none		0.333	ZMYM5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014242	
TNFRSF19	55504	hgsc.bcm.edu	37	13	24243093	24243093	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr13:24243093A>C	ENST00000382258.4	+	9	1306	c.1102A>C	c.(1102-1104)Aac>Cac	p.N368H	TNFRSF19_ENST00000248484.4_Missense_Mutation_p.N368H|TNFRSF19_ENST00000403372.2_Missense_Mutation_p.N236H|TNFRSF19_ENST00000382263.3_Missense_Mutation_p.N368H	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	368					apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		TCATTCTGAAAACTTTACAGC	0.413																																					p.N368H		Atlas-SNP	.											.	TNFRSF19	52	.	0			c.A1102C						PASS	.						113.0	115.0	114.0					13																	24243093		2203	4300	6503	SO:0001583	missense	55504	exon9			TCTGAAAACTTTA	AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.1102A>C	chr13.hg19:g.24243093A>C	ENSP00000371693:p.Asn368His	169.0	0.0	.		160.0	14.0	.	NM_018647	A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Missense_Mutation	SNP	ENST00000382258.4	hg19	CCDS9302.1	.	.	.	.	.	.	.	.	.	.	A	16.15	3.042549	0.55003	.	.	ENSG00000127863	ENST00000248484;ENST00000403372;ENST00000382258;ENST00000382263	T;T;T;T	0.79749	-1.29;1.32;-1.3;-1.29	5.71	3.22	0.36961	.	0.505867	0.20968	N	0.082460	T	0.78892	0.4355	L	0.27053	0.805	0.09310	N	1	D;D;D	0.63880	0.986;0.993;0.993	P;P;P	0.58873	0.794;0.847;0.847	T	0.69176	-0.5214	10	0.66056	D	0.02	-3.4156	8.9366	0.35704	0.853:0.0:0.147:0.0	.	236;368;368	B4E2I6;Q9NS68;Q9NS68-2	.;TNR19_HUMAN;.	H	368;236;368;368	ENSP00000248484:N368H;ENSP00000385408:N236H;ENSP00000371693:N368H;ENSP00000371698:N368H	ENSP00000248484:N368H	N	+	1	0	TNFRSF19	23141093	0.007000	0.16637	0.000000	0.03702	0.006000	0.05464	0.827000	0.27421	0.422000	0.26005	0.533000	0.62120	AAC	.	.	.	none		0.413	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044156.2	NM_018647	
CKAP2	26586	hgsc.bcm.edu	37	13	53042426	53042426	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr13:53042426T>A	ENST00000378037.5	+	7	1583	c.1493T>A	c.(1492-1494)aTg>aAg	p.M498K	CKAP2_ENST00000258607.5_Missense_Mutation_p.M497K|CKAP2_ENST00000490903.1_Missense_Mutation_p.M449K	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		ATTGAAGAGATGCGACACACG	0.299																																					p.M498K		Atlas-SNP	.											.	CKAP2	51	.	0			c.T1493A						PASS	.						97.0	100.0	99.0					13																	53042426		2203	4300	6503	SO:0001583	missense	26586	exon7			AAGAGATGCGACA	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1493T>A	chr13.hg19:g.53042426T>A	ENSP00000367276:p.Met498Lys	57.0	0.0	.		44.0	4.0	.	NM_001098525		Missense_Mutation	SNP	ENST00000378037.5	hg19	CCDS41893.1	.	.	.	.	.	.	.	.	.	.	.	16.76	3.211433	0.58343	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.26373	1.74;1.74;1.74	5.53	5.53	0.82687	.	0.149392	0.47093	D	0.000251	T	0.32941	0.0846	M	0.74881	2.28	0.43959	D	0.99663	P;P;P	0.42409	0.61;0.61;0.779	B;B;B	0.41036	0.346;0.346;0.346	T	0.23904	-1.0175	10	0.87932	D	0	-5.2435	12.0802	0.53667	0.0:0.0:0.0:1.0	.	449;498;497	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	K	497;498;449	ENSP00000258607:M497K;ENSP00000367276:M498K;ENSP00000417830:M449K	ENSP00000258607:M497K	M	+	2	0	CKAP2	51940427	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.810000	0.55613	2.100000	0.63781	0.533000	0.62120	ATG	.	.	.	none		0.299	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355010.2		
CLEC14A	161198	hgsc.bcm.edu	37	14	38723829	38723829	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr14:38723829C>T	ENST00000342213.2	-	1	1745	c.1399G>A	c.(1399-1401)Ggg>Agg	p.G467R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	467						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		TCACAGTCCCCGACTTTCACC	0.597																																					p.G467R		Atlas-SNP	.											.	CLEC14A	83	.	0			c.G1399A						PASS	.						75.0	77.0	76.0					14																	38723829		2203	4300	6503	SO:0001583	missense	161198	exon1			AGTCCCCGACTTT		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.1399G>A	chr14.hg19:g.38723829C>T	ENSP00000353013:p.Gly467Arg	167.0	0.0	.		160.0	22.0	.	NM_175060	Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	ENST00000342213.2	hg19	CCDS9667.1	.	.	.	.	.	.	.	.	.	.	C	8.642	0.896202	0.17686	.	.	ENSG00000176435	ENST00000342213	T	0.73681	-0.77	4.19	-6.15	0.02105	.	0.640736	0.12966	N	0.424617	T	0.50343	0.1610	L	0.27053	0.805	0.09310	N	1	B	0.20459	0.045	B	0.09377	0.004	T	0.33624	-0.9861	10	0.87932	D	0	-0.4303	2.5087	0.04652	0.1371:0.2062:0.1279:0.5287	.	467	Q86T13	CLC14_HUMAN	R	467	ENSP00000353013:G467R	ENSP00000353013:G467R	G	-	1	0	CLEC14A	37793580	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	0.081000	0.14823	-1.071000	0.03145	-0.253000	0.11424	GGG	.	.	.	none		0.597	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
NPAP1	23742	hgsc.bcm.edu	37	15	24923231	24923231	+	Silent	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr15:24923231T>A	ENST00000329468.2	+	1	2691	c.2217T>A	c.(2215-2217)acT>acA	p.T739T		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	739					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCGGCAACACTGCCTCAGTCC	0.557																																					p.T739T		Atlas-SNP	.											.	.	.	.	0			c.T2217A						PASS	.						108.0	110.0	109.0					15																	24923231		2203	4300	6503	SO:0001819	synonymous_variant	23742	exon1			CAACACTGCCTCA	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2217T>A	chr15.hg19:g.24923231T>A		239.0	0.0	.		231.0	22.0	.	NM_018958		Silent	SNP	ENST00000329468.2	hg19	CCDS10015.1																																																																																			.	.	.	none		0.557	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
HERC2	8924	hgsc.bcm.edu	37	15	28510872	28510872	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr15:28510872T>A	ENST00000261609.7	-	14	1870	c.1762A>T	c.(1762-1764)Agt>Tgt	p.S588C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCGTCCTCACTGGAGCCTTCA	0.577																																					p.S588C		Atlas-SNP	.											.	HERC2	501	.	0			c.A1762T						PASS	.						123.0	92.0	102.0					15																	28510872		2203	4300	6503	SO:0001583	missense	8924	exon14			CCTCACTGGAGCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1762A>T	chr15.hg19:g.28510872T>A	ENSP00000261609:p.Ser588Cys	73.0	0.0	.		84.0	10.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	31	5.104071	0.94245	.	.	ENSG00000128731	ENST00000261609	D	0.85411	-1.98	5.83	5.83	0.93111	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.90202	0.6937	L	0.48986	1.54	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.90297	0.4327	10	0.52906	T	0.07	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	588	O95714	HERC2_HUMAN	C	588	ENSP00000261609:S588C	ENSP00000261609:S588C	S	-	1	0	HERC2	26184467	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.629000	0.83207	2.367000	0.80283	0.529000	0.55759	AGT	.	.	.	none		0.577	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TMEM62	80021	hgsc.bcm.edu	37	15	43426530	43426530	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr15:43426530A>G	ENST00000260403.2	+	2	535	c.256A>G	c.(256-258)Att>Gtt	p.I86V		NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	86						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		TTCTGAAACTATTGACATCAT	0.507																																					p.I86V		Atlas-SNP	.											.	TMEM62	47	.	0			c.A256G						PASS	.						110.0	93.0	99.0					15																	43426530		2203	4299	6502	SO:0001583	missense	80021	exon2			GAAACTATTGACA	BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.256A>G	chr15.hg19:g.43426530A>G	ENSP00000260403:p.Ile86Val	84.0	0.0	.		83.0	10.0	.	NM_024956	Q6I9Y5|Q9H5J6	Missense_Mutation	SNP	ENST00000260403.2	hg19	CCDS32210.1	.	.	.	.	.	.	.	.	.	.	A	7.057	0.565544	0.13560	.	.	ENSG00000137842	ENST00000260403	T	0.22945	1.93	4.97	2.62	0.31277	.	0.161216	0.53938	D	0.000050	T	0.09379	0.0231	N	0.05259	-0.085	0.43708	D	0.996176	B	0.12630	0.006	B	0.15484	0.013	T	0.18209	-1.0344	10	0.05833	T	0.94	-8.7407	8.1815	0.31313	0.8138:0.0:0.1862:0.0	.	86	Q0P6H9	TMM62_HUMAN	V	86	ENSP00000260403:I86V	ENSP00000260403:I86V	I	+	1	0	TMEM62	41213822	0.969000	0.33509	1.000000	0.80357	0.998000	0.95712	1.160000	0.31761	0.912000	0.36772	0.533000	0.62120	ATT	.	.	.	none		0.507	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432227.1	NM_024956	
FES	2242	hgsc.bcm.edu	37	15	91438758	91438758	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr15:91438758G>T	ENST00000328850.3	+	19	2581	c.2439G>T	c.(2437-2439)gaG>gaT	p.E813D	FES_ENST00000444422.2_Missense_Mutation_p.E743D|FES_ENST00000450438.2_Missense_Mutation_p.E685D|FES_ENST00000414248.2_Missense_Mutation_p.E685D|FES_ENST00000394300.3_Missense_Mutation_p.E755D|FES_ENST00000394302.1_Missense_Mutation_p.E672D	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	813	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TCTACCAGGAGCTGCAGAGCA	0.642																																					p.E813D		Atlas-SNP	.											.	FES	102	.	0			c.G2439T						PASS	.						60.0	60.0	60.0					15																	91438758		2198	4298	6496	SO:0001583	missense	2242	exon19			CCAGGAGCTGCAG	X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.2439G>T	chr15.hg19:g.91438758G>T	ENSP00000331504:p.Glu813Asp	121.0	0.0	.		108.0	8.0	.	NM_002005	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	ENST00000328850.3	hg19	CCDS10365.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789274	0.31685	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08	4.18	3.25	0.37280	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.164239	0.53938	D	0.000058	T	0.37999	0.1024	N	0.25031	0.7	0.44780	D	0.997783	B;B;B;B;B;B	0.13594	0.001;0.008;0.001;0.001;0.008;0.001	B;B;B;B;B;B	0.14023	0.004;0.01;0.003;0.002;0.01;0.004	T	0.16394	-1.0404	10	0.19147	T	0.46	-35.8073	9.2926	0.37795	0.0886:0.1513:0.7602:0.0	.	795;685;672;755;743;813	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	D	813;685;672;743;755;685	ENSP00000331504:E813D;ENSP00000414629:E685D;ENSP00000377839:E672D;ENSP00000400868:E743D;ENSP00000377837:E755D;ENSP00000409915:E685D	ENSP00000331504:E813D	E	+	3	2	FES	89239762	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.776000	0.26704	2.339000	0.79563	0.555000	0.69702	GAG	.	.	.	none		0.642	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005	
DECR2	26063	hgsc.bcm.edu	37	16	457438	457438	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr16:457438T>G	ENST00000219481.5	+	4	353	c.215T>G	c.(214-216)cTg>cGg	p.L72R	DECR2_ENST00000397710.1_Missense_Mutation_p.L123R|DECR2_ENST00000461947.1_Intron|DECR2_ENST00000424398.2_Missense_Mutation_p.L60R	NM_020664.3	NP_065715.1	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2, peroxisomal	72					unsaturated fatty acid biosynthetic process (GO:0006636)	peroxisomal membrane (GO:0005778)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)	9		Hepatocellular(16;0.00015)				GCCAGGAAGCTGGCTGGGGCC	0.652																																					p.L72R		Atlas-SNP	.											.	DECR2	47	.	0			c.T215G						PASS	.						26.0	31.0	29.0					16																	457438		2201	4299	6500	SO:0001583	missense	26063	exon4			GGAAGCTGGCTGG	AJ293009	CCDS10409.1	16p13.3	2011-09-14			ENSG00000242612	ENSG00000242612	1.3.1.34	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2754	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 17C, member 1"""	615839				11514237, 19027726	Standard	NM_020664		Approved	PDCR, SDR17C1	uc002chb.3	Q9NUI1	OTTHUMG00000047846	ENST00000219481.5:c.215T>G	chr16.hg19:g.457438T>G	ENSP00000219481:p.Leu72Arg	70.0	0.0	.		109.0	9.0	.	NM_020664	Q6ZRS7|Q96ET0	Missense_Mutation	SNP	ENST00000219481.5	hg19	CCDS10409.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.096100	0.56075	.	.	ENSG00000242612	ENST00000219481;ENST00000397710;ENST00000424398	T;T	0.54071	0.59;0.59	4.89	4.89	0.63831	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	M	0.88181	2.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80446	-0.1379	10	0.87932	D	0	.	12.2476	0.54578	0.0:0.0:0.0:1.0	.	72	Q9NUI1	DECR2_HUMAN	R	72;123;60	ENSP00000219481:L72R;ENSP00000400374:L60R	ENSP00000219481:L72R	L	+	2	0	DECR2	397439	1.000000	0.71417	0.987000	0.45799	0.506000	0.33950	7.499000	0.81566	1.831000	0.53308	0.459000	0.35465	CTG	.	.	.	none		0.652	DECR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109069.4	NM_020664	
TSC2	7249	hgsc.bcm.edu	37	16	2126139	2126139	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr16:2126139T>C	ENST00000219476.3	+	24	3340	c.2710T>C	c.(2710-2712)Ttc>Ctc	p.F904L	TSC2_ENST00000401874.2_Missense_Mutation_p.F904L|TSC2_ENST00000350773.4_Missense_Mutation_p.F904L|TSC2_ENST00000568454.1_Missense_Mutation_p.F915L|TSC2_ENST00000382538.6_Missense_Mutation_p.F855L|TSC2_ENST00000439673.2_Missense_Mutation_p.F867L|TSC2_ENST00000353929.4_Missense_Mutation_p.F904L	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	904					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CCGCCTGCCCTTCCGGAAGGA	0.567			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.F904L		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.T2710C						PASS	.						117.0	94.0	102.0					16																	2126139		2198	4300	6498	SO:0001583	missense	7249	exon24	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CTGCCCTTCCGGA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2710T>C	chr16.hg19:g.2126139T>C	ENSP00000219476:p.Phe904Leu	64.0	0.0	.		104.0	13.0	.	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.281054	0.59758	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	5.09	5.09	0.68999	Tuberin-type domain (1);	0.056979	0.64402	D	0.000001	T	0.81221	0.4777	N	0.14661	0.345	0.51012	D	0.999905	B;B;B;B;B;D	0.59357	0.101;0.313;0.176;0.021;0.082;0.985	B;B;B;B;B;D	0.72338	0.147;0.174;0.091;0.132;0.103;0.977	T	0.77351	-0.2620	10	0.02654	T	1	-38.9999	9.422	0.38557	0.0:0.0795:0.0:0.9205	.	855;867;904;904;904;904	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	L	904;904;904;867;855;904	ENSP00000219476:F904L;ENSP00000384468:F904L;ENSP00000248099:F904L;ENSP00000399232:F867L;ENSP00000371978:F855L;ENSP00000344383:F904L	ENSP00000219476:F904L	F	+	1	0	TSC2	2066140	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.116000	0.64661	1.919000	0.55581	0.459000	0.35465	TTC	.	.	.	none		0.567	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
PRPF8	10594	hgsc.bcm.edu	37	17	1564455	1564455	+	Splice_Site	SNP	A	A	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:1564455A>T	ENST00000572621.1	-	27	4605	c.4340T>A	c.(4339-4341)gTt>gAt	p.V1447D	PRPF8_ENST00000304992.6_Splice_Site_p.V1447D			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1447	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTGCTTCAAAACCTAGATGGC	0.547																																					p.V1447D		Atlas-SNP	.											.	PRPF8	169	.	0			c.T4340A						PASS	.						82.0	73.0	76.0					17																	1564455		2203	4300	6503	SO:0001630	splice_region_variant	10594	exon28			TTCAAAACCTAGA	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4339-1T>A	chr17.hg19:g.1564455A>T		66.0	0.0	.		79.0	9.0	.	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	a	12.99	2.102694	0.37145	.	.	ENSG00000174231	ENST00000304992	T	0.80994	-1.44	6.17	6.17	0.99709	Pre-mRNA-processing-splicing factor 8, U6-snRNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.80999	0.4732	L	0.47716	1.5	0.80722	D	1	P	0.42620	0.785	P	0.45794	0.493	T	0.82474	-0.0439	10	0.66056	D	0.02	-2.8406	16.8222	0.85835	1.0:0.0:0.0:0.0	.	1447	Q6P2Q9	PRP8_HUMAN	D	1447	ENSP00000304350:V1447D	ENSP00000304350:V1447D	V	-	2	0	PRPF8	1511205	1.000000	0.71417	1.000000	0.80357	0.193000	0.23685	9.307000	0.96226	2.371000	0.80710	0.533000	0.62120	GTT	.	.	.	none		0.547	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		Missense_Mutation
NEURL4	84461	hgsc.bcm.edu	37	17	7220554	7220554	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:7220554G>A	ENST00000399464.2	-	28	4469	c.4454C>T	c.(4453-4455)gCt>gTt	p.A1485V	NEURL4_ENST00000315614.7_Missense_Mutation_p.A1483V|GPS2_ENST00000389167.5_5'Flank|NEURL4_ENST00000570460.1_Missense_Mutation_p.A1461V|GPS2_ENST00000391950.3_5'Flank|NEURL4_ENST00000574120.1_5'Flank|RP11-542C16.2_ENST00000575474.1_Silent_p.L299L|GPS2_ENST00000380728.2_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	1485						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTCCGCCCCAGCATATTGAAG	0.647																																					p.A1485V		Atlas-SNP	.											.	NEURL4	192	.	0			c.C4454T						PASS	.						27.0	29.0	28.0					17																	7220554		1909	4108	6017	SO:0001583	missense	84461	exon28			GCCCCAGCATATT		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.4454C>T	chr17.hg19:g.7220554G>A	ENSP00000382390:p.Ala1485Val	54.0	0.0	.		50.0	5.0	.	NM_032442	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	hg19	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522700	0.85600	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.38722	1.12;1.12	5.02	5.02	0.67125	.	0.068616	0.64402	D	0.000017	T	0.49575	0.1565	M	0.71581	2.175	0.40718	D	0.982632	P;P	0.44139	0.827;0.734	B;B	0.43386	0.418;0.239	T	0.59747	-0.7396	10	0.72032	D	0.01	-10.282	17.1077	0.86668	0.0:0.0:1.0:0.0	.	1483;1485	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	V	1483;1485	ENSP00000319826:A1483V;ENSP00000382390:A1485V	ENSP00000319826:A1483V	A	-	2	0	NEURL4	7161278	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.975000	0.70475	2.325000	0.78763	0.462000	0.41574	GCT	.	.	.	none		0.647	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
SCRN2	90507	hgsc.bcm.edu	37	17	45915217	45915217	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:45915217T>C	ENST00000290216.9	-	8	1396	c.1271A>G	c.(1270-1272)tAt>tGt	p.Y424C	SCRN2_ENST00000407215.3_3'UTR|SCRN2_ENST00000584123.1_Missense_Mutation_p.Y432C	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	424						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						AGCTTACGCATAAGCCTGGCT	0.657																																					p.Y424C		Atlas-SNP	.											.	SCRN2	35	.	0			c.A1271G						PASS	.						24.0	26.0	25.0					17																	45915217		2203	4300	6503	SO:0001583	missense	90507	exon8			TACGCATAAGCCT	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1271A>G	chr17.hg19:g.45915217T>C	ENSP00000290216:p.Tyr424Cys	47.0	0.0	.		45.0	8.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	hg19	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.631333	0.28978	.	.	ENSG00000141295	ENST00000290216	T	0.09817	2.94	5.72	5.72	0.89469	.	0.114320	0.64402	D	0.000008	T	0.37237	0.0996	M	0.83953	2.67	0.53688	D	0.999977	D	0.89917	1.0	D	0.85130	0.997	T	0.26538	-1.0100	10	0.87932	D	0	-1.5376	14.9863	0.71351	0.0:0.0:0.0:1.0	.	424	Q96FV2	SCRN2_HUMAN	C	424	ENSP00000290216:Y424C	ENSP00000290216:Y424C	Y	-	2	0	SCRN2	43270216	1.000000	0.71417	0.037000	0.18230	0.025000	0.11179	5.686000	0.68211	2.184000	0.69523	0.533000	0.62120	TAT	.	.	.	none		0.657	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
TEX2	55852	hgsc.bcm.edu	37	17	62290509	62290509	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:62290509C>T	ENST00000583097.1	-	2	1241	c.1069G>A	c.(1069-1071)Ggc>Agc	p.G357S	TEX2_ENST00000258991.3_Missense_Mutation_p.G357S|TEX2_ENST00000584379.1_Missense_Mutation_p.G357S			Q8IWB9	TEX2_HUMAN	testis expressed 2	357					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CTTCCGTAGCCATCCCCCTCA	0.498																																					p.G357S		Atlas-SNP	.											.	TEX2	89	.	0			c.G1069A						PASS	.						85.0	76.0	79.0					17																	62290509		2203	4300	6503	SO:0001583	missense	55852	exon2			CGTAGCCATCCCC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.1069G>A	chr17.hg19:g.62290509C>T	ENSP00000462665:p.Gly357Ser	93.0	0.0	.		115.0	12.0	.	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	C	5.664	0.307054	0.10733	.	.	ENSG00000136478	ENST00000258991	T	0.42513	0.97	6.03	3.96	0.45880	.	0.773939	0.13084	N	0.415036	T	0.20820	0.0501	N	0.08118	0	0.09310	N	1	B;B	0.20261	0.043;0.025	B;B	0.20577	0.03;0.013	T	0.27191	-1.0081	10	0.11485	T	0.65	-0.2203	8.1607	0.31196	0.5291:0.374:0.0969:0.0	.	357;357	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	S	357	ENSP00000258991:G357S	ENSP00000258991:G357S	G	-	1	0	TEX2	59644241	0.137000	0.22531	0.007000	0.13788	0.465000	0.32709	1.751000	0.38339	0.809000	0.34255	0.655000	0.94253	GGC	.	.	.	none		0.498	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
MYO1F	4542	hgsc.bcm.edu	37	19	8604865	8604865	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr19:8604865T>G	ENST00000338257.8	-	16	1925	c.1658A>C	c.(1657-1659)aAg>aCg	p.K553T		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	553	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						GGGGCGCCCCTTCTTGTCTCC	0.632																																					p.K553T		Atlas-SNP	.											.	MYO1F	128	.	0			c.A1658C						PASS	.						40.0	43.0	42.0					19																	8604865		1904	4113	6017	SO:0001583	missense	4542	exon16			CGCCCCTTCTTGT	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.1658A>C	chr19.hg19:g.8604865T>G	ENSP00000344871:p.Lys553Thr	80.0	0.0	.		87.0	6.0	.	NM_012335	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	hg19	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577175	0.86645	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.88201	-2.35	5.01	5.01	0.66863	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93249	0.7849	M	0.73217	2.22	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.93407	0.6765	10	0.52906	T	0.07	.	13.55	0.61726	0.0:0.0:0.0:1.0	.	553	O00160	MYO1F_HUMAN	T	598;553	ENSP00000344871:K553T	ENSP00000304899:K598T	K	-	2	0	MYO1F	8510865	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	5.902000	0.69869	1.891000	0.54761	0.482000	0.46254	AAG	.	.	.	none		0.632	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
GPRASP1	9737	hgsc.bcm.edu	37	X	101910683	101910683	+	Silent	SNP	G	G	C			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chrX:101910683G>C	ENST00000361600.5	+	5	2643	c.1842G>C	c.(1840-1842)ggG>ggC	p.G614G	GPRASP1_ENST00000444152.1_Silent_p.G614G|GPRASP1_ENST00000415986.1_Silent_p.G614G|GPRASP1_ENST00000537097.1_Silent_p.G614G|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	614	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						CCATTATTGGGTCCTGGTTTT	0.512																																					p.G614G		Atlas-SNP	.											.	GPRASP1	140	.	0			c.G1842C						PASS	.						104.0	103.0	103.0					X																	101910683		2203	4300	6503	SO:0001819	synonymous_variant	9737	exon3			TATTGGGTCCTGG	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1842G>C	chrX.hg19:g.101910683G>C		145.0	0.0	.		160.0	24.0	.	NM_001099411	O43168|Q96LA1	Silent	SNP	ENST00000361600.5	hg19	CCDS35352.1																																																																																			.	.	.	none		0.512	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
F8	2157	hgsc.bcm.edu	37	X	154157883	154157883	+	Silent	SNP	C	C	T			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chrX:154157883C>T	ENST00000360256.4	-	14	4382	c.4182G>A	c.(4180-4182)acG>acA	p.T1394T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1394	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TATGACTCCTCGTAAGGCAAT	0.428																																					p.T1394T		Atlas-SNP	.											.	F8	646	.	0			c.G4182A						PASS	.						166.0	149.0	154.0					X																	154157883		2203	4300	6503	SO:0001819	synonymous_variant	2157	exon14			ACTCCTCGTAAGG	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4182G>A	chrX.hg19:g.154157883C>T		175.0	0.0	.		137.0	25.0	.	NM_000132	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	hg19	CCDS35457.1																																																																																			.	.	.	none		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
MYH10	4628	hgsc.bcm.edu	37	17	8452026	8452026	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:8452026delT	ENST00000269243.4	-	9	1107	c.969delA	c.(967-969)aaafs	p.K323fs	MYH10_ENST00000379980.4_Frame_Shift_Del_p.K339fs|MYH10_ENST00000360416.3_Frame_Shift_Del_p.K333fs|RN7SL129P_ENST00000479993.2_RNA|MYH10_ENST00000396239.1_Frame_Shift_Del_p.K323fs	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	323	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GGAAATTATCTTTGTCTTGCT	0.383																																					p.D334fs		Atlas-INDEL	.											.	MYH10	148	.	0			c.1000delG						PASS	.						163.0	160.0	161.0					17																	8452026		2203	4300	6503	SO:0001589	frameshift_variant	4628	exon10			.	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.969delA	chr17.hg19:g.8452026delT	ENSP00000269243:p.Lys323fs	197.0	0.0	0		208.0	19.0	0.0913462	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Frame_Shift_Del	DEL	ENST00000269243.4	hg19	CCDS11144.1																																																																																			.	.	.	none		0.383	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
LYAR	55646	hgsc.bcm.edu	37	4	4276371	4276375	+	Frame_Shift_Del	DEL	CTTCA	CTTCA	-			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	CTTCA	CTTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr4:4276371_4276375delCTTCA	ENST00000343470.4	-	7	791_795	c.551_555delTGAAG	c.(550-555)gtgaagfs	p.VK184fs	LYAR_ENST00000452476.1_Frame_Shift_Del_p.VK184fs	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	184	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ttttATTCTTCTTCACCTCCCCTTG	0.449																																					p.184_186del		Atlas-INDEL	.											.	LYAR	36	.	0			c.552_556del						PASS	.																																			SO:0001589	frameshift_variant	55646	exon7			.	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.551_555delTGAAG	chr4.hg19:g.4276371_4276375delCTTCA	ENSP00000345917:p.Val184fs	206.0	0.0	0		175.0	14.0	0.08	NM_001145725	D3DVS4|Q6FI78|Q9NYS1	Frame_Shift_Del	DEL	ENST00000343470.4	hg19	CCDS3374.1																																																																																			.	.	.	none		0.449	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
SNX30	401548	hgsc.bcm.edu	37	9	115567070	115567071	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr9:115567070_115567071insA	ENST00000374232.3	+	2	335_336	c.171_172insA	c.(172-174)aacfs	p.N58fs		NM_001012994.1	NP_001013012.1	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	58					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8						TCATTTTGCCCAACGGTGGTAC	0.401																																					p.P57fs		Atlas-INDEL	.											.	SNX30	32	.	0			c.171_172insA						PASS	.																																			SO:0001589	frameshift_variant	401548	exon2			.	AK126644	CCDS43865.1	9q33.1	2014-02-12			ENSG00000148158	ENSG00000148158		"""Sorting nexins"""	23685	protein-coding gene	gene with protein product							Standard	NM_001012994		Approved	ATG24A	uc004bgj.4	Q5VWJ9	OTTHUMG00000020512	ENST00000374232.3:c.173dupA	chr9.hg19:g.115567072_115567072dupA	ENSP00000363349:p.Asn58fs	252.0	0.0	0		265.0	27.0	0.101887	NM_001012994		Frame_Shift_Ins	INS	ENST00000374232.3	hg19	CCDS43865.1																																																																																			.	.	.	none		0.401	SNX30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053700.1		
PRPSAP1	5635	hgsc.bcm.edu	37	17	74307703	74307703	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5889-01A-11D-1589-08	TCGA-BQ-5889-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	46b1253a-f381-46d3-ad7d-e0ed2bda9eff	fc277028-a6e0-4459-8608-40506e4c36cb	g.chr17:74307703delT	ENST00000446526.3	-	10	1523	c.1078delA	c.(1078-1080)attfs	p.I360fs	PRPSAP1_ENST00000324684.4_Frame_Shift_Del_p.I257fs|PRPSAP1_ENST00000588364.1_5'UTR	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	331					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						TCAGAAAGAATCAAACTGATA	0.468																																					p.I360fs		Atlas-INDEL	.											.	PRPSAP1	32	.	0			c.1079delT						PASS	.						154.0	120.0	131.0					17																	74307703		2203	4300	6503	SO:0001589	frameshift_variant	5635	exon10			.	D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.1078delA	chr17.hg19:g.74307703delT	ENSP00000414624:p.Ile360fs	55.0	0.0	0		98.0	10.0	0.102041	NM_002766	B2R6M4|Q96H06	Frame_Shift_Del	DEL	ENST00000446526.3	hg19	CCDS11743.2																																																																																			.	.	.	none		0.468	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342480.2	NM_002766	
