#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATP13A2	23400	hgsc.bcm.edu	37	1	17322884	17322884	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:17322884G>T	ENST00000326735.8	-	13	1336	c.1303C>A	c.(1303-1305)Ctg>Atg	p.L435M	ATP13A2_ENST00000452699.1_Missense_Mutation_p.L430M|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000502860.1_Intron|ATP13A2_ENST00000341676.5_Missense_Mutation_p.L430M			Q9NQ11	AT132_HUMAN	ATPase type 13A2	435					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CACTCACCCAGGACAGAGAGG	0.612																																					p.L435M		Atlas-SNP	.											.	ATP13A2	85	.	0			c.C1303A						PASS	.						69.0	78.0	75.0					1																	17322884		2203	4300	6503	SO:0001583	missense	23400	exon13			CACCCAGGACAGA	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1303C>A	chr1.hg19:g.17322884G>T	ENSP00000327214:p.Leu435Met	97.0	0.0	.		90.0	35.0	.	NM_022089	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	hg19	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879903	0.51801	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000506174	D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98	4.69	2.76	0.32466	ATPase, P-type, ATPase-associated domain (1);	0.545880	0.17421	N	0.174829	D	0.93462	0.7914	M	0.71871	2.18	0.40886	D	0.984039	P;P;D;P	0.53745	0.489;0.898;0.962;0.656	B;P;P;P	0.62491	0.314;0.672;0.903;0.579	D	0.90678	0.4603	10	0.59425	D	0.04	.	4.3183	0.11003	0.2691:0.1732:0.5577:0.0	.	148;430;430;435	Q6ZP48;Q5JXY1;Q6S9Z9;Q9NQ11	.;.;.;AT132_HUMAN	M	435;430;430;149	ENSP00000327214:L435M;ENSP00000341115:L430M;ENSP00000413307:L430M;ENSP00000424393:L149M	ENSP00000327214:L435M	L	-	1	2	ATP13A2	17195471	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	1.657000	0.37366	0.383000	0.24910	-0.258000	0.10820	CTG	.	.	.	none		0.612	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
CACNA1S	779	hgsc.bcm.edu	37	1	201030589	201030589	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:201030589A>G	ENST00000362061.3	-	25	3287	c.3061T>C	c.(3061-3063)Tac>Cac	p.Y1021H	CACNA1S_ENST00000367338.3_Missense_Mutation_p.Y1021H	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1021	Dihydropyridine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATGGCCTTGTACAGCAGCCTG	0.557																																					p.Y1021H		Atlas-SNP	.											.	CACNA1S	249	.	0			c.T3061C						PASS	.						99.0	91.0	94.0					1																	201030589		2203	4300	6503	SO:0001583	missense	779	exon25			CCTTGTACAGCAG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3061T>C	chr1.hg19:g.201030589A>G	ENSP00000355192:p.Tyr1021His	54.0	0.0	.		83.0	17.0	.	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.507446	0.85282	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.97529	-4.42;-4.42	5.21	5.21	0.72293	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98639	0.9544	M	0.89968	3.075	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	D	0.99751	1.1018	10	0.72032	D	0.01	.	15.3483	0.74359	1.0:0.0:0.0:0.0	.	1021	Q13698	CAC1S_HUMAN	H	1021	ENSP00000355192:Y1021H;ENSP00000356307:Y1021H	ENSP00000355192:Y1021H	Y	-	1	0	CACNA1S	199297212	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	8.889000	0.92470	2.087000	0.62958	0.459000	0.35465	TAC	.	.	.	none		0.557	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
NAV1	89796	hgsc.bcm.edu	37	1	201781618	201781618	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:201781618G>T	ENST00000367296.4	+	27	5470	c.5050G>T	c.(5050-5052)Gag>Tag	p.E1684*	NAV1_ENST00000367300.3_Nonsense_Mutation_p.E1624*|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Nonsense_Mutation_p.E1637*|NAV1_ENST00000295624.6_Nonsense_Mutation_p.E1681*|NAV1_ENST00000367297.4_Nonsense_Mutation_p.E1676*|NAV1_ENST00000367295.1_Nonsense_Mutation_p.E1290*	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1684					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CAACAACGTGGAGCCAGCCAA	0.562																																					p.E1684X		Atlas-SNP	.											.	NAV1	143	.	0			c.G5050T						PASS	.						131.0	108.0	116.0					1																	201781618		2203	4300	6503	SO:0001587	stop_gained	89796	exon27			AACGTGGAGCCAG	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.5050G>T	chr1.hg19:g.201781618G>T	ENSP00000356265:p.Glu1684*	107.0	0.0	.		182.0	84.0	.	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Nonsense_Mutation	SNP	ENST00000367296.4	hg19	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	48	14.566335	0.99801	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295;ENST00000367301	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-33.9888	20.2191	0.98319	0.0:0.0:1.0:0.0	.	.	.	.	X	1637;1684;1681;1676;1624;1290;93	.	ENSP00000295624:E1681X	E	+	1	0	NAV1	200048241	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.753000	0.98904	2.866000	0.98385	0.650000	0.86243	GAG	.	.	.	none		0.562	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204236626	204236626	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:204236626T>A	ENST00000272203.3	-	5	573	c.257A>T	c.(256-258)gAt>gTt	p.D86V	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.D86V	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	86	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GAGGCAGCGATCCACCAGGAC	0.592																																					p.D86V		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.A257T						PASS	.						114.0	85.0	95.0					1																	204236626		2203	4300	6503	SO:0001583	missense	22874	exon5			CAGCGATCCACCA	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.257A>T	chr1.hg19:g.204236626T>A	ENSP00000272203:p.Asp86Val	73.0	0.0	.		125.0	40.0	.	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	hg19	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554500	0.86231	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.15017	2.46;2.46	5.51	5.51	0.81932	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.86573	2.825	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.56962	-0.7892	10	0.87932	D	0	-24.5699	15.2951	0.73898	0.0:0.0:0.0:1.0	.	86	Q9Y2H5	PKHA6_HUMAN	V	86	ENSP00000272203:D86V;ENSP00000402046:D86V	ENSP00000272203:D86V	D	-	2	0	PLEKHA6	202503249	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.511000	0.73733	2.086000	0.62901	0.448000	0.29417	GAT	.	.	.	none		0.592	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
KIAA1804	84451	hgsc.bcm.edu	37	1	233518317	233518317	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:233518317A>G	ENST00000366624.3	+	10	3232	c.2971A>G	c.(2971-2973)Aga>Gga	p.R991G	MLK4_ENST00000366622.1_Missense_Mutation_p.R437G	NM_032435.2	NP_115811.2																					TGCCAAGGAGAGAACTAAATC	0.557																																					p.R991G		Atlas-SNP	.											.	KIAA1804	129	.	0			c.A2971G						PASS	.						118.0	102.0	108.0					1																	233518317		2203	4300	6503	SO:0001583	missense	0	exon10			AAGGAGAGAACTA																												ENST00000366624.3:c.2971A>G	chr1.hg19:g.233518317A>G	ENSP00000355583:p.Arg991Gly	94.0	0.0	.		149.0	39.0	.	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	hg19	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760485	0.49468	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.74947	-0.89;3.17	4.55	4.55	0.56014	.	0.160789	0.30428	U	0.009649	T	0.61236	0.2331	N	0.22421	0.69	0.33546	D	0.59548	P;B	0.40619	0.724;0.029	B;B	0.38500	0.275;0.023	T	0.73569	-0.3941	10	0.48119	T	0.1	.	12.6166	0.56580	1.0:0.0:0.0:0.0	.	438;991	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	G	991;437	ENSP00000355583:R991G;ENSP00000355581:R437G	ENSP00000355581:R437G	R	+	1	2	RP5-862P8.2	231584940	0.995000	0.38212	0.055000	0.19348	0.009000	0.06853	2.656000	0.46716	1.908000	0.55244	0.460000	0.39030	AGA	.	.	.	none		0.557	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
TBCE	6905	hgsc.bcm.edu	37	1	235599915	235599915	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr1:235599915A>C	ENST00000366601.3	+	11	1131	c.955A>C	c.(955-957)Ata>Cta	p.I319L	TBCE_ENST00000543662.1_Missense_Mutation_p.I370L|TBCE_ENST00000406207.1_Missense_Mutation_p.I319L|TBCE_ENST00000472011.1_3'UTR			Q15813	TBCE_HUMAN	tubulin folding cofactor E	319					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			CGACAATCAGATATCACAAGT	0.428																																					p.I319L		Atlas-SNP	.											.	TBCE	40	.	0			c.A955C						PASS	.						127.0	121.0	123.0					1																	235599915		2203	4300	6503	SO:0001583	missense	6905	exon11			AATCAGATATCAC	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.955A>C	chr1.hg19:g.235599915A>C	ENSP00000355560:p.Ile319Leu	126.0	0.0	.		158.0	34.0	.	NM_003193	A8K8C2|B7Z3P1	Missense_Mutation	SNP	ENST00000366601.3	hg19	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163199	0.78226	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	T;T;T	0.25414	1.8;1.8;1.8	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	L	0.52823	1.66	0.58432	D	0.999993	D;B;P	0.60575	0.988;0.391;0.538	P;B;P	0.52309	0.695;0.194;0.545	T	0.04723	-1.0931	10	0.15952	T	0.53	-23.5139	12.9072	0.58160	1.0:0.0:0.0:0.0	.	370;319;319	B7Z3P1;A8K8C2;Q15813	.;.;TBCE_HUMAN	L	319;319;370	ENSP00000355560:I319L;ENSP00000384571:I319L;ENSP00000439170:I370L	ENSP00000355560:I319L	I	+	1	0	TBCE	233666538	1.000000	0.71417	0.946000	0.38457	0.879000	0.50718	5.808000	0.69165	2.053000	0.61076	0.533000	0.62120	ATA	.	.	.	none		0.428	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193	
TFCP2L1	29842	hgsc.bcm.edu	37	2	121991738	121991738	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr2:121991738C>T	ENST00000263707.5	-	12	1224	c.1127G>A	c.(1126-1128)tGt>tAt	p.C376Y		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	376					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CAGCTCCTGACAGACATAAAT	0.532																																					p.C376Y		Atlas-SNP	.											.	TFCP2L1	54	.	0			c.G1127A						PASS	.						103.0	91.0	95.0					2																	121991738		2203	4300	6503	SO:0001583	missense	29842	exon12			TCCTGACAGACAT	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1127G>A	chr2.hg19:g.121991738C>T	ENSP00000263707:p.Cys376Tyr	90.0	0.0	.		87.0	32.0	.	NM_014553	Q4ZG43	Missense_Mutation	SNP	ENST00000263707.5	hg19	CCDS2134.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941307	0.73557	.	.	ENSG00000115112	ENST00000263707	T	0.26067	1.76	5.7	4.83	0.62350	.	0.152997	0.64402	D	0.000010	T	0.49677	0.1571	M	0.81942	2.565	0.80722	D	1	D	0.61080	0.989	P	0.60886	0.88	T	0.55730	-0.8095	10	0.56958	D	0.05	.	14.5903	0.68359	0.0:0.93:0.0:0.07	.	376	Q9NZI6	TF2L1_HUMAN	Y	376	ENSP00000263707:C376Y	ENSP00000263707:C376Y	C	-	2	0	TFCP2L1	121708208	1.000000	0.71417	0.994000	0.49952	0.818000	0.46254	6.831000	0.75324	1.426000	0.47256	0.549000	0.68633	TGT	.	.	.	none		0.532	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
CNPPD1	27013	hgsc.bcm.edu	37	2	220039577	220039577	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr2:220039577T>G	ENST00000409789.1	-	6	860	c.433A>C	c.(433-435)Aac>Cac	p.N145H	CNPPD1_ENST00000360507.5_Missense_Mutation_p.N145H			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	145					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CATTCGTCGTTGAAGACCTCC	0.577																																					p.N145H		Atlas-SNP	.											.	CNPPD1	22	.	0			c.A433C						PASS	.						86.0	80.0	82.0					2																	220039577		2203	4300	6503	SO:0001583	missense	27013	exon5			CGTCGTTGAAGAC	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.433A>C	chr2.hg19:g.220039577T>G	ENSP00000386277:p.Asn145His	77.0	0.0	.		91.0	31.0	.	NM_015680	B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	ENST00000409789.1	hg19	CCDS2433.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.250866	0.80135	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038;ENST00000451647	T;T;T	0.58940	0.3;0.3;0.3	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.81192	0.4771	M	0.93638	3.44	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.86432	0.1761	10	0.87932	D	0	-21.9189	13.8616	0.63564	0.0:0.0:0.0:1.0	.	145	Q9BV87	CNPD1_HUMAN	H	145;145;145;172	ENSP00000353698:N145H;ENSP00000386277:N145H;ENSP00000410109:N145H	ENSP00000353698:N145H	N	-	1	0	CNPPD1	219747821	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.766000	0.85320	1.873000	0.54277	0.459000	0.35465	AAC	.	.	.	none		0.577	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680	
AGXT	189	hgsc.bcm.edu	37	2	241808770	241808770	+	Missense_Mutation	SNP	G	G	A	rs180177208		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr2:241808770G>A	ENST00000307503.3	+	2	736	c.349G>A	c.(349-351)Gag>Aag	p.E117K		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	117					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	GGACATCGGGGAGCGCATAGG	0.657																																					p.E117K		Atlas-SNP	.											.	AGXT	50	.	0			c.G349A						PASS	.						51.0	52.0	52.0					2																	241808770		2203	4300	6503	SO:0001583	missense	189	exon2			ATCGGGGAGCGCA	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.349G>A	chr2.hg19:g.241808770G>A	ENSP00000302620:p.Glu117Lys	82.0	0.0	.		87.0	32.0	.	NM_000030	Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	hg19	CCDS2543.1	.	.	.	.	.	.	.	.	.	.	G	6.004	0.369211	0.11352	.	.	ENSG00000172482	ENST00000307503	D	0.85702	-2.02	4.12	4.12	0.48240	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.160335	0.53938	D	0.000048	T	0.80681	0.4669	L	0.60067	1.865	0.49915	D	0.999836	B;B	0.14012	0.004;0.009	B;B	0.17979	0.012;0.02	T	0.75516	-0.3290	10	0.27785	T	0.31	-32.4358	10.2905	0.43592	0.151:0.0:0.849:0.0	.	117;117	B7Z548;P21549	.;SPYA_HUMAN	K	117	ENSP00000302620:E117K	ENSP00000302620:E117K	E	+	1	0	AGXT	241457443	1.000000	0.71417	0.826000	0.32828	0.290000	0.27261	4.798000	0.62510	2.007000	0.58848	0.591000	0.81541	GAG	.	.	.	alt		0.657	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030	
PASK	23178	hgsc.bcm.edu	37	2	242065794	242065794	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr2:242065794G>A	ENST00000405260.1	-	10	3234	c.2536C>T	c.(2536-2538)Cac>Tac	p.H846Y	PASK_ENST00000539818.1_Missense_Mutation_p.H630Y|PASK_ENST00000358649.4_Missense_Mutation_p.H846Y|PASK_ENST00000403638.3_Missense_Mutation_p.H846Y|PASK_ENST00000234040.4_Missense_Mutation_p.H846Y|PASK_ENST00000544142.1_Missense_Mutation_p.H660Y	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	846					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAAGGAACGTGTCCTGGGCTT	0.572																																					p.H846Y		Atlas-SNP	.											.	PASK	230	.	0			c.C2536T						PASS	.						159.0	149.0	152.0					2																	242065794		2203	4300	6503	SO:0001583	missense	23178	exon10			GAACGTGTCCTGG	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2536C>T	chr2.hg19:g.242065794G>A	ENSP00000384016:p.His846Tyr	132.0	0.0	.		165.0	59.0	.	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	hg19	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.619945	0.00828	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.66280	-0.2;-0.19;-0.2;-0.15;-0.19;0.81	3.24	-6.48	0.01896	.	1.203440	0.06016	N	0.650378	T	0.35856	0.0946	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.32365	0.367;0.011;0.032;0.031;0.09	B;B;B;B;B	0.28385	0.089;0.036;0.009;0.024;0.023	T	0.20773	-1.0265	10	0.31617	T	0.26	.	6.1419	0.20265	0.3709:0.0:0.4891:0.14	.	811;660;846;846;846	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	Y	846;660;846;846;630;846	ENSP00000234040:H846Y;ENSP00000441374:H660Y;ENSP00000384016:H846Y;ENSP00000351475:H846Y;ENSP00000443083:H630Y;ENSP00000384438:H846Y	ENSP00000234040:H846Y	H	-	1	0	PASK	241714467	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.416000	0.02467	-1.226000	0.02574	-1.169000	0.01745	CAC	.	.	.	none		0.572	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
ZNF502	91392	hgsc.bcm.edu	37	3	44763320	44763320	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr3:44763320C>G	ENST00000296091.4	+	4	1267	c.1011C>G	c.(1009-1011)aaC>aaG	p.N337K	ZNF502_ENST00000436624.2_Missense_Mutation_p.N337K|ZNF502_ENST00000449836.1_Missense_Mutation_p.N337K	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		CAAAGGCAAACCTCTCTCAGC	0.403																																					p.N337K		Atlas-SNP	.											.	ZNF502	58	.	0			c.C1011G						PASS	.						57.0	61.0	60.0					3																	44763320		2203	4300	6503	SO:0001583	missense	91392	exon4			GGCAAACCTCTCT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.1011C>G	chr3.hg19:g.44763320C>G	ENSP00000296091:p.Asn337Lys	124.0	0.0	.		117.0	79.0	.	NM_001134440		Missense_Mutation	SNP	ENST00000296091.4	hg19	CCDS2719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.31|11.31	1.599882|1.599882	0.28534|0.28534	.|.	.|.	ENSG00000196653|ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624|ENST00000427783	T;T;T|.	0.07021|.	3.23;3.23;3.23|.	4.27|4.27	-1.17|-1.17	0.09648|0.09648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.14700|0.14700	0.0355|0.0355	N|N	0.20986|0.20986	0.625|0.625	0.09310|0.09310	N|N	1|1	P|.	0.35982|.	0.531|.	B|.	0.24155|.	0.051|.	T|T	0.29119|0.29119	-1.0022|-1.0022	9|6	0.10377|0.02654	T|T	0.69|1	.|.	1.6891|1.6891	0.02848|0.02848	0.1337:0.367:0.1313:0.368|0.1337:0.367:0.1313:0.368	.|.	337|.	Q8TBZ5|.	ZN502_HUMAN|.	K|S	337|337	ENSP00000397390:N337K;ENSP00000296091:N337K;ENSP00000406469:N337K|.	ENSP00000296091:N337K|ENSP00000397812:T337S	N|T	+|+	3|2	2|0	ZNF502|ZNF502	44738324|44738324	0.000000|0.000000	0.05858|0.05858	0.859000|0.859000	0.33776|0.33776	0.997000|0.997000	0.91878|0.91878	-1.664000|-1.664000	0.01966|0.01966	-0.114000|-0.114000	0.11936|0.11936	0.655000|0.655000	0.94253|0.94253	AAC|ACC	.	.	.	none		0.403	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
NBEAL2	23218	hgsc.bcm.edu	37	3	47032943	47032943	+	Silent	SNP	G	G	T	rs181297174		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr3:47032943G>T	ENST00000450053.3	+	8	869	c.690G>T	c.(688-690)ctG>ctT	p.L230L	NBEAL2_ENST00000292309.5_Silent_p.L230L|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	230					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		AGGGCCTGCTGAGTGTGGTGC	0.637																																					p.L230L		Atlas-SNP	.											.	NBEAL2	267	.	0			c.G690T						PASS	.						31.0	33.0	32.0					3																	47032943		2012	4187	6199	SO:0001819	synonymous_variant	23218	exon8			CCTGCTGAGTGTG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.690G>T	chr3.hg19:g.47032943G>T		20.0	0.0	.		29.0	22.0	.	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1																																																																																			.	G|1.000;C|0.000	.	alt		0.637	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
SETD2	29072	hgsc.bcm.edu	37	3	47143047	47143047	+	Splice_Site	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr3:47143047T>C	ENST00000409792.3	-	8	4960		c.e8-2			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.?(2)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CACAGTCCACTGAGATGATGT	0.408			"""N, F, S, Mis"""		clear cell renal carcinoma																																.		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	SETD2_ENST00000409792,NS,carcinoma,0,2	SETD2	721	.	2	Unknown(2)	kidney(2)	c.4918-2A>G						PASS	.						109.0	108.0	108.0					3																	47143047		2203	4300	6503	SO:0001630	splice_region_variant	29072	exon9			GTCCACTGAGATG	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4918-2A>G	chr3.hg19:g.47143047T>C		115.0	0.0	.		139.0	102.0	.	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	27.7	4.856990	0.91433	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2291	0.82321	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47118051	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.955000	0.87856	2.238000	0.73509	0.528000	0.53228	.	.	.	.	none		0.408	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Intron
NPHP3	27031	hgsc.bcm.edu	37	3	132410108	132410108	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr3:132410108T>C	ENST00000337331.5	-	18	2584	c.2498A>G	c.(2497-2499)gAg>gGg	p.E833G	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	833					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TTCCAGGTACTCCAATCTCAC	0.388																																					p.E833G		Atlas-SNP	.											.	NPHP3	110	.	0			c.A2498G						PASS	.						163.0	169.0	167.0					3																	132410108		2203	4300	6503	SO:0001583	missense	27031	exon18			AGGTACTCCAATC	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2498A>G	chr3.hg19:g.132410108T>C	ENSP00000338766:p.Glu833Gly	251.0	0.0	.		308.0	175.0	.	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	hg19	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.525698	0.27299	.	.	ENSG00000113971	ENST00000393144;ENST00000337331	D	0.91577	-2.87	4.55	3.35	0.38373	.	0.108809	0.64402	D	0.000011	D	0.87977	0.6314	M	0.61703	1.905	0.80722	D	1	B	0.24258	0.1	B	0.24541	0.054	D	0.83643	0.0151	10	0.49607	T	0.09	-10.5568	10.9157	0.47135	0.0:0.0:0.1571:0.8429	.	833	Q7Z494	NPHP3_HUMAN	G	113;833	ENSP00000338766:E833G	ENSP00000338766:E833G	E	-	2	0	NPHP3	133892798	1.000000	0.71417	0.291000	0.24904	0.151000	0.21798	5.118000	0.64673	0.661000	0.30985	0.460000	0.39030	GAG	.	.	.	none		0.388	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
STX18	53407	hgsc.bcm.edu	37	4	4436571	4436571	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:4436571C>T	ENST00000306200.2	-	7	691	c.628G>A	c.(628-630)Gaa>Aaa	p.E210K	STX18_ENST00000505286.1_Missense_Mutation_p.E210K	NM_016930.2	NP_058626.1	Q9P2W9	STX18_HUMAN	syntaxin 18	210					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		GGTTGTGTTTCAGCCAAAATT	0.353																																					p.E210K		Atlas-SNP	.											.	STX18	16	.	0			c.G628A						PASS	.						80.0	81.0	81.0					4																	4436571		2203	4300	6503	SO:0001583	missense	53407	exon7			GTGTTTCAGCCAA	AB028741	CCDS3377.1	4p16.3-p16.2	2013-09-23			ENSG00000168818	ENSG00000168818			15942	protein-coding gene	gene with protein product		606046				10788491	Standard	NM_016930		Approved	Ufe1	uc003gic.3	Q9P2W9	OTTHUMG00000090331	ENST00000306200.2:c.628G>A	chr4.hg19:g.4436571C>T	ENSP00000305810:p.Glu210Lys	88.0	0.0	.		71.0	18.0	.	NM_016930	Q596L3|Q5TZP5	Missense_Mutation	SNP	ENST00000306200.2	hg19	CCDS3377.1	.	.	.	.	.	.	.	.	.	.	C	9.694	1.152643	0.21371	.	.	ENSG00000168818	ENST00000505286;ENST00000306200;ENST00000512195;ENST00000507908	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.19	2.55	0.30701	.	0.372946	0.28388	N	0.015531	T	0.35828	0.0945	L	0.55103	1.725	0.09310	N	0.999999	B	0.06786	0.001	B	0.09377	0.004	T	0.30563	-0.9974	10	0.09338	T	0.73	-1.7145	8.2654	0.31810	0.0:0.7549:0.0:0.2451	.	210	Q9P2W9	STX18_HUMAN	K	210;210;129;129	ENSP00000426648:E210K;ENSP00000305810:E210K;ENSP00000425483:E129K;ENSP00000422376:E129K	ENSP00000305810:E210K	E	-	1	0	STX18	4487472	0.834000	0.29399	0.008000	0.14137	0.804000	0.45430	2.929000	0.48916	0.225000	0.20959	0.655000	0.94253	GAA	.	.	.	none		0.353	STX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206696.1		
YTHDC1	91746	hgsc.bcm.edu	37	4	69185877	69185877	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:69185877T>C	ENST00000344157.4	-	12	1983	c.1648A>G	c.(1648-1650)Agg>Ggg	p.R550G	YTHDC1_ENST00000579690.1_Missense_Mutation_p.R550G|YTHDC1_ENST00000355665.3_Missense_Mutation_p.R532G	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	550	Arg-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TAGTCAATCCTTGGTTTCTTT	0.323																																					p.R550G		Atlas-SNP	.											.	YTHDC1	81	.	0			c.A1648G						PASS	.						66.0	68.0	67.0					4																	69185877		2203	4300	6503	SO:0001583	missense	91746	exon12			CAATCCTTGGTTT	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1648A>G	chr4.hg19:g.69185877T>C	ENSP00000339245:p.Arg550Gly	113.0	0.0	.		81.0	25.0	.	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	hg19	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	T	16.05	3.013953	0.54468	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.27557	1.68;1.66	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.44519	0.1297	L	0.27053	0.805	0.58432	D	0.999999	D;D	0.67145	0.989;0.996	D;P	0.75020	0.985;0.867	T	0.41805	-0.9488	10	0.72032	D	0.01	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	532;550	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	G	550;532	ENSP00000339245:R550G;ENSP00000347888:R532G	ENSP00000339245:R550G	R	-	1	2	YTHDC1	68868472	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.886000	0.69743	2.371000	0.80710	0.533000	0.62120	AGG	.	.	.	none		0.323	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	
ELOVL6	79071	hgsc.bcm.edu	37	4	111119479	111119479	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:111119479C>A	ENST00000394607.3	-	2	176	c.13G>T	c.(13-15)Gtg>Ttg	p.V5L	ELOVL6_ENST00000302274.3_Missense_Mutation_p.V5L|ELOVL6_ENST00000506461.1_5'UTR			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	5					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		AAAGTCAACACTGACATGTTC	0.418																																					p.V5L		Atlas-SNP	.											.	ELOVL6	27	.	0			c.G13T						PASS	.						210.0	182.0	191.0					4																	111119479		2203	4300	6503	SO:0001583	missense	79071	exon2			TCAACACTGACAT	AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.13G>T	chr4.hg19:g.111119479C>A	ENSP00000378105:p.Val5Leu	204.0	0.0	.		147.0	45.0	.	NM_001130721	Q4W5L0|Q8NCD1	Missense_Mutation	SNP	ENST00000394607.3	hg19	CCDS3690.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761175	0.69763	.	.	ENSG00000170522	ENST00000394607;ENST00000302274;ENST00000506625;ENST00000503885	T;T	0.21932	1.98;1.98	5.68	5.68	0.88126	.	0.204024	0.41712	D	0.000835	T	0.16981	0.0408	N	0.22421	0.69	0.48511	D	0.999667	B	0.02656	0.0	B	0.04013	0.001	T	0.06110	-1.0845	10	0.23302	T	0.38	-10.017	18.5758	0.91154	0.0:1.0:0.0:0.0	.	5	Q9H5J4	ELOV6_HUMAN	L	5	ENSP00000378105:V5L;ENSP00000304736:V5L	ENSP00000304736:V5L	V	-	1	0	ELOVL6	111338928	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.795000	0.75140	2.683000	0.91414	0.655000	0.94253	GTG	.	.	.	none		0.418	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255748.1	NM_024090	
INPP4B	8821	hgsc.bcm.edu	37	4	143181690	143181690	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:143181690G>T	ENST00000513000.1	-	12	1076	c.643C>A	c.(643-645)Ccg>Acg	p.P215T	INPP4B_ENST00000508116.1_Missense_Mutation_p.P215T|INPP4B_ENST00000262992.4_Missense_Mutation_p.P215T|INPP4B_ENST00000308502.4_Missense_Mutation_p.P215T|INPP4B_ENST00000509777.1_Missense_Mutation_p.P215T	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	215					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.P215S(2)		breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ACACTTTCCGGGGCTGTACAT	0.279																																					p.P215T		Atlas-SNP	.											INPP4B,NS,carcinoma,0,1	INPP4B	132	.	2	Substitution - Missense(2)	lung(2)	c.C643A						PASS	.						53.0	53.0	53.0					4																	143181690		2203	4300	6503	SO:0001583	missense	8821	exon12			TTTCCGGGGCTGT	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.643C>A	chr4.hg19:g.143181690G>T	ENSP00000425487:p.Pro215Thr	47.0	0.0	.		52.0	16.0	.	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.349424	0.41599	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.52	3.78	0.43462	.	0.221687	0.37219	N	0.002193	T	0.18551	0.0445	N	0.14661	0.345	0.32366	N	0.556496	P;P	0.45531	0.86;0.767	P;B	0.47075	0.536;0.359	T	0.12604	-1.0541	10	0.09843	T	0.71	.	6.5521	0.22440	0.1539:0.0:0.6999:0.1463	.	86;215	B7Z6T2;O15327	.;INP4B_HUMAN	T	215;215;215;86;215;215;30;30;215;86	ENSP00000425487:P215T;ENSP00000262992:P215T;ENSP00000308441:P215T;ENSP00000423954:P215T;ENSP00000422793:P215T;ENSP00000426207:P30T;ENSP00000427250:P215T;ENSP00000421065:P86T	ENSP00000262992:P215T	P	-	1	0	INPP4B	143401140	0.996000	0.38824	0.954000	0.39281	0.988000	0.76386	1.385000	0.34408	0.674000	0.31244	0.655000	0.94253	CCG	.	.	.	none		0.279	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
TIGD4	201798	hgsc.bcm.edu	37	4	153691640	153691640	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:153691640C>T	ENST00000304337.2	-	2	1337	c.517G>A	c.(517-519)Gat>Aat	p.D173N		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	173						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					GGATGATAATCATTTAAATAA	0.353																																					p.D173N		Atlas-SNP	.											.	TIGD4	53	.	0			c.G517A						PASS	.						35.0	38.0	37.0					4																	153691640		2172	4288	6460	SO:0001583	missense	201798	exon2			GATAATCATTTAA	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.517G>A	chr4.hg19:g.153691640C>T	ENSP00000355162:p.Asp173Asn	87.0	0.0	.		56.0	18.0	.	NM_145720	Q96LP5	Missense_Mutation	SNP	ENST00000304337.2	hg19	CCDS34079.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341226	0.41498	.	.	ENSG00000169989	ENST00000304337	T	0.14893	2.47	5.7	5.7	0.88788	.	0.000000	0.46145	D	0.000301	T	0.16854	0.0405	L	0.35723	1.085	0.38647	D	0.951745	B	0.26744	0.158	B	0.26864	0.074	T	0.09100	-1.0690	10	0.17369	T	0.5	-28.5772	19.8349	0.96652	0.0:1.0:0.0:0.0	.	173	Q8IY51	TIGD4_HUMAN	N	173	ENSP00000355162:D173N	ENSP00000355162:D173N	D	-	1	0	TIGD4	153911090	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.463000	0.66712	2.861000	0.98227	0.655000	0.94253	GAT	.	.	.	none		0.353	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720	
SORBS2	8470	hgsc.bcm.edu	37	4	186545113	186545114	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr4:186545113_186545114GT>AG	ENST00000284776.7	-	13	1966_1967	c.1457_1458AC>CT	c.(1456-1458)cAC>cCT	p.H486P	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.H390P|SORBS2_ENST00000355634.5_Missense_Mutation_p.H586P|SORBS2_ENST00000431808.1_Missense_Mutation_p.H486P|SORBS2_ENST00000319471.9_Intron|SORBS2_ENST00000449407.2_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	486					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GCAGGTCCTTGTGCTGCTGCTC	0.579																																					p.H586H|p.H586P	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											.	SORBS2	300	.	0			c.C1758T|c.A1757C						PASS	.																																			SO:0001583	missense	8470	exon16			GTCCTTGTGCTGC|TCCTTGTGCTGCT		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1457_1458delinsAG	chr4.hg19:g.186545113_186545114delinsAG	ENSP00000284776:p.His486Pro	106.0|108.0	0.0	.		117.0|114.0	49.0	.	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent|Missense_Mutation	SNP	ENST00000284776.7	hg19	CCDS3845.1																																																																																			.	.	.	none		0.579	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
MROH2B	133558	hgsc.bcm.edu	37	5	41048530	41048530	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr5:41048530C>T	ENST00000399564.4	-	16	2030	c.1580G>A	c.(1579-1581)gGg>gAg	p.G527E	MROH2B_ENST00000506092.2_Missense_Mutation_p.G82E	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	527																	TGCACCAGCCCCACGTAACTC	0.448																																					p.G527E		Atlas-SNP	.											.	.	.	.	0			c.G1580A						PASS	.						92.0	85.0	87.0					5																	41048530		1879	4102	5981	SO:0001583	missense	133558	exon16			CCAGCCCCACGTA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1580G>A	chr5.hg19:g.41048530C>T	ENSP00000382476:p.Gly527Glu	63.0	0.0	.		58.0	31.0	.	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	hg19	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522411	0.44866	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.07908	3.15;3.15	4.87	4.87	0.63330	Armadillo-type fold (1);	0.218754	0.32593	N	0.005895	T	0.28167	0.0695	M	0.74647	2.275	0.30027	N	0.813842	D	0.89917	1.0	D	0.97110	1.0	T	0.03202	-1.1061	10	0.66056	D	0.02	.	13.7123	0.62675	0.0:1.0:0.0:0.0	.	527	Q7Z745	HTRB2_HUMAN	E	82;231;527	ENSP00000441504:G82E;ENSP00000382476:G527E	ENSP00000296803:G231E	G	-	2	0	HEATR7B2	41084287	0.914000	0.31030	0.274000	0.24659	0.058000	0.15608	3.303000	0.51858	2.683000	0.91414	0.655000	0.94253	GGG	.	.	.	none		0.448	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
KLHL3	26249	hgsc.bcm.edu	37	5	136975648	136975648	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr5:136975648C>T	ENST00000309755.4	-	9	1365	c.922G>A	c.(922-924)Ggc>Agc	p.G308S	KLHL3_ENST00000541417.1_Intron|KLHL3_ENST00000506491.1_Missense_Mutation_p.G226S|KLHL3_ENST00000508657.1_Missense_Mutation_p.G276S|KLHL3_ENST00000506873.1_5'UTR	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	308					distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GGTGCCTGGCCGCCAACCACA	0.542																																					p.G308S		Atlas-SNP	.											.	KLHL3	54	.	0			c.G922A						PASS	.						94.0	88.0	90.0					5																	136975648		2203	4300	6503	SO:0001583	missense	26249	exon9			CCTGGCCGCCAAC	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.922G>A	chr5.hg19:g.136975648C>T	ENSP00000312397:p.Gly308Ser	78.0	0.0	.		90.0	20.0	.	NM_017415	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Missense_Mutation	SNP	ENST00000309755.4	hg19	CCDS4192.1	.	.	.	.	.	.	.	.	.	.	C	35	5.522061	0.96416	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755;ENST00000505853	D;D;D;D	0.99494	-6.01;-6.01;-6.01;-6.01	4.54	4.54	0.55810	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.99701	0.9886	H	0.96048	3.76	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.989;0.999	D	0.97261	0.9904	10	0.87932	D	0	.	17.8383	0.88707	0.0:1.0:0.0:0.0	.	77;268;276;308	B7Z6E2;D6RH21;Q9UH77-2;Q9UH77	.;.;.;KLHL3_HUMAN	S	226;276;308;268	ENSP00000424828:G226S;ENSP00000422099:G276S;ENSP00000312397:G308S;ENSP00000426173:G268S	ENSP00000312397:G308S	G	-	1	0	KLHL3	137003547	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	7.416000	0.80143	2.535000	0.85469	0.655000	0.94253	GGC	.	.	.	none		0.542	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		
FAM13B	51306	hgsc.bcm.edu	37	5	137289855	137289855	+	Splice_Site	SNP	C	C	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr5:137289855C>G	ENST00000033079.3	-	14	2103	c.1652G>C	c.(1651-1653)aGa>aCa	p.R551T	FAM13B_ENST00000425075.2_Splice_Site_p.R455T|FAM13B_ENST00000420893.2_Splice_Site_p.R551T	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	551					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AATCATATACCTAGTAAAAGA	0.388																																					p.R551T		Atlas-SNP	.											.	FAM13B	46	.	0			c.G1652C						PASS	.						67.0	65.0	66.0					5																	137289855		2203	4300	6503	SO:0001630	splice_region_variant	51306	exon14			ATATACCTAGTAA	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1652+1G>C	chr5.hg19:g.137289855C>G		64.0	0.0	.		77.0	17.0	.	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	hg19	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148430	0.78001	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.27104	2.85;1.69;2.85	5.49	5.49	0.81192	.	0.083341	0.64402	D	0.000002	T	0.51550	0.1681	M	0.73217	2.22	0.54753	D	0.999983	D;D;D	0.89917	1.0;0.981;1.0	D;D;D	0.74023	0.982;0.962;0.959	T	0.46978	-0.9152	9	.	.	.	-6.7113	18.3606	0.90372	0.0:1.0:0.0:0.0	.	455;551;551	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	T	551;455;551	ENSP00000033079:R551T;ENSP00000394669:R455T;ENSP00000388521:R551T	.	R	-	2	0	FAM13B	137317754	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	6.298000	0.72763	2.576000	0.86940	0.585000	0.79938	AGA	.	.	.	none		0.388	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		Missense_Mutation
GABRA1	2554	hgsc.bcm.edu	37	5	161281260	161281260	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr5:161281260G>A	ENST00000428797.2	+	4	526	c.171G>A	c.(169-171)ctG>ctA	p.L57L	GABRA1_ENST00000444819.1_Silent_p.L57L|GABRA1_ENST00000437025.2_Silent_p.L57L|GABRA1_ENST00000420560.1_Silent_p.L57L|GABRA1_ENST00000023897.6_Silent_p.L57L|GABRA1_ENST00000393943.4_Silent_p.L57L	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	57					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACAATCGCCTGAGACCAGGAT	0.383																																					p.L57L		Atlas-SNP	.											.	GABRA1	132	.	0			c.G171A						PASS	.						92.0	95.0	94.0					5																	161281260		2203	4299	6502	SO:0001819	synonymous_variant	2554	exon4			TCGCCTGAGACCA		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.171G>A	chr5.hg19:g.161281260G>A		73.0	0.0	.		112.0	23.0	.	NM_001127643	D3DQK6|Q8N629	Silent	SNP	ENST00000428797.2	hg19	CCDS4357.1																																																																																			.	.	.	none		0.383	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
TNXB	7148	hgsc.bcm.edu	37	6	32049190	32049190	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:32049190G>A	ENST00000375244.3	-	10	4198	c.3997C>T	c.(3997-3999)Cgt>Tgt	p.R1333C	RNA5SP206_ENST00000516703.1_RNA|TNXB_ENST00000375247.2_Missense_Mutation_p.R1333C			P22105	TENX_HUMAN	tenascin XB	1420	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGCCTGCCACGAAGCCCGTAG	0.647																																					p.R1333C		Atlas-SNP	.											TNXB_ENST00000375247,NS,carcinoma,0,2	TNXB	553	.	0			c.C3997T						PASS	.						23.0	30.0	28.0					6																	32049190		2123	4220	6343	SO:0001583	missense	7148	exon10			TGCCACGAAGCCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3997C>T	chr6.hg19:g.32049190G>A	ENSP00000364393:p.Arg1333Cys	5.0	0.0	.		8.0	5.0	.	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	hg19		.	.	.	.	.	.	.	.	.	.	G	17.37	3.372666	0.61624	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57595	0.39;0.39	5.23	5.23	0.72850	.	0.950594	0.08613	N	0.919605	T	0.53286	0.1787	M	0.69823	2.125	0.09310	N	1	D	0.53312	0.959	P	0.54924	0.764	T	0.46638	-0.9177	10	0.49607	T	0.09	.	10.2526	0.43377	0.0912:0.0:0.9088:0.0	.	1333	P22105-3	.	C	1333	ENSP00000364393:R1333C;ENSP00000364396:R1333C	ENSP00000364393:R1333C	R	-	1	0	TNXB	32157168	0.365000	0.25006	0.021000	0.16686	0.986000	0.74619	1.552000	0.36244	2.610000	0.88304	0.407000	0.27541	CGT	.	.	.	none		0.647	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
SCUBE3	222663	hgsc.bcm.edu	37	6	35213120	35213120	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:35213120G>A	ENST00000274938.7	+	19	2517	c.2517G>A	c.(2515-2517)aaG>aaA	p.K839K	SCUBE3_ENST00000394681.1_Silent_p.K855K	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CCCCACCCAAGCGCAAGATCC	0.562																																					p.K839K		Atlas-SNP	.											.	SCUBE3	99	.	0			c.G2517A						PASS	.						111.0	102.0	105.0					6																	35213120		2203	4300	6503	SO:0001819	synonymous_variant	222663	exon19			ACCCAAGCGCAAG	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2517G>A	chr6.hg19:g.35213120G>A		117.0	0.0	.		122.0	39.0	.	NM_152753		Silent	SNP	ENST00000274938.7	hg19	CCDS4800.1																																																																																			.	.	.	none		0.562	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
PEX6	5190	hgsc.bcm.edu	37	6	42932546	42932546	+	Missense_Mutation	SNP	C	C	T	rs61753232		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:42932546C>T	ENST00000304611.8	-	16	2857	c.2788G>A	c.(2788-2790)Gtt>Att	p.V930I	PEX6_ENST00000244546.4_3'UTR	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	930					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			AGGTCATGAACCCTGCGTTTG	0.587																																					p.V930I		Atlas-SNP	.											.	PEX6	44	.	0			c.G2788A						PASS	.						112.0	98.0	103.0					6																	42932546		2203	4300	6503	SO:0001583	missense	5190	exon16			CATGAACCCTGCG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2788G>A	chr6.hg19:g.42932546C>T	ENSP00000303511:p.Val930Ile	143.0	0.0	.		148.0	54.0	.	NM_000287	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	ENST00000304611.8	hg19	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765700	0.31228	.	.	ENSG00000124587	ENST00000304611	D	0.94723	-3.5	5.78	4.92	0.64577	.	0.159370	0.56097	D	0.000024	T	0.79616	0.4476	N	0.13272	0.32	0.80722	D	1	B	0.25667	0.131	B	0.29942	0.109	T	0.76016	-0.3113	10	0.02654	T	1	-14.3262	14.7217	0.69311	0.0:0.9297:0.0:0.0703	.	930	Q13608	PEX6_HUMAN	I	930	ENSP00000303511:V930I	ENSP00000303511:V930I	V	-	1	0	PEX6	43040524	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.850000	0.48294	1.453000	0.47775	-0.143000	0.13931	GTT	.	.	.	none		0.587	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
PKHD1	5314	hgsc.bcm.edu	37	6	51882414	51882414	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:51882414G>A	ENST00000371117.3	-	34	5669	c.5394C>T	c.(5392-5394)ttC>ttT	p.F1798F	PKHD1_ENST00000340994.4_Silent_p.F1798F	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1798					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGCCACACAGGAAGGCCAAGG	0.522																																					p.F1798F		Atlas-SNP	.											.	PKHD1	927	.	0			c.C5394T						PASS	.						101.0	89.0	93.0					6																	51882414		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon34			ACACAGGAAGGCC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5394C>T	chr6.hg19:g.51882414G>A		102.0	0.0	.		103.0	42.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.	.	none		0.522	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
ENPP1	5167	hgsc.bcm.edu	37	6	132206107	132206107	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:132206107A>C	ENST00000360971.2	+	23	2368	c.2348A>C	c.(2347-2349)aAg>aCg	p.K783T		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	783	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CTACTGCGAAAGTATGCTGAA	0.408																																					p.K783T	Colon(104;336 1535 5856 11019 33782)	Atlas-SNP	.											.	ENPP1	108	.	0			c.A2348C						PASS	.						228.0	208.0	215.0					6																	132206107		2203	4300	6503	SO:0001583	missense	5167	exon23			TGCGAAAGTATGC	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.2348A>C	chr6.hg19:g.132206107A>C	ENSP00000354238:p.Lys783Thr	84.0	0.0	.		96.0	34.0	.	NM_006208	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	ENST00000360971.2	hg19	CCDS5150.2	.	.	.	.	.	.	.	.	.	.	A	12.63	1.996697	0.35226	.	.	ENSG00000197594	ENST00000360971	T	0.69561	-0.41	5.91	-0.54	0.11861	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.445357	0.26013	N	0.026870	T	0.46405	0.1391	L	0.61036	1.89	0.22940	N	0.998539	B	0.24920	0.114	B	0.37833	0.259	T	0.54180	-0.8332	10	0.45353	T	0.12	-2.7243	8.0938	0.30816	0.6341:0.1292:0.2367:0.0	.	783	P22413	ENPP1_HUMAN	T	783	ENSP00000354238:K783T	ENSP00000354238:K783T	K	+	2	0	ENPP1	132247800	1.000000	0.71417	0.005000	0.12908	0.829000	0.46940	1.859000	0.39418	-0.182000	0.10602	-0.242000	0.12053	AAG	.	.	.	none		0.408	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042238.2		
TNFAIP3	7128	hgsc.bcm.edu	37	6	138200458	138200458	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr6:138200458C>A	ENST00000237289.4	+	7	1942	c.1876C>A	c.(1876-1878)Ctg>Atg	p.L626M		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	626	Interaction with TNIP1. {ECO:0000250}.|Required for proteosomal degradation of UBE2N and UBE2D3, TRAF6 deubiquitination, and TAX1BP1 interaction with UBE2N. {ECO:0000250}.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.L626fs*45(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CTTTTGCACACTGTGTTTCAT	0.512			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.L626M	GBM(130;153 1739 22295 28918 47987)	Atlas-SNP	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.,1	TNFAIP3	340	.	26	Whole gene deletion(25)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(26)	c.C1876A						PASS	.						71.0	77.0	75.0					6																	138200458		2203	4300	6503	SO:0001583	missense	7128	exon7			TGCACACTGTGTT	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1876C>A	chr6.hg19:g.138200458C>A	ENSP00000237289:p.Leu626Met	85.0	0.0	.		52.0	32.0	.	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	hg19	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552844	0.65425	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.43688	0.94	5.82	4.96	0.65561	Zinc finger, A20-type (3);	0.066315	0.64402	D	0.000008	T	0.49406	0.1555	M	0.67953	2.075	0.45837	D	0.9987	D	0.76494	0.999	D	0.75484	0.986	T	0.51934	-0.8642	10	0.41790	T	0.15	-20.5642	11.1227	0.48300	0.0:0.8531:0.0:0.1469	.	626	P21580	TNAP3_HUMAN	M	626	ENSP00000237289:L626M	ENSP00000237289:L626M	L	+	1	2	TNFAIP3	138242151	0.881000	0.30235	0.909000	0.35828	0.972000	0.66771	1.756000	0.38390	1.472000	0.48140	0.655000	0.94253	CTG	.	.	.	none		0.512	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
LRWD1	222229	hgsc.bcm.edu	37	7	102110042	102110043	+	Missense_Mutation	DNP	TC	TC	GA			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr7:102110042_102110043TC>GA	ENST00000292616.5	+	10	1402_1403	c.1250_1251TC>GA	c.(1249-1251)aTC>aGA	p.I417R	MIR4467_ENST00000578629.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	417					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						GACAAGCGGATCATCCTCTGGG	0.644																																					p.I417S|p.I417I		Atlas-SNP	.											.	LRWD1	41	.	0			c.T1250G|c.C1251A						PASS	.																																			SO:0001583	missense	222229	exon10			AGCGGATCATCCT|GCGGATCATCCTC	AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	Exception_encountered	chr7.hg19:g.102110042_102110043delinsGA	ENSP00000292616:p.Ile417Arg	143.0|144.0	0.0	.		127.0	26.0|27.0	.	NM_152892	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation|Silent	SNP	ENST00000292616.5	hg19	CCDS34715.1																																																																																			.	.	.	none		0.644	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349493.1	NM_152892	
CSMD1	64478	hgsc.bcm.edu	37	8	3216707	3216707	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr8:3216707G>A	ENST00000520002.1	-	22	3829	c.3274C>T	c.(3274-3276)Cgt>Tgt	p.R1092C	CSMD1_ENST00000602723.1_Missense_Mutation_p.R1092C|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1092C|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1091C|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1091C|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1092C|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1091C			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1092	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTCCACACACGGCGGCCCCCA	0.557																																					p.R1091C		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C3271T						PASS	.						70.0	74.0	73.0					8																	3216707		2203	4300	6503	SO:0001583	missense	64478	exon21			ACACACGGCGGCC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3274C>T	chr8.hg19:g.3216707G>A	ENSP00000430733:p.Arg1092Cys	117.0	0.0	.		120.0	33.0	.	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.9|20.9	4.074273|4.074273	0.76415|0.76415	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.64991	.|-0.13;-0.13;-0.13;-0.13;-0.13	5.34|5.34	5.34|5.34	0.76211|0.76211	.|Complement control module (2);Sushi/SCR/CCP (3);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.83096|0.83096	0.5180|0.5180	M|M	0.92268|0.92268	3.29|3.29	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.998	D|D	0.86677|0.86677	0.1914|0.1914	5|10	.|0.66056	.|D	.|0.02	.|.	13.9698|13.9698	0.64233|0.64233	0.0:0.0:0.8484:0.1516|0.0:0.0:0.8484:0.1516	.|.	.|1092;1092;1092	.|E5RIG2;Q96PZ7;Q96PZ7-4	.|.;CSMD1_HUMAN;.	L|C	571|1092;1092;954;1091;1091;1091	.|ENSP00000383047:R1092C;ENSP00000430733:R1092C;ENSP00000441462:R1091C;ENSP00000446243:R1091C;ENSP00000441675:R1091C	.|ENSP00000320445:R954C	P|R	-|-	2|1	0|0	CSMD1|CSMD1	3204114|3204114	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.283000|4.283000	0.58977|0.58977	2.489000|2.489000	0.83994|0.83994	0.550000|0.550000	0.68814|0.68814	CCG|CGT	.	.	.	none		0.557	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ADAM7	8756	hgsc.bcm.edu	37	8	24357759	24357760	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr8:24357759_24357760AC>CA	ENST00000175238.6	+	18	2075_2076	c.1992_1993AC>CA	c.(1990-1995)ttACat>ttCAat	p.664_665LH>FN	ADAM7_ENST00000380789.1_Missense_Mutation_p.664_665LH>FN|ADAM7_ENST00000520720.1_Missense_Mutation_p.436_437LH>FN|RP11-624C23.1_ENST00000523578.1_RNA|RP11-561E1.1_ENST00000519364.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	664	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		AAGAAACCTTACATGTTACCAG	0.411																																					p.L664F|p.H665N		Atlas-SNP	.											.	ADAM7	165	.	0			c.A1992C|c.C1993A						PASS	.																																			SO:0001583	missense	8756	exon18			AACCTTACATGTT|ACCTTACATGTTA	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	Exception_encountered	chr8.hg19:g.24357759_24357760delinsCA	ENSP00000175238:p.L664_H665delinsFN	43.0	0.0	.		66.0|68.0	26.0	.	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	hg19	CCDS6045.1																																																																																			.	.	.	none		0.411	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84608073	84608073	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr9:84608073T>G	ENST00000344803.2	+	4	2735	c.2688T>G	c.(2686-2688)agT>agG	p.S896R		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	896					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTTCCTTAGTTCCAACAAAC	0.428																																					p.S896R		Atlas-SNP	.											.	.	.	.	0			c.T2688G						PASS	.						74.0	65.0	68.0					9																	84608073		1843	4100	5943	SO:0001583	missense	389763	exon4			CCTTAGTTCCAAC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2688T>G	chr9.hg19:g.84608073T>G	ENSP00000341988:p.Ser896Arg	56.0	0.0	.		66.0	26.0	.	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	T	6.930	0.541227	0.13250	.	.	ENSG00000214929	ENST00000344803	T	0.44482	0.92	3.45	-0.949	0.10376	.	2.375910	0.01543	N	0.019319	T	0.28499	0.0705	L	0.34521	1.04	0.09310	N	1	B	0.29085	0.232	B	0.30251	0.113	T	0.03910	-1.0993	10	0.21540	T	0.41	1.1122	0.6148	0.00767	0.1883:0.1384:0.2367:0.4366	.	896	Q6ZQQ2	F75D1_HUMAN	R	896	ENSP00000341988:S896R	ENSP00000341988:S896R	S	+	3	2	FAM75D1	83797893	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.406000	0.07187	-0.259000	0.09432	-0.417000	0.06048	AGT	.	.	.	none		0.428	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
TXN	7295	hgsc.bcm.edu	37	9	113013695	113013695	+	Silent	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr9:113013695T>C	ENST00000374517.5	-	2	276	c.72A>G	c.(70-72)gtA>gtG	p.V24V	TXN_ENST00000374515.5_Silent_p.V24V	NM_003329.3	NP_003320.2	P10599	THIO_HUMAN	thioredoxin	24	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|glycerol ether metabolic process (GO:0006662)|innate immune response (GO:0045087)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|oxidation-reduction process (GO:0055114)|positive regulation of DNA binding (GO:0043388)|regulation of protein import into nucleus, translocation (GO:0033158)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	peptide disulfide oxidoreductase activity (GO:0015037)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		AGAAGTCAACTACTACAAGTT	0.363																																					p.V24V		Atlas-SNP	.											.	TXN	6	.	0			c.A72G						PASS	.						60.0	60.0	60.0					9																	113013695		2203	4300	6503	SO:0001819	synonymous_variant	7295	exon2			GTCAACTACTACA	X77584	CCDS35103.1, CCDS59139.1	9q31	2008-02-05			ENSG00000136810	ENSG00000136810			12435	protein-coding gene	gene with protein product		187700					Standard	NM_003329		Approved	TRX	uc004bep.2	P10599	OTTHUMG00000020480	ENST00000374517.5:c.72A>G	chr9.hg19:g.113013695T>C		41.0	0.0	.		46.0	12.0	.	NM_001244938	B1ALW1|O60744|Q53X69|Q96KI3|Q9UDG5	Silent	SNP	ENST00000374517.5	hg19	CCDS35103.1																																																																																			.	.	.	none		0.363	TXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053614.1		
MVB12B	89853	hgsc.bcm.edu	37	9	129143362	129143362	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr9:129143362G>C	ENST00000361171.3	+	3	305	c.224G>C	c.(223-225)gGt>gCt	p.G75A	MVB12B_ENST00000436593.3_Missense_Mutation_p.G60A|MVB12B_ENST00000545391.1_Missense_Mutation_p.G75A|MVB12B_ENST00000535766.1_Missense_Mutation_p.G68A	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B	75	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										ACAGCAGATGGTGTGGATGCT	0.478																																					p.G75A		Atlas-SNP	.											.	.	.	.	0			c.G224C						PASS	.						131.0	113.0	119.0					9																	129143362		2203	4300	6503	SO:0001583	missense	89853	exon3			CAGATGGTGTGGA	AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.224G>C	chr9.hg19:g.129143362G>C	ENSP00000354772:p.Gly75Ala	103.0	0.0	.		93.0	28.0	.	NM_001011703	Q8N6S7	Missense_Mutation	SNP	ENST00000361171.3	hg19	CCDS35142.1	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625105	0.66901	.	.	ENSG00000196814	ENST00000361171;ENST00000545391;ENST00000402437;ENST00000436593;ENST00000535766	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	5.15	5.15	0.70609	MABP domain (1);	0.101991	0.64402	D	0.000002	T	0.71937	0.3399	M	0.81497	2.545	0.58432	D	0.999999	D;P;P	0.89917	1.0;0.841;0.675	D;P;B	0.91635	0.999;0.46;0.337	T	0.76542	-0.2921	10	0.87932	D	0	-9.369	18.6946	0.91596	0.0:0.0:1.0:0.0	.	68;60;75	B7Z4X0;B7Z1P9;Q9H7P6	.;.;F125B_HUMAN	A	75;75;60;60;68	ENSP00000354772:G75A;ENSP00000441988:G75A;ENSP00000384751:G60A;ENSP00000401379:G60A;ENSP00000442846:G68A	ENSP00000354772:G75A	G	+	2	0	FAM125B	128183183	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.359000	0.97115	2.418000	0.82041	0.650000	0.86243	GGT	.	.	.	none		0.478	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054110.1	XM_088525	
CYP2C18	1562	hgsc.bcm.edu	37	10	96443672	96443672	+	Silent	SNP	C	C	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr10:96443672C>A	ENST00000285979.6	+	1	295	c.96C>A	c.(94-96)ggC>ggA	p.G32G	CYP2C18_ENST00000339022.5_Silent_p.G32G	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	32					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TCCCGTCTGGCCCCACTCCTC	0.483																																					p.G32G		Atlas-SNP	.											.	CYP2C18	79	.	0			c.C96A						PASS	.						99.0	87.0	91.0					10																	96443672		2203	4300	6503	SO:0001819	synonymous_variant	1562	exon1			GTCTGGCCCCACT	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.96C>A	chr10.hg19:g.96443672C>A		52.0	0.0	.		78.0	9.0	.	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Silent	SNP	ENST00000285979.6	hg19	CCDS7435.1																																																																																			.	.	.	none		0.483	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
DMBT1	1755	hgsc.bcm.edu	37	10	124351862	124351862	+	Silent	SNP	C	C	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr10:124351862C>A	ENST00000338354.3	+	20	2357	c.2251C>A	c.(2251-2253)Cga>Aga	p.R751R	DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000344338.3_Silent_p.R741R|DMBT1_ENST00000368909.3_Silent_p.R751R|DMBT1_ENST00000368955.3_Silent_p.R741R|DMBT1_ENST00000359586.6_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	751	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.R751R(3)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGTCCTATACCGAGGCTCCTG	0.582																																					p.R751R	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	3	Substitution - coding silent(3)	lung(3)	c.C2251A						PASS	.						322.0	237.0	265.0					10																	124351862		2025	4157	6182	SO:0001819	synonymous_variant	1755	exon20			CTATACCGAGGCT		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2251C>A	chr10.hg19:g.124351862C>A		397.0	1.0	.		437.0	141.0	.	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	hg19																																																																																				.	.	.	none		0.582	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
CD81	975	hgsc.bcm.edu	37	11	2417109	2417109	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr11:2417109G>T	ENST00000263645.5	+	6	726	c.470G>T	c.(469-471)tGt>tTt	p.C157F	CD81_ENST00000481687.1_Missense_Mutation_p.C163F|CD81_ENST00000381036.3_Missense_Mutation_p.C195F|CD81_ENST00000526072.1_Missense_Mutation_p.C86F|CD81_ENST00000524805.1_3'UTR|CD81_ENST00000492627.1_Missense_Mutation_p.C86F	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	157					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		CTTGACTGCTGTGGCTCCAGC	0.602																																					p.C157F		Atlas-SNP	.											.	CD81	11	.	0			c.G470T						PASS	.						94.0	73.0	80.0					11																	2417109		2202	4299	6501	SO:0001583	missense	975	exon6			ACTGCTGTGGCTC		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.470G>T	chr11.hg19:g.2417109G>T	ENSP00000263645:p.Cys157Phe	70.0	0.0	.		75.0	32.0	.	NM_004356	P18582|Q5U0J6	Missense_Mutation	SNP	ENST00000263645.5	hg19	CCDS7734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.61|11.61	1.691270|1.691270	0.30052|0.30052	.|.	.|.	ENSG00000110651|ENSG00000110651	ENST00000475945;ENST00000263645;ENST00000492627;ENST00000527343;ENST00000381036;ENST00000492252;ENST00000526072;ENST00000481687|ENST00000464784	D;D;D;D;D;D;D;D|.	0.99881|.	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47|.	3.56|3.56	3.56|3.56	0.40772|0.40772	Tetraspanin, EC2 domain (1);CD81 extracellular domain (1);|.	0.106944|.	0.64402|.	D|.	0.000003|.	D|D	0.85999|0.85999	0.5828|0.5828	H|H	0.96662|0.96662	3.86|3.86	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.89124|0.89124	0.3505|0.3505	10|5	0.87932|.	D|.	0|.	.|.	10.8427|10.8427	0.46726|0.46726	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	195;157|.	A6NMH8;P60033|.	.;CD81_HUMAN|.	F|L	86;157;86;146;195;150;86;163|142	ENSP00000433178:C86F;ENSP00000263645:C157F;ENSP00000437242:C86F;ENSP00000433767:C146F;ENSP00000370424:C195F;ENSP00000432249:C150F;ENSP00000431780:C86F;ENSP00000432033:C163F|.	ENSP00000263645:C157F|.	C|V	+|+	2|1	0|0	CD81|CD81	2373685|2373685	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.035000|0.035000	0.12851|0.12851	3.056000|3.056000	0.49923|0.49923	2.011000|2.011000	0.59026|0.59026	0.491000|0.491000	0.48974|0.48974	TGT|GTG	.	.	.	none		0.602	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	NM_004356	
NELL1	4745	hgsc.bcm.edu	37	11	21581738	21581738	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr11:21581738T>G	ENST00000357134.5	+	17	1942	c.1790T>G	c.(1789-1791)aTt>aGt	p.I597S	NELL1_ENST00000532434.1_Missense_Mutation_p.I550S|NELL1_ENST00000298925.5_Missense_Mutation_p.I625S|NELL1_ENST00000529218.1_Intron|NELL1_ENST00000325319.5_Missense_Mutation_p.I540S	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	597	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						ATTGCAGACATTGATGAATGT	0.478																																					p.I597S		Atlas-SNP	.											.	NELL1	179	.	0			c.T1790G						PASS	.						132.0	122.0	125.0					11																	21581738		2203	4300	6503	SO:0001583	missense	4745	exon17			CAGACATTGATGA	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1790T>G	chr11.hg19:g.21581738T>G	ENSP00000349654:p.Ile597Ser	181.0	0.0	.		144.0	60.0	.	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	hg19	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.603633	0.66445	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	5.9	5.9	0.94986	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.067178	0.64402	D	0.000016	D	0.96898	0.8987	M	0.88570	2.965	0.51767	D	0.999934	D;D;D;D	0.64830	0.993;0.994;0.986;0.994	P;D;P;D	0.63192	0.857;0.912;0.885;0.912	D	0.97543	1.0087	10	0.87932	D	0	-6.8617	16.3275	0.82990	0.0:0.0:0.0:1.0	.	540;625;550;597	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	S	625;597;540;550	ENSP00000298925:I625S;ENSP00000349654:I597S;ENSP00000317837:I540S;ENSP00000437170:I550S	ENSP00000298925:I625S	I	+	2	0	NELL1	21538314	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	8.040000	0.89188	2.266000	0.75297	0.528000	0.53228	ATT	.	.	.	none		0.478	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
SLC5A12	159963	hgsc.bcm.edu	37	11	26742996	26742996	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr11:26742996A>T	ENST00000396005.3	-	1	575	c.266T>A	c.(265-267)cTa>cAa	p.L89Q	SLC5A12_ENST00000280467.6_Missense_Mutation_p.L89Q	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	89					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GATGACAAATAGGTAAGCAAT	0.468																																					p.L89Q		Atlas-SNP	.											.	SLC5A12	134	.	0			c.T266A						PASS	.						94.0	95.0	95.0					11																	26742996		2203	4299	6502	SO:0001583	missense	159963	exon1			ACAAATAGGTAAG	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.266T>A	chr11.hg19:g.26742996A>T	ENSP00000379326:p.Leu89Gln	81.0	0.0	.		66.0	28.0	.	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	9.586	1.124947	0.20959	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.91686	-2.89;-2.89	5.83	1.3	0.21679	.	1.064190	0.07282	N	0.870876	D	0.91740	0.7388	L	0.58583	1.82	0.09310	N	1	B;P	0.37176	0.204;0.586	P;B	0.45856	0.495;0.436	T	0.81684	-0.0821	10	0.59425	D	0.04	.	6.9268	0.24419	0.1679:0.2534:0.5788:0.0	.	89;89	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	Q	89	ENSP00000379326:L89Q;ENSP00000280467:L89Q	ENSP00000280467:L89Q	L	-	2	0	SLC5A12	26699572	0.018000	0.18449	0.000000	0.03702	0.042000	0.13812	1.941000	0.40233	-0.023000	0.13963	-0.472000	0.04984	CTA	.	.	.	none		0.468	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
MACROD1	28992	hgsc.bcm.edu	37	11	63884401	63884401	+	Intron	SNP	T	T	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr11:63884401T>A	ENST00000255681.6	-	3	584				FLRT1_ENST00000246841.3_Missense_Mutation_p.L221H|RP11-21A7A.3_ENST00000543817.1_RNA	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						TTCAAGGGCCTCAACAGCCTG	0.657																																					p.L221H		Atlas-SNP	.											.	FLRT1	46	.	0			c.T662A						PASS	.						37.0	33.0	34.0					11																	63884401		2201	4297	6498	SO:0001627	intron_variant	23769	exon2			AGGGCCTCAACAG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34309A>T	chr11.hg19:g.63884401T>A		50.0	0.0	.		44.0	13.0	.	NM_013280	Q9UH96	Missense_Mutation	SNP	ENST00000255681.6	hg19	CCDS8056.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.012781	0.75161	.	.	ENSG00000126500	ENST00000246841	T	0.71222	-0.55	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000007	D	0.88966	0.6581	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92298	0.5847	10	0.87932	D	0	-26.892	14.697	0.69129	0.0:0.0:0.0:1.0	.	193	Q9NZU1	FLRT1_HUMAN	H	221	ENSP00000246841:L221H	ENSP00000246841:L221H	L	+	2	0	FLRT1	63640977	0.997000	0.39634	0.940000	0.37924	0.996000	0.88848	5.163000	0.64948	2.114000	0.64651	0.454000	0.30748	CTC	.	.	.	none		0.657	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
PITPNM1	9600	hgsc.bcm.edu	37	11	67265787	67265787	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr11:67265787G>A	ENST00000534749.1	-	10	1679	c.1491C>T	c.(1489-1491)agC>agT	p.S497S	PITPNM1_ENST00000436757.2_Silent_p.S497S|PITPNM1_ENST00000356404.3_Silent_p.S497S			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	497					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						GGCTGTAAGGGCTCAGGCTGT	0.657																																					p.S497S	GBM(28;144 709 4607 5525)	Atlas-SNP	.											.	PITPNM1	84	.	0			c.C1491T						PASS	.						56.0	55.0	55.0					11																	67265787		2196	4291	6487	SO:0001819	synonymous_variant	9600	exon11			GTAAGGGCTCAGG	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1491C>T	chr11.hg19:g.67265787G>A		24.0	0.0	.		23.0	8.0	.	NM_001130848	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	hg19	CCDS31620.1																																																																																			.	.	.	none		0.657	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
WNK1	65125	hgsc.bcm.edu	37	12	977170	977170	+	Intron	SNP	C	C	T	rs200794710		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr12:977170C>T	ENST00000315939.6	+	9	2782				WNK1_ENST00000574564.1_Missense_Mutation_p.R59C|WNK1_ENST00000340908.4_Intron|WNK1_ENST00000537687.1_Missense_Mutation_p.R760C|WNK1_ENST00000530271.2_Missense_Mutation_p.R845C|WNK1_ENST00000535572.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTCCCAGCGGCGTAAGAGCAC	0.512																																					p.R845C	Colon(19;451 567 6672 12618 28860)	Atlas-SNP	.											.	WNK1	403	.	0			c.C2533T						PASS	.	C	CYS/ARG,CYS/ARG,,	0,3850		0,0,1925	104.0	105.0	105.0		2278,2533,,	5.7	1.0	12		105	1,8271		0,1,4135	yes	missense,missense,intron,intron	WNK1	NM_001184985.1,NM_213655.4,NM_014823.2,NM_018979.3	180,180,,	0,1,6060	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging,probably-damaging,,	760/2643,845/2635,,	977170	1,12121	1925	4136	6061	SO:0001627	intron_variant	65125	exon10			CAGCGGCGTAAGA	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2140-3261C>T	chr12.hg19:g.977170C>T		101.0	0.0	.		148.0	7.0	.	NM_213655	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	hg19	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984466	0.53934	0.0	1.21E-4	ENSG00000060237	ENST00000537687;ENST00000530271	T;T	0.15603	2.41;2.41	5.67	5.67	0.87782	.	.	.	.	.	T	0.46795	0.1411	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.39522	-0.9610	8	0.56958	D	0.05	.	19.7725	0.96373	0.0:1.0:0.0:0.0	.	845	F5H2M7	.	C	760;845	ENSP00000444465:R760C;ENSP00000433548:R845C	ENSP00000433548:R845C	R	+	1	0	WNK1	847431	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.673000	0.90976	0.467000	0.42956	CGT	.	.	.	weak		0.512	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
KCNC2	3747	hgsc.bcm.edu	37	12	75441966	75441966	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr12:75441966A>C	ENST00000549446.1	-	4	2427	c.1747T>G	c.(1747-1749)Tac>Gac	p.Y583D	KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000548513.1_Missense_Mutation_p.Y583D|KCNC2_ENST00000550433.1_Missense_Mutation_p.Y583D|KCNC2_ENST00000393288.2_Missense_Mutation_p.Y583D|KCNC2_ENST00000341669.3_Missense_Mutation_p.Y583D|KCNC2_ENST00000540018.1_Intron|KCNC2_ENST00000548243.1_5'Flank|KCNC2_ENST00000298972.1_Missense_Mutation_p.Y583D	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	583					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GCACACGTGTAATCACCTGTC	0.463																																					p.Y583D		Atlas-SNP	.											.	KCNC2	239	.	0			c.T1747G						PASS	.						322.0	257.0	279.0					12																	75441966		2203	4300	6503	SO:0001583	missense	3747	exon4			ACGTGTAATCACC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1747T>G	chr12.hg19:g.75441966A>C	ENSP00000449253:p.Tyr583Asp	284.0	0.0	.		286.0	108.0	.	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	hg19	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.589934	0.86851	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000393288	D;D;D;D;D;D	0.97959	-4.52;-4.57;-4.63;-4.52;-4.57;-4.61	5.55	5.55	0.83447	.	1.098430	0.06893	N	0.804679	D	0.98052	0.9358	L	0.55990	1.75	0.58432	D	0.999996	D;P;D	0.57899	0.981;0.895;0.964	P;B;P	0.55871	0.786;0.389;0.745	D	0.93970	0.7248	10	0.72032	D	0.01	.	15.683	0.77388	1.0:0.0:0.0:0.0	.	583;583;583	Q96PR1-2;Q96PR1;Q96PR1-3	.;KCNC2_HUMAN;.	D	583	ENSP00000448301:Y583D;ENSP00000449941:Y583D;ENSP00000449253:Y583D;ENSP00000340121:Y583D;ENSP00000298972:Y583D;ENSP00000376966:Y583D	ENSP00000298972:Y583D	Y	-	1	0	KCNC2	73728233	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.855000	0.75445	2.104000	0.64026	0.477000	0.44152	TAC	.	.	.	none		0.463	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
NUAK1	9891	hgsc.bcm.edu	37	12	106460987	106460987	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr12:106460987G>T	ENST00000261402.2	-	7	2958	c.1579C>A	c.(1579-1581)Cac>Aac	p.H527N		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	527					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TTGCTGCTGTGTTTCAAGATG	0.627																																					p.H527N		Atlas-SNP	.											.	NUAK1	196	.	0			c.C1579A						PASS	.						68.0	75.0	72.0					12																	106460987		2203	4300	6503	SO:0001583	missense	9891	exon7			TGCTGTGTTTCAA	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1579C>A	chr12.hg19:g.106460987G>T	ENSP00000261402:p.His527Asn	113.0	0.0	.		121.0	53.0	.	NM_014840	A7MD39|Q96KA8	Missense_Mutation	SNP	ENST00000261402.2	hg19	CCDS31892.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692745	0.68271	.	.	ENSG00000074590	ENST00000261402	T	0.73258	-0.73	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000008	T	0.77239	0.4101	M	0.61703	1.905	0.54753	D	0.999988	P	0.47910	0.902	P	0.50082	0.63	T	0.78411	-0.2214	10	0.51188	T	0.08	.	19.0535	0.93054	0.0:0.0:1.0:0.0	.	527	O60285	NUAK1_HUMAN	N	527	ENSP00000261402:H527N	ENSP00000261402:H527N	H	-	1	0	NUAK1	104985117	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	9.476000	0.97823	2.493000	0.84123	0.462000	0.41574	CAC	.	.	.	none		0.627	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2	NM_014840	
RNF17	56163	hgsc.bcm.edu	37	13	25352542	25352542	+	Silent	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr13:25352542T>C	ENST00000255324.5	+	4	479	c.427T>C	c.(427-429)Ttg>Ctg	p.L143L	RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000381921.1_Silent_p.L143L|RNF17_ENST00000255325.6_Silent_p.L143L	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	143					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AGCTGTAATGTTGGTATGAAA	0.383																																					p.L143L		Atlas-SNP	.											.	RNF17	259	.	0			c.T427C						PASS	.						158.0	141.0	147.0					13																	25352542		2203	4300	6503	SO:0001819	synonymous_variant	56163	exon4			GTAATGTTGGTAT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.427T>C	chr13.hg19:g.25352542T>C		171.0	0.0	.		197.0	60.0	.	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	hg19	CCDS9308.2																																																																																			.	.	.	none		0.383	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
CSPG4	1464	hgsc.bcm.edu	37	15	75981607	75981607	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr15:75981607C>T	ENST00000308508.5	-	3	1891	c.1799G>A	c.(1798-1800)gGc>gAc	p.G600D		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	600	Globular or compact configuration stabilized by disulfide bonds.|Interaction with COL6A2. {ECO:0000250}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CACGGGGAGGCCAGAGGAGGT	0.672																																					p.G600D		Atlas-SNP	.											.	CSPG4	175	.	0			c.G1799A						PASS	.						19.0	23.0	21.0					15																	75981607		2192	4287	6479	SO:0001583	missense	1464	exon3			GGGAGGCCAGAGG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1799G>A	chr15.hg19:g.75981607C>T	ENSP00000312506:p.Gly600Asp	47.0	0.0	.		49.0	23.0	.	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	hg19	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	2.636	-0.285218	0.05605	.	.	ENSG00000173546	ENST00000308508	T	0.19938	2.11	5.35	4.4	0.53042	.	0.186703	0.37955	N	0.001879	T	0.15522	0.0374	L	0.53249	1.67	0.09310	N	1	B	0.33583	0.418	B	0.24541	0.054	T	0.18272	-1.0342	10	0.24483	T	0.36	.	6.6414	0.22911	0.1799:0.7302:0.0:0.0899	.	600	Q6UVK1	CSPG4_HUMAN	D	600	ENSP00000312506:G600D	ENSP00000312506:G600D	G	-	2	0	CSPG4	73768662	.	.	0.001000	0.08648	0.417000	0.31264	.	.	1.194000	0.43101	0.555000	0.69702	GGC	.	.	.	none		0.672	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
MCTP2	55784	hgsc.bcm.edu	37	15	94884070	94884070	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr15:94884070G>T	ENST00000357742.4	+	6	886	c.886G>T	c.(886-888)Gat>Tat	p.D296Y	MCTP2_ENST00000543482.1_Missense_Mutation_p.D296Y|MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000451018.3_Missense_Mutation_p.D296Y	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	296					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			AAAACTGGAAGATCCAAACAG	0.388																																					p.D296Y		Atlas-SNP	.											.	MCTP2	122	.	0			c.G886T						PASS	.						84.0	82.0	83.0					15																	94884070		2197	4298	6495	SO:0001583	missense	55784	exon6			CTGGAAGATCCAA	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.886G>T	chr15.hg19:g.94884070G>T	ENSP00000350377:p.Asp296Tyr	63.0	0.0	.		56.0	25.0	.	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148823	0.78001	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.10573	2.86;2.86;2.86	5.77	4.86	0.63082	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.99;0.994;0.997;0.999	T	0.02053	-1.1222	10	0.87932	D	0	.	14.4552	0.67411	0.0712:0.0:0.9288:0.0	.	296;296;296;296;296	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	Y	296	ENSP00000438521:D296Y;ENSP00000395109:D296Y;ENSP00000350377:D296Y	ENSP00000350377:D296Y	D	+	1	0	MCTP2	92685074	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.178000	0.94855	1.442000	0.47568	-0.136000	0.14681	GAT	.	.	.	none		0.388	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
PRSS21	10942	hgsc.bcm.edu	37	16	2868724	2868724	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:2868724C>G	ENST00000005995.3	+	4	346	c.304C>G	c.(304-306)Cag>Gag	p.Q102E	PRSS21_ENST00000450020.3_Missense_Mutation_p.Q102E|PRSS21_ENST00000455114.1_Missense_Mutation_p.Q100E			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	102	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						CCAGTTTGGCCAGCTGACTTC	0.562																																					p.Q102E		Atlas-SNP	.											.	PRSS21	32	.	0			c.C304G						PASS	.						126.0	101.0	109.0					16																	2868724		2198	4300	6498	SO:0001583	missense	10942	exon4			TTTGGCCAGCTGA	AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.304C>G	chr16.hg19:g.2868724C>G	ENSP00000005995:p.Gln102Glu	98.0	0.0	.		184.0	35.0	.	NM_144957	Q9NS34|Q9P2V6	Missense_Mutation	SNP	ENST00000005995.3	hg19	CCDS10478.1	.	.	.	.	.	.	.	.	.	.	c	0.406	-0.915839	0.02415	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	D;D;D	0.87412	-2.25;-2.25;-2.25	4.9	0.325	0.15903	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.253065	0.20623	N	0.088727	T	0.57636	0.2067	N	0.00670	-1.27	0.09310	N	1	B;B;B	0.15930	0.015;0.012;0.012	B;B;B	0.12837	0.008;0.005;0.005	T	0.56220	-0.8015	10	0.02654	T	1	.	10.9331	0.47230	0.0:0.6074:0.267:0.1256	.	102;100;102	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	E	100;102;102	ENSP00000400632:Q100E;ENSP00000407741:Q102E;ENSP00000005995:Q102E	ENSP00000005995:Q102E	Q	+	1	0	PRSS21	2808725	0.201000	0.23410	0.726000	0.30738	0.199000	0.23934	0.700000	0.25601	0.575000	0.29434	-0.299000	0.09455	CAG	.	.	.	none		0.562	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1	NM_006799	
ZNF597	146434	hgsc.bcm.edu	37	16	3487524	3487524	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:3487524G>C	ENST00000301744.4	-	4	410	c.175C>G	c.(175-177)Cct>Gct	p.P59A		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	59	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TTAATCTCAGGCTTGCCTTCC	0.413																																					p.P59A		Atlas-SNP	.											ZNF597,NS,malignant_melanoma,0,1	ZNF597	41	.	0			c.C175G						PASS	.						49.0	50.0	50.0					16																	3487524		2197	4300	6497	SO:0001583	missense	146434	exon4			TCTCAGGCTTGCC	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.175C>G	chr16.hg19:g.3487524G>C	ENSP00000301744:p.Pro59Ala	82.0	0.0	.		145.0	91.0	.	NM_152457		Missense_Mutation	SNP	ENST00000301744.4	hg19	CCDS10505.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.351852	0.00217	.	.	ENSG00000167981	ENST00000301744	T	0.08458	3.09	4.91	-1.26	0.09376	Krueppel-associated box (1);	0.486115	0.17564	N	0.169702	T	0.04227	0.0117	N	0.25201	0.72	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33929	-0.9849	10	0.62326	D	0.03	-0.9659	1.0959	0.01673	0.1461:0.1764:0.3287:0.3488	.	59	Q96LX8	ZN597_HUMAN	A	59	ENSP00000301744:P59A	ENSP00000301744:P59A	P	-	1	0	ZNF597	3427525	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	0.183000	0.16919	-0.121000	0.11787	-0.262000	0.10625	CCT	.	.	.	none		0.413	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457	
USP31	57478	hgsc.bcm.edu	37	16	23083424	23083424	+	Silent	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:23083424G>T	ENST00000219689.7	-	15	2429	c.2430C>A	c.(2428-2430)acC>acA	p.T810T	USP31_ENST00000567975.1_Silent_p.T103T	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		ACGCCAGGGAGGTGCGTCTGG	0.577																																					p.T810T		Atlas-SNP	.											.	USP31	122	.	0			c.C2430A						PASS	.						122.0	120.0	121.0					16																	23083424		2197	4300	6497	SO:0001819	synonymous_variant	57478	exon15			CAGGGAGGTGCGT	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2430C>A	chr16.hg19:g.23083424G>T		134.0	0.0	.		232.0	20.0	.	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	hg19	CCDS10607.1																																																																																			.	.	.	none		0.577	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
NUP93	9688	hgsc.bcm.edu	37	16	56792502	56792502	+	Silent	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:56792502T>C	ENST00000308159.5	+	3	353	c.232T>C	c.(232-234)Ttg>Ctg	p.L78L	NUP93_ENST00000569842.1_Silent_p.L78L	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	78					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CTCCCAGCGATTGGAGAGTCT	0.512																																					p.L78L	Colon(33;610 796 1305 1705 38917)	Atlas-SNP	.											.	NUP93	75	.	0			c.T232C						PASS	.						108.0	94.0	98.0					16																	56792502		2198	4300	6498	SO:0001819	synonymous_variant	9688	exon3			CAGCGATTGGAGA	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.232T>C	chr16.hg19:g.56792502T>C		112.0	0.0	.		98.0	37.0	.	NM_014669	B3KPQ8|Q14705	Silent	SNP	ENST00000308159.5	hg19	CCDS10769.1																																																																																			.	.	.	none		0.512	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
COG8	84342	hgsc.bcm.edu	37	16	69368791	69368791	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:69368791C>G	ENST00000306875.4	-	3	1160	c.1046G>C	c.(1045-1047)tGc>tCc	p.C349S	RP11-343C2.12_ENST00000562949.1_5'Flank|COG8_ENST00000562081.1_Missense_Mutation_p.C349S	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	349					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						AAAGTACATGCACTGGCCCAG	0.592																																					p.C349S		Atlas-SNP	.											.	COG8	32	.	0			c.G1046C						PASS	.						57.0	60.0	59.0					16																	69368791		2198	4300	6498	SO:0001583	missense	84342	exon3			TACATGCACTGGC	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1046G>C	chr16.hg19:g.69368791C>G	ENSP00000305459:p.Cys349Ser	103.0	0.0	.		93.0	34.0	.	NM_032382	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	hg19	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460053	0.84317	.	.	ENSG00000213380	ENST00000306875	T	0.47528	0.84	5.93	5.93	0.95920	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61489	0.2351	L	0.61218	1.895	0.80722	D	1	B;B	0.33379	0.41;0.41	P;P	0.46917	0.531;0.531	T	0.54330	-0.8310	10	0.35671	T	0.21	-0.7999	20.3363	0.98740	0.0:1.0:0.0:0.0	.	376;349	B4DYU2;Q96MW5	.;COG8_HUMAN	S	349	ENSP00000305459:C349S	ENSP00000305459:C349S	C	-	2	0	COG8	67926292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.441000	0.80485	2.814000	0.96858	0.563000	0.77884	TGC	.	.	.	none		0.592	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
ZNF778	197320	hgsc.bcm.edu	37	16	89294017	89294017	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:89294017C>T	ENST00000433976.2	+	6	1569	c.1237C>T	c.(1237-1239)Cga>Tga	p.R413*	RP11-46C24.6_ENST00000563182.1_RNA|ZNF778_ENST00000306502.6_Nonsense_Mutation_p.R371*	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TAGACACGTACGAACACACAC	0.498																																					p.R441X		Atlas-SNP	.											.	ZNF778	67	.	0			c.C1321T						PASS	.						92.0	96.0	94.0					16																	89294017		2154	4282	6436	SO:0001587	stop_gained	197320	exon7			CACGTACGAACAC	AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.1237C>T	chr16.hg19:g.89294017C>T	ENSP00000405289:p.Arg413*	71.0	0.0	.		80.0	23.0	.	NM_001201407	Q08AG0	Nonsense_Mutation	SNP	ENST00000433976.2	hg19	CCDS45550.1	.	.	.	.	.	.	.	.	.	.	C	35	5.468936	0.96274	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	.	.	.	1.13	-0.119	0.13543	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.1288	0.14899	0.6032:0.3967:0.0:0.0	.	.	.	.	X	413;371	.	ENSP00000305203:R371X	R	+	1	2	ZNF778	87821518	0.000000	0.05858	0.002000	0.10522	0.104000	0.19210	-0.846000	0.04336	-0.009000	0.14296	0.558000	0.71614	CGA	.	.	.	none		0.498	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430383.1	NM_182531	
DEF8	54849	hgsc.bcm.edu	37	16	90015887	90015887	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr16:90015887C>A	ENST00000268676.7	+	2	103	c.14C>A	c.(13-15)tCc>tAc	p.S5Y	DEF8_ENST00000567874.1_5'UTR|DEF8_ENST00000563594.1_5'UTR|DEF8_ENST00000570182.1_5'UTR|DEF8_ENST00000418391.2_5'UTR|DEF8_ENST00000563795.1_5'UTR|DEF8_ENST00000569453.1_5'UTR	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	5					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		GCCATCCTGTCCCTGCGAGCC	0.672																																					p.S5Y		Atlas-SNP	.											.	DEF8	28	.	0			c.C14A						PASS	.						46.0	47.0	47.0					16																	90015887		2198	4300	6498	SO:0001583	missense	54849	exon2			TCCTGTCCCTGCG	AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.14C>A	chr16.hg19:g.90015887C>A	ENSP00000268676:p.Ser5Tyr	86.0	0.0	.		90.0	31.0	.	NM_207514	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Missense_Mutation	SNP	ENST00000268676.7	hg19	CCDS10989.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417522	0.42918	.	.	ENSG00000140995	ENST00000268676	T	0.50001	0.76	2.59	-0.8	0.10897	.	.	.	.	.	T	0.23014	0.0556	N	0.08118	0	0.09310	N	0.999994	B	0.16166	0.016	B	0.16289	0.015	T	0.18745	-1.0327	9	0.87932	D	0	.	3.1996	0.06645	0.0:0.4875:0.226:0.2865	.	5	Q6ZN54	DEFI8_HUMAN	Y	5	ENSP00000268676:S5Y	ENSP00000268676:S5Y	S	+	2	0	DEF8	88543388	0.007000	0.16637	0.000000	0.03702	0.020000	0.10135	1.378000	0.34328	-0.124000	0.11724	0.511000	0.50034	TCC	.	.	.	none		0.672	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1	NM_207514	
KDM6B	23135	hgsc.bcm.edu	37	17	7755372	7755372	+	Silent	SNP	T	T	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr17:7755372T>G	ENST00000448097.2	+	18	4600	c.4269T>G	c.(4267-4269)gcT>gcG	p.A1423A	KDM6B_ENST00000254846.5_Silent_p.A1423A			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1423	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CCATCAGCGCTTTCTGTGATC	0.632											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1423A		Atlas-SNP	.											.	KDM6B	95	.	0			c.T4269G						PASS	.						95.0	82.0	86.0					17																	7755372		2203	4300	6503	SO:0001819	synonymous_variant	23135	exon18			CAGCGCTTTCTGT	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4269T>G	chr17.hg19:g.7755372T>G		57.0	0.0	.	644	63.0	19.0	.	NM_001080424	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	hg19																																																																																				.	.	.	none		0.632	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
ABCA9	10350	hgsc.bcm.edu	37	17	66981100	66981100	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr17:66981100G>A	ENST00000340001.4	-	34	4516	c.4305C>T	c.(4303-4305)atC>atT	p.I1435I	ABCA9_ENST00000453985.2_Silent_p.I1397I|ABCA9_ENST00000370732.2_Intron|ABCA9_ENST00000482072.1_5'Flank	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1435	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGTTCCCCAGGATGCTCAGCA	0.597																																					p.I1435I		Atlas-SNP	.											.	ABCA9	192	.	0			c.C4305T						PASS	.						132.0	116.0	121.0					17																	66981100		2203	4300	6503	SO:0001819	synonymous_variant	10350	exon34			CCCCAGGATGCTC	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4305C>T	chr17.hg19:g.66981100G>A		116.0	0.0	.		174.0	31.0	.	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	hg19	CCDS11681.1																																																																																			.	.	.	none		0.597	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
ABCA10	10349	hgsc.bcm.edu	37	17	67170778	67170778	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr17:67170778G>T	ENST00000269081.4	-	25	3927	c.3018C>A	c.(3016-3018)ttC>ttA	p.F1006L	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_Intron	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1006					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATGAAAGCTGGAATCCCAGAA	0.333																																					p.F1006L		Atlas-SNP	.											.	ABCA10	209	.	0			c.C3018A						PASS	.						78.0	86.0	83.0					17																	67170778		2202	4296	6498	SO:0001583	missense	10349	exon25			AAGCTGGAATCCC	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.3018C>A	chr17.hg19:g.67170778G>T	ENSP00000269081:p.Phe1006Leu	143.0	0.0	.		231.0	71.0	.	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	hg19	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	2.023	-0.424331	0.04734	.	.	ENSG00000154263	ENST00000269081	D	0.84944	-1.92	3.1	2.05	0.26809	.	.	.	.	.	T	0.67277	0.2876	N	0.17474	0.49	0.09310	N	1	B	0.25351	0.124	B	0.26614	0.071	T	0.51942	-0.8641	9	0.11485	T	0.65	.	1.6357	0.02741	0.1265:0.2031:0.4424:0.2279	.	1006	Q8WWZ4	ABCAA_HUMAN	L	1006	ENSP00000269081:F1006L	ENSP00000269081:F1006L	F	-	3	2	ABCA10	64682373	0.000000	0.05858	0.001000	0.08648	0.086000	0.17979	-0.664000	0.05292	0.551000	0.29008	0.407000	0.27541	TTC	.	.	.	none		0.333	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
FASN	2194	hgsc.bcm.edu	37	17	80050833	80050833	+	Missense_Mutation	SNP	G	G	A	rs200752265		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr17:80050833G>A	ENST00000306749.2	-	6	936	c.718C>T	c.(718-720)Cgg>Tgg	p.R240W		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	240	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TACACCCGCCGGGCCAGGGAC	0.682																																					p.R240W	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C718T						PASS	.						30.0	31.0	31.0					17																	80050833		2183	4296	6479	SO:0001583	missense	2194	exon6			CCCGCCGGGCCAG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.718C>T	chr17.hg19:g.80050833G>A	ENSP00000304592:p.Arg240Trp	24.0	0.0	.		37.0	12.0	.	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841387	0.71488	.	.	ENSG00000169710	ENST00000306749	T	0.32988	1.43	4.64	2.47	0.30058	Thiolase-like, subgroup (1);Thiolase-like (1);	0.239450	0.32401	N	0.006145	T	0.51873	0.1700	M	0.86028	2.79	0.34231	D	0.676504	D	0.89917	1.0	D	0.66351	0.943	T	0.63350	-0.6657	10	0.87932	D	0	-32.0916	6.8759	0.24147	0.1029:0.0:0.2594:0.6378	.	240	P49327	FAS_HUMAN	W	240	ENSP00000304592:R240W	ENSP00000304592:R240W	R	-	1	2	FASN	77644122	0.246000	0.23909	0.993000	0.49108	0.893000	0.52053	1.570000	0.36439	0.338000	0.23692	0.313000	0.20887	CGG	.	G|0.998;T|0.002	.	alt		0.682	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
MED16	10025	hgsc.bcm.edu	37	19	879943	879943	+	Missense_Mutation	SNP	G	G	C	rs201392672|rs76403059	byFrequency	TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr19:879943G>C	ENST00000589119.1	-	7	1346	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	MED16_ENST00000395808.3_Missense_Mutation_p.H449Q|MED16_ENST00000606828.1_Intron|MED16_ENST00000269814.4_Missense_Mutation_p.H449Q|MED16_ENST00000325464.1_Missense_Mutation_p.H449Q|MED16_ENST00000312090.6_Missense_Mutation_p.H449Q			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	449					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCTTCCCGTGGCTGTCAA	0.672																																					p.H449Q		Atlas-SNP	.											MED16,colon,carcinoma,0,1	MED16	61	.	0			c.C1347G						PASS	.						13.0	11.0	12.0					19																	879943		2152	4247	6399	SO:0001583	missense	10025	exon8			CTTCCCGTGGCTG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1347C>G	chr19.hg19:g.879943G>C	ENSP00000464810:p.His449Gln	15.0	1.0	.		19.0	2.0	.	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	hg19	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127462	0.06753	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.21	-7.89	0.01174	WD40 repeat-like-containing domain (1);	0.323237	0.32357	N	0.006220	T	0.21307	0.0513	L	0.37850	1.14	0.37741	D	0.925623	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.001;0.001	B;B;B;B;B	0.14023	0.006;0.006;0.003;0.006;0.01	T	0.20009	-1.0288	10	0.15066	T	0.55	-14.2411	8.1092	0.30905	0.4704:0.1904:0.3392:0.0	.	449;449;449;449;449	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	449;449;449;449;449;305;210;208;449	ENSP00000325612:H449Q;ENSP00000308528:H449Q;ENSP00000379153:H449Q;ENSP00000269814:H449Q	ENSP00000269814:H449Q	H	-	3	2	MED16	830943	0.000000	0.05858	0.886000	0.34754	0.057000	0.15508	-3.404000	0.00482	-1.779000	0.01280	-2.326000	0.00250	CAC	.	.	.	weak		0.672	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
CD97	976	hgsc.bcm.edu	37	19	14513447	14513447	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr19:14513447A>G	ENST00000242786.5	+	12	1302	c.1222A>G	c.(1222-1224)Acg>Gcg	p.T408A	CD97_ENST00000357355.3_Missense_Mutation_p.T359A|CD97_ENST00000358600.3_Missense_Mutation_p.T315A|CTC-548K16.5_ENST00000590626.1_RNA	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	408					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CCAGAACATGACGACATTGCT	0.572																																					p.T408A		Atlas-SNP	.											.	CD97	86	.	0			c.A1222G						PASS	.						120.0	109.0	112.0					19																	14513447		2203	4300	6503	SO:0001583	missense	976	exon12			AACATGACGACAT		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1222A>G	chr19.hg19:g.14513447A>G	ENSP00000242786:p.Thr408Ala	121.0	0.0	.		91.0	4.0	.	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	hg19	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	A	3.783	-0.045280	0.07452	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70045	-0.45;-0.37;0.01	5.12	-10.2	0.00374	.	.	.	.	.	T	0.45155	0.1328	N	0.22421	0.69	0.09310	N	1	B;B;B	0.30634	0.288;0.288;0.003	B;B;B	0.26416	0.069;0.069;0.008	T	0.53078	-0.8489	9	0.37606	T	0.19	.	12.7911	0.57534	0.1338:0.4984:0.3678:0.0	.	315;359;408	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	A	408;359;315;358	ENSP00000242786:T408A;ENSP00000349918:T359A;ENSP00000351413:T315A	ENSP00000242786:T408A	T	+	1	0	CD97	14374447	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-3.355000	0.00500	-4.211000	0.00064	0.374000	0.22700	ACG	.	.	.	none		0.572	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
PPP1R15A	23645	hgsc.bcm.edu	37	19	49379135	49379135	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr19:49379135G>A	ENST00000200453.5	+	3	2199	c.1930G>A	c.(1930-1932)Gtc>Atc	p.V644I		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	644					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		TTCGTCCCCAGTCCAGACCAC	0.672																																					p.V644I		Atlas-SNP	.											.	PPP1R15A	48	.	0			c.G1930A						PASS	.						122.0	120.0	121.0					19																	49379135		2203	4300	6503	SO:0001583	missense	23645	exon3			TCCCCAGTCCAGA	U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1930G>A	chr19.hg19:g.49379135G>A	ENSP00000200453:p.Val644Ile	247.0	0.0	.		284.0	91.0	.	NM_014330	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	ENST00000200453.5	hg19	CCDS12738.1	.	.	.	.	.	.	.	.	.	.	G	7.302	0.613292	0.14066	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.05081	3.5	2.9	-5.81	0.02340	.	2.513440	0.01909	N	0.039689	T	0.01905	0.0060	N	0.02916	-0.46	0.09310	N	1	B	0.22346	0.068	B	0.18263	0.021	T	0.35325	-0.9793	10	0.07030	T	0.85	0.3665	0.7652	0.01014	0.2207:0.1394:0.1939:0.446	.	644	O75807	PR15A_HUMAN	I	644;484;602	ENSP00000200453:V644I	ENSP00000200453:V644I	V	+	1	0	PPP1R15A	54070947	0.000000	0.05858	0.000000	0.03702	0.099000	0.18886	-0.505000	0.06367	-1.336000	0.02238	-0.274000	0.10170	GTC	.	.	.	none		0.672	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466226.1	NM_014330	
ZNF773	374928	hgsc.bcm.edu	37	19	58018434	58018434	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr19:58018434T>C	ENST00000282292.4	+	4	1111	c.971T>C	c.(970-972)gTt>gCt	p.V324A	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.V323A|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CATCAGAGAGTTCACACTGGA	0.428																																					p.V324A		Atlas-SNP	.											.	ZNF773	62	.	0			c.T971C						PASS	.						128.0	130.0	130.0					19																	58018434		2203	4300	6503	SO:0001583	missense	374928	exon4			AGAGAGTTCACAC	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.971T>C	chr19.hg19:g.58018434T>C	ENSP00000282292:p.Val324Ala	219.0	0.0	.		200.0	47.0	.	NM_198542	Q96DL8	Missense_Mutation	SNP	ENST00000282292.4	hg19	CCDS33134.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.418764	0.25552	.	.	ENSG00000152439	ENST00000282292	T	0.00976	5.48	1.17	1.17	0.20885	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00906	0.0030	L	0.37850	1.14	0.09310	N	0.999999	P;B	0.39903	0.694;0.429	B;B	0.34652	0.133;0.187	T	0.51521	-0.8695	9	0.87932	D	0	.	5.4406	0.16507	0.0:0.0:0.2844:0.7155	.	323;324	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	A	324	ENSP00000282292:V324A	ENSP00000282292:V324A	V	+	2	0	ZNF773	62710246	0.000000	0.05858	0.990000	0.47175	0.939000	0.58152	0.440000	0.21592	0.785000	0.33685	0.254000	0.18369	GTT	.	.	.	none		0.428	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	NM_198542	
PLCB1	23236	hgsc.bcm.edu	37	20	8741054	8741054	+	Splice_Site	SNP	G	G	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:8741054G>T	ENST00000338037.6	+	25	2684	c.2657G>T	c.(2656-2658)gGt>gTt	p.G886V	PLCB1_ENST00000378637.2_Splice_Site_p.G886V|PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Splice_Site_p.G886V	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	886					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TATATTACAGGTTCTGTAAAG	0.348																																					p.Q886L		Atlas-SNP	.											.	PLCB1	394	.	0			c.A2657T						PASS	.						42.0	42.0	42.0					20																	8741054		2203	4300	6503	SO:0001630	splice_region_variant	23236	exon25			TTACAGGTTCTGT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2657-1G>T	chr20.hg19:g.8741054G>T		71.0	0.0	.		69.0	21.0	.	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522308	0.64747	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.19250	2.17;2.16;2.17	6.07	6.07	0.98685	.	0.168672	0.52532	D	0.000067	T	0.39384	0.1076	L	0.44542	1.39	0.80722	D	1	D;D	0.65815	0.988;0.995	P;D	0.63113	0.676;0.911	T	0.00559	-1.1671	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	886;886	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	V	886;886;886;806;806	ENSP00000367908:G886V;ENSP00000338185:G886V;ENSP00000367904:G886V	.	G	+	2	0	PLCB1	8689054	1.000000	0.71417	0.996000	0.52242	0.929000	0.56500	8.960000	0.93117	2.885000	0.99019	0.655000	0.94253	GGT	.	.	.	none		0.348	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		Missense_Mutation
KCNS1	3787	hgsc.bcm.edu	37	20	43726464	43726464	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:43726464A>T	ENST00000306117.1	-	4	1345	c.949T>A	c.(949-951)Tat>Aat	p.Y317N	KCNS1_ENST00000537075.1_Missense_Mutation_p.Y317N	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	317					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				AGCGTGAGATAGAAGGGCAGC	0.632																																					p.Y317N		Atlas-SNP	.											.	KCNS1	30	.	0			c.T949A						PASS	.						74.0	57.0	62.0					20																	43726464		2203	4300	6503	SO:0001583	missense	3787	exon4			TGAGATAGAAGGG	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.949T>A	chr20.hg19:g.43726464A>T	ENSP00000307694:p.Tyr317Asn	32.0	0.0	.		29.0	16.0	.	NM_002251	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	hg19	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403414	0.83230	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.98701	-5.08;-5.08	5.31	5.31	0.75309	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99336	0.9767	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98784	1.0733	10	0.87932	D	0	.	15.2726	0.73717	1.0:0.0:0.0:0.0	.	317	Q96KK3	KCNS1_HUMAN	N	317	ENSP00000307694:Y317N;ENSP00000445595:Y317N	ENSP00000307694:Y317N	Y	-	1	0	KCNS1	43159878	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.220000	0.95180	2.015000	0.59207	0.459000	0.35465	TAT	.	.	.	none		0.632	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	
WFDC2	10406	hgsc.bcm.edu	37	20	44108666	44108666	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:44108666G>A	ENST00000372676.3	+	3	384	c.308G>A	c.(307-309)tGt>tAt	p.C103Y	WFDC2_ENST00000342873.3_Missense_Mutation_p.C52Y|WFDC2_ENST00000339946.3_Missense_Mutation_p.C55Y|WFDC2_ENST00000488143.1_3'UTR|AL031663.1_ENST00000599747.1_5'Flank	NM_006103.3	NP_006094.3	Q14508	WFDC2_HUMAN	WAP four-disulfide core domain 2	103	WAP 2. {ECO:0000255|PROSITE- ProRule:PRU00722}.				negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase inhibitor activity (GO:0019828)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			lung(1)	1		Myeloproliferative disorder(115;0.0122)				GACAGCCAGTGTCCTGGCCAG	0.537																																					p.C103Y		Atlas-SNP	.											.	WFDC2	8	.	0			c.G308A						PASS	.						107.0	112.0	110.0					20																	44108666		2203	4300	6503	SO:0001583	missense	10406	exon3			GCCAGTGTCCTGG	X63187	CCDS35501.1	20q13.12	2013-01-21			ENSG00000101443	ENSG00000101443		"""WAP four-disulfide core domain containing"""	15939	protein-coding gene	gene with protein product	"""epididymal protein 4"""					1686187, 10570965	Standard	NM_006103		Approved	HE4, WAP5, dJ461P17.6, EDDM4	uc002xoo.3	Q14508	OTTHUMG00000032594	ENST00000372676.3:c.308G>A	chr20.hg19:g.44108666G>A	ENSP00000361761:p.Cys103Tyr	217.0	0.0	.		181.0	74.0	.	NM_006103	A2A2A5|A2A2A6|A6PVD5|Q6IB27|Q8WXV9|Q8WXW0|Q8WXW1|Q8WXW2|Q96KJ1	Missense_Mutation	SNP	ENST00000372676.3	hg19	CCDS35501.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620538	0.46736	.	.	ENSG00000101443	ENST00000372676;ENST00000339946;ENST00000342873	D;D;D	0.99239	-5.61;-5.61;-5.61	5.26	5.26	0.73747	Whey acidic protein, 4-disulphide core (5);	0.000000	0.64402	D	0.000017	D	0.99670	0.9877	H	0.98276	4.19	0.43947	D	0.996613	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.97440	1.0021	10	0.87932	D	0	-13.7907	14.7141	0.69254	0.0:0.0:1.0:0.0	.	52;55;103	Q14508-2;Q14508-3;Q14508	.;.;WFDC2_HUMAN	Y	103;55;52	ENSP00000361761:C103Y;ENSP00000340215:C55Y;ENSP00000342890:C52Y	ENSP00000340215:C55Y	C	+	2	0	WFDC2	43542080	0.997000	0.39634	0.953000	0.39169	0.096000	0.18686	3.179000	0.50887	2.598000	0.87819	0.655000	0.94253	TGT	.	.	.	none		0.537	WFDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079476.3		
DNTTIP1	116092	hgsc.bcm.edu	37	20	44424050	44424050	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:44424050A>G	ENST00000372622.3	+	4	408	c.340A>G	c.(340-342)Atc>Gtc	p.I114V		NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	114						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				AGAGCAGCTGATCCAGGAAGC	0.557																																					p.I114V		Atlas-SNP	.											.	DNTTIP1	23	.	0			c.A340G						PASS	.						48.0	32.0	38.0					20																	44424050		2203	4300	6503	SO:0001583	missense	116092	exon4			CAGCTGATCCAGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.340A>G	chr20.hg19:g.44424050A>G	ENSP00000361705:p.Ile114Val	29.0	0.0	.		18.0	7.0	.	NM_052951	B2RA18|Q96DE3|Q9BQP2|Q9H148	Missense_Mutation	SNP	ENST00000372622.3	hg19	CCDS13369.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	17.46|17.46	3.396221|3.396221	0.62177|0.62177	.|.	.|.	ENSG00000101457|ENSG00000101457	ENST00000372622;ENST00000449078;ENST00000415790|ENST00000435014	T;T|.	0.48201|.	0.92;0.82|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.045638|.	0.85682|.	D|.	0.000000|.	T|.	0.60715|.	0.2290|.	L|L	0.42686|0.42686	1.345|1.345	0.44711|0.44711	D|D	0.997702|0.997702	B|.	0.28850|.	0.225|.	B|.	0.30316|.	0.114|.	T|.	0.57551|.	-0.7792|.	10|.	0.35671|.	T|.	0.21|.	-18.7653|-18.7653	14.5366|14.5366	0.67966|0.67966	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	114|.	Q9H147|.	TDIF1_HUMAN|.	V|W	114;109;74|40	ENSP00000361705:I114V;ENSP00000392509:I74V|.	ENSP00000361705:I114V|.	I|X	+|+	1|3	0|0	DNTTIP1|DNTTIP1	43857457|43857457	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.264000|7.264000	0.78432|0.78432	2.304000|2.304000	0.77564|0.77564	0.524000|0.524000	0.50904|0.50904	ATC|TGA	.	.	.	none		0.557	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
PSMA7	5688	hgsc.bcm.edu	37	20	60714841	60714841	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:60714841T>G	ENST00000370873.4	-	3	470	c.344A>C	c.(343-345)aAg>aCg	p.K115T	PSMA7_ENST00000484488.1_5'UTR|PSMA7_ENST00000370858.3_Missense_Mutation_p.K115T|PSMA7_ENST00000370861.1_Missense_Mutation_p.K45T	NM_002792.3	NP_002783.1	O14818	PSA7_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 7	115					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	identical protein binding (GO:0042802)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|lung(2)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			ACCCACCTGCTTCAGACTGGC	0.617																																					p.K115T		Atlas-SNP	.											.	PSMA7	13	.	0			c.A344C						PASS	.						67.0	55.0	59.0					20																	60714841		2203	4300	6503	SO:0001583	missense	5688	exon3			ACCTGCTTCAGAC	AF022815	CCDS13489.1	20q13.33	2008-07-02			ENSG00000101182	ENSG00000101182		"""Proteasome (prosome, macropain) subunits"""	9536	protein-coding gene	gene with protein product	"""proteasome subunit XAPC7"", ""proteasome subunit RC6-1"""	606607				8764072	Standard	NM_002792		Approved	XAPC7, C6, HSPC, RC6-1	uc002ybx.2	O14818	OTTHUMG00000032895	ENST00000370873.4:c.344A>C	chr20.hg19:g.60714841T>G	ENSP00000359910:p.Lys115Thr	59.0	0.0	.		64.0	21.0	.	NM_002792	B2R515|Q5JXJ2|Q9BR53|Q9H4K5|Q9UEU8	Missense_Mutation	SNP	ENST00000370873.4	hg19	CCDS13489.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	19.47|19.47	3.834596|3.834596	0.71373|0.71373	.|.	.|.	ENSG00000101182|ENSG00000101182	ENST00000370873;ENST00000370861;ENST00000370858|ENST00000442551	T;T;T|.	0.21191|.	2.02;2.02;2.02|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80110|0.80110	0.4563|0.4563	M|M	0.88512|0.88512	2.96|2.96	0.80722|0.80722	D|D	1|1	P|.	0.46578|.	0.88|.	P|.	0.55391|.	0.775|.	D|D	0.83890|0.83890	0.0284|0.0284	10|5	0.87932|.	D|.	0|.	.|.	14.9125|14.9125	0.70770|0.70770	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	115|.	O14818|.	PSA7_HUMAN|.	T|R	115;45;115|41	ENSP00000359910:K115T;ENSP00000359898:K45T;ENSP00000359895:K115T|.	ENSP00000359895:K115T|.	K|S	-|-	2|1	0|0	PSMA7|PSMA7	60148236|60148236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.264000|0.264000	0.26372|0.26372	7.469000|7.469000	0.80959|0.80959	1.974000|1.974000	0.57490|0.57490	0.460000|0.460000	0.39030|0.39030	AAG|AGC	.	.	.	none		0.617	PSMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079975.1	NM_002792	
ZNF512B	57473	hgsc.bcm.edu	37	20	62642772	62642772	+	Intron	SNP	G	G	C	rs199552405		TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr20:62642772G>C	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Silent_p.T480T			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					ATGGGAACACGCAGATGGTGG	0.587																																					p.T480T		Atlas-SNP	.											.	PRPF6	88	.	0			c.G1440C						PASS	.						94.0	77.0	83.0					20																	62642772		2203	4300	6503	SO:0001627	intron_variant	24148	exon11			GAACACGCAGATG	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+37285C>G	chr20.hg19:g.62642772G>C		52.0	0.0	.		46.0	12.0	.	NM_012469	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	hg19	CCDS13548.1																																																																																			.	G|1.000;A|0.000	.	alt		0.587	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
SON	6651	hgsc.bcm.edu	37	21	34925625	34925625	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr21:34925625C>T	ENST00000356577.4	+	3	4563	c.4088C>T	c.(4087-4089)tCg>tTg	p.S1363L	SON_ENST00000290239.6_Missense_Mutation_p.S1363L|SON_ENST00000300278.4_Missense_Mutation_p.S1363L|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.S1363L	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1363	4 X 8 AA tandem repeats of V-L-E-SS- [AVT]-VT.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTGGAGTCTTCGGCTGTGACC	0.577																																					p.S1363L		Atlas-SNP	.											.	SON	343	.	0			c.C4088T						PASS	.						52.0	45.0	48.0					21																	34925625		2203	4300	6503	SO:0001583	missense	6651	exon3			AGTCTTCGGCTGT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4088C>T	chr21.hg19:g.34925625C>T	ENSP00000348984:p.Ser1363Leu	54.0	0.0	.		68.0	17.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	hg19	CCDS13629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.86|11.86	1.765064|1.765064	0.31228|0.31228	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000436227|ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	.|T;T;T;T	.|0.11930	.|2.93;2.93;2.92;2.73	5.08|5.08	4.2|4.2	0.49525|0.49525	.|.	.|0.972270	.|0.08431	.|N	.|0.946875	T|T	0.10035|0.10035	0.0246|0.0246	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.20780	.|0.048;0.004;0.019;0.007;0.019	.|B;B;B;B;B	.|0.09377	.|0.004;0.001;0.004;0.004;0.004	T|T	0.26360|0.26360	-1.0105|-1.0105	5|10	.|0.36615	.|T	.|0.2	.|.	9.0913|9.0913	0.36612|0.36612	0.0:0.9012:0.0:0.0988|0.0:0.9012:0.0:0.0988	.|.	.|1363;1363;1044;1363;1363	.|P18583-10;P18583;P18583-2;P18583-3;P18583-6	.|.;SON_HUMAN;.;.;.	W|L	358|1363	.|ENSP00000348984:S1363L;ENSP00000290239:S1363L;ENSP00000300278:S1363L;ENSP00000371095:S1363L	.|ENSP00000290239:S1363L	R|S	+|+	1|2	2|0	SON|SON	33847495|33847495	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.011000|0.011000	0.07611|0.07611	0.354000|0.354000	0.20146|0.20146	1.362000|1.362000	0.46000|0.46000	0.514000|0.514000	0.50259|0.50259	CGG|TCG	.	.	.	none		0.577	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
STAG2	10735	hgsc.bcm.edu	37	X	123200037	123200037	+	Silent	SNP	T	T	C			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chrX:123200037T>C	ENST00000371160.1	+	22	2399	c.2109T>C	c.(2107-2109)ctT>ctC	p.L703L	STAG2_ENST00000371144.3_Silent_p.L703L|STAG2_ENST00000371157.3_Silent_p.L703L|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Silent_p.L703L|STAG2_ENST00000354548.5_Silent_p.L634L|STAG2_ENST00000371145.3_Silent_p.L703L	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	703					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CCCATGACCTTTCAAAGTGGG	0.294																																					p.L703L		Atlas-SNP	.											.	STAG2	309	.	0			c.T2109C						PASS	.						60.0	61.0	61.0					X																	123200037		2202	4298	6500	SO:0001819	synonymous_variant	10735	exon22			TGACCTTTCAAAG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2109T>C	chrX.hg19:g.123200037T>C		76.0	0.0	.		65.0	44.0	.	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.	.	none		0.294	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
MT-ND4	4538	hgsc.bcm.edu	37	M	10971	10971	+	Silent	SNP	G	G	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chrM:10971G>A	ENST00000361381.2	+	1	212	c.212G>A	c.(211-213)tGa>tAa	p.*71*	MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	71					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACTAACTACCTGACTCCTACC	0.448																																					p.W71X		Atlas-SNP	.											.	.	.	.	0			c.G212A						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CTACCTGACTCCT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.212G>A	chrM.hg19:g.10971G>A		51.0	0.0	.		141.0	127.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Nonsense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
PBRM1	55193	hgsc.bcm.edu	37	3	52696272	52696272	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr3:52696272delT	ENST00000296302.7	-	4	406	c.405delA	c.(403-405)aaafs	p.K135fs	PBRM1_ENST00000394830.3_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000356770.4_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000337303.4_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000409114.3_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000409057.1_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000409767.1_Frame_Shift_Del_p.K135fs|PBRM1_ENST00000410007.1_Frame_Shift_Del_p.K135fs			Q86U86	PB1_HUMAN	polybromo 1	135					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGCAAGCGGCTTTATATTCAG	0.368			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.A136fs		Atlas-INDEL	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.406delG						PASS	.						110.0	106.0	107.0					3																	52696272		2203	4300	6503	SO:0001589	frameshift_variant	55193	exon5			.	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.405delA	chr3.hg19:g.52696272delT	ENSP00000296302:p.Lys135fs	149.0	0.0	0		91.0	61.0	0.67033	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Frame_Shift_Del	DEL	ENST00000296302.7	hg19																																																																																				.	.	.	none		0.368	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
HOXA2	3199	hgsc.bcm.edu	37	7	27140389	27140390	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr7:27140389_27140390insA	ENST00000222718.5	-	2	1396_1397	c.1086_1087insT	c.(1084-1089)tttacafs	p.T363fs	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000593300.1_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	363					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						AGTGTGTCTGTAAAAAAGTCTA	0.436																																					p.T363fs		Atlas-INDEL	.											.	HOXA2	56	.	0			c.1087_1088insT						PASS	.																																			SO:0001589	frameshift_variant	3199	exon2			.		CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.1087dupT	chr7.hg19:g.27140395_27140395dupA	ENSP00000222718:p.Thr363fs	177.0	0.0	0		177.0	23.0	0.129944	NM_006735	A1L4K3|B2RMW3	Frame_Shift_Ins	INS	ENST00000222718.5	hg19	CCDS5403.1																																																																																			.	.	.	none		0.436	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2		
COL14A1	7373	hgsc.bcm.edu	37	8	121219275	121219276	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5890-01A-11D-1589-08	TCGA-BQ-5890-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c6938c32-20f1-4d04-9939-0c3d217b7c81	7d6403bb-f48a-43e1-9a32-feb3bb9de789	g.chr8:121219275_121219276insA	ENST00000297848.3	+	10	1403_1404	c.1133_1134insA	c.(1132-1137)ggaaatfs	p.N379fs	COL14A1_ENST00000247781.3_Frame_Shift_Ins_p.N284fs|COL14A1_ENST00000537875.1_Frame_Shift_Ins_p.N379fs|COL14A1_ENST00000309791.4_Frame_Shift_Ins_p.N379fs|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			CATGCCCCAGGAAATGTGGAAA	0.436																																					p.G378fs		Atlas-INDEL	.											.	COL14A1	292	.	0			c.1133_1134insA						PASS	.																																			SO:0001589	frameshift_variant	7373	exon10			.		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1136dupA	chr8.hg19:g.121219278_121219278dupA	ENSP00000297848:p.Asn379fs	49.0	0.0	0		59.0	19.0	0.322034	NM_021110		Frame_Shift_Ins	INS	ENST00000297848.3	hg19	CCDS34938.1																																																																																			.	.	.	none		0.436	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
