#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
JAK1	3716	hgsc.bcm.edu	37	1	65344759	65344759	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:65344759C>T	ENST00000342505.4	-	4	526	c.278G>A	c.(277-279)cGc>cAc	p.R93H		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	93	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GGTGATGGTGCGATTTGGAGC	0.507			Mis		ALL																																p.R93H		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	209	.	0			c.G278A						PASS	.						134.0	132.0	133.0					1																	65344759		2051	4200	6251	SO:0001583	missense	3716	exon4			ATGGTGCGATTTG	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.278G>A	chr1.hg19:g.65344759C>T	ENSP00000343204:p.Arg93His	53.0	0.0	.		45.0	25.0	.	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.643910	0.00792	.	.	ENSG00000162434	ENST00000342505	T	0.60797	0.16	5.17	-4.45	0.03546	Band 4.1 domain (1);FERM domain (1);	.	.	.	.	T	0.03564	0.0102	N	0.00044	-2.46	0.20926	N	0.999829	B	0.02656	0.0	B	0.01281	0.0	T	0.48091	-0.9065	9	0.02654	T	1	-0.1135	14.8839	0.70553	0.0:0.2045:0.0:0.7955	.	93	P23458	JAK1_HUMAN	H	93	ENSP00000343204:R93H	ENSP00000343204:R93H	R	-	2	0	JAK1	65117347	0.002000	0.14202	0.069000	0.20011	0.073000	0.16967	-0.194000	0.09559	-0.765000	0.04645	-0.794000	0.03295	CGC	.	.	.	none		0.507	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
SNX7	51375	hgsc.bcm.edu	37	1	99150445	99150445	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:99150445C>A	ENST00000306121.3	+	2	194	c.185C>A	c.(184-186)gCc>gAc	p.A62D	SNX7_ENST00000370189.5_5'UTR|SNX7_ENST00000529992.1_Missense_Mutation_p.A62D	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	200	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TCTTAGGATGCCTCATTGATG	0.303																																					p.A62D		Atlas-SNP	.											.	SNX7	76	.	0			c.C185A						PASS	.						97.0	88.0	91.0					1																	99150445		2203	4300	6503	SO:0001583	missense	51375	exon2			AGGATGCCTCATT	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.185C>A	chr1.hg19:g.99150445C>A	ENSP00000304429:p.Ala62Asp	110.0	0.0	.		111.0	37.0	.	NM_015976	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	ENST00000306121.3	hg19	CCDS755.2	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624884	0.66901	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	T;T	0.32753	2.12;1.44	5.29	4.36	0.52297	.	.	.	.	.	T	0.15522	0.0374	N	0.19112	0.55	0.80722	D	1	B;D	0.53462	0.003;0.96	B;P	0.51229	0.003;0.663	T	0.03221	-1.1059	9	0.16896	T	0.51	.	15.2016	0.73142	0.142:0.858:0.0:0.0	.	62;62	E9PNL2;Q9UNH6-3	.;.	D	62	ENSP00000434731:A62D;ENSP00000304429:A62D	ENSP00000304429:A62D	A	+	2	0	SNX7	98923033	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	3.677000	0.54619	1.212000	0.43366	0.650000	0.86243	GCC	.	.	.	none		0.303	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
SLC9C2	284525	hgsc.bcm.edu	37	1	173505010	173505010	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:173505010G>T	ENST00000367714.3	-	15	2156	c.1734C>A	c.(1732-1734)ttC>ttA	p.F578L	SLC9C2_ENST00000536496.1_Intron|SLC9C2_ENST00000466087.1_5'UTR	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	578					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.F578L(1)									AATATTCCAAGAAAGTTAAAA	0.259																																					p.F578L		Atlas-SNP	.											SLC9A11,rectum,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1734A						PASS	.						30.0	36.0	34.0					1																	173505010		2143	4195	6338	SO:0001583	missense	284525	exon15			TTCCAAGAAAGTT	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1734C>A	chr1.hg19:g.173505010G>T	ENSP00000356687:p.Phe578Leu	77.0	0.0	.		113.0	29.0	.	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	hg19	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	G	1.013	-0.687321	0.03328	.	.	ENSG00000162753	ENST00000367714	T	0.04275	3.66	5.81	2.48	0.30137	.	0.605739	0.15672	N	0.250356	T	0.00967	0.0032	L	0.36672	1.1	0.09310	N	1	B	0.22346	0.068	B	0.15484	0.013	T	0.47898	-0.9081	10	0.11485	T	0.65	-5.8685	3.7288	0.08485	0.2435:0.2051:0.5513:0.0	.	578	Q5TAH2	S9A11_HUMAN	L	578	ENSP00000356687:F578L	ENSP00000356687:F578L	F	-	3	2	SLC9A11	171771633	0.739000	0.28196	0.234000	0.24042	0.083000	0.17756	1.040000	0.30278	0.747000	0.32809	0.603000	0.83216	TTC	.	.	.	none		0.259	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
OR13G1	441933	hgsc.bcm.edu	37	1	247835611	247835611	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr1:247835611C>G	ENST00000359688.2	-	1	754	c.733G>C	c.(733-735)Gtg>Ctg	p.V245L	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TAAAGGGTCACCACTGTGAGA	0.448																																					p.V245L		Atlas-SNP	.											.	OR13G1	78	.	0			c.G733C						PASS	.						162.0	139.0	147.0					1																	247835611		2203	4300	6503	SO:0001583	missense	441933	exon1			GGGTCACCACTGT	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.733G>C	chr1.hg19:g.247835611C>G	ENSP00000352717:p.Val245Leu	122.0	0.0	.		122.0	32.0	.	NM_001005487	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	hg19	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373546	0.24857	.	.	ENSG00000197437	ENST00000359688	T	0.00355	7.91	4.2	3.29	0.37713	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001320	T	0.00815	0.0027	M	0.86740	2.835	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.26258	-1.0108	10	0.66056	D	0.02	-60.5376	10.2821	0.43545	0.0:0.9016:0.0:0.0984	.	245	Q8NGZ3	O13G1_HUMAN	L	245	ENSP00000352717:V245L	ENSP00000352717:V245L	V	-	1	0	OR13G1	245902234	0.021000	0.18746	0.037000	0.18230	0.096000	0.18686	0.139000	0.16036	1.126000	0.42016	-0.214000	0.12660	GTG	.	.	.	none		0.448	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487	
PIK3CA	5290	hgsc.bcm.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,1131	PIK3CA	8460	.	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A						PASS	.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290	exon10			ATCACTGAGCAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	chr3.hg19:g.178936091G>A	ENSP00000263967:p.Glu545Lys	92.0	0.0	.		68.0	4.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	.	.	.	weak		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
LARS	51520	hgsc.bcm.edu	37	5	145533344	145533344	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:145533344C>T	ENST00000394434.2	-	12	1349	c.1183G>A	c.(1183-1185)Gac>Aac	p.D395N	LARS_ENST00000545646.1_Missense_Mutation_p.D349N|LARS_ENST00000274562.9_Missense_Mutation_p.D368N|LARS_ENST00000510191.1_Missense_Mutation_p.D341N	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	395	Editing domain.				gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	TCAGGGGAGTCGGAAGGAACA	0.363																																					p.D395N		Atlas-SNP	.											.	LARS	100	.	0			c.G1183A						PASS	.						128.0	121.0	123.0					5																	145533344		2203	4300	6503	SO:0001583	missense	51520	exon12			GGGAGTCGGAAGG	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.1183G>A	chr5.hg19:g.145533344C>T	ENSP00000377954:p.Asp395Asn	35.0	0.0	.		67.0	31.0	.	NM_020117	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	ENST00000394434.2	hg19	CCDS34265.1	.	.	.	.	.	.	.	.	.	.	C	34	5.346551	0.95807	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000510191;ENST00000274562	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.59	5.59	0.84812	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.67664	0.2917	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.996;0.948	T	0.70536	-0.4845	10	0.54805	T	0.06	-7.3038	19.956	0.97218	0.0:1.0:0.0:0.0	.	368;349;395	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	N	395;349;341;368	ENSP00000377954:D395N;ENSP00000437791:D349N;ENSP00000426005:D341N;ENSP00000274562:D368N	ENSP00000274562:D368N	D	-	1	0	LARS	145513537	1.000000	0.71417	0.998000	0.56505	0.887000	0.51463	5.851000	0.69481	2.788000	0.95919	0.557000	0.71058	GAC	.	.	.	none		0.363	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
GRPEL2	134266	hgsc.bcm.edu	37	5	148730749	148730749	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:148730749C>T	ENST00000329271.3	+	4	692	c.582C>T	c.(580-582)acC>acT	p.T194T	GRPEL2_ENST00000507562.1_3'UTR|GRPEL2_ENST00000416916.2_3'UTR|GRPEL2-AS1_ENST00000521295.1_RNA	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	194					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCTGGCACCGTGGCATTAG	0.527																																					p.T194T		Atlas-SNP	.											.	GRPEL2	18	.	0			c.C582T						PASS	.						119.0	111.0	114.0					5																	148730749		2203	4300	6503	SO:0001819	synonymous_variant	134266	exon4			TGGCACCGTGGCA	AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.582C>T	chr5.hg19:g.148730749C>T		150.0	0.0	.		105.0	37.0	.	NM_152407	B4DFA6|Q49AJ6	Silent	SNP	ENST00000329271.3	hg19	CCDS4295.1																																																																																			.	.	.	none		0.527	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407	
BCLAF1	9774	hgsc.bcm.edu	37	6	136599912	136599912	+	Missense_Mutation	SNP	G	G	T	rs200334350		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:136599912G>T	ENST00000531224.1	-	4	359	c.107C>A	c.(106-108)tCt>tAt	p.S36Y	BCLAF1_ENST00000392348.2_Intron|BCLAF1_ENST00000527536.1_Missense_Mutation_p.S36Y|BCLAF1_ENST00000530767.1_Missense_Mutation_p.S36Y|BCLAF1_ENST00000353331.4_Intron|BCLAF1_ENST00000527759.1_Intron	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	36					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACGAGACCTAGAACTAAAAAT	0.318																																					p.S36Y	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.C107A						PASS	.						23.0	24.0	24.0					6																	136599912		2199	4289	6488	SO:0001583	missense	9774	exon4			GACCTAGAACTAA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.107C>A	chr6.hg19:g.136599912G>T	ENSP00000435210:p.Ser36Tyr	37.0	0.0	.		66.0	7.0	.	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	5.506	0.278344	0.10403	.	.	ENSG00000029363	ENST00000531224;ENST00000527536;ENST00000530767;ENST00000529826	T;T;T;T	0.46819	1.23;1.07;0.86;0.93	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000004	T	0.63295	0.2499	M	0.61703	1.905	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.74348	0.983;0.983	T	0.64245	-0.6453	10	0.87932	D	0	-6.9024	20.1392	0.98050	0.0:0.0:1.0:0.0	.	36;36	Q9NYF8;Q9NYF8-4	BCLF1_HUMAN;.	Y	36	ENSP00000435210:S36Y;ENSP00000435441:S36Y;ENSP00000436501:S36Y;ENSP00000431734:S36Y	ENSP00000435441:S36Y	S	-	2	0	BCLAF1	136641605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.159000	0.77483	2.765000	0.95021	0.557000	0.71058	TCT	.	.	.	weak		0.318	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
SAMD5	389432	hgsc.bcm.edu	37	6	147830100	147830100	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr6:147830100G>A	ENST00000367474.1	+	1	38	c.36G>A	c.(34-36)gcG>gcA	p.A12A		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	12	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.												Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		GGCTCAAAGCGCTGCAGCTTC	0.637																																					p.A12A		Atlas-SNP	.											.	SAMD5	4	.	0			c.G36A						PASS	.						53.0	49.0	50.0					6																	147830100		2203	4300	6503	SO:0001819	synonymous_variant	389432	exon1			CAAAGCGCTGCAG	AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.36G>A	chr6.hg19:g.147830100G>A		73.0	0.0	.		55.0	12.0	.	NM_001030060		Silent	SNP	ENST00000367474.1	hg19	CCDS34548.1																																																																																			.	.	.	none		0.637	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1	NM_001030060	
PKD1L1	168507	hgsc.bcm.edu	37	7	47970797	47970797	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:47970797G>A	ENST00000289672.2	-	6	691	c.641C>T	c.(640-642)aCg>aTg	p.T214M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	214					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGTCTCCATCGTGACAGTCCC	0.617																																					p.T214M		Atlas-SNP	.											.	PKD1L1	328	.	0			c.C641T						PASS	.						67.0	68.0	68.0					7																	47970797		2203	4300	6503	SO:0001583	missense	168507	exon6			TCCATCGTGACAG	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.641C>T	chr7.hg19:g.47970797G>A	ENSP00000289672:p.Thr214Met	110.0	0.0	.		85.0	27.0	.	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	8.481	0.859718	0.17178	.	.	ENSG00000158683	ENST00000289672	T	0.23147	1.92	3.26	-2.9	0.05648	.	6.156550	0.00725	N	0.000901	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.20505	-1.0273	10	0.46703	T	0.11	.	4.4996	0.11858	0.4273:0.1738:0.3989:0.0	.	214	Q8TDX9	PK1L1_HUMAN	M	214	ENSP00000289672:T214M	ENSP00000289672:T214M	T	-	2	0	PKD1L1	47937322	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.622000	0.02042	-0.610000	0.05716	-0.225000	0.12378	ACG	.	.	.	none		0.617	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
TPK1	27010	hgsc.bcm.edu	37	7	144245631	144245631	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:144245631C>A	ENST00000360057.3	-	8	668	c.566G>T	c.(565-567)gGa>gTa	p.G189V	TPK1_ENST00000547966.1_5'UTR|TPK1_ENST00000538212.2_Missense_Mutation_p.G135V|TPK1_ENST00000549981.1_Missense_Mutation_p.G72V|TPK1_ENST00000378099.3_Missense_Mutation_p.G140V	NM_022445.3	NP_071890.2	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1	189					small molecule metabolic process (GO:0044281)|thiamine diphosphate biosynthetic process (GO:0009229)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|thiamine binding (GO:0030975)|thiamine diphosphokinase activity (GO:0004788)			large_intestine(3)|lung(12)|ovary(2)|urinary_tract(2)	19					Thiamine(DB00152)	ACAAGGCTGTCCAACAGGAAT	0.418																																					p.G189V	Ovarian(45;88 1034 2073 5829 28455)	Atlas-SNP	.											.	TPK1	41	.	0			c.G566T						PASS	.						200.0	167.0	178.0					7																	144245631		2203	4300	6503	SO:0001583	missense	27010	exon8			GGCTGTCCAACAG	AB028138	CCDS5888.1, CCDS55178.1	7q34-q35	2008-07-18			ENSG00000196511	ENSG00000196511			17358	protein-coding gene	gene with protein product	"""placental protein 20"", ""thiamine pyrophosphokinase 1"", ""thiamine kinase"", ""thiamine diphosphokinase"""	606370				11342111	Standard	NM_022445		Approved	HTPK1, PP20	uc003weq.3	Q9H3S4	OTTHUMG00000152774	ENST00000360057.3:c.566G>T	chr7.hg19:g.144245631C>A	ENSP00000353165:p.Gly189Val	172.0	0.0	.		145.0	65.0	.	NM_022445	A8K0T7|D3DWG0|I6L9B8|Q6NUR5|Q9H602	Missense_Mutation	SNP	ENST00000360057.3	hg19	CCDS5888.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524985	0.64747	.	.	ENSG00000196511	ENST00000360057;ENST00000538212;ENST00000378099;ENST00000549981	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.95	5.95	0.96441	Thiamin pyrophosphokinase, vitamin B1-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.91402	0.7287	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.999	D	0.92101	0.5688	10	0.59425	D	0.04	-17.4306	15.8749	0.79154	0.0:1.0:0.0:0.0	.	140;189;135	F5GZG6;Q9H3S4;Q6ZQX6	.;TPK1_HUMAN;.	V	189;135;140;72	ENSP00000353165:G189V;ENSP00000438813:G135V;ENSP00000367339:G140V;ENSP00000448698:G72V	ENSP00000353165:G189V	G	-	2	0	TPK1	143876564	1.000000	0.71417	1.000000	0.80357	0.467000	0.32768	5.315000	0.65810	2.817000	0.96982	0.563000	0.77884	GGA	.	.	.	none		0.418	TPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327777.1	NM_022445	
KMT2C	58508	hgsc.bcm.edu	37	7	151845739	151845739	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr7:151845739C>A	ENST00000262189.6	-	52	13491	c.13273G>T	c.(13273-13275)Gat>Tat	p.D4425Y	KMT2C_ENST00000355193.2_Missense_Mutation_p.D4482Y	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4425					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACCCACAGATCCAAGTCAAGG	0.502																																					p.D4425Y		Atlas-SNP	.											MLL3_ENST00000355193,NS,carcinoma,0,2	MLL3	1564	.	0			c.G13273T						PASS	.						97.0	89.0	92.0					7																	151845739		2203	4300	6503	SO:0001583	missense	58508	exon52			ACAGATCCAAGTC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.13273G>T	chr7.hg19:g.151845739C>A	ENSP00000262189:p.Asp4425Tyr	128.0	0.0	.		102.0	45.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.05|17.05	3.290706|3.290706	0.59976|0.59976	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.90385|.	-2.0;-1.98;-2.66|.	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	0.000000|.	0.44285|.	U|.	0.000480|.	T|T	0.78123|0.78123	0.4234|0.4234	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.997;0.999;0.999|.	T|T	0.78221|0.78221	-0.2288|-0.2288	10|5	0.49607|.	T|.	0.09|.	.|.	19.1777|19.1777	0.93609|0.93609	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4425;3543;4482|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	Y|V	4425;4482;1042|1985	ENSP00000262189:D4425Y;ENSP00000347325:D4482Y;ENSP00000410411:D1042Y|.	ENSP00000262189:D4425Y|.	D|G	-|-	1|2	0|0	MLL3|MLL3	151476672|151476672	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.957000|0.957000	0.61999|0.61999	7.776000|7.776000	0.85560|0.85560	2.602000|2.602000	0.87976|0.87976	0.557000|0.557000	0.71058|0.71058	GAT|GGA	.	.	.	none		0.502	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MYOM2	9172	hgsc.bcm.edu	37	8	2044224	2044224	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:2044224A>G	ENST00000262113.4	+	18	2404	c.2263A>G	c.(2263-2265)Aaa>Gaa	p.K755E	MYOM2_ENST00000523438.1_Missense_Mutation_p.K180E	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	755	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGTTCACCATAAAAACTGGCA	0.517																																					p.K755E		Atlas-SNP	.											.	MYOM2	251	.	0			c.A2263G						PASS	.						104.0	92.0	96.0					8																	2044224		2203	4300	6503	SO:0001583	missense	9172	exon18			CACCATAAAAACT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2263A>G	chr8.hg19:g.2044224A>G	ENSP00000262113:p.Lys755Glu	74.0	0.0	.		73.0	23.0	.	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.135743	0.00335	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.54675	0.56;0.56	5.46	0.23	0.15372	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.912312	0.09530	N	0.789730	T	0.32315	0.0825	N	0.25201	0.72	0.09310	N	1	B	0.23540	0.087	B	0.30943	0.122	T	0.31166	-0.9953	10	0.02654	T	1	.	6.2231	0.20693	0.4732:0.3775:0.0689:0.0804	.	755	P54296	MYOM2_HUMAN	E	755;180	ENSP00000262113:K755E;ENSP00000428396:K180E	ENSP00000262113:K755E	K	+	1	0	MYOM2	2031631	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.150000	0.16263	-0.212000	0.10109	-1.477000	0.00996	AAA	.	.	.	none		0.517	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
FAM110B	90362	hgsc.bcm.edu	37	8	59059734	59059734	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:59059734C>T	ENST00000361488.3	+	5	1825	c.945C>T	c.(943-945)agC>agT	p.S315S	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	315						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				GCATGATCAGCTCAGACTGTG	0.483																																					p.S315S		Atlas-SNP	.											.	FAM110B	64	.	0			c.C945T						PASS	.						79.0	75.0	76.0					8																	59059734		2203	4300	6503	SO:0001819	synonymous_variant	90362	exon5			GATCAGCTCAGAC	U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.945C>T	chr8.hg19:g.59059734C>T		60.0	0.0	.		45.0	19.0	.	NM_147189	Q5BM08|Q9Y4K2	Silent	SNP	ENST00000361488.3	hg19	CCDS6170.1																																																																																			.	.	.	none		0.483	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
CSPP1	79848	hgsc.bcm.edu	37	8	68087587	68087587	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:68087587C>A	ENST00000262210.5	+	24	3041	c.3010C>A	c.(3010-3012)Cac>Aac	p.H1004N	ARFGEF1_ENST00000520381.1_3'UTR|CSPP1_ENST00000412460.1_Missense_Mutation_p.H659N|CSPP1_ENST00000521168.1_3'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1039					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			AAGAGATCATCACACCTTAGA	0.363																																					p.H1004N		Atlas-SNP	.											.	CSPP1	129	.	0			c.C3010A						PASS	.						67.0	66.0	66.0					8																	68087587		1874	4104	5978	SO:0001583	missense	79848	exon24			GATCATCACACCT	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3010C>A	chr8.hg19:g.68087587C>A	ENSP00000262210:p.His1004Asn	94.0	0.0	.		98.0	5.0	.	NM_024790	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	hg19	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034076	0.35893	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.29655	1.56;1.58;1.58	4.8	1.4	0.22301	.	0.673183	0.14117	N	0.340319	T	0.18425	0.0442	L	0.29908	0.895	0.54753	D	0.999989	B;B;B;B	0.25904	0.137;0.102;0.082;0.034	B;B;B;B	0.25140	0.058;0.05;0.037;0.025	T	0.07927	-1.0747	10	0.36615	T	0.2	-2.5735	4.0688	0.09872	0.1755:0.4941:0.2432:0.0872	.	162;659;1004;1039	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	N	1004;1039;659;659	ENSP00000262210:H1004N;ENSP00000415782:H659N;ENSP00000430092:H659N	ENSP00000262210:H1004N	H	+	1	0	CSPP1	68250141	0.582000	0.26749	0.987000	0.45799	0.995000	0.86356	0.360000	0.20250	0.541000	0.28827	0.591000	0.81541	CAC	.	.	.	none		0.363	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
CSMD3	114788	hgsc.bcm.edu	37	8	113249531	113249531	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:113249531G>T	ENST00000297405.5	-	67	10759	c.10515C>A	c.(10513-10515)taC>taA	p.Y3505*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.Y3336*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.Y3465*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.Y3435*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3505						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTTGAAATTGTAAGAGCCTT	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.Y3505X		Atlas-SNP	.											.	CSMD3	2325	.	0			c.C10515A						PASS	.						157.0	144.0	148.0					8																	113249531		2203	4300	6503	SO:0001587	stop_gained	114788	exon67			GAAATTGTAAGAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10515C>A	chr8.hg19:g.113249531G>T	ENSP00000297405:p.Tyr3505*	99.0	0.0	.		104.0	38.0	.	NM_198123	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	51	17.550337	0.99888	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.77	-1.61	0.08399	.	0.090578	0.46442	D	0.000299	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6815	0.23123	0.3366:0.1118:0.5516:0.0	.	.	.	.	X	3465;3505;2775;3336;3435	.	ENSP00000297405:Y3505X	Y	-	3	2	CSMD3	113318707	0.982000	0.34865	0.993000	0.49108	0.533000	0.34776	0.213000	0.17521	-0.254000	0.09500	-0.499000	0.04595	TAC	.	.	.	none		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113249566	113249566	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:113249566C>A	ENST00000297405.5	-	67	10724	c.10480G>T	c.(10480-10482)Gta>Tta	p.V3494L	CSMD3_ENST00000455883.2_Missense_Mutation_p.V3325L|CSMD3_ENST00000343508.3_Missense_Mutation_p.V3454L|CSMD3_ENST00000352409.3_Missense_Mutation_p.V3424L	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3494						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGGGCAAATACATCATCAGGA	0.303										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V3494L		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G10480T						PASS	.						110.0	103.0	105.0					8																	113249566		2203	4300	6503	SO:0001583	missense	114788	exon67			CAAATACATCATC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10480G>T	chr8.hg19:g.113249566C>A	ENSP00000297405:p.Val3494Leu	82.0	0.0	.		80.0	25.0	.	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563747	0.45694	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.33865	1.71;1.7;1.78;1.39;1.76	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000010	T	0.55417	0.1919	M	0.71206	2.165	0.48087	D	0.999581	D;D;B	0.61080	0.989;0.961;0.038	D;P;B	0.63033	0.91;0.741;0.07	T	0.50432	-0.8829	10	0.16896	T	0.51	.	17.9788	0.89134	0.0:1.0:0.0:0.0	.	3325;3494;3454	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	L	3454;3494;2764;3325;3424	ENSP00000345799:V3454L;ENSP00000297405:V3494L;ENSP00000341558:V2764L;ENSP00000412263:V3325L;ENSP00000343124:V3424L	ENSP00000297405:V3494L	V	-	1	0	CSMD3	113318742	1.000000	0.71417	1.000000	0.80357	0.431000	0.31685	7.627000	0.83176	2.467000	0.83353	0.467000	0.42956	GTA	.	.	.	none		0.303	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DENND3	22898	hgsc.bcm.edu	37	8	142186773	142186773	+	Silent	SNP	C	C	T	rs374490803		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:142186773C>T	ENST00000262585.2	+	15	2657	c.2379C>T	c.(2377-2379)ttC>ttT	p.F793F	DENND3_ENST00000424248.1_Silent_p.F741F|DENND3_ENST00000519811.1_Silent_p.F873F	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	793					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			AAGAAGTCTTCGAAGCCAACC	0.512																																					p.F793F		Atlas-SNP	.											.	DENND3	127	.	0			c.C2379T						PASS	.	C		0,4406		0,0,2203	117.0	105.0	109.0		2379	-8.0	0.4	8		109	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DENND3	NM_014957.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		793/1199	142186773	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22898	exon15			AGTCTTCGAAGCC	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2379C>T	chr8.hg19:g.142186773C>T		121.0	0.0	.		91.0	40.0	.	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Silent	SNP	ENST00000262585.2	hg19	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	9.548	1.115101	0.20795	0.0	2.33E-4	ENSG00000105339	ENST00000518668	.	.	.	5.37	-7.98	0.01135	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.7694	14.5506	0.68065	0.0:0.5424:0.0:0.4576	.	.	.	.	X	798	.	.	R	+	1	2	DENND3	142255955	0.831000	0.29352	0.363000	0.25875	0.894000	0.52154	-0.115000	0.10741	-1.794000	0.01256	-1.124000	0.02001	CGA	.	.	.	weak		0.512	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
FAM83H	286077	hgsc.bcm.edu	37	8	144809117	144809117	+	Silent	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr8:144809117G>C	ENST00000388913.3	-	5	2639	c.2514C>G	c.(2512-2514)gcC>gcG	p.A838A		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	838					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGTGGCTCTGGGCAGAGAGGA	0.701																																					p.A838A		Atlas-SNP	.											.	FAM83H	68	.	0			c.C2514G						PASS	.						10.0	11.0	11.0					8																	144809117		1984	4151	6135	SO:0001819	synonymous_variant	286077	exon5			GCTCTGGGCAGAG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2514C>G	chr8.hg19:g.144809117G>C		28.0	0.0	.		22.0	8.0	.	NM_198488	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	hg19	CCDS6410.2																																																																																			.	.	.	none		0.701	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
SMARCA2	6595	hgsc.bcm.edu	37	9	2110312	2110312	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:2110312C>T	ENST00000382203.1	+	24	3560	c.3351C>T	c.(3349-3351)tcC>tcT	p.S1117S	SMARCA2_ENST00000349721.2_Silent_p.S1117S|SMARCA2_ENST00000357248.2_Silent_p.S1117S|SMARCA2_ENST00000382194.1_Silent_p.S1117S			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1117	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AACCTGGATCCCAGTATTTCA	0.453																																					p.S1117S		Atlas-SNP	.											.	SMARCA2	313	.	0			c.C3351T						PASS	.						94.0	88.0	90.0					9																	2110312		2203	4300	6503	SO:0001819	synonymous_variant	6595	exon24			TGGATCCCAGTAT	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3351C>T	chr9.hg19:g.2110312C>T		64.0	0.0	.		102.0	32.0	.	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.	.	none		0.453	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84607771	84607771	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:84607771G>T	ENST00000344803.2	+	4	2433	c.2386G>T	c.(2386-2388)Gat>Tat	p.D796Y		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	796					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TTCAGACAAGGATCTGAGGTC	0.463																																					p.D796Y		Atlas-SNP	.											.	.	.	.	0			c.G2386T						PASS	.						102.0	99.0	100.0					9																	84607771		1908	4112	6020	SO:0001583	missense	389763	exon4			GACAAGGATCTGA		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2386G>T	chr9.hg19:g.84607771G>T	ENSP00000341988:p.Asp796Tyr	157.0	0.0	.		102.0	37.0	.	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664689	0.29604	.	.	ENSG00000214929	ENST00000344803	T	0.07114	3.22	2.85	1.93	0.25924	.	3.256700	0.00687	N	0.000704	T	0.16896	0.0406	L	0.54323	1.7	0.09310	N	1	D	0.57571	0.98	P	0.60012	0.867	T	0.48234	-0.9053	10	0.02654	T	1	1.3602	5.6289	0.17499	0.1558:0.0:0.8442:0.0	.	796	Q6ZQQ2	F75D1_HUMAN	Y	796	ENSP00000341988:D796Y	ENSP00000341988:D796Y	D	+	1	0	FAM75D1	83797591	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.442000	0.21628	0.762000	0.33152	0.462000	0.41574	GAT	.	.	.	none		0.463	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
SVEP1	79987	hgsc.bcm.edu	37	9	113141740	113141740	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:113141740T>C	ENST00000401783.2	-	44	10631	c.10295A>G	c.(10294-10296)tAt>tGt	p.Y3432C	SVEP1_ENST00000374469.1_Missense_Mutation_p.Y3409C|SVEP1_ENST00000297826.5_Missense_Mutation_p.Y1358C	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3432	Sushi 34. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCCATATTGATAATGTACGCC	0.403																																					p.Y3432C		Atlas-SNP	.											.	SVEP1	326	.	0			c.A10295G						PASS	.						112.0	100.0	104.0					9																	113141740		1940	4146	6086	SO:0001583	missense	79987	exon44			TATTGATAATGTA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10295A>G	chr9.hg19:g.113141740T>C	ENSP00000384917:p.Tyr3432Cys	79.0	0.0	.		71.0	33.0	.	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.394554	0.62066	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.69926	-0.44;-0.44;-0.44	5.87	5.87	0.94306	Complement control module (2);Sushi/SCR/CCP (3);	0.240647	0.43416	D	0.000575	D	0.83912	0.5357	M	0.93720	3.45	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.86941	0.2079	10	0.52906	T	0.07	.	11.9508	0.52954	0.1299:0.0:0.0:0.8701	.	3432	Q4LDE5	SVEP1_HUMAN	C	3432;3409;1358	ENSP00000384917:Y3432C;ENSP00000363593:Y3409C;ENSP00000297826:Y1358C	ENSP00000297826:Y1358C	Y	-	2	0	SVEP1	112181561	1.000000	0.71417	0.989000	0.46669	0.666000	0.39218	4.371000	0.59523	2.248000	0.74166	0.533000	0.62120	TAT	.	.	.	none		0.403	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
OR1B1	347169	hgsc.bcm.edu	37	9	125391500	125391500	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr9:125391500G>A	ENST00000304833.3	-	1	352	c.315C>T	c.(313-315)ttC>ttT	p.F105F	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						ATGCATAGAAGAAAAAGAACT	0.502																																					p.F105F		Atlas-SNP	.											.	OR1B1	48	.	0			c.C315T						PASS	.						85.0	77.0	79.0					9																	125391500		2203	4300	6503	SO:0001819	synonymous_variant	347169	exon1			ATAGAAGAAAAAG	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.315C>T	chr9.hg19:g.125391500G>A		60.0	0.0	.		55.0	21.0	.	NM_001004450	Q6IFN3	Silent	SNP	ENST00000304833.3	hg19	CCDS35126.1																																																																																			.	.	.	none		0.502	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053947.2	NM_001004450	
OR13A1	79290	hgsc.bcm.edu	37	10	45799786	45799786	+	Missense_Mutation	SNP	C	C	T	rs200530280		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr10:45799786C>T	ENST00000553795.1	-	4	393	c.85G>A	c.(85-87)Gag>Aag	p.E29K	OR13A1_ENST00000374401.2_Missense_Mutation_p.E29K|OR13A1_ENST00000536058.1_Missense_Mutation_p.E29K	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E29K(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						AGGATGAACTCGGTTACCAAC	0.517																																					p.E29K		Atlas-SNP	.											OR13A1,ear,carcinoma,0,1	OR13A1	49	.	1	Substitution - Missense(1)	skin(1)	c.G85A						PASS	.						70.0	81.0	77.0					10																	45799786		2203	4300	6503	SO:0001583	missense	79290	exon4			TGAACTCGGTTAC	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.85G>A	chr10.hg19:g.45799786C>T	ENSP00000451950:p.Glu29Lys	95.0	0.0	.		84.0	38.0	.	NM_001004297	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	hg19	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	c	10.75	1.438543	0.25900	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.01119	5.31;5.31;5.31	5.09	3.18	0.36537	.	0.350510	0.20650	N	0.088225	T	0.02380	0.0073	M	0.80028	2.48	0.29732	N	0.837839	B	0.25743	0.133	B	0.27715	0.082	T	0.04678	-1.0934	10	0.72032	D	0.01	-21.4609	8.6395	0.33968	0.0:0.7602:0.1539:0.0858	.	29	Q8NGR1	O13A1_HUMAN	K	29	ENSP00000451950:E29K;ENSP00000438657:E29K;ENSP00000363522:E29K	ENSP00000311379:E29K	E	-	1	0	OR13A1	45119792	0.008000	0.16893	0.368000	0.25939	0.065000	0.16274	0.141000	0.16076	0.625000	0.30304	0.603000	0.83216	GAG	.	C|0.999;A|0.001	.	alt		0.517	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7618800	7618800	+	Missense_Mutation	SNP	C	C	G	rs17851928		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:7618800C>G	ENST00000299492.4	+	5	770	c.382C>G	c.(382-384)Ctc>Gtc	p.L128V	PPFIBP2_ENST00000533792.1_5'UTR|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.L16V	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	128				L -> I (in Ref. 2; AAH21714). {ECO:0000305}.	cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGTGAGTGTCCTCACAGACCA	0.512																																					p.L128V		Atlas-SNP	.											.	PPFIBP2	87	.	0			c.C382G						PASS	.						63.0	58.0	60.0					11																	7618800		2201	4296	6497	SO:0001583	missense	8495	exon5			AGTGTCCTCACAG	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.382C>G	chr11.hg19:g.7618800C>G	ENSP00000299492:p.Leu128Val	33.0	0.0	.		19.0	9.0	.	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	hg19	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718828	0.89205	.	.	ENSG00000166387	ENST00000299492;ENST00000527790;ENST00000541115;ENST00000528883	T;T;T	0.49720	2.55;2.55;0.77	5.5	5.5	0.81552	.	0.000000	0.53938	D	0.000044	T	0.70202	0.3197	M	0.78344	2.41	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;D;D;D	0.91635	0.999;0.929;0.999;0.997	T	0.72626	-0.4236	10	0.59425	D	0.04	-6.6607	16.8778	0.86056	0.0:1.0:0.0:0.0	.	16;16;51;128	E9PK77;B7Z433;F5GWB0;Q8ND30	.;.;.;LIPB2_HUMAN	V	128;128;51;16	ENSP00000299492:L128V;ENSP00000434981:L128V;ENSP00000435469:L16V	ENSP00000299492:L128V	L	+	1	0	PPFIBP2	7575376	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.639000	0.61361	2.600000	0.87896	0.655000	0.94253	CTC	.	.	.	alt		0.512	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
TTC17	55761	hgsc.bcm.edu	37	11	43380551	43380551	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:43380551G>A	ENST00000039989.4	+	1	61	c.47G>A	c.(46-48)tGc>tAc	p.C16Y	RP11-484D2.2_ENST00000526220.1_RNA|TTC17_ENST00000299240.6_Missense_Mutation_p.C16Y	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	16					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTGCCGCCTTGCTCCGGCCCA	0.711																																					p.C16Y		Atlas-SNP	.											.	TTC17	112	.	0			c.G47A						PASS	.						10.0	13.0	12.0					11																	43380551		2188	4280	6468	SO:0001583	missense	55761	exon1			CGCCTTGCTCCGG	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.47G>A	chr11.hg19:g.43380551G>A	ENSP00000039989:p.Cys16Tyr	25.0	0.0	.		20.0	10.0	.	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	hg19	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759055	0.49468	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.30981	1.51;1.52	5.5	5.5	0.81552	.	0.471757	0.22070	N	0.065056	T	0.13114	0.0318	N	0.08118	0	0.23611	N	0.99729	B;B	0.33379	0.41;0.021	B;B	0.26094	0.066;0.037	T	0.17623	-1.0363	10	0.17832	T	0.49	-0.8355	9.4046	0.38453	0.0:0.1538:0.6866:0.1596	.	16;16	Q96AE7;G3XAB3	TTC17_HUMAN;.	Y	16	ENSP00000299240:C16Y;ENSP00000039989:C16Y	ENSP00000039989:C16Y	C	+	2	0	TTC17	43337127	0.979000	0.34478	0.972000	0.41901	0.951000	0.60555	3.441000	0.52893	2.868000	0.98415	0.555000	0.69702	TGC	.	.	.	none		0.711	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
PICALM	8301	hgsc.bcm.edu	37	11	85714416	85714416	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr11:85714416C>A	ENST00000393346.3	-	9	1034	c.886G>T	c.(886-888)Gca>Tca	p.A296S	PICALM_ENST00000526033.1_Missense_Mutation_p.A296S|PICALM_ENST00000528398.1_Missense_Mutation_p.A245S|PICALM_ENST00000356360.5_Missense_Mutation_p.A296S|PICALM_ENST00000532317.1_Missense_Mutation_p.A296S			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	296					axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				TACCTGCTTGCAGCTGTAGAA	0.388			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.A296S		Atlas-SNP	.		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	PICALM	82	.	0			c.G886T						PASS	.						97.0	93.0	94.0					11																	85714416		2203	4299	6502	SO:0001583	missense	8301	exon9			TGCTTGCAGCTGT	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.886G>T	chr11.hg19:g.85714416C>A	ENSP00000377015:p.Ala296Ser	74.0	0.0	.		99.0	27.0	.	NM_007166	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	ENST00000393346.3	hg19	CCDS8272.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559328	0.86335	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.72574	0.3477	M	0.71036	2.16	0.80722	D	1	D;D;B;P	0.69078	0.997;0.968;0.356;0.95	D;P;B;P	0.75020	0.985;0.854;0.178;0.716	T	0.71533	-0.4564	9	.	.	.	-9.5668	19.5037	0.95106	0.0:1.0:0.0:0.0	.	245;296;296;296	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	S	296;296;296;296;245;296	ENSP00000436958:A296S;ENSP00000433846:A296S;ENSP00000377015:A296S;ENSP00000434884:A245S;ENSP00000348718:A296S	.	A	-	1	0	PICALM	85392064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	GCA	.	.	.	none		0.388	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392224.1	NM_007166	
SPATA13	221178	hgsc.bcm.edu	37	13	24825881	24825881	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr13:24825881C>A	ENST00000382095.4	+	3	577	c.170C>A	c.(169-171)gCt>gAt	p.A57D	SPATA13_ENST00000382108.3_Missense_Mutation_p.A682D|SPATA13-AS1_ENST00000430733.1_RNA|SPATA13_ENST00000424834.2_Missense_Mutation_p.A682D|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.A560D	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	57					cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CCCATGCCTGCTCACCAGGTG	0.622																																					p.A682D		Atlas-SNP	.											.	SPATA13	92	.	0			c.C2045A						PASS	.						60.0	65.0	63.0					13																	24825881		2203	4300	6503	SO:0001583	missense	221178	exon4			TGCCTGCTCACCA	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.170C>A	chr13.hg19:g.24825881C>A	ENSP00000371527:p.Ala57Asp	117.0	0.0	.		118.0	49.0	.	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	hg19	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.7|25.7	4.662502|4.662502	0.88251|0.88251	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694|ENST00000424834	T;T;T|.	0.35789|.	1.29;1.29;1.29|.	5.97|5.97	5.13|5.13	0.70059|0.70059	.|.	0.125113|.	0.56097|.	D|.	0.000034|.	T|.	0.61173|.	0.2326|.	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P;D;B|.	0.53462|.	0.634;0.96;0.361|.	B;P;B|.	0.48795|.	0.3;0.59;0.074|.	T|.	0.55866|.	-0.8073|.	10|.	0.46703|.	T|.	0.11|.	.|.	13.7166|13.7166	0.62700|0.62700	0.0:0.927:0.0:0.073|0.0:0.927:0.0:0.073	.|.	3;3;57|.	Q96N96-5;Q96N96-4;Q96N96|.	.;.;SPT13_HUMAN|.	D|X	682;57;17;3|719	ENSP00000371542:A682D;ENSP00000371527:A57D;ENSP00000401605:A17D|.	ENSP00000371527:A57D|.	A|C	+|+	2|3	0|2	SPATA13|SPATA13	23723881|23723881	1.000000|1.000000	0.71417|0.71417	0.636000|0.636000	0.29352|0.29352	0.775000|0.775000	0.43874|0.43874	5.552000|5.552000	0.67281|0.67281	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.	.	.	none		0.622	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
SHISA2	387914	hgsc.bcm.edu	37	13	26620708	26620708	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr13:26620708C>G	ENST00000319420.3	-	2	886	c.831G>C	c.(829-831)caG>caC	p.Q277H		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	277					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						GGAAGGGGGACTGAATCTGCC	0.567																																					p.Q277H		Atlas-SNP	.											.	SHISA2	43	.	0			c.G831C						PASS	.						104.0	91.0	96.0					13																	26620708		2203	4300	6503	SO:0001583	missense	387914	exon2			GGGGGACTGAATC		CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.831G>C	chr13.hg19:g.26620708C>G	ENSP00000313079:p.Gln277His	87.0	0.0	.		85.0	30.0	.	NM_001007538	B9EH70|Q5W0G8	Missense_Mutation	SNP	ENST00000319420.3	hg19	CCDS31951.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.599692	0.66332	.	.	ENSG00000180730	ENST00000319420	T	0.52057	0.68	5.58	4.74	0.60224	.	0.149265	0.46758	D	0.000272	T	0.55924	0.1951	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.60530	-0.7245	10	0.66056	D	0.02	-21.8958	14.6091	0.68504	0.0:0.9296:0.0:0.0704	.	277	Q6UWI4	SHSA2_HUMAN	H	277	ENSP00000313079:Q277H	ENSP00000313079:Q277H	Q	-	3	2	SHISA2	25518708	1.000000	0.71417	0.996000	0.52242	0.854000	0.48673	2.473000	0.45145	1.364000	0.46038	0.650000	0.86243	CAG	.	.	.	none		0.567	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
DENND4A	10260	hgsc.bcm.edu	37	15	65983020	65983020	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr15:65983020C>T	ENST00000431932.2	-	22	3988	c.3780G>A	c.(3778-3780)gtG>gtA	p.V1260V	DENND4A_ENST00000443035.3_Silent_p.V1303V|DENND4A_ENST00000567323.1_5'Flank	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1260					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TGGTAAGTCTCACTGGCTTAG	0.413																																					p.V1303V		Atlas-SNP	.											.	DENND4A	217	.	0			c.G3909A						PASS	.						101.0	104.0	103.0					15																	65983020		1893	4107	6000	SO:0001819	synonymous_variant	10260	exon23			AAGTCTCACTGGC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.3780G>A	chr15.hg19:g.65983020C>T		133.0	0.0	.		100.0	29.0	.	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	hg19	CCDS45285.1																																																																																			.	.	.	none		0.413	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
SIN3A	25942	hgsc.bcm.edu	37	15	75692465	75692465	+	Silent	SNP	C	C	T	rs373830836		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr15:75692465C>T	ENST00000394947.3	-	12	2084	c.1770G>A	c.(1768-1770)tcG>tcA	p.S590S	SIN3A_ENST00000360439.4_Silent_p.S590S|SIN3A_ENST00000394949.4_Silent_p.S590S	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CCTCAGACCACGAAGGGAAGG	0.393																																					p.S590S		Atlas-SNP	.											.	SIN3A	152	.	0			c.G1770A						PASS	.	C	,,	0,4394		0,0,2197	96.0	91.0	93.0		1770,1770,1770	-12.2	0.2	15		93	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous,coding-synonymous,coding-synonymous	SIN3A	NM_001145357.1,NM_001145358.1,NM_015477.2	,,	0,1,6490	TT,TC,CC		0.0116,0.0,0.0077	,,	590/1274,590/1274,590/1274	75692465	1,12981	2197	4294	6491	SO:0001819	synonymous_variant	25942	exon12			AGACCACGAAGGG	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1770G>A	chr15.hg19:g.75692465C>T		86.0	0.0	.		87.0	32.0	.	NM_001145358		Silent	SNP	ENST00000394947.3	hg19	CCDS10279.1																																																																																			.	.	.	weak		0.393	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
CIITA	4261	hgsc.bcm.edu	37	16	10992850	10992850	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:10992850C>A	ENST00000324288.8	+	5	560	c.427C>A	c.(427-429)Cag>Aag	p.Q143K	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Missense_Mutation_p.Q143K	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	143					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GCAGAAAAGTCAGAAAAGACG	0.507			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.Q143K		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.C427A						PASS	.						159.0	151.0	154.0					16																	10992850		2197	4300	6497	SO:0001583	missense	4261	exon5			AAAAGTCAGAAAA	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.427C>A	chr16.hg19:g.10992850C>A	ENSP00000316328:p.Gln143Lys	115.0	0.0	.		137.0	29.0	.	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	hg19	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446255	0.43429	.	.	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	T;T	0.74842	-0.88;1.54	3.81	3.81	0.43845	.	0.428781	0.17282	N	0.179967	T	0.66626	0.2808	L	0.50333	1.59	0.25966	N	0.982563	P;P;B;B;P;B	0.40398	0.649;0.455;0.126;0.126;0.716;0.323	B;B;B;B;B;B	0.36567	0.228;0.094;0.049;0.049;0.228;0.079	T	0.64118	-0.6482	10	0.54805	T	0.06	.	11.3836	0.49771	0.0:1.0:0.0:0.0	.	143;143;143;143;144;143	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	K	143;143;144;143	ENSP00000316328:Q143K;ENSP00000371257:Q143K	ENSP00000316328:Q143K	Q	+	1	0	CIITA	10900351	0.989000	0.36119	0.889000	0.34880	0.900000	0.52787	3.160000	0.50739	2.134000	0.65973	0.557000	0.71058	CAG	.	.	.	none		0.507	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ANKRD11	29123	hgsc.bcm.edu	37	16	89349917	89349917	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr16:89349917C>G	ENST00000301030.4	-	9	3493	c.3033G>C	c.(3031-3033)aaG>aaC	p.K1011N	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K1011N	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1011	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GGCCATCCTTCTTCTCCTTCT	0.517																																					p.K1011N		Atlas-SNP	.											.	ANKRD11	195	.	0			c.G3033C						PASS	.						142.0	139.0	140.0					16																	89349917		2198	4300	6498	SO:0001583	missense	29123	exon9			ATCCTTCTTCTCC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3033G>C	chr16.hg19:g.89349917C>G	ENSP00000301030:p.Lys1011Asn	187.0	0.0	.		122.0	69.0	.	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.26|16.26	3.072498|3.072498	0.55646|0.55646	.|.	.|.	ENSG00000167522|ENSG00000167522	ENST00000301030;ENST00000378330|ENST00000330736	T;T|.	0.54071|.	0.59;0.59|.	5.5|5.5	3.5|3.5	0.40072|0.40072	.|.	0.059984|.	0.64402|.	D|.	0.000004|.	T|T	0.69324|0.69324	0.3098|0.3098	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D|.	0.59767|.	0.986|.	P|.	0.62435|.	0.902|.	T|T	0.71626|0.71626	-0.4536|-0.4536	10|6	0.51188|0.54805	T|T	0.08|0.06	.|.	12.1739|12.1739	0.54173|0.54173	0.0:0.8519:0.0:0.1481|0.0:0.8519:0.0:0.1481	.|.	1011|.	Q6UB99|.	ANR11_HUMAN|.	N|T	1011|562	ENSP00000301030:K1011N;ENSP00000367581:K1011N|.	ENSP00000301030:K1011N|ENSP00000330815:R562T	K|R	-|-	3|2	2|0	ANKRD11|ANKRD11	87877418|87877418	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.198000|0.198000	0.23893|0.23893	4.656000|4.656000	0.61483|0.61483	1.425000|1.425000	0.47237|0.47237	0.655000|0.655000	0.94253|0.94253	AAG|AGA	.	.	.	none		0.517	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
TP53	7157	hgsc.bcm.edu	37	17	7574002	7574002	+	Missense_Mutation	SNP	C	C	A	rs375338359		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr17:7574002C>A	ENST00000269305.4	-	10	1214	c.1025G>T	c.(1024-1026)cGa>cTa	p.R342L	TP53_ENST00000359597.4_Intron|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R342L|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R342P(3)|p.R342Q(2)|p.?(1)|p.R342_N345delRELN(1)|p.E343fs*3(1)|p.R342fs*3(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATTCAGCTCTCGGAACATCTC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R342L	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000269305,NS,malignant_melanoma,-1,10	TP53	33396	.	18	Whole gene deletion(8)|Substitution - Missense(5)|Deletion - Frameshift(3)|Unknown(1)|Deletion - In frame(1)	upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|ovary(2)|large_intestine(1)|stomach(1)	c.G1025T						PASS	.						62.0	48.0	53.0					17																	7574002		2203	4300	6503	SO:0001583	missense	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGCTCTCGGAACA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1025G>T	chr17.hg19:g.7574002C>A	ENSP00000269305:p.Arg342Leu	81.0	1.0	.		58.0	3.0	.	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.280933	0.23392	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.92595	-3.07;-3.07	5.43	2.35	0.29111	p53, tetramerisation domain (3);	0.217683	0.37906	N	0.001893	D	0.85349	0.5676	L	0.42581	1.335	0.19575	N	0.999965	B	0.10296	0.003	B	0.18871	0.023	T	0.70898	-0.4747	10	0.29301	T	0.29	-0.3792	4.3338	0.11076	0.1588:0.5914:0.0:0.2498	.	342	P04637	P53_HUMAN	L	342;342;331	ENSP00000269305:R342L;ENSP00000391478:R342L	ENSP00000269305:R342L	R	-	2	0	TP53	7514727	0.035000	0.19736	0.264000	0.24511	0.867000	0.49689	-0.268000	0.08607	0.271000	0.22005	0.561000	0.74099	CGA	.	.	.	alt		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIAA1468	57614	hgsc.bcm.edu	37	18	59888685	59888685	+	Silent	SNP	C	C	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr18:59888685C>T	ENST00000398130.2	+	5	1045	c.813C>T	c.(811-813)aaC>aaT	p.N271N	KIAA1468_ENST00000256858.6_Silent_p.N271N	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	271	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.									autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TGAAGAATAACTATAAGCTTA	0.303																																					p.N271N		Atlas-SNP	.											.	KIAA1468	93	.	0			c.C813T						PASS	.						52.0	49.0	50.0					18																	59888685		1803	4062	5865	SO:0001819	synonymous_variant	57614	exon5			GAATAACTATAAG	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.813C>T	chr18.hg19:g.59888685C>T		68.0	0.0	.		98.0	28.0	.	NM_020854		Silent	SNP	ENST00000398130.2	hg19	CCDS11979.2																																																																																			.	.	.	none		0.303	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
RHPN2	85415	hgsc.bcm.edu	37	19	33503622	33503622	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:33503622G>C	ENST00000254260.3	-	5	434	c.399C>G	c.(397-399)atC>atG	p.I133M	RHPN2_ENST00000400226.4_De_novo_Start_InFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	133	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					AATGTTCCAGGATAAAATCCT	0.348																																					p.I133M		Atlas-SNP	.											.	RHPN2	107	.	0			c.C399G						PASS	.						64.0	63.0	64.0					19																	33503622		2203	4300	6503	SO:0001583	missense	85415	exon5			TTCCAGGATAAAA	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.399C>G	chr19.hg19:g.33503622G>C	ENSP00000254260:p.Ile133Met	50.0	0.0	.		54.0	24.0	.	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	hg19	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045171	0.36085	.	.	ENSG00000131941	ENST00000254260	T	0.36340	1.26	4.67	-0.356	0.12583	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.65407	0.2688	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69316	-0.5177	10	0.87932	D	0	4.3606	9.4837	0.38917	0.5257:0.0:0.4743:0.0	.	133	Q8IUC4	RHPN2_HUMAN	M	133	ENSP00000254260:I133M	ENSP00000254260:I133M	I	-	3	3	RHPN2	38195462	1.000000	0.71417	0.998000	0.56505	0.408000	0.30992	0.918000	0.28678	0.003000	0.14656	0.455000	0.32223	ATC	.	.	.	none		0.348	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
KIAA0355	9710	hgsc.bcm.edu	37	19	34832921	34832921	+	Silent	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:34832921G>A	ENST00000299505.6	+	10	2955	c.2082G>A	c.(2080-2082)ctG>ctA	p.L694L		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	694										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGCCGTCACTGCCTGTGCCCC	0.632																																					p.L694L		Atlas-SNP	.											.	KIAA0355	105	.	0			c.G2082A						PASS	.						69.0	72.0	71.0					19																	34832921		2203	4299	6502	SO:0001819	synonymous_variant	9710	exon10			GTCACTGCCTGTG		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2082G>A	chr19.hg19:g.34832921G>A		133.0	0.0	.		111.0	35.0	.	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	hg19	CCDS12436.1																																																																																			.	.	.	none		0.632	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
IGFLR1	79713	hgsc.bcm.edu	37	19	36230750	36230750	+	Silent	SNP	G	G	C			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:36230750G>C	ENST00000592537.1	-	4	682	c.582C>G	c.(580-582)gcC>gcG	p.A194A	IGFLR1_ENST00000246532.1_Silent_p.A194A|AD000671.6_ENST00000589807.1_3'UTR|IGFLR1_ENST00000588992.1_Intron|KMT2B_ENST00000607650.1_RNA|IGFLR1_ENST00000592889.1_Intron|IGFLR1_ENST00000587101.1_5'UTR|IGFLR1_ENST00000344990.3_Intron			Q9H665	IGFR1_HUMAN	IGF-like family receptor 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(3)|large_intestine(1)|lung(8)|prostate(1)	15						GATAGGGGTCGGCTTTCTCCT	0.617																																					p.A194A		Atlas-SNP	.											.	IGFLR1	28	.	0			c.C582G						PASS	.						88.0	91.0	90.0					19																	36230750		2203	4300	6503	SO:0001819	synonymous_variant	79713	exon4			GGGGTCGGCTTTC	AK026226	CCDS12472.1	19q13.12	2012-10-02	2011-04-04	2011-04-04	ENSG00000126246	ENSG00000126246			23620	protein-coding gene	gene with protein product		614143	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 4"", ""transmembrane protein 149"""	U2AF1L4, TMEM149		21454693	Standard	NM_024660		Approved	FLJ22573	uc002obd.4	Q9H665		ENST00000592537.1:c.582C>G	chr19.hg19:g.36230750G>C		197.0	0.0	.		159.0	66.0	.	NM_024660	Q8N5X0	Silent	SNP	ENST00000592537.1	hg19	CCDS12472.1																																																																																			.	.	.	none		0.617	IGFLR1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459077.1	NM_024660	
CNFN	84518	hgsc.bcm.edu	37	19	42893120	42893120	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:42893120A>G	ENST00000222032.5	-	2	119	c.70T>C	c.(70-72)Tgg>Cgg	p.W24R	CNFN_ENST00000597255.1_Missense_Mutation_p.W24R	NM_032488.3	NP_115877.2	Q9BYD5	CNFN_HUMAN	cornifelin	24					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				lung(1)|prostate(1)	2		Prostate(69;0.00899)				CCTGTGTGCCAGTCACTGAGC	0.617																																					p.W24R		Atlas-SNP	.											.	CNFN	5	.	0			c.T70C						PASS	.						133.0	99.0	111.0					19																	42893120		2203	4300	6503	SO:0001583	missense	84518	exon2			TGTGCCAGTCACT	AB049591	CCDS12606.1	19q13.31	2006-01-11				ENSG00000105427			30183	protein-coding gene	gene with protein product		611764					Standard	NM_032488		Approved	PLAC8L2	uc002otp.4	Q9BYD5		ENST00000222032.5:c.70T>C	chr19.hg19:g.42893120A>G	ENSP00000222032:p.Trp24Arg	50.0	0.0	.		37.0	22.0	.	NM_032488	B2R569	Missense_Mutation	SNP	ENST00000222032.5	hg19	CCDS12606.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244613	0.59103	.	.	ENSG00000105427	ENST00000222032	T	0.29655	1.56	5.0	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	M	0.89658	3.05	0.46078	D	0.998858	D	0.56746	0.977	P	0.56612	0.802	T	0.60702	-0.7211	10	0.72032	D	0.01	-18.0017	10.0235	0.42057	0.8298:0.1702:0.0:0.0	.	24	Q9BYD5	CNFN_HUMAN	R	24	ENSP00000222032:W24R	ENSP00000222032:W24R	W	-	1	0	CNFN	47584960	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.707000	0.68370	0.847000	0.35167	-0.471000	0.05019	TGG	.	.	.	none		0.617	CNFN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463859.1	NM_032488	
DMPK	1760	hgsc.bcm.edu	37	19	46280763	46280763	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:46280763G>A	ENST00000291270.4	-	8	1093	c.968C>T	c.(967-969)aCa>aTa	p.T323I	DMPK_ENST00000343373.4_Missense_Mutation_p.T333I|DMPK_ENST00000458663.2_Missense_Mutation_p.T323I|DMPK_ENST00000600757.1_Missense_Mutation_p.T333I|DMPK_ENST00000354227.5_Missense_Mutation_p.T323I|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000447742.2_Missense_Mutation_p.T323I	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		GCCCAGCCGTGTCTCCGGGGG	0.647																																					p.T333I	Esophageal Squamous(35;307 869 9153 24033 28903)	Atlas-SNP	.											.	DMPK	74	.	0			c.C998T						PASS	.						39.0	41.0	40.0					19																	46280763		2203	4300	6503	SO:0001583	missense	1760	exon7			AGCCGTGTCTCCG	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.968C>T	chr19.hg19:g.46280763G>A	ENSP00000291270:p.Thr323Ile	82.0	0.0	.		76.0	31.0	.	NM_001081563	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	ENST00000291270.4	hg19	CCDS12674.1	.	.	.	.	.	.	.	.	.	.	g	6.239	0.412186	0.11812	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	4.63	-1.42	0.08913	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.960065	0.08582	N	0.924432	T	0.47985	0.1475	L	0.48935	1.535	0.09310	N	1	B;B;B;B;B;B;B;B	0.10296	0.001;0.0;0.003;0.001;0.001;0.001;0.001;0.0	B;B;B;B;B;B;B;B	0.12156	0.005;0.002;0.003;0.007;0.007;0.004;0.001;0.001	T	0.31392	-0.9945	10	0.21014	T	0.42	.	4.9214	0.13871	0.5892:0.0:0.2497:0.1611	.	323;323;349;323;323;323;370;333	Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;DMPK_HUMAN;.;.	I	323;349;323;323;323;333;333;323	ENSP00000401753:T323I;ENSP00000291270:T323I;ENSP00000413417:T323I;ENSP00000345997:T333I;ENSP00000346168:T323I	ENSP00000291270:T323I	T	-	2	0	DMPK	50972603	0.000000	0.05858	0.091000	0.20842	0.655000	0.38815	-1.221000	0.02968	-0.044000	0.13491	-0.254000	0.11334	ACA	.	.	.	none		0.647	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460572.1	NM_004409	
PRKCG	5582	hgsc.bcm.edu	37	19	54385815	54385815	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:54385815G>T	ENST00000263431.3	+	1	349	c.67G>T	c.(67-69)Ggg>Tgg	p.G23W	PRKCG_ENST00000540413.1_Missense_Mutation_p.G23W|PRKCG_ENST00000536044.1_Missense_Mutation_p.G23W|PRKCG_ENST00000542049.1_5'Flank	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	23					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TTGCAGAAAGGGGGCCCTGAG	0.627																																					p.G23W		Atlas-SNP	.											.	PRKCG	246	.	0			c.G67T						PASS	.						66.0	74.0	71.0					19																	54385815		2203	4300	6503	SO:0001583	missense	5582	exon1			AGAAAGGGGGCCC	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.67G>T	chr19.hg19:g.54385815G>T	ENSP00000263431:p.Gly23Trp	175.0	0.0	.		156.0	72.0	.	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	hg19	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929442	0.73327	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486	D;D;D	0.95069	-3.6;-3.6;-3.6	4.08	4.08	0.47627	.	.	.	.	.	D	0.96830	0.8965	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.97398	0.9994	9	0.87932	D	0	.	14.1554	0.65415	0.0:0.0:1.0:0.0	.	23;23;23;23	F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;KPCG_HUMAN	W	23;23;23;46	ENSP00000440541:G23W;ENSP00000443493:G23W;ENSP00000263431:G23W	ENSP00000263431:G23W	G	+	1	0	PRKCG	59077627	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.851000	0.92205	1.996000	0.58369	0.491000	0.48974	GGG	.	.	.	none		0.627	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
KIR3DL3	115653	hgsc.bcm.edu	37	19	55239373	55239373	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr19:55239373G>A	ENST00000291860.1	+	4	670	c.652G>A	c.(652-654)Gta>Ata	p.V218I	KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CATCGTGGTCGTAGGTGAGAG	0.542																																					p.V218I		Atlas-SNP	.											KIR3DL3,colon,carcinoma,0,1	KIR3DL3	46	.	0			c.G652A						PASS	.						8.0	8.0	8.0					19																	55239373		1846	3121	4967	SO:0001583	missense	115653	exon4			GTGGTCGTAGGTG	AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.652G>A	chr19.hg19:g.55239373G>A	ENSP00000291860:p.Val218Ile	181.0	0.0	.		146.0	65.0	.	NM_153443	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	hg19	CCDS12903.1	.	.	.	.	.	.	.	.	.	.	-	4.693	0.128795	0.08981	.	.	ENSG00000242019	ENST00000291860	T	0.00730	5.77	1.38	0.293	0.15742	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.958988	0.08407	N	0.950530	T	0.00328	0.0010	N	0.00436	-1.5	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44345	-0.9334	10	0.45353	T	0.12	.	4.3253	0.11038	0.5511:0.0:0.4489:0.0	.	218	Q8N743	KI3L3_HUMAN	I	218	ENSP00000291860:V218I	ENSP00000291860:V218I	V	+	1	0	KIR3DL3	59931185	0.003000	0.15002	0.002000	0.10522	0.002000	0.02628	-0.697000	0.05098	-0.402000	0.07633	-1.140000	0.01884	GTA	.	.	.	none		0.542	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
SAMHD1	25939	hgsc.bcm.edu	37	20	35563508	35563508	+	Missense_Mutation	SNP	G	G	C	rs121434517		TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr20:35563508G>C	ENST00000262878.4	-	4	632	c.433C>G	c.(433-435)Cga>Gga	p.R145G	SAMHD1_ENST00000373694.5_5'UTR	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	145			R -> Q (in AGS5). {ECO:0000269|PubMed:19525956}.		dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				TTGATGTATCGAAGACGTTGA	0.433																																					p.R145G		Atlas-SNP	.											.	SAMHD1	62	.	0			c.C433G						PASS	.						135.0	125.0	129.0					20																	35563508		2203	4300	6503	SO:0001583	missense	25939	exon4			TGTATCGAAGACG	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.433C>G	chr20.hg19:g.35563508G>C	ENSP00000262878:p.Arg145Gly	114.0	0.0	.		73.0	4.0	.	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	hg19	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343156	0.82022	.	.	ENSG00000101347	ENST00000262878	D	0.96522	-4.04	6.05	4.04	0.47022	HD domain (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98576	1.0648	10	0.87932	D	0	-16.0364	9.3019	0.37851	0.0657:0.0:0.6789:0.2553	.	145	Q9Y3Z3	SAMH1_HUMAN	G	145	ENSP00000262878:R145G	ENSP00000262878:R145G	R	-	1	2	SAMHD1	34996922	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	3.147000	0.50639	1.571000	0.49722	0.650000	0.86243	CGA	.	.	.	alt		0.433	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
EIF1AX	1964	hgsc.bcm.edu	37	X	20152121	20152121	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:20152121C>A	ENST00000379607.5	-	4	412	c.209G>T	c.(208-210)tGg>tTg	p.W70L	EIF1AX_ENST00000379593.1_Missense_Mutation_p.W42L|snoU2_19_ENST00000364722.1_RNA|snoU2-30_ENST00000365012.1_RNA	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	70	S1-like.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						GGTATTTATCCAAACCTACAA	0.323																																					p.W70L		Atlas-SNP	.											.	EIF1AX	21	.	0			c.G209T						PASS	.						56.0	47.0	50.0					X																	20152121		2203	4300	6503	SO:0001583	missense	1964	exon4			TTTATCCAAACCT	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.209G>T	chrX.hg19:g.20152121C>A	ENSP00000368927:p.Trp70Leu	37.0	0.0	.		33.0	20.0	.	NM_001412	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	ENST00000379607.5	hg19	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803652	0.90623	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.58652	0.32;0.32	5.64	5.64	0.86602	Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1, IF1 type (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	D	0.86653	0.5984	H	0.99090	4.425	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.92362	0.5898	9	0.87932	D	0	-3.1686	16.8722	0.86043	0.0:1.0:0.0:0.0	.	70	P47813	IF1AX_HUMAN	L	70;42	ENSP00000368927:W70L;ENSP00000368912:W42L	ENSP00000368912:W42L	W	-	2	0	EIF1AX	20062042	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.076000	0.76806	2.361000	0.80049	0.600000	0.82982	TGG	.	.	.	none		0.323	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058913.1		
GPR34	2857	hgsc.bcm.edu	37	X	41555435	41555435	+	Silent	SNP	T	T	A			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:41555435T>A	ENST00000378142.4	+	3	833	c.549T>A	c.(547-549)ctT>ctA	p.L183L	CASK_ENST00000442742.2_Intron|CASK_ENST00000318588.9_Intron|GPR34_ENST00000378138.5_Silent_p.L183L|CASK_ENST00000378154.1_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000421587.2_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	183					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TGCTTGCTCTTGGTGGATTCC	0.353																																					p.L183L		Atlas-SNP	.											.	GPR34	42	.	0			c.T549A						PASS	.						63.0	59.0	60.0					X																	41555435		2203	4300	6503	SO:0001819	synonymous_variant	2857	exon3			TGCTCTTGGTGGA	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.549T>A	chrX.hg19:g.41555435T>A		60.0	0.0	.		58.0	49.0	.	NM_001097579	O95853	Silent	SNP	ENST00000378142.4	hg19	CCDS14258.1																																																																																			.	.	.	none		0.353	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
BCORL1	63035	hgsc.bcm.edu	37	X	129173153	129173154	+	Frame_Shift_Ins	INS	-	-	CTGG			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chrX:129173153_129173154insCTGG	ENST00000218147.7	+	10	4711_4712	c.4514_4515insCTGG	c.(4513-4518)atctggfs	p.-1509fs	BCORL1_ENST00000303743.5_Frame_Shift_Ins_p.-1583fs|BCORL1_ENST00000540052.1_Frame_Shift_Ins_p.-1509fs|BCORL1_ENST00000359304.2_Frame_Shift_Ins_p.-1379fs			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CTGGAGACCATCTGGCTCCTGC	0.574																																					p.I1505fs		Atlas-INDEL	.											.	BCORL1	213	.	0			c.4514_4515insCTGG						PASS	.																																			SO:0001589	frameshift_variant	63035	exon9			.	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4515_4518dupCTGG	chrX.hg19:g.129173154_129173157dupCTGG	ENSP00000218147:p.Leu1509fs	74.0	0.0	0		38.0	22.0	0.578947	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Frame_Shift_Ins	INS	ENST00000218147.7	hg19	CCDS14616.1																																																																																			.	.	.	none		0.574	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
COL4A3BP	10087	hgsc.bcm.edu	37	5	74712823	74712828	+	In_Frame_Del	DEL	TACCAT	TACCAT	-			TCGA-BQ-5893-01A-11D-1589-08	TCGA-BQ-5893-11A-01D-1589-08	TACCAT	TACCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c3f8ab09-b776-4ca3-9b9d-f9848542f3dd	bbfe1ddb-1749-401c-b2f8-9b0854ae7d23	g.chr5:74712823_74712828delTACCAT	ENST00000405807.4	-	7	1131_1136	c.710_715delATGGTA	c.(709-717)aatggtata>ata	p.NG237del	COL4A3BP_ENST00000380494.5_In_Frame_Del_p.NG365del|COL4A3BP_ENST00000261415.7_In_Frame_Del_p.NG237del	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	237					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TTAAAGTCTATACCATTAATTCCTTT	0.32																																					p.365_367del		Atlas-INDEL	.											.	COL4A3BP	72	.	0			c.1095_1100del						PASS	.																																			SO:0001651	inframe_deletion	10087	exon8			.	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.710_715delATGGTA	chr5.hg19:g.74712823_74712828delTACCAT	ENSP00000383996:p.Asn237_Gly238del	89.0	0.0	0		73.0	26.0	0.356164	NM_001130105	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	In_Frame_Del	DEL	ENST00000405807.4	hg19	CCDS4028.1																																																																																			.	.	.	none		0.320	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713	
