#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRSF4	6429	hgsc.bcm.edu	37	1	29475685	29475685	+	Missense_Mutation	SNP	C	C	T	rs368357249		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:29475685C>T	ENST00000373795.4	-	6	956	c.722G>A	c.(721-723)cGg>cAg	p.R241Q	SRSF4_ENST00000546138.1_Silent_p.P139P|SRSF4_ENST00000466448.1_5'UTR|RP11-242O24.3_ENST00000413004.1_lincRNA	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	241	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						TTTCTTgctccggctccgact	0.592																																					p.R241Q		Atlas-SNP	.											SRSF4,colon,carcinoma,0,1	SRSF4	44	.	0			c.G722A						PASS	.	C	GLN/ARG	2,4398		0,2,2198	50.0	60.0	57.0		722	5.8	1.0	1		57	0,8596		0,0,4298	no	missense	SRSF4	NM_005626.4	43	0,2,6496	TT,TC,CC		0.0,0.0455,0.0154	probably-damaging	241/495	29475685	2,12994	2200	4298	6498	SO:0001583	missense	6429	exon6			TTGCTCCGGCTCC	BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.722G>A	chr1.hg19:g.29475685C>T	ENSP00000362900:p.Arg241Gln	200.0	1.0	.		162.0	15.0	.	NM_005626	Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	ENST00000373795.4	hg19	CCDS333.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131145	0.56828	4.55E-4	0.0	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.38401	1.14	5.77	5.77	0.91146	.	0.201011	0.34932	N	0.003572	T	0.35189	0.0923	L	0.52573	1.65	0.80722	D	1	D	0.61080	0.989	B	0.42087	0.375	T	0.19778	-1.0295	10	0.59425	D	0.04	.	13.8822	0.63688	0.1522:0.8478:0.0:0.0	.	241	Q08170	SRSF4_HUMAN	Q	241	ENSP00000362900:R241Q	ENSP00000362900:R241Q	R	-	2	0	SRSF4	29348272	0.993000	0.37304	0.999000	0.59377	0.988000	0.76386	3.219000	0.51200	2.723000	0.93209	0.655000	0.94253	CGG	.	.	.	none		0.592	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010392.1	NM_005626	
ZNF691	51058	hgsc.bcm.edu	37	1	43317094	43317094	+	Silent	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:43317094C>A	ENST00000372506.1	+	4	805	c.465C>A	c.(463-465)ctC>ctA	p.L155L	ZNF691_ENST00000372502.1_Silent_p.L177L|ZNF691_ENST00000397044.3_Silent_p.L186L|ZNF691_ENST00000372504.1_Silent_p.L177L|ZNF691_ENST00000372508.3_Silent_p.L155L|ZNF691_ENST00000372507.1_Silent_p.L155L	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	186						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCTCAGACCTCACCACGCACC	0.597																																					p.L186L		Atlas-SNP	.											.	ZNF691	30	.	0			c.C558A						PASS	.						61.0	56.0	58.0					1																	43317094		2203	4300	6503	SO:0001819	synonymous_variant	51058	exon4			AGACCTCACCACG		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.465C>A	chr1.hg19:g.43317094C>A		89.0	0.0	.		78.0	17.0	.	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Silent	SNP	ENST00000372506.1	hg19	CCDS476.1																																																																																			.	.	.	none		0.597	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
CACHD1	57685	hgsc.bcm.edu	37	1	65143946	65143946	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:65143946G>A	ENST00000371073.2	+	23	3197	c.3197G>A	c.(3196-3198)gGg>gAg	p.G1066E	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Missense_Mutation_p.G1015E			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1066					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TGCTTCGGGGGGATTGTGGGA	0.473																																					p.G1015E		Atlas-SNP	.											.	CACHD1	125	.	0			c.G3044A						PASS	.						94.0	95.0	95.0					1																	65143946		2203	4300	6503	SO:0001583	missense	57685	exon23			TCGGGGGGATTGT	AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3197G>A	chr1.hg19:g.65143946G>A	ENSP00000360113:p.Gly1066Glu	65.0	0.0	.		84.0	6.0	.	NM_020925	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	hg19		.	.	.	.	.	.	.	.	.	.	G	33	5.284715	0.95517	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.58210	0.35;0.4	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.66839	0.2830	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66056	-0.6018	10	0.87932	D	0	-25.7352	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1066	Q5VU97	CAHD1_HUMAN	E	1066;1015	ENSP00000360113:G1066E;ENSP00000290039:G1015E	ENSP00000290039:G1015E	G	+	2	0	CACHD1	64916534	1.000000	0.71417	0.941000	0.38009	0.996000	0.88848	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GGG	.	.	.	none		0.473	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
FMO1	2326	hgsc.bcm.edu	37	1	171247924	171247924	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:171247924A>T	ENST00000354841.4	+	4	672	c.541A>T	c.(541-543)Ata>Tta	p.I181L	FMO1_ENST00000402921.2_Missense_Mutation_p.I118L|FMO1_ENST00000367750.3_Missense_Mutation_p.I181L|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	181					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCATCCAGATATATTTAAGGA	0.418																																					p.I181L		Atlas-SNP	.											.	FMO1	79	.	0			c.A541T						PASS	.						74.0	77.0	76.0					1																	171247924		2203	4300	6503	SO:0001583	missense	2326	exon5			CCAGATATATTTA	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.541A>T	chr1.hg19:g.171247924A>T	ENSP00000346901:p.Ile181Leu	111.0	0.0	.		137.0	44.0	.	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	hg19	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.131021	0.37630	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000402921;ENST00000354841	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.66	1.85	0.25348	.	0.462268	0.24947	N	0.034331	T	0.13243	0.0321	N	0.20610	0.595	0.09310	N	0.999994	B;B;B	0.13145	0.007;0.001;0.002	B;B;B	0.16289	0.015;0.001;0.01	T	0.21621	-1.0240	10	0.31617	T	0.26	-0.8266	5.0708	0.14606	0.5496:0.1475:0.3029:0.0	.	118;181;181	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	L	181;181;118;181	ENSP00000356724:I181L;ENSP00000406982:I181L;ENSP00000385543:I118L;ENSP00000346901:I181L	ENSP00000346901:I181L	I	+	1	0	FMO1	169514548	0.000000	0.05858	0.998000	0.56505	0.998000	0.95712	0.351000	0.20096	0.401000	0.25424	0.460000	0.39030	ATA	.	.	.	none		0.418	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
SUCO	51430	hgsc.bcm.edu	37	1	172558217	172558217	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:172558217T>G	ENST00000263688.3	+	18	2195	c.1976T>G	c.(1975-1977)cTt>cGt	p.L659R	SUCO_ENST00000610051.1_Intron|SUCO_ENST00000367723.4_Missense_Mutation_p.L810R|SUCO_ENST00000608151.1_Missense_Mutation_p.L811R	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	659					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											AAAGATTATCTTGTGTTAGCT	0.383																																					p.L659R		Atlas-SNP	.											.	.	.	.	0			c.T1976G						PASS	.						79.0	81.0	81.0					1																	172558217		2203	4299	6502	SO:0001583	missense	51430	exon18			ATTATCTTGTGTT	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1976T>G	chr1.hg19:g.172558217T>G	ENSP00000263688:p.Leu659Arg	73.0	0.0	.		88.0	30.0	.	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	hg19	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	T	3.471	-0.108011	0.06924	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	4.95	2.51	0.30379	.	0.913904	0.09394	N	0.808213	T	0.11324	0.0276	L	0.43152	1.355	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.28170	-1.0052	9	0.18276	T	0.48	-0.0114	2.1827	0.03879	0.4718:0.1619:0.0:0.3663	.	659;811;659	B4DZJ3;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	R	811;659	.	ENSP00000263688:L659R	L	+	2	0	C1orf9	170824840	0.000000	0.05858	0.002000	0.10522	0.610000	0.37248	-0.219000	0.09228	0.693000	0.31634	0.460000	0.39030	CTT	.	.	.	none		0.383	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
TMEM81	388730	hgsc.bcm.edu	37	1	205053045	205053045	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:205053045A>C	ENST00000367167.3	-	1	600	c.404T>G	c.(403-405)tTc>tGc	p.F135C		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	135	Ig-like.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			AAAGGGTTTGAAGACCTCATC	0.468																																					p.F135C		Atlas-SNP	.											.	TMEM81	23	.	0			c.T404G						PASS	.						87.0	92.0	90.0					1																	205053045		2203	4300	6503	SO:0001583	missense	388730	exon1			GGTTTGAAGACCT	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.404T>G	chr1.hg19:g.205053045A>C	ENSP00000356135:p.Phe135Cys	119.0	0.0	.		139.0	32.0	.	NM_203376	Q6UVZ4	Missense_Mutation	SNP	ENST00000367167.3	hg19	CCDS1450.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.853325	0.51270	.	.	ENSG00000174529	ENST00000367167	T	0.42900	0.96	5.93	5.93	0.95920	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64216	0.2578	M	0.72894	2.215	0.47245	D	0.999365	D	0.89917	1.0	D	0.91635	0.999	T	0.67562	-0.5639	10	0.87932	D	0	-6.5281	14.6242	0.68608	1.0:0.0:0.0:0.0	.	135	Q6P7N7	TMM81_HUMAN	C	135	ENSP00000356135:F135C	ENSP00000356135:F135C	F	-	2	0	TMEM81	203319668	1.000000	0.71417	0.999000	0.59377	0.171000	0.22731	5.953000	0.70290	2.281000	0.76405	0.533000	0.62120	TTC	.	.	.	none		0.468	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376	
NT5C1B	93034	hgsc.bcm.edu	37	2	18767651	18767651	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:18767651G>C	ENST00000359846.2	-	4	384	c.307C>G	c.(307-309)Caa>Gaa	p.Q103E	NT5C1B_ENST00000304081.4_Missense_Mutation_p.Q43E|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000460052.1_5'UTR|NT5C1B_ENST00000600945.1_Missense_Mutation_p.Q103E|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.Q103E	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	103	Ser-rich.				nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GATGATTCTTGTGATCCCTGT	0.488																																					p.Q120E		Atlas-SNP	.											.	NT5C1B	72	.	0			c.C358G						PASS	.						97.0	86.0	89.0					2																	18767651		2203	4300	6503	SO:0001583	missense	93034	exon4			ATTCTTGTGATCC	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.307C>G	chr2.hg19:g.18767651G>C	ENSP00000352904:p.Gln103Glu	104.0	0.0	.		104.0	11.0	.	NM_001199087	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	hg19	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655456	0.29425	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	D	0.91124	-2.79	4.79	4.79	0.61399	.	0.287423	0.25604	N	0.029528	D	0.84723	0.5535	L	0.29908	0.895	0.26210	N	0.979313	B;B;B;P;B;B;B;B	0.35745	0.366;0.366;0.278;0.518;0.39;0.264;0.209;0.313	B;B;B;B;B;B;B;B	0.35931	0.156;0.156;0.079;0.156;0.068;0.164;0.106;0.214	T	0.77930	-0.2403	10	0.37606	T	0.19	-30.2005	13.6483	0.62294	0.0:0.0:1.0:0.0	.	86;120;43;86;43;43;103;103	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;5NT1B_HUMAN;.	E	103;43;43;103;120	ENSP00000412639:Q43E	ENSP00000305979:Q43E	Q	-	1	0	NT5C1B-RDH14;NT5C1B	18631132	0.991000	0.36638	0.985000	0.45067	0.092000	0.18411	2.396000	0.44468	2.941000	0.99782	0.655000	0.94253	CAA	.	.	.	none		0.488	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
CPO	130749	hgsc.bcm.edu	37	2	207827299	207827299	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:207827299C>T	ENST00000272852.3	+	7	784	c.738C>T	c.(736-738)taC>taT	p.Y246Y		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	246						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TCACACCTTACGGCTACACCA	0.448																																					p.Y246Y		Atlas-SNP	.											.	CPO	42	.	0			c.C738T						PASS	.						170.0	160.0	164.0					2																	207827299		2203	4300	6503	SO:0001819	synonymous_variant	130749	exon7			ACCTTACGGCTAC		CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.738C>T	chr2.hg19:g.207827299C>T		179.0	0.0	.		255.0	15.0	.	NM_173077	Q2M277|Q7RTW7	Silent	SNP	ENST00000272852.3	hg19	CCDS2372.1																																																																																			.	.	.	none		0.448	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202040.2	NM_173077	
VHL	7428	hgsc.bcm.edu	37	3	10191506	10191506	+	Missense_Mutation	SNP	C	C	G	rs5030820		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr3:10191506C>G	ENST00000256474.2	+	3	1339	c.499C>G	c.(499-501)Cgg>Ggg	p.R167G	VHL_ENST00000345392.2_Missense_Mutation_p.R126G|VHL_ENST00000477538.1_3'UTR	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	167			R -> G (in VHLD; type I-II). {ECO:0000269|PubMed:9829911}.|R -> Q (in pheochromocytoma and VHLD; type II; common mutation; dbSNP:rs5030821). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.|R -> W (in pheochromocytoma and VHLD; type II; common mutation; dbSNP:rs5030820). {ECO:0000269|PubMed:12000816, ECO:0000269|PubMed:8592333, ECO:0000269|PubMed:8956040, ECO:0000269|PubMed:9829912}.		cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.R167W(8)|p.R167G(2)|p.R167fs*1(1)|p.V166fs*6(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCAGGTTGTCCGGAGCCTAGT	0.512		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.R167G		Atlas-SNP	.	yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	VHL,NS,carcinoma,-1,1	VHL	2192	.	12	Substitution - Missense(10)|Deletion - Frameshift(1)|Insertion - Frameshift(1)	kidney(8)|adrenal_gland(2)|large_intestine(1)|endometrium(1)	c.C499G	GRCh37	CM941383|CM941384|HX040002	VHL	M|X	rs5030820	PASS	.						92.0	84.0	87.0					3																	10191506		2203	4300	6503	SO:0001583	missense	7428	exon3	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	GTTGTCCGGAGCC	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.499C>G	chr3.hg19:g.10191506C>G	ENSP00000256474:p.Arg167Gly	47.0	0.0	.		58.0	24.0	.	NM_000551	B2RE45|Q13599|Q6PDA9	Missense_Mutation	SNP	ENST00000256474.2	hg19	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548531	0.65311	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	D;D	0.99830	-7.01;-7.01	4.86	3.97	0.46021	von Hippel-Lindau disease tumour suppressor, beta/alpha domain (2);von Hippel-Lindau disease tumor suppressor, alpha domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	M	0.68952	2.095	0.42468	D	0.992812	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97794	1.0240	10	0.54805	T	0.06	-6.8035	10.4067	0.44260	0.3559:0.6441:0.0:0.0	.	126;167	P40337-2;P40337	.;VHL_HUMAN	G	167;126;85	ENSP00000256474:R167G;ENSP00000344757:R126G	ENSP00000256474:R167G	R	+	1	2	VHL	10166506	0.999000	0.42202	0.908000	0.35775	0.831000	0.47069	2.914000	0.48797	1.375000	0.46248	0.655000	0.94253	CGG	.	C|1.000	.	weak		0.512	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1	NM_000551	
PHF7	51533	hgsc.bcm.edu	37	3	52443866	52443866	+	5'Flank	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr3:52443866C>T	ENST00000327906.3	+	0	0				BAP1_ENST00000460680.1_Missense_Mutation_p.S10N|PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000296288.5_Missense_Mutation_p.S10N	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.S10T(1)|p.E7_S10delELES(1)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		ACCTGGGTCGCTCTCCAGCTC	0.746																																					p.S10N		Atlas-SNP	.											BAP1,NS,carcinoma,0,3	BAP1	371	.	2	Substitution - Missense(1)|Deletion - In frame(1)	kidney(2)	c.G29A						PASS	.						24.0	30.0	28.0					3																	52443866		2203	4298	6501	SO:0001631	upstream_gene_variant	8314	exon1			GGGTCGCTCTCCA	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		chr3.hg19:g.52443866C>T	Exception_encountered	59.0	0.0	.		48.0	24.0	.	NM_004656	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	hg19	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450733	0.96205	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.61627	0.09;0.09	4.93	4.93	0.64822	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (4);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83154	-0.0102	10	0.66056	D	0.02	-4.1481	15.9287	0.79644	0.0:1.0:0.0:0.0	.	10	Q92560	BAP1_HUMAN	N	10	ENSP00000417132:S10N;ENSP00000296288:S10N	ENSP00000296288:S10N	S	-	2	0	BAP1	52418906	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.832000	0.62759	2.289000	0.77006	0.561000	0.74099	AGC	.	.	.	none		0.746	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
HAUS3	79441	hgsc.bcm.edu	37	4	2242534	2242534	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:2242534A>C	ENST00000243706.4	-	2	369	c.140T>G	c.(139-141)gTg>gGg	p.V47G	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000506763.1_Missense_Mutation_p.V47G|HAUS3_ENST00000443786.2_Missense_Mutation_p.V47G	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	47					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTGTTCATTCACATTCCCACA	0.413																																					p.V47G		Atlas-SNP	.											.	HAUS3	54	.	0			c.T140G						PASS	.						121.0	110.0	114.0					4																	2242534		2203	4300	6503	SO:0001583	missense	79441	exon2			TCATTCACATTCC	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.140T>G	chr4.hg19:g.2242534A>C	ENSP00000243706:p.Val47Gly	168.0	0.0	.		153.0	13.0	.	NM_024511	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	ENST00000243706.4	hg19	CCDS33941.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101593	0.76983	.	.	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.59638	0.25;0.25	4.68	4.68	0.58851	.	0.084524	0.49305	U	0.000154	T	0.70596	0.3242	M	0.78049	2.395	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.62089	0.898;0.898	T	0.74222	-0.3735	10	0.87932	D	0	-17.236	8.3587	0.32346	0.9107:0.0:0.0893:0.0	.	47;47	B4DF64;Q68CZ6	.;HAUS3_HUMAN	G	47	ENSP00000243706:V47G;ENSP00000392903:V47G	ENSP00000243706:V47G	V	-	2	0	HAUS3	2212332	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.993000	0.70616	1.850000	0.53721	0.459000	0.35465	GTG	.	.	.	none		0.413	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357446.1	NM_024511	
TMPRSS11A	339967	hgsc.bcm.edu	37	4	68777129	68777129	+	Silent	SNP	C	C	T	rs376494815		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:68777129C>T	ENST00000334830.7	-	10	1943	c.1197G>A	c.(1195-1197)aaG>aaA	p.K399K	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Silent_p.K395K|TMPRSS11A_ENST00000396188.2_Silent_p.K396K			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	399	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CAGGCTTGTCCTTTTGACCAC	0.403																																					p.K399K	NSCLC(26;2 894 10941 14480 22546)	Atlas-SNP	.											.	TMPRSS11A	74	.	0			c.G1197A						PASS	.	C	,	0,4406		0,0,2203	181.0	170.0	174.0		1188,1197	3.8	1.0	4		174	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TMPRSS11A	NM_001114387.1,NM_182606.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	396/419,399/422	68777129	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	339967	exon10			CTTGTCCTTTTGA	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.1197G>A	chr4.hg19:g.68777129C>T		150.0	0.0	.		176.0	9.0	.	NM_182606	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Silent	SNP	ENST00000334830.7	hg19	CCDS3519.1																																																																																			.	.	.	weak		0.403	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251433.3	NM_182606	
ALPK1	80216	hgsc.bcm.edu	37	4	113333046	113333046	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:113333046G>A	ENST00000458497.1	+	5	619	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	ALPK1_ENST00000505912.1_3'UTR|ALPK1_ENST00000504176.2_Missense_Mutation_p.V36M|ALPK1_ENST00000177648.9_Missense_Mutation_p.V114M	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	114							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TGTGTTCTTGGTGGACCGGTT	0.622																																					p.V114M		Atlas-SNP	.											.	ALPK1	125	.	0			c.G340A						PASS	.						54.0	51.0	52.0					4																	113333046		2203	4300	6503	SO:0001583	missense	80216	exon5			TTCTTGGTGGACC	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.340G>A	chr4.hg19:g.113333046G>A	ENSP00000398048:p.Val114Met	40.0	0.0	.		39.0	7.0	.	NM_001102406	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	hg19	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	5.078	0.200114	0.09652	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610;ENST00000504176	T;T;T	0.24151	1.87;1.87;1.87	5.34	-1.67	0.08238	.	0.652897	0.16722	N	0.202210	T	0.05364	0.0142	N	0.00538	-1.39	0.20873	N	0.999835	B;B;B;B	0.18610	0.029;0.023;0.006;0.009	B;B;B;B	0.12837	0.008;0.008;0.005;0.004	T	0.39231	-0.9624	10	0.18276	T	0.48	0.8551	6.1882	0.20510	0.448:0.3512:0.2008:0.0	.	36;89;89;114	F5H138;Q9H623;E7EX13;Q96QP1	.;.;.;ALPK1_HUMAN	M	114;114;89;36	ENSP00000398048:V114M;ENSP00000177648:V114M;ENSP00000426044:V36M	ENSP00000177648:V114M	V	+	1	0	ALPK1	113552495	1.000000	0.71417	0.016000	0.15963	0.097000	0.18754	2.098000	0.41757	-0.525000	0.06391	-0.502000	0.04539	GTG	.	.	.	none		0.622	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
KIAA1109	84162	hgsc.bcm.edu	37	4	123128292	123128292	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr4:123128292G>C	ENST00000264501.4	+	16	1899	c.1526G>C	c.(1525-1527)aGt>aCt	p.S509T	KIAA1109_ENST00000495260.1_3'UTR|KIAA1109_ENST00000455637.1_Missense_Mutation_p.S509T|KIAA1109_ENST00000388738.3_Missense_Mutation_p.S509T			Q2LD37	K1109_HUMAN	KIAA1109	509					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCTAGTGACAGTCCTCCAGAC	0.313																																					p.S509T		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G1526C						PASS	.						117.0	112.0	114.0					4																	123128292		1798	4073	5871	SO:0001583	missense	84162	exon14			GTGACAGTCCTCC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1526G>C	chr4.hg19:g.123128292G>C	ENSP00000264501:p.Ser509Thr	300.0	0.0	.		276.0	65.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.47|11.47	1.647458|1.647458	0.29246|0.29246	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000424425|ENST00000264501;ENST00000388738;ENST00000455637	.|T;T;T	.|0.23147	.|2.51;2.51;1.92	5.67|5.67	4.81|4.81	0.61882|0.61882	.|.	.|0.580238	.|0.15339	.|N	.|0.267600	T|T	0.38983|0.38983	0.1061|0.1061	L|L	0.33485|0.33485	1.01|1.01	0.42164|0.42164	D|D	0.991613|0.991613	.|D	.|0.58268	.|0.982	.|D	.|0.67548	.|0.952	T|T	0.08848|0.08848	-1.0702|-1.0702	5|10	.|0.45353	.|T	.|0.12	.|.	13.7177|13.7177	0.62708|0.62708	0.0749:0.0:0.9251:0.0|0.0749:0.0:0.9251:0.0	.|.	.|509	.|Q2LD37	.|K1109_HUMAN	H|T	341|509	.|ENSP00000264501:S509T;ENSP00000373390:S509T;ENSP00000389925:S509T	.|ENSP00000264501:S509T	Q|S	+|+	3|2	2|0	KIAA1109|KIAA1109	123347742|123347742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.198000|3.198000	0.51035|0.51035	1.349000|1.349000	0.45751|0.45751	0.655000|0.655000	0.94253|0.94253	CAG|AGT	.	.	.	none		0.313	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
NIM1K	167359	hgsc.bcm.edu	37	5	43280172	43280172	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:43280172A>G	ENST00000512796.1	+	4	2151	c.652A>G	c.(652-654)Agc>Ggc	p.S218G	NIM1_ENST00000326035.2_Missense_Mutation_p.S218G			Q8IY84	NIM1_HUMAN		218	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)										TTTTGGATTCAGCACAGTAAG	0.433																																					p.S218G		Atlas-SNP	.											.	.	.	.	0			c.A652G						PASS	.						93.0	87.0	89.0					5																	43280172		2203	4300	6503	SO:0001583	missense	0	exon4			GGATTCAGCACAG																												ENST00000512796.1:c.652A>G	chr5.hg19:g.43280172A>G	ENSP00000420849:p.Ser218Gly	139.0	0.0	.		120.0	40.0	.	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	hg19	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.726016	0.89298	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.30448	1.53;1.53	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56819	0.2011	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56062	-0.8041	10	0.33940	T	0.23	.	15.9442	0.79782	1.0:0.0:0.0:0.0	.	218	Q8IY84	NIM1_HUMAN	G	218	ENSP00000313572:S218G;ENSP00000420849:S218G	ENSP00000313572:S218G	S	+	1	0	AC114947.1	43315929	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.166000	0.68216	0.533000	0.62120	AGC	.	.	.	none		0.433	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
BDP1	55814	hgsc.bcm.edu	37	5	70800508	70800508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:70800508C>T	ENST00000358731.4	+	16	2565	c.2302C>T	c.(2302-2304)Cag>Tag	p.Q768*	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	768					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGTCATATTACAGCCTGAGAA	0.328																																					p.Q768X		Atlas-SNP	.											.	BDP1	204	.	0			c.C2302T						PASS	.						94.0	86.0	88.0					5																	70800508		1839	4090	5929	SO:0001587	stop_gained	55814	exon16			ATATTACAGCCTG	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2302C>T	chr5.hg19:g.70800508C>T	ENSP00000351575:p.Gln768*	86.0	0.0	.		143.0	42.0	.	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	ENST00000358731.4	hg19	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	C	38	7.211890	0.98139	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000451951;ENST00000444711	.	.	.	4.86	1.8	0.24995	.	0.592434	0.16073	N	0.230909	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9453	0.29982	0.165:0.4911:0.3439:0.0	.	.	.	.	X	768;768;348;768	.	ENSP00000351575:Q768X	Q	+	1	0	BDP1	70836264	0.007000	0.16637	0.008000	0.14137	0.007000	0.05969	0.576000	0.23744	0.600000	0.29862	0.603000	0.83216	CAG	.	.	.	none		0.328	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
ECI2	10455	hgsc.bcm.edu	37	6	4128067	4128067	+	Splice_Site	SNP	T	T	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr6:4128067T>A	ENST00000380118.3	-	5	538		c.e5-2		C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000465828.1_Splice_Site|ECI2_ENST00000361538.2_Splice_Site|ECI2_ENST00000413766.2_Splice_Site|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000380125.2_Splice_Site			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2						fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						ATGATACATCTGTGTAATGGG	0.398																																					.		Atlas-SNP	.											.	ECI2	59	.	0			c.412-2A>T						PASS	.						116.0	118.0	117.0					6																	4128067		2203	4300	6503	SO:0001630	splice_region_variant	10455	exon6			TACATCTGTGTAA	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.502-2A>T	chr6.hg19:g.4128067T>A		164.0	0.0	.		194.0	53.0	.	NM_006117	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Splice_Site	SNP	ENST00000380118.3	hg19	CCDS43420.2	.	.	.	.	.	.	.	.	.	.	T	12.53	1.966691	0.34659	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6923	0.69096	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ECI2	4073066	1.000000	0.71417	0.918000	0.36340	0.109000	0.19521	6.484000	0.73621	2.148000	0.66965	0.533000	0.62120	.	.	.	.	none		0.398	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039716.4	NM_006117	Intron
SKIV2L	6499	hgsc.bcm.edu	37	6	31937328	31937328	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr6:31937328G>A	ENST00000375394.2	+	28	3690	c.3577G>A	c.(3577-3579)Gag>Aag	p.E1193K	DXO_ENST00000478221.1_5'Flank|STK19_ENST00000375333.2_5'Flank|STK19_ENST00000375331.2_5'Flank|SKIV2L_ENST00000544581.1_Missense_Mutation_p.E1000K	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	1193					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						AGGGACCCCTGAGGGCCTGGT	0.662																																					p.E1193K		Atlas-SNP	.											.	SKIV2L	97	.	0			c.G3577A						PASS	.						64.0	77.0	72.0					6																	31937328		1511	2709	4220	SO:0001583	missense	6499	exon28			ACCCCTGAGGGCC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.3577G>A	chr6.hg19:g.31937328G>A	ENSP00000364543:p.Glu1193Lys	162.0	0.0	.		160.0	41.0	.	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946649	0.92593	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.39229	1.09;1.09	5.38	5.38	0.77491	DSH, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71221	0.3314	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80353	-0.1418	10	0.87932	D	0	-26.0112	17.9328	0.89004	0.0:0.0:1.0:0.0	.	1193	Q15477	SKIV2_HUMAN	K	1193;1035;1000	ENSP00000364543:E1193K;ENSP00000442645:E1000K	ENSP00000364543:E1193K	E	+	1	0	SKIV2L	32045307	1.000000	0.71417	0.476000	0.27291	0.947000	0.59692	8.247000	0.89830	2.507000	0.84556	0.655000	0.94253	GAG	.	.	.	none		0.662	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
NYAP1	222950	hgsc.bcm.edu	37	7	100087003	100087003	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:100087003C>T	ENST00000300179.2	+	4	1818	c.1659C>T	c.(1657-1659)gcC>gcT	p.A553A	NYAP1_ENST00000423930.1_Silent_p.A553A|NYAP1_ENST00000454988.1_Silent_p.A496A	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	553					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CCTACCCAGCCACAGCAGCTG	0.682																																					p.A553A		Atlas-SNP	.											.	.	.	.	0			c.C1659T						PASS	.						16.0	19.0	18.0					7																	100087003		2157	4234	6391	SO:0001819	synonymous_variant	222950	exon4			CCCAGCCACAGCA	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.1659C>T	chr7.hg19:g.100087003C>T		43.0	0.0	.		81.0	19.0	.	NM_173564	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	hg19	CCDS5696.1																																																																																			.	.	.	none		0.682	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
CCAR2	57805	hgsc.bcm.edu	37	8	22473664	22473664	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr8:22473664C>T	ENST00000308511.4	+	14	1997	c.1748C>T	c.(1747-1749)gCc>gTc	p.A583V	CCAR2_ENST00000389279.3_Missense_Mutation_p.A583V|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000520861.1_Missense_Mutation_p.A258V			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	583					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										AAGGAAGAAGCCACCAAGGAG	0.552																																					p.A583V		Atlas-SNP	.											.	KIAA1967	72	.	0			c.C1748T						PASS	.						94.0	92.0	93.0					8																	22473664		2203	4300	6503	SO:0001583	missense	57805	exon14			AAGAAGCCACCAA	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1748C>T	chr8.hg19:g.22473664C>T	ENSP00000310670:p.Ala583Val	142.0	0.0	.		133.0	39.0	.	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	hg19	CCDS34863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.012|2.012	-0.426830|-0.426830	0.04701|0.04701	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861|ENST00000520738	T;T;T|.	0.31769|.	1.48;1.48;1.48|.	3.18|3.18	0.0872|0.0872	0.14449|0.14449	.|.	0.654422|.	0.13268|.	N|.	0.400758|.	T|T	0.14313|0.14313	0.0346|0.0346	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.24404|0.24404	-1.0161|-1.0161	10|5	0.28530|.	T|.	0.3|.	-1.6537|-1.6537	3.0601|3.0601	0.06197|0.06197	0.1906:0.4477:0.0:0.3617|0.1906:0.4477:0.0:0.3617	.|.	258;583|.	G3V119;Q8N163|.	.;K1967_HUMAN|.	V|S	583;583;258|275	ENSP00000310670:A583V;ENSP00000373930:A583V;ENSP00000429773:A258V|.	ENSP00000310670:A583V|.	A|P	+|+	2|1	0|0	KIAA1967|KIAA1967	22529609|22529609	0.001000|0.001000	0.12720|0.12720	0.050000|0.050000	0.19076|0.19076	0.319000|0.319000	0.28217|0.28217	-0.315000|-0.315000	0.08081|0.08081	-0.013000|-0.013000	0.14199|0.14199	-0.323000|-0.323000	0.08544|0.08544	GCC|CCA	.	.	.	none		0.552	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
TEX15	56154	hgsc.bcm.edu	37	8	30704070	30704070	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr8:30704070T>C	ENST00000256246.2	-	1	2538	c.2464A>G	c.(2464-2466)Att>Gtt	p.I822V	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	822					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGGGAATAAATGTCAAATCCT	0.373																																					p.I822V		Atlas-SNP	.											.	TEX15	350	.	0			c.A2464G						PASS	.						55.0	51.0	53.0					8																	30704070		2203	4298	6501	SO:0001583	missense	56154	exon1			AATAAATGTCAAA	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.2464A>G	chr8.hg19:g.30704070T>C	ENSP00000256246:p.Ile822Val	108.0	0.0	.		101.0	10.0	.	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	hg19	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	T	0.012	-1.665157	0.00765	.	.	ENSG00000133863	ENST00000256246	T	0.09911	2.93	6.03	3.73	0.42828	.	0.872782	0.10069	N	0.719942	T	0.08846	0.0219	L	0.27053	0.805	0.09310	N	1	B	0.33171	0.4	B	0.33960	0.173	T	0.19224	-1.0312	10	0.87932	D	0	.	7.3269	0.26560	0.0:0.1436:0.0:0.8564	.	822	Q9BXT5	TEX15_HUMAN	V	822	ENSP00000256246:I822V	ENSP00000256246:I822V	I	-	1	0	TEX15	30823612	0.000000	0.05858	0.032000	0.17829	0.027000	0.11550	0.328000	0.19681	2.302000	0.77476	0.533000	0.62120	ATT	.	.	.	none		0.373	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
RORB	6096	hgsc.bcm.edu	37	9	77286722	77286722	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:77286722G>A	ENST00000396204.2	+	9	1162	c.1162G>A	c.(1162-1164)Gaa>Aaa	p.E388K	RORB_ENST00000376896.3_Missense_Mutation_p.E377K			Q92753	RORB_HUMAN	RAR-related orphan receptor B	388	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E377Q(2)|p.E377*(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	CTGGCTTATAGAACCAAGGAA	0.428																																					p.E377K		Atlas-SNP	.											RORB_ENST00000376896,colon,carcinoma,-2,3	RORB	89	.	3	Substitution - Missense(2)|Substitution - Nonsense(1)	breast(2)|ovary(1)	c.G1129A						PASS	.						73.0	69.0	70.0					9																	77286722		2203	4300	6503	SO:0001583	missense	6096	exon9			CTTATAGAACCAA	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1162G>A	chr9.hg19:g.77286722G>A	ENSP00000379507:p.Glu388Lys	66.0	0.0	.		96.0	33.0	.	NM_006914	Q8WX73	Missense_Mutation	SNP	ENST00000396204.2	hg19		.	.	.	.	.	.	.	.	.	.	G	22.2	4.255074	0.80135	.	.	ENSG00000198963	ENST00000376896;ENST00000396204	D;D	0.96967	-4.19;-4.19	5.73	5.73	0.89815	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	L	0.56280	1.765	0.80722	D	1	B;B	0.27594	0.182;0.01	B;B	0.35813	0.211;0.04	D	0.93462	0.6811	10	0.52906	T	0.07	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	388;377	Q92753;Q58EY0	RORB_HUMAN;.	K	377;388	ENSP00000366093:E377K;ENSP00000379507:E388K	ENSP00000366093:E377K	E	+	1	0	RORB	76476542	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	GAA	.	.	.	none		0.428	RORB-201	KNOWN	basic	protein_coding	protein_coding			
C10orf90	118611	hgsc.bcm.edu	37	10	128193076	128193076	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr10:128193076C>G	ENST00000284694.7	-	3	813	c.693G>C	c.(691-693)gaG>gaC	p.E231D	C10orf90_ENST00000544758.1_Missense_Mutation_p.E328D|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000392694.1_Missense_Mutation_p.E184D|C10orf90_ENST00000454341.1_Missense_Mutation_p.E231D|C10orf90_ENST00000356858.3_Missense_Mutation_p.E184D	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	231					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AAAAACTGGTCTCTTTGTCGT	0.557											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E231D		Atlas-SNP	.											.	C10orf90	121	.	0			c.G693C						PASS	.						73.0	78.0	76.0					10																	128193076		2203	4300	6503	SO:0001583	missense	118611	exon3			ACTGGTCTCTTTG	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.693G>C	chr10.hg19:g.128193076C>G	ENSP00000284694:p.Glu231Asp	96.0	0.0	.	1563	98.0	24.0	.	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	hg19	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.944946	0.34283	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.28255	1.91;1.9;1.94;1.92;1.62	5.27	3.38	0.38709	.	0.457153	0.20722	N	0.086884	T	0.28863	0.0716	L	0.58101	1.795	0.09310	N	1	B;B;B;B;B	0.13594	0.001;0.001;0.008;0.001;0.001	B;B;B;B;B	0.19148	0.003;0.01;0.024;0.01;0.007	T	0.25641	-1.0126	10	0.59425	D	0.04	-3.5758	8.1384	0.31069	0.3227:0.5212:0.1561:0.0	.	328;328;184;231;231	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	D	184;231;231;328;231;184;184	ENSP00000284694:E231D;ENSP00000398786:E231D;ENSP00000444369:E328D;ENSP00000405995:E231D;ENSP00000376459:E184D	ENSP00000284694:E231D	E	-	3	2	C10orf90	128183066	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	0.565000	0.23578	0.756000	0.33013	0.655000	0.94253	GAG	.	.	.	none		0.557	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
OR52B2	255725	hgsc.bcm.edu	37	11	6190974	6190974	+	Missense_Mutation	SNP	T	T	A	rs35364339		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:6190974T>A	ENST00000530810.1	-	1	664	c.583A>T	c.(583-585)Act>Tct	p.T195S	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATGTTAACAGTGATGTCAGCA	0.478																																					p.T195S	NSCLC(5;186 261 1778 7098 14207)	Atlas-SNP	.											.	OR52B2	68	.	0			c.A583T						PASS	.						51.0	51.0	51.0					11																	6190974		2072	4218	6290	SO:0001583	missense	255725	exon1			TAACAGTGATGTC	AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.583A>T	chr11.hg19:g.6190974T>A	ENSP00000432011:p.Thr195Ser	42.0	0.0	.		43.0	11.0	.	NM_001004052	Q8NGM7	Missense_Mutation	SNP	ENST00000530810.1	hg19	CCDS53598.1	.	.	.	.	.	.	.	.	.	.	T	9.208	1.030275	0.19512	.	.	ENSG00000255307	ENST00000530810	T	0.00042	8.84	5.32	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00144	0.0004	N	0.03881	-0.34	0.09310	N	1	D	0.76494	0.999	D	0.83275	0.996	T	0.64347	-0.6429	9	0.26408	T	0.33	.	7.1804	0.25770	0.146:0.0:0.1526:0.7014	.	195	Q96RD2	O52B2_HUMAN	S	195	ENSP00000432011:T195S	ENSP00000432011:T195S	T	-	1	0	OR52B2	6147550	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	0.367000	0.20382	1.007000	0.39238	0.450000	0.29827	ACT	.	.	.	alt		0.478	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385977.1	NM_001004052	
OR4C11	219429	hgsc.bcm.edu	37	11	55371448	55371448	+	Missense_Mutation	SNP	C	C	A	rs373760102		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:55371448C>A	ENST00000302231.4	-	1	426	c.402G>T	c.(400-402)atG>atT	p.M134I		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						CCTGCTGGCTCATGATGGTTG	0.463																																					p.M134I		Atlas-SNP	.											.	OR4C11	73	.	0			c.G402T						PASS	.						88.0	72.0	78.0					11																	55371448		2177	4010	6187	SO:0001583	missense	219429	exon1			CTGGCTCATGATG	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.402G>T	chr11.hg19:g.55371448C>A	ENSP00000306651:p.Met134Ile	110.0	0.0	.		110.0	6.0	.	NM_001004700	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	hg19	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319072	0.41096	.	.	ENSG00000172188	ENST00000302231	T	0.00551	6.65	4.34	3.42	0.39159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000014	T	0.02047	0.0064	M	0.82923	2.615	0.27993	N	0.935588	D	0.69078	0.997	D	0.75020	0.985	T	0.08027	-1.0742	10	0.72032	D	0.01	.	10.4812	0.44695	0.0:0.9023:0.0:0.0977	.	134	Q6IEV9	OR4CB_HUMAN	I	134	ENSP00000306651:M134I	ENSP00000306651:M134I	M	-	3	0	OR4C11	55128024	0.991000	0.36638	0.963000	0.40424	0.237000	0.25408	2.968000	0.49224	1.187000	0.43000	0.478000	0.44815	ATG	.	.	.	alt		0.463	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
DDX47	51202	hgsc.bcm.edu	37	12	12974592	12974592	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:12974592T>C	ENST00000358007.3	+	4	396	c.374T>C	c.(373-375)gTg>gCg	p.V125A	DDX47_ENST00000352940.4_Missense_Mutation_p.V125A	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	125	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		TCTGTAGCTGTGATTGTAGGT	0.358																																					p.V125A		Atlas-SNP	.											.	DDX47	37	.	0			c.T374C						PASS	.						137.0	139.0	139.0					12																	12974592		2203	4300	6503	SO:0001583	missense	51202	exon4			TAGCTGTGATTGT	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.374T>C	chr12.hg19:g.12974592T>C	ENSP00000350698:p.Val125Ala	84.0	0.0	.		102.0	35.0	.	NM_201224	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	hg19	CCDS8655.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143646	0.77888	.	.	ENSG00000213782	ENST00000352940;ENST00000358007;ENST00000544400	T;T;T	0.15017	2.46;2.46;2.46	4.87	4.87	0.63330	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	N	0.13299	0.325	0.80722	D	1	B;B;D	0.55385	0.398;0.186;0.971	B;B;P	0.59703	0.379;0.121;0.862	T	0.05517	-1.0880	10	0.46703	T	0.11	-19.7359	14.3028	0.66364	0.0:0.0:0.0:1.0	.	125;125;125	Q9H4E3;G5E955;Q9H0S4	.;.;DDX47_HUMAN	A	125;125;62	ENSP00000319578:V125A;ENSP00000350698:V125A;ENSP00000444000:V62A	ENSP00000319578:V125A	V	+	2	0	DDX47	12865859	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	4.293000	0.59037	2.051000	0.60960	0.454000	0.30748	GTG	.	.	.	none		0.358	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
ANP32D	23519	hgsc.bcm.edu	37	12	48866684	48866684	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:48866684C>T	ENST00000266594.1	+	1	237	c.237C>T	c.(235-237)ggC>ggT	p.G79G		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	79						nuclear matrix (GO:0016363)				central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						CCTCAGTGGGCCTAGAAGTAT	0.378																																					p.G79G		Atlas-SNP	.											.	ANP32D	15	.	0			c.C237T						PASS	.						91.0	91.0	91.0					12																	48866684		2203	4300	6503	SO:0001819	synonymous_variant	23519	exon1			AGTGGGCCTAGAA	U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.237C>T	chr12.hg19:g.48866684C>T		103.0	0.0	.		112.0	38.0	.	NM_012404	Q6NTC4	Silent	SNP	ENST00000266594.1	hg19	CCDS31788.1																																																																																			.	.	.	none		0.378	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370058.1	NM_012404	
PPFIA2	8499	hgsc.bcm.edu	37	12	81839465	81839465	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr12:81839465C>A	ENST00000549396.1	-	6	600	c.440G>T	c.(439-441)cGa>cTa	p.R147L	PPFIA2_ENST00000550584.2_Missense_Mutation_p.R147L|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R147L|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R73L|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R73L|PPFIA2_ENST00000550359.2_5'UTR|RP11-315E17.1_ENST00000550272.1_RNA|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R147L|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R129L|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R129L	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	147	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)		p.R147Q(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TCTTTCATGTCGTGACACAAG	0.393																																					p.R147L		Atlas-SNP	.											PPFIA2,rectum,carcinoma,0,1	PPFIA2	207	.	1	Substitution - Missense(1)	large_intestine(1)	c.G440T						PASS	.						98.0	89.0	92.0					12																	81839465		1881	4113	5994	SO:0001583	missense	8499	exon5			TCATGTCGTGACA	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.440G>T	chr12.hg19:g.81839465C>A	ENSP00000450337:p.Arg147Leu	43.0	0.0	.		50.0	3.0	.	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	hg19	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	C	36	5.659794	0.96734	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000551442	T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.60958	0.2309	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.996;0.987	D;D	0.79108	0.992;0.953	T	0.62348	-0.6873	10	0.87932	D	0	-10.6387	20.3736	0.98901	0.0:1.0:0.0:0.0	.	47;147	B7Z4H8;O75334	.;LIPA2_HUMAN	L	147;129;73;158;129;147;73;147;129	ENSP00000450337:R147L;ENSP00000450298:R129L;ENSP00000385093:R73L;ENSP00000327416:R129L;ENSP00000449338:R147L;ENSP00000388373:R73L;ENSP00000447868:R147L;ENSP00000449469:R129L	ENSP00000327416:R129L	R	-	2	0	PPFIA2	80363596	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	CGA	.	.	.	none		0.393	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
FBXO34	55030	hgsc.bcm.edu	37	14	55818351	55818351	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:55818351C>G	ENST00000313833.4	+	2	1488	c.1243C>G	c.(1243-1245)Cct>Gct	p.P415A	FBXO34_ENST00000440021.1_Missense_Mutation_p.P415A	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	415										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CGTTGGGTTACCTTTTTCCTC	0.458																																					p.P415A		Atlas-SNP	.											.	FBXO34	61	.	0			c.C1243G						PASS	.						149.0	132.0	138.0					14																	55818351		2203	4300	6503	SO:0001583	missense	55030	exon2			GGGTTACCTTTTT	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1243C>G	chr14.hg19:g.55818351C>G	ENSP00000313159:p.Pro415Ala	238.0	0.0	.		210.0	57.0	.	NM_017943	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	hg19	CCDS32086.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.215359	0.01542	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.16897	2.31;2.31	5.48	1.31	0.21738	.	0.732971	0.11730	U	0.535077	T	0.12305	0.0299	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.33599	-0.9862	10	0.40728	T	0.16	-21.5592	0.8915	0.01255	0.1775:0.4073:0.173:0.2422	.	415	Q9NWN3	FBX34_HUMAN	A	415	ENSP00000313159:P415A;ENSP00000394117:P415A	ENSP00000313159:P415A	P	+	1	0	FBXO34	54888104	.	.	0.001000	0.08648	0.123000	0.20343	.	.	0.409000	0.25649	-0.156000	0.13503	CCT	.	.	.	none		0.458	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
DICER1	23405	hgsc.bcm.edu	37	14	95562982	95562982	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:95562982C>A	ENST00000526495.1	-	25	4566	c.4275G>T	c.(4273-4275)gaG>gaT	p.E1425D	DICER1_ENST00000527414.1_Missense_Mutation_p.E1425D|DICER1_ENST00000393063.1_Missense_Mutation_p.E1425D|DICER1_ENST00000343455.3_Missense_Mutation_p.E1425D|DICER1_ENST00000541352.1_Missense_Mutation_p.E1425D|DICER1_ENST00000556045.1_Missense_Mutation_p.E323D			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1425					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACATCAGGCTctcctcctcct	0.478			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.E1425D		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.G4275T						PASS	.						60.0	56.0	57.0					14																	95562982		2203	4300	6503	SO:0001583	missense	23405	exon24	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	CAGGCTCTCCTCC	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.4275G>T	chr14.hg19:g.95562982C>A	ENSP00000437256:p.Glu1425Asp	49.0	0.0	.		61.0	24.0	.	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	hg19	CCDS9931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.70|11.70	1.715346|1.715346	0.30413|0.30413	.|.	.|.	ENSG00000100697|ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352|ENST00000532939	T;T;T;T;D;T|.	0.87103|.	0.36;0.36;0.36;0.36;-2.21;0.67|.	5.32|5.32	1.91|1.91	0.25777|0.25777	Ribonuclease III (3);|.	0.391869|0.391869	0.24366|0.24366	N|N	0.039146|0.039146	T|.	0.38746|.	0.1052|.	L|L	0.38175|0.38175	1.15|1.15	0.39976|0.39976	D|D	0.974854|0.974854	B;B;B|.	0.13594|.	0.008;0.001;0.0|.	B;B;B|.	0.14578|.	0.009;0.011;0.004|.	T|.	0.21075|.	-1.0256|.	10|.	0.30854|.	T|.	0.27|.	-10.9506|-10.9506	0.6205|0.6205	0.00777|0.00777	0.405:0.2239:0.2011:0.17|0.405:0.2239:0.2011:0.17	.|.	323;1425;1425|.	B3KRG4;E0AD28;Q9UPY3|.	.;.;DICER_HUMAN|.	D|X	1425;1425;1425;1425;323;1425|104	ENSP00000343745:E1425D;ENSP00000437256:E1425D;ENSP00000376783:E1425D;ENSP00000435681:E1425D;ENSP00000451041:E323D;ENSP00000444719:E1425D|.	ENSP00000343745:E1425D|.	E|E	-|-	3|1	2|0	DICER1|DICER1	94632735|94632735	0.946000|0.946000	0.32159|0.32159	0.825000|0.825000	0.32803|0.32803	0.882000|0.882000	0.50991|0.50991	0.405000|0.405000	0.21015|0.21015	0.561000|0.561000	0.29186|0.29186	0.561000|0.561000	0.74099|0.74099	GAG|GAG	.	.	.	none		0.478	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
TELO2	9894	hgsc.bcm.edu	37	16	1552985	1552985	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:1552985G>T	ENST00000262319.6	+	15	2103	c.1824G>T	c.(1822-1824)caG>caT	p.Q608H	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	608					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GCCTCCGGCAGCGCATGGACA	0.622																																					p.Q608H		Atlas-SNP	.											.	TELO2	44	.	0			c.G1824T						PASS	.						143.0	133.0	137.0					16																	1552985		2199	4300	6499	SO:0001583	missense	9894	exon15			CCGGCAGCGCATG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1824G>T	chr16.hg19:g.1552985G>T	ENSP00000262319:p.Gln608His	155.0	0.0	.		166.0	19.0	.	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	hg19	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772621	0.69992	.	.	ENSG00000100726	ENST00000262319	T	0.26518	1.73	5.09	5.09	0.68999	Telomere length regulation protein, conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.49660	0.1570	M	0.76938	2.355	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.50734	-0.8793	10	0.54805	T	0.06	-37.6041	10.8668	0.46860	0.0882:0.0:0.9118:0.0	.	608	Q9Y4R8	TELO2_HUMAN	H	608	ENSP00000262319:Q608H	ENSP00000262319:Q608H	Q	+	3	2	TELO2	1492986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.437000	0.52863	2.391000	0.81399	0.462000	0.41574	CAG	.	.	.	none		0.622	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
CNOT1	23019	hgsc.bcm.edu	37	16	58580300	58580300	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:58580300T>G	ENST00000317147.5	-	29	4263	c.3931A>C	c.(3931-3933)Aat>Cat	p.N1311H	CNOT1_ENST00000569240.1_Missense_Mutation_p.N1306H|SNORA46_ENST00000384762.1_RNA|CNOT1_ENST00000441024.2_Missense_Mutation_p.N1311H|CNOT1_ENST00000245138.4_Missense_Mutation_p.N162H	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1311	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TCATCTAAATTCTTCAGGCGA	0.413																																					p.N1311H		Atlas-SNP	.											.	CNOT1	359	.	0			c.A3931C						PASS	.						142.0	128.0	133.0					16																	58580300		2198	4300	6498	SO:0001583	missense	23019	exon29			CTAAATTCTTCAG	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3931A>C	chr16.hg19:g.58580300T>G	ENSP00000320949:p.Asn1311His	131.0	0.0	.		159.0	43.0	.	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.719378	0.48728	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200;ENST00000441024	T;T	0.49432	0.81;0.78	5.39	5.39	0.77823	.	0.219192	0.53938	D	0.000042	T	0.35335	0.0928	N	0.24115	0.695	0.45541	D	0.998496	B;B;B;B	0.31351	0.0;0.32;0.0;0.003	B;B;B;B	0.34138	0.003;0.176;0.001;0.004	T	0.26258	-1.0108	10	0.48119	T	0.1	.	10.6062	0.45396	0.0:0.0753:0.0:0.9247	.	162;1311;1311;1306	B5MDN3;A5YKK6-4;A5YKK6;A5YKK6-2	.;.;CNOT1_HUMAN;.	H	1311;162;1306;1311	ENSP00000320949:N1311H;ENSP00000413113:N1311H	ENSP00000245138:N162H	N	-	1	0	CNOT1	57137801	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.289000	0.72696	2.043000	0.60533	0.528000	0.53228	AAT	.	.	.	none		0.413	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
SLC13A5	284111	hgsc.bcm.edu	37	17	6597517	6597517	+	Splice_Site	SNP	C	C	G	rs113208940		TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:6597517C>G	ENST00000433363.2	-	8	1289		c.e8-1		SLC13A5_ENST00000381074.4_Splice_Site|SLC13A5_ENST00000573648.1_Splice_Site|SLC13A5_ENST00000293800.6_Splice_Site	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5						transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						GGAGACATACCTAGGTGGGGA	0.502																																					.		Atlas-SNP	.											.	SLC13A5	57	.	0			c.1056-1G>C						PASS	.						74.0	62.0	66.0					17																	6597517		2203	4300	6503	SO:0001630	splice_region_variant	284111	exon9			ACATACCTAGGTG	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1056-1G>C	chr17.hg19:g.6597517C>G		27.0	0.0	.		66.0	17.0	.	NM_001143838	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Splice_Site	SNP	ENST00000433363.2	hg19	CCDS11079.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969840	0.34754	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5007	0.87731	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC13A5	6538241	1.000000	0.71417	0.947000	0.38551	0.090000	0.18270	6.842000	0.75379	2.815000	0.96918	0.561000	0.74099	.	.	G|1.000	.	weak		0.502	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	Intron
ALOX12	239	hgsc.bcm.edu	37	17	6899500	6899500	+	Missense_Mutation	SNP	G	G	T	rs202195274	byFrequency	TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:6899500G>T	ENST00000251535.6	+	1	117	c.64G>T	c.(64-66)Gtg>Ttg	p.V22L	RP11-589P10.5_ENST00000573222.1_lincRNA|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	22	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						GTACAACCGCGTGCAGCTTTG	0.756													G|||	3	0.000599042	0.0	0.0014	5008	,	,		9570	0.0		0.002	False		,,,				2504	0.0				p.V22L		Atlas-SNP	.											.	ALOX12	49	.	0			c.G64T						PASS	.						4.0	4.0	4.0					17																	6899500		1680	3274	4954	SO:0001583	missense	239	exon1			AACCGCGTGCAGC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.64G>T	chr17.hg19:g.6899500G>T	ENSP00000251535:p.Val22Leu	0.0	0.0	.		5.0	4.0	.	NM_000697	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	hg19	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029860	0.75504	.	.	ENSG00000108839	ENST00000251535	T	0.70282	-0.47	4.89	4.89	0.63831	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.077311	0.51477	D	0.000088	T	0.76579	0.4007	M	0.86953	2.85	0.35586	D	0.806715	B	0.27791	0.189	B	0.34385	0.181	T	0.82514	-0.0419	10	0.62326	D	0.03	-9.731	13.7403	0.62845	0.0:0.0:1.0:0.0	.	22	P18054	LOX12_HUMAN	L	22	ENSP00000251535:V22L	ENSP00000251535:V22L	V	+	1	0	ALOX12	6840224	0.936000	0.31750	1.000000	0.80357	0.994000	0.84299	1.345000	0.33953	2.709000	0.92574	0.591000	0.81541	GTG	.	.	.	weak		0.756	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
GAS7	8522	hgsc.bcm.edu	37	17	9846496	9846496	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:9846496G>A	ENST00000432992.2	-	7	833	c.673C>T	c.(673-675)Cag>Tag	p.Q225*	GAS7_ENST00000583882.1_Intron|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000542249.1_Nonsense_Mutation_p.Q161*|GAS7_ENST00000579158.1_Nonsense_Mutation_p.Q161*|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000578655.1_5'Flank|GAS7_ENST00000580865.1_Nonsense_Mutation_p.Q85*|GAS7_ENST00000585266.1_Nonsense_Mutation_p.Q165*|GAS7_ENST00000323816.4_Nonsense_Mutation_p.Q165*|GAS7_ENST00000437099.2_Nonsense_Mutation_p.Q161*	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	225	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						AGCTGTTTCTGGAGCAGTAGT	0.552			T	MLL	AML*																																p.Q225X		Atlas-SNP	.		Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	GAS7	113	.	0			c.C673T						PASS	.						182.0	164.0	170.0					17																	9846496		2203	4300	6503	SO:0001587	stop_gained	8522	exon7			GTTTCTGGAGCAG	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.673C>T	chr17.hg19:g.9846496G>A	ENSP00000407552:p.Gln225*	255.0	0.0	.		364.0	18.0	.	NM_201433	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Nonsense_Mutation	SNP	ENST00000432992.2	hg19	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	G	38	6.925348	0.97940	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	.	.	.	5.36	5.36	0.76844	.	0.081859	0.51477	D	0.000091	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.6746	18.2231	0.89907	0.0:0.0:1.0:0.0	.	.	.	.	X	225;165;164;85;165;39	.	.	Q	-	1	0	GAS7	9787221	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	8.955000	0.93058	2.676000	0.91093	0.655000	0.94253	CAG	.	.	.	none		0.552	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	
MYO1D	4642	hgsc.bcm.edu	37	17	30932193	30932193	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:30932193C>T	ENST00000318217.5	-	21	3080	c.2776G>A	c.(2776-2778)Gac>Aac	p.D926N	MYO1D_ENST00000579584.1_Missense_Mutation_p.D926N|MYO1D_ENST00000394649.4_Missense_Mutation_p.D838N	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	926	Myosin tail. {ECO:0000255}.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			ACAATGAGGTCTTTGTTGTCT	0.423																																					p.D926N		Atlas-SNP	.											.	MYO1D	93	.	0			c.G2776A						PASS	.						131.0	112.0	119.0					17																	30932193		2203	4300	6503	SO:0001583	missense	4642	exon21			TGAGGTCTTTGTT	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.2776G>A	chr17.hg19:g.30932193C>T	ENSP00000324527:p.Asp926Asn	67.0	0.0	.		108.0	19.0	.	NM_015194	A6H8V3|Q8NHP9	Missense_Mutation	SNP	ENST00000318217.5	hg19	CCDS32615.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168518	0.94768	.	.	ENSG00000176658	ENST00000318217;ENST00000394649	T	0.61158	0.13	4.88	4.88	0.63580	Myosin tail 2 (1);	0.000000	0.41294	U	0.000917	T	0.77579	0.4151	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.99;0.994	T	0.81355	-0.0970	10	0.72032	D	0.01	.	15.8776	0.79178	0.0:1.0:0.0:0.0	.	837;926	Q7Z3N6;O94832	.;MYO1D_HUMAN	N	926;118	ENSP00000324527:D926N	ENSP00000324527:D926N	D	-	1	0	MYO1D	27956306	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.421000	0.82119	0.655000	0.94253	GAC	.	.	.	none		0.423	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
UBTF	7343	hgsc.bcm.edu	37	17	42289818	42289818	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:42289818G>C	ENST00000302904.4	-	8	1157	c.665C>G	c.(664-666)aCt>aGt	p.T222S	UBTF_ENST00000527034.1_Intron|UBTF_ENST00000526094.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000343638.5_Intron|UBTF_ENST00000533177.1_Intron|UBTF_ENST00000393606.3_Intron|UBTF_ENST00000436088.1_Missense_Mutation_p.T222S|UBTF_ENST00000529383.1_Missense_Mutation_p.T222S|UBTF_ENST00000537550.1_5'Flank			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	222					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CTCCTTCGTAGTGGCCTGCAA	0.637																																					p.T222S		Atlas-SNP	.											.	UBTF	65	.	0			c.C665G						PASS	.						78.0	73.0	75.0					17																	42289818		2203	4300	6503	SO:0001583	missense	7343	exon8			TTCGTAGTGGCCT	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.665C>G	chr17.hg19:g.42289818G>C	ENSP00000302640:p.Thr222Ser	136.0	0.0	.		179.0	44.0	.	NM_014233	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	hg19	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	g	2.112	-0.403562	0.04832	.	.	ENSG00000108312	ENST00000302904;ENST00000436088;ENST00000529383	D;D;D	0.97791	-4.54;-4.54;-4.54	4.9	3.89	0.44902	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.171589	0.50627	N	0.000119	D	0.89853	0.6835	N	0.03050	-0.425	0.33275	D	0.561518	B	0.12630	0.006	B	0.23716	0.048	D	0.84792	0.0779	10	0.02654	T	1	-4.647	10.1054	0.42530	0.0:0.1493:0.696:0.1547	.	222	P17480	UBF1_HUMAN	S	222	ENSP00000302640:T222S;ENSP00000390669:T222S;ENSP00000435708:T222S	ENSP00000302640:T222S	T	-	2	0	UBTF	39645344	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.273000	0.65564	1.135000	0.42183	0.442000	0.29010	ACT	.	.	.	none		0.637	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
MRPL10	124995	hgsc.bcm.edu	37	17	45901623	45901623	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr17:45901623G>A	ENST00000351111.2	-	5	739	c.734C>T	c.(733-735)tCt>tTt	p.S245F	OSBPL7_ENST00000392507.3_5'Flank|MRPL10_ENST00000414011.1_Missense_Mutation_p.S255F|MRPL10_ENST00000290208.7_Missense_Mutation_p.S255F|OSBPL7_ENST00000007414.3_5'Flank	NM_145255.3	NP_660298.2	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10	245					ribosome biogenesis (GO:0042254)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|large_intestine(1)|lung(3)|ovary(1)	8						CGACATGACAGAATCCTTCTC	0.577																																					p.S255F		Atlas-SNP	.											.	MRPL10	24	.	0			c.C764T						PASS	.						119.0	104.0	109.0					17																	45901623		2203	4300	6503	SO:0001583	missense	124995	exon6			ATGACAGAATCCT	AB051618	CCDS11516.1, CCDS11517.1	17q21.3	2012-09-13			ENSG00000159111	ENSG00000159111		"""Mitochondrial ribosomal proteins / large subunits"""	14055	protein-coding gene	gene with protein product	"""39S ribosomal protein L10, mitochondrial"""	611825				11551941	Standard	NM_148887		Approved	RPML8, MRP-L8, L10MT, MRP-L10, MRPL8, MGC17973	uc002ily.3	Q7Z7H8	OTTHUMG00000156302	ENST00000351111.2:c.734C>T	chr17.hg19:g.45901623G>A	ENSP00000324100:p.Ser245Phe	110.0	0.0	.		179.0	87.0	.	NM_148887	A6NGJ4|Q96B80|Q96Q55	Missense_Mutation	SNP	ENST00000351111.2	hg19	CCDS11516.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.809636	0.50421	.	.	ENSG00000159111	ENST00000351111;ENST00000290208;ENST00000414011	T;T;T	0.50813	0.73;1.76;1.76	4.76	2.49	0.30216	.	1.038680	0.07593	N	0.922261	T	0.57286	0.2043	L	0.59436	1.845	0.09310	N	1	P;D	0.56521	0.8;0.976	B;P	0.51016	0.347;0.656	T	0.53034	-0.8495	10	0.72032	D	0.01	-2.0384	13.9408	0.64054	0.0:0.3197:0.6803:0.0	.	245;255	Q7Z7H8;A6NGJ4	RM10_HUMAN;.	F	245;255;255	ENSP00000324100:S245F;ENSP00000290208:S255F;ENSP00000395870:S255F	ENSP00000290208:S255F	S	-	2	0	MRPL10	43256622	0.009000	0.17119	0.001000	0.08648	0.056000	0.15407	1.692000	0.37731	0.954000	0.37851	0.491000	0.48974	TCT	.	.	.	none		0.577	MRPL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343764.1	NM_145255	
SHC2	25759	hgsc.bcm.edu	37	19	422226	422226	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:422226T>C	ENST00000264554.6	-	11	1539	c.1540A>G	c.(1540-1542)Acc>Gcc	p.T514A		NM_012435.2	NP_036567.2	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing) transforming protein 2	514	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPK activity (GO:0000187)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)	cytosol (GO:0005829)				endometrium(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGGGTTGGTGACGCTGTCT	0.677																																					p.T514A		Atlas-SNP	.											.	SHC2	47	.	0			c.A1540G						PASS	.						23.0	28.0	27.0					19																	422226		2196	4298	6494	SO:0001583	missense	25759	exon11			GGTTGGTGACGCT	AB001451	CCDS45891.1	19p13.3	2013-02-14				ENSG00000129946		"""SH2 domain containing"""	29869	protein-coding gene	gene with protein product	"""neuronal Shc adaptor homolog"""	605217				7527937, 9507002	Standard	NM_012435		Approved	SLI, SCK, SHCB	uc002loq.4	P98077		ENST00000264554.6:c.1540A>G	chr19.hg19:g.422226T>C	ENSP00000264554:p.Thr514Ala	16.0	0.0	.		31.0	9.0	.	NM_012435	O60230|Q9NPL5|Q9UCX4	Missense_Mutation	SNP	ENST00000264554.6	hg19	CCDS45891.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.738320	0.69304	.	.	ENSG00000129946	ENST00000264554	T	0.65178	-0.14	4.76	4.76	0.60689	SH2 motif (5);	0.000000	0.85682	D	0.000000	T	0.67401	0.2889	M	0.65975	2.015	0.54753	D	0.999983	P	0.36495	0.556	P	0.44561	0.453	T	0.71563	-0.4555	10	0.62326	D	0.03	-60.9323	13.7837	0.63097	0.0:0.0:0.0:1.0	.	514	P98077	SHC2_HUMAN	A	514	ENSP00000264554:T514A	ENSP00000264554:T514A	T	-	1	0	SHC2	373226	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	7.409000	0.80053	2.084000	0.62774	0.533000	0.62120	ACC	.	.	.	none		0.677	SHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451840.3		
MUC16	94025	hgsc.bcm.edu	37	19	9046479	9046479	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:9046479C>G	ENST00000397910.4	-	5	35355	c.35152G>C	c.(35152-35154)Gta>Cta	p.V11718L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11720	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGCCATTACAGGTGTGGCA	0.502																																					p.V11718L		Atlas-SNP	.											.	MUC16	4315	.	0			c.G35152C						PASS	.						125.0	120.0	121.0					19																	9046479		1975	4155	6130	SO:0001583	missense	94025	exon5			CCATTACAGGTGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35152G>C	chr19.hg19:g.9046479C>G	ENSP00000381008:p.Val11718Leu	115.0	0.0	.		158.0	44.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	6.049	0.377322	0.11466	.	.	ENSG00000181143	ENST00000397910	T	0.01998	4.51	3.09	-1.82	0.07857	.	.	.	.	.	T	0.00845	0.0028	N	0.01352	-0.895	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.47032	-0.9148	8	0.87932	D	0	.	1.1809	0.01845	0.2598:0.1629:0.1061:0.4712	.	11718	B5ME49	.	L	11718	ENSP00000381008:V11718L	ENSP00000381008:V11718L	V	-	1	0	MUC16	8907479	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.203000	0.09438	-0.527000	0.06374	-0.373000	0.07131	GTA	.	.	.	none		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9085838	9085838	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:9085838C>A	ENST00000397910.4	-	1	6180	c.5977G>T	c.(5977-5979)Gaa>Taa	p.E1993*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1993	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAAACTTTTTCTGAAGAAACT	0.473																																					p.E1993X		Atlas-SNP	.											.	MUC16	4315	.	0			c.G5977T						PASS	.						139.0	135.0	136.0					19																	9085838		1983	4158	6141	SO:0001587	stop_gained	94025	exon1			CTTTTTCTGAAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5977G>T	chr19.hg19:g.9085838C>A	ENSP00000381008:p.Glu1993*	93.0	0.0	.		126.0	9.0	.	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	46	12.553061	0.99677	.	.	ENSG00000181143	ENST00000397910	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	1993	.	ENSP00000381008:E1993X	E	-	1	0	MUC16	8946838	0.001000	0.12720	0.291000	0.24904	0.292000	0.27327	0.223000	0.17719	0.308000	0.22923	0.313000	0.20887	GAA	.	.	.	none		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF544	27300	hgsc.bcm.edu	37	19	58774085	58774085	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:58774085G>A	ENST00000596652.1	+	6	2347	c.2113G>A	c.(2113-2115)Gtg>Atg	p.V705M	ZNF544_ENST00000596929.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000600220.1_Missense_Mutation_p.V677M|ZNF544_ENST00000269829.4_Missense_Mutation_p.V705M|ZNF544_ENST00000599953.1_Missense_Mutation_p.V563M|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000415203.2_Missense_Mutation_p.V677M|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000600044.1_Missense_Mutation_p.V677M|CTD-3138B18.5_ENST00000597230.1_RNA			Q6NX49	ZN544_HUMAN	zinc finger protein 544	705					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TCAACTTGTAGTGCATCGGCG	0.488																																					p.V705M		Atlas-SNP	.											.	ZNF544	57	.	0			c.G2113A						PASS	.						143.0	146.0	145.0					19																	58774085		2203	4300	6503	SO:0001583	missense	27300	exon7			CTTGTAGTGCATC	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.2113G>A	chr19.hg19:g.58774085G>A	ENSP00000469635:p.Val705Met	282.0	0.0	.		327.0	85.0	.	NM_014480	A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	hg19	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	G	7.249	0.602782	0.13939	.	.	ENSG00000198131	ENST00000269829;ENST00000415203;ENST00000441758	T;T	0.36340	1.26;1.26	3.46	-0.182	0.13287	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24661	0.0598	L	0.49126	1.545	0.09310	N	1	B;B;P	0.39480	0.061;0.235;0.675	B;B;B	0.32677	0.018;0.019;0.15	T	0.12734	-1.0536	9	0.48119	T	0.1	.	4.3215	0.11020	0.411:0.1657:0.4233:0.0	.	677;677;705	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	M	705;677;257	ENSP00000269829:V705M;ENSP00000394341:V677M	ENSP00000269829:V705M	V	+	1	0	ZNF544	63465897	0.000000	0.05858	0.000000	0.03702	0.507000	0.33981	-0.746000	0.04829	-0.024000	0.13941	0.563000	0.77884	GTG	.	.	.	none		0.488	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480	
JAG1	182	hgsc.bcm.edu	37	20	10625851	10625851	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr20:10625851C>T	ENST00000254958.5	-	17	2682	c.2167G>A	c.(2167-2169)Gag>Aag	p.E723K	JAG1_ENST00000423891.2_Missense_Mutation_p.E564K|JAG1_ENST00000488480.1_RNA	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	723	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.E723fs*6(1)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GCATCCCCCTCATCATAGCAG	0.547									Alagille Syndrome																												p.E723K		Atlas-SNP	.											.	JAG1	213	.	1	Insertion - Frameshift(1)	lung(1)	c.G2167A						PASS	.						122.0	99.0	107.0					20																	10625851		2203	4300	6503	SO:0001583	missense	182	exon17	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CCCCCTCATCATA	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2167G>A	chr20.hg19:g.10625851C>T	ENSP00000254958:p.Glu723Lys	119.0	0.0	.		142.0	43.0	.	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	hg19	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.224010	0.39300	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.85629	-2.01;-2.01	5.85	5.85	0.93711	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	N	0.12569	0.235	0.58432	D	0.999995	B	0.02656	0.0	B	0.06405	0.002	T	0.68777	-0.5319	10	0.10377	T	0.69	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	723	P78504	JAG1_HUMAN	K	723;564	ENSP00000254958:E723K;ENSP00000389519:E564K	ENSP00000254958:E723K	E	-	1	0	JAG1	10573851	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	4.891000	0.63185	2.767000	0.95098	0.655000	0.94253	GAG	.	.	.	none		0.547	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
SON	6651	hgsc.bcm.edu	37	21	34918555	34918555	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:34918555T>G	ENST00000356577.4	+	2	589	c.114T>G	c.(112-114)aaT>aaG	p.N38K	SON_ENST00000300278.4_Missense_Mutation_p.N38K|SON_ENST00000381692.2_Missense_Mutation_p.N38K|SON_ENST00000381679.4_Missense_Mutation_p.N38K|SON_ENST00000290239.6_Missense_Mutation_p.N38K	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	38					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GTGAAACAAATACACCCATTG	0.393																																					p.N38K		Atlas-SNP	.											.	SON	343	.	0			c.T114G						PASS	.						75.0	76.0	76.0					21																	34918555		2203	4300	6503	SO:0001583	missense	6651	exon2			AACAAATACACCC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.114T>G	chr21.hg19:g.34918555T>G	ENSP00000348984:p.Asn38Lys	73.0	0.0	.		65.0	23.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678619	0.68042	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000381692;ENST00000300278;ENST00000381679	T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45	5.68	-2.68	0.06041	.	0.232218	0.30244	N	0.010080	T	0.15003	0.0362	L	0.27053	0.805	0.22639	N	0.998909	B;D;D;D	0.58970	0.003;0.984;0.967;0.967	B;P;P;P	0.50860	0.001;0.449;0.652;0.652	T	0.20571	-1.0271	10	0.66056	D	0.02	.	10.9891	0.47539	0.0:0.578:0.0:0.422	.	38;38;38;38	Q6ZRV7;P18583;P18583-3;P18583-6	.;SON_HUMAN;.;.	K	38	ENSP00000348984:N38K;ENSP00000290239:N38K;ENSP00000371111:N38K;ENSP00000300278:N38K;ENSP00000371095:N38K	ENSP00000290239:N38K	N	+	3	2	SON	33840425	0.995000	0.38212	0.896000	0.35187	0.659000	0.38960	0.152000	0.16302	-0.281000	0.09141	-0.359000	0.07587	AAT	.	.	.	none		0.393	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SON	6651	hgsc.bcm.edu	37	21	34922861	34922861	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:34922861T>G	ENST00000356577.4	+	3	1799	c.1324T>G	c.(1324-1326)Tct>Gct	p.S442A	SON_ENST00000300278.4_Missense_Mutation_p.S442A|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.S442A|SON_ENST00000290239.6_Missense_Mutation_p.S442A	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	442					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCCAGGGCCCTCTGTGACACC	0.632																																					p.S442A		Atlas-SNP	.											.	SON	343	.	0			c.T1324G						PASS	.						34.0	37.0	36.0					21																	34922861		2202	4299	6501	SO:0001583	missense	6651	exon3			GGGCCCTCTGTGA	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1324T>G	chr21.hg19:g.34922861T>G	ENSP00000348984:p.Ser442Ala	88.0	0.0	.		87.0	23.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937742	0.52972	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14893	2.65;2.66;2.66;2.47	4.92	1.26	0.21427	.	0.404453	0.21839	N	0.068355	T	0.13713	0.0332	N	0.19112	0.55	0.24219	N	0.995448	P;P;P	0.47962	0.844;0.903;0.903	B;P;P	0.50270	0.432;0.636;0.636	T	0.09975	-1.0650	10	0.38643	T	0.18	.	6.7013	0.23227	0.0:0.3711:0.0:0.6289	.	442;442;442	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	A	442	ENSP00000348984:S442A;ENSP00000290239:S442A;ENSP00000300278:S442A;ENSP00000371095:S442A	ENSP00000290239:S442A	S	+	1	0	SON	33844731	.	.	1.000000	0.80357	0.966000	0.64601	.	.	0.427000	0.26145	0.402000	0.26972	TCT	.	.	.	none		0.632	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
UBE2L3	7332	hgsc.bcm.edu	37	22	21975858	21975858	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr22:21975858G>C	ENST00000342192.4	+	4	563	c.365G>C	c.(364-366)cGg>cCg	p.R122P	UBE2L3_ENST00000545681.1_Missense_Mutation_p.R90P|UBE2L3_ENST00000458578.2_Missense_Mutation_p.R180P	NM_003347.3	NP_003338.1	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	122					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein K11-linked ubiquitination (GO:0070979)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)|ubiquitin-protein transferase activity (GO:0004842)		UBE2L3/KRAS(2)	large_intestine(4)	4	Colorectal(54;0.105)					CACCCGCTTCGGGCTGACCTA	0.478																																					p.R180P		Atlas-SNP	.											.	UBE2L3	11	.	0			c.G539C						PASS	.						34.0	34.0	34.0					22																	21975858		2203	4300	6503	SO:0001583	missense	7332	exon4			CGCTTCGGGCTGA	AJ000519	CCDS13790.1, CCDS58795.1, CCDS58796.1	22q11.2	2007-02-05			ENSG00000185651	ENSG00000185651		"""Ubiquitin-conjugating enzymes E2"""	12488	protein-coding gene	gene with protein product		603721				8672131, 9693040	Standard	NM_001256356		Approved	UBCH7	uc031rxe.1	P68036	OTTHUMG00000150823	ENST00000342192.4:c.365G>C	chr22.hg19:g.21975858G>C	ENSP00000344259:p.Arg122Pro	64.0	0.0	.		62.0	20.0	.	NM_001256355	B2R4A7|B4DDG1|B4DSZ4|E7EWS7|P51966|P70653|Q9HAV1	Missense_Mutation	SNP	ENST00000342192.4	hg19	CCDS13790.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.485144	0.84854	.	.	ENSG00000185651	ENST00000458578;ENST00000342192;ENST00000545681	T;T;T	0.71934	-0.61;-0.61;1.16	5.66	5.66	0.87406	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.070661	0.53938	D	0.000050	D	0.87103	0.6094	M	0.90814	3.15	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75484	0.986;0.977	D	0.89031	0.3442	10	0.66056	D	0.02	.	17.2403	0.87011	0.0:0.0:1.0:0.0	.	90;122	B4DDG1;P68036	.;UB2L3_HUMAN	P	180;122;90	ENSP00000400906:R180P;ENSP00000344259:R122P;ENSP00000445931:R90P	ENSP00000344259:R122P	R	+	2	0	UBE2L3	20305858	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.848000	0.99507	2.680000	0.91292	0.561000	0.74099	CGG	.	.	.	none		0.478	UBE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320219.1	NM_198157	
UTP14A	10813	hgsc.bcm.edu	37	X	129045744	129045744	+	Silent	SNP	C	C	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chrX:129045744C>T	ENST00000394422.3	+	6	412	c.384C>T	c.(382-384)atC>atT	p.I128I	UTP14A_ENST00000425117.2_Intron|UTP14A_ENST00000371042.3_5'Flank|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371051.5_Silent_p.I74I	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	128					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						TGCTTCAGATCCACAGAGAAG	0.473																																					p.I128I		Atlas-SNP	.											.	UTP14A	74	.	0			c.C384T						PASS	.						139.0	133.0	135.0					X																	129045744		2203	4300	6503	SO:0001819	synonymous_variant	10813	exon6			TCAGATCCACAGA	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.384C>T	chrX.hg19:g.129045744C>T		138.0	0.0	.		180.0	109.0	.	NM_006649	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Silent	SNP	ENST00000394422.3	hg19	CCDS14615.1																																																																																			.	.	.	none		0.473	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
SVEP1	79987	hgsc.bcm.edu	37	9	113265327	113265327	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr9:113265327delG	ENST00000401783.2	-	6	1810	c.1474delC	c.(1474-1476)cggfs	p.R492fs	SVEP1_ENST00000302728.8_Frame_Shift_Del_p.R492fs|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Frame_Shift_Del_p.R469fs|SVEP1_ENST00000374461.1_Frame_Shift_Del_p.R469fs	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	492	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCCACACACCGGGGTTCTGGC	0.443																																					p.R492fs		Atlas-INDEL	.											.	SVEP1	326	.	0			c.1475delG						PASS	.						133.0	135.0	134.0					9																	113265327		1926	4129	6055	SO:0001589	frameshift_variant	79987	exon6			.	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1474delC	chr9.hg19:g.113265327delG	ENSP00000384917:p.Arg492fs	90.0	0.0	0		110.0	29.0	0.263636	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Frame_Shift_Del	DEL	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.	.	none		0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CHD8	57680	hgsc.bcm.edu	37	14	21862522	21862522	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr14:21862522delT	ENST00000557364.1	-	31	5776	c.5513delA	c.(5512-5514)aagfs	p.K1838fs	CHD8_ENST00000430710.3_Frame_Shift_Del_p.K1559fs|CHD8_ENST00000399982.2_Frame_Shift_Del_p.K1838fs|SNORD8_ENST00000363915.1_RNA|CHD8_ENST00000555962.1_5'Flank|SNORD9_ENST00000362566.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1838					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		TTCATCTGTCTTTTTGTCTAG	0.498																																					p.K1838fs		Atlas-INDEL	.											.	CHD8	339	.	0			c.5514delG						PASS	.						76.0	78.0	77.0					14																	21862522		2011	4188	6199	SO:0001589	frameshift_variant	57680	exon30			.	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5513delA	chr14.hg19:g.21862522delT	ENSP00000451601:p.Lys1838fs	80.0	0.0	0		83.0	24.0	0.289157	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Frame_Shift_Del	DEL	ENST00000557364.1	hg19	CCDS53885.1																																																																																			.	.	.	none		0.498	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
CADPS2	93664	hgsc.bcm.edu	37	7	122130209	122130210	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:122130209_122130210insA	ENST00000449022.2	-	11	1796_1797	c.1777_1778insT	c.(1777-1779)tatfs	p.Y593fs	CADPS2_ENST00000476131.1_5'Flank|CADPS2_ENST00000412584.2_Frame_Shift_Ins_p.Y593fs|CADPS2_ENST00000313070.7_Frame_Shift_Ins_p.Y593fs|CADPS2_ENST00000334010.7_Frame_Shift_Ins_p.Y593fs	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	593					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						AACTGGTTTATATGATTGACCT	0.376																																					p.Y593fs		Atlas-INDEL	.											.	CADPS2	116	.	0			c.1778_1779insT						PASS	.																																			SO:0001589	frameshift_variant	93664	exon11			.		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1778dupT	chr7.hg19:g.122130210_122130210dupA	ENSP00000398481:p.Tyr593fs	120.0	0.0	0		145.0	39.0	0.268966	NM_001009571	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Frame_Shift_Ins	INS	ENST00000449022.2	hg19	CCDS55158.1																																																																																			.	.	.	none		0.376	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
RCAN3	11123	hgsc.bcm.edu	37	1	24840967	24840967	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr1:24840967delT	ENST00000374395.4	+	2	418	c.105delT	c.(103-105)gatfs	p.D35fs	RCAN3_ENST00000436717.2_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000538532.1_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000374393.2_Frame_Shift_Del_p.D35fs|RCAN3_ENST00000412742.2_Frame_Shift_Del_p.D35fs	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	35					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		ATGAAGATGATTTGGATGAGA	0.433																																					p.D35fs		Atlas-INDEL	.											.	RCAN3	22	.	0			c.104delA						PASS	.						206.0	186.0	193.0					1																	24840967		2203	4300	6503	SO:0001589	frameshift_variant	11123	exon1			.		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.105delT	chr1.hg19:g.24840967delT	ENSP00000363516:p.Asp35fs	93.0	0.0	0		101.0	21.0	0.207921	NM_001251980	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Frame_Shift_Del	DEL	ENST00000374395.4	hg19	CCDS254.1																																																																																			.	.	.	none		0.433	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		
ATXN3L	92552	hgsc.bcm.edu	37	X	13337247	13337248	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chrX:13337247_13337248delTG	ENST00000380622.2	-	1	1270_1271	c.806_807delCA	c.(805-807)acafs	p.T269fs	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	269					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TTACACATGATGTCTTTGGAAG	0.426																																					p.269_270del		Atlas-INDEL	.											.	ATXN3L	64	.	0			c.807_808del						PASS	.																																			SO:0001589	frameshift_variant	92552	exon1			.		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.806_807delCA	chrX.hg19:g.13337247_13337248delTG	ENSP00000369996:p.Thr269fs	338.0	0.0	0		360.0	205.0	0.569444	NM_001135995	B2RNY8	Frame_Shift_Del	DEL	ENST00000380622.2	hg19	CCDS48080.1																																																																																			.	.	.	none		0.426	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
NFATC3	4775	hgsc.bcm.edu	37	16	68200904	68200904	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr16:68200904delT	ENST00000346183.3	+	5	1784	c.1760delT	c.(1759-1761)atafs	p.I587fs	NFATC3_ENST00000575270.1_Frame_Shift_Del_p.I587fs|NFATC3_ENST00000329524.4_Frame_Shift_Del_p.I587fs|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000349223.5_Frame_Shift_Del_p.I587fs	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	587	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ATAGCCTCTATACCCGTTGAG	0.383																																					p.I587fs		Atlas-INDEL	.											.	NFATC3	190	.	0			c.1759delA						PASS	.						223.0	215.0	218.0					16																	68200904		2198	4300	6498	SO:0001589	frameshift_variant	4775	exon5			.	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.1760delT	chr16.hg19:g.68200904delT	ENSP00000300659:p.Ile587fs	152.0	0.0	0		163.0	10.0	0.0613497	NM_173165	O75211|Q14516|Q99840|Q99841|Q99842	Frame_Shift_Del	DEL	ENST00000346183.3	hg19	CCDS10860.1																																																																																			.	.	.	none		0.383	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268890.2	NM_004555	
MAML1	9794	hgsc.bcm.edu	37	5	179192969	179192987	+	Frame_Shift_Del	DEL	GGGTCTGCAGGGCAGACCT	GGGTCTGCAGGGCAGACCT	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	GGGTCTGCAGGGCAGACCT	GGGTCTGCAGGGCAGACCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:179192969_179192987delGGGTCTGCAGGGCAGACCT	ENST00000292599.3	+	2	1221_1239	c.958_976delGGGTCTGCAGGGCAGACCT	c.(958-978)gggtctgcagggcagacctttfs	p.GSAGQTF320fs	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGAGGGCCGGGTCTGCAGGGCAGACCTTTCTGGGGCC	0.571																																					p.319_325del		Atlas-INDEL	.											.	MAML1	118	.	0			c.957_975del						PASS	.																																			SO:0001589	frameshift_variant	9794	exon2			.	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.958_976delGGGTCTGCAGGGCAGACCT	chr5.hg19:g.179192969_179192987delGGGTCTGCAGGGCAGACCT	ENSP00000292599:p.Gly320fs	94.0	0.0	0		89.0	19.0	0.213483	NM_014757		Frame_Shift_Del	DEL	ENST00000292599.3	hg19	CCDS34315.1																																																																																			.	.	.	none		0.571	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
POM121	9883	hgsc.bcm.edu	37	7	72412459	72412459	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr7:72412459delG	ENST00000434423.2	+	11	1927	c.1927delG	c.(1927-1929)gggfs	p.G643fs	POM121_ENST00000446813.1_Frame_Shift_Del_p.G378fs|POM121_ENST00000257622.4_Frame_Shift_Del_p.G378fs|POM121_ENST00000358357.3_Frame_Shift_Del_p.G378fs|POM121_ENST00000395270.1_Frame_Shift_Del_p.G378fs			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	643	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ATCACAGTCAGGGCCGCCAGG	0.597																																					p.S377fs		Atlas-INDEL	.											.	POM121	131	.	0			c.1131delA						PASS	.						1.0	2.0	2.0					7																	72412459		806	2133	2939	SO:0001589	frameshift_variant	9883	exon11			.	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1927delG	chr7.hg19:g.72412459delG	ENSP00000405562:p.Gly643fs	112.0	0.0	0		177.0	11.0	0.0621469	NM_172020	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Frame_Shift_Del	DEL	ENST00000434423.2	hg19																																																																																				.	.	.	none		0.597	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
CEP250	11190	hgsc.bcm.edu	37	20	34064377	34064378	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr20:34064377_34064378insT	ENST00000397527.1	+	16	2540_2541	c.1820_1821insT	c.(1819-1824)gctttgfs	p.L608fs	RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Frame_Shift_Ins_p.L608fs	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	608	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			TTAAATGAGGCTTTGGCGTTAG	0.515																																					p.A607fs		Atlas-INDEL	.											.	CEP250	141	.	0			c.1820_1821insT						PASS	.																																			SO:0001589	frameshift_variant	11190	exon16			.	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.1823dupT	chr20.hg19:g.34064380_34064380dupT	ENSP00000380661:p.Leu608fs	68.0	0.0	0		74.0	23.0	0.310811	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Frame_Shift_Ins	INS	ENST00000397527.1	hg19	CCDS13255.1																																																																																			.	.	.	none		0.515	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
MTCH2	23788	hgsc.bcm.edu	37	11	47653227	47653227	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr11:47653227delG	ENST00000302503.3	-	6	563	c.406delC	c.(406-408)ctcfs	p.L136fs	MTCH2_ENST00000534074.1_5'Flank|MTCH2_ENST00000542981.1_Intron	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	136					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						TGTGTGATGAGGGTAGCAGCA	0.433																																					p.L136fs		Atlas-INDEL	.											.	MTCH2	25	.	0			c.407delT						PASS	.						170.0	137.0	148.0					11																	47653227		2201	4298	6499	SO:0001589	frameshift_variant	23788	exon6			.	AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.406delC	chr11.hg19:g.47653227delG	ENSP00000303222:p.Leu136fs	68.0	0.0	0		66.0	23.0	0.348485	NM_014342	B2R7L8	Frame_Shift_Del	DEL	ENST00000302503.3	hg19	CCDS7943.1																																																																																			.	.	.	none		0.433	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391921.2	NM_014342	
ZNF225	7768	hgsc.bcm.edu	37	19	44636328	44636328	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:44636328delT	ENST00000262894.6	+	5	1841	c.1561delT	c.(1561-1563)tttfs	p.F521fs	ZNF225_ENST00000590612.1_Frame_Shift_Del_p.F521fs|ZNF225_ENST00000592780.1_3'UTR	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				TGGGAAAAGATTTACTCAGAA	0.388																																					p.R520fs		Atlas-INDEL	.											.	ZNF225	41	.	0			c.1560delA						PASS	.						83.0	92.0	89.0					19																	44636328		2200	4296	6496	SO:0001589	frameshift_variant	7768	exon5			.	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1561delT	chr19.hg19:g.44636328delT	ENSP00000262894:p.Phe521fs	120.0	0.0	0		127.0	12.0	0.0944882	NM_013362	A8K8S2|Q53F12|Q9NS46|Q9UID8	Frame_Shift_Del	DEL	ENST00000262894.6	hg19	CCDS46100.1																																																																																			.	.	.	none		0.388	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460581.1		
GPR155	151556	hgsc.bcm.edu	37	2	175346653	175346657	+	Frame_Shift_Del	DEL	GTTAA	GTTAA	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	GTTAA	GTTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr2:175346653_175346657delGTTAA	ENST00000392552.2	-	2	266_270	c.28_32delTTAAC	c.(28-33)ttaaccfs	p.LT10fs	GPR155_ENST00000295500.4_Frame_Shift_Del_p.LT10fs|GPR155_ENST00000392551.2_Frame_Shift_Del_p.LT10fs	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	10					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GACTGCAATGGTTAAGTTCTCTGCA	0.4																																					p.10_11del		Atlas-INDEL	.											.	GPR155	76	.	0			c.29_33del						PASS	.																																			SO:0001589	frameshift_variant	151556	exon2			.	AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.28_32delTTAAC	chr2.hg19:g.175346653_175346657delGTTAA	ENSP00000376335:p.Leu10fs	161.0	0.0	0		162.0	45.0	0.277778	NM_001267051	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Frame_Shift_Del	DEL	ENST00000392552.2	hg19	CCDS2259.1																																																																																			.	.	.	none		0.400	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255455.1	NM_152529	
PRMT2	3275	hgsc.bcm.edu	37	21	48056904	48056905	+	Splice_Site	INS	-	-	AA			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr21:48056904_48056905insAA	ENST00000397637.1	+	2	993		c.e2+2		PRMT2_ENST00000397628.1_Splice_Site|PRMT2_ENST00000451211.2_Splice_Site|PRMT2_ENST00000355680.3_Splice_Site|PRMT2_ENST00000334494.4_Splice_Site|PRMT2_ENST00000458387.2_Splice_Site|PRMT2_ENST00000291705.6_Splice_Site|PRMT2_ENST00000440086.1_Splice_Site|PRMT2_ENST00000397638.2_Splice_Site			P55345	ANM2_HUMAN	protein arginine methyltransferase 2						developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		GAATCGCAGGTAATTTCCGTTC	0.421																																					.		Atlas-INDEL	.											.	PRMT2	48	.	0			c.39+2->AA						PASS	.																																			SO:0001630	splice_region_variant	3275	exon2			.	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.39+2->AA	chr21.hg19:g.48056905_48056906dupAA		38.0	0.0	0		55.0	12.0	0.218182	NM_001535	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Splice_Site	INS	ENST00000397637.1	hg19	CCDS13737.1																																																																																			.	.	.	none		0.421	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207401.1	NM_001535	Intron
LRRC8E	80131	hgsc.bcm.edu	37	19	7960603	7960603	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr19:7960603delG	ENST00000306708.6	+	2	216	c.115delG	c.(115-117)gggfs	p.G39fs		NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	39					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						GCTCATGATTGGGGTCTTTGG	0.627																																					p.I38fs		Atlas-INDEL	.											.	LRRC8E	67	.	0			c.114delT						PASS	.						120.0	90.0	100.0					19																	7960603		2203	4300	6503	SO:0001589	frameshift_variant	80131	exon3			.		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.115delG	chr19.hg19:g.7960603delG	ENSP00000306524:p.Gly39fs	68.0	0.0	0		68.0	17.0	0.25	NM_001268284	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Frame_Shift_Del	DEL	ENST00000306708.6	hg19	CCDS12189.1																																																																																			.	.	.	none		0.627	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
SAR1B	51128	hgsc.bcm.edu	37	5	133956720	133956720	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-5892-01A-11D-1589-08	TCGA-BQ-5892-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6e208c0a-d4dc-41d8-9f75-740d3fbf33ba	2684973c-b534-4ced-a232-197ba7e30757	g.chr5:133956720delT	ENST00000402673.2	-	3	359	c.81delA	c.(79-81)aaafs	p.K27fs	SAR1B_ENST00000507419.1_Intron|SAR1B_ENST00000439578.1_Frame_Shift_Del_p.K27fs	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B	27					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAAATACCAGTTTACCAGTTT	0.343																																					p.L28fs		Atlas-INDEL	.											.	SAR1B	19	.	0			c.82delC						PASS	.						179.0	162.0	168.0					5																	133956720		2202	4300	6502	SO:0001589	frameshift_variant	51128	exon4			.	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	ENST00000402673.2:c.81delA	chr5.hg19:g.133956720delT	ENSP00000385432:p.Lys27fs	111.0	0.0	0		170.0	41.0	0.241176	NM_001033503	D3DQA4|Q567T4	Frame_Shift_Del	DEL	ENST00000402673.2	hg19	CCDS4177.1																																																																																			.	.	.	none		0.343	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	
