#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLXNA2	5362	hgsc.bcm.edu	37	1	208270156	208270156	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr1:208270156C>A	ENST00000367033.3	-	7	2561	c.1804G>T	c.(1804-1806)Gtg>Ttg	p.V602L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	602					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TGCCCCTCCACCTCTGTCAGG	0.562																																					p.V602L		Atlas-SNP	.											.	PLXNA2	178	.	0			c.G1804T						PASS	.						76.0	63.0	67.0					1																	208270156		2203	4300	6503	SO:0001583	missense	5362	exon7			CCTCCACCTCTGT	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1804G>T	chr1.hg19:g.208270156C>A	ENSP00000356000:p.Val602Leu	82.0	0.0	.		63.0	20.0	.	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764098	0.31228	.	.	ENSG00000076356	ENST00000367033	T	0.00856	5.61	4.92	4.92	0.64577	.	0.309702	0.38837	N	0.001558	T	0.01695	0.0054	L	0.57536	1.79	0.58432	D	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.61272	-0.7096	10	0.22109	T	0.4	.	18.3153	0.90218	0.0:1.0:0.0:0.0	.	602	O75051	PLXA2_HUMAN	L	602	ENSP00000356000:V602L	ENSP00000356000:V602L	V	-	1	0	PLXNA2	206336779	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.321000	0.65846	2.563000	0.86464	0.655000	0.94253	GTG	.	.	.	none		0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
MBD5	55777	hgsc.bcm.edu	37	2	149226038	149226038	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:149226038A>G	ENST00000407073.1	+	9	1523	c.526A>G	c.(526-528)Aat>Gat	p.N176D	MBD5_ENST00000404807.1_Missense_Mutation_p.N176D	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	176					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGGATCATCAAATGCCATGGG	0.423																																					p.N176D		Atlas-SNP	.											.	MBD5	164	.	0			c.A526G						PASS	.						77.0	73.0	74.0					2																	149226038		2203	4300	6503	SO:0001583	missense	55777	exon9			TCATCAAATGCCA	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.526A>G	chr2.hg19:g.149226038A>G	ENSP00000386049:p.Asn176Asp	94.0	0.0	.		99.0	24.0	.	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	hg19	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.227484	0.58668	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.45668	0.89;0.89	5.16	5.16	0.70880	.	0.088275	0.49305	D	0.000155	T	0.30070	0.0753	N	0.08118	0	0.33054	D	0.533103	D	0.56968	0.978	P	0.47528	0.549	T	0.43015	-0.9417	10	0.40728	T	0.16	-3.4654	13.8586	0.63545	1.0:0.0:0.0:0.0	.	176	Q9P267	MBD5_HUMAN	D	176	ENSP00000386049:N176D;ENSP00000384672:N176D	ENSP00000384672:N176D	N	+	1	0	MBD5	148942508	1.000000	0.71417	0.909000	0.35828	0.972000	0.66771	4.483000	0.60264	2.079000	0.62486	0.482000	0.46254	AAT	.	.	.	none		0.423	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
CYTIP	9595	hgsc.bcm.edu	37	2	158287080	158287080	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr2:158287080T>C	ENST00000264192.3	-	5	588	c.467A>G	c.(466-468)aAc>aGc	p.N156S	CYTIP_ENST00000540637.1_Missense_Mutation_p.N50S|CYTIP_ENST00000497432.1_5'Flank	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	156	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						CGTTAGCAGGTTTCCGGACGA	0.428																																					p.N156S		Atlas-SNP	.											.	CYTIP	45	.	0			c.A467G						PASS	.						173.0	152.0	159.0					2																	158287080		2203	4300	6503	SO:0001583	missense	9595	exon5			AGCAGGTTTCCGG	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.467A>G	chr2.hg19:g.158287080T>C	ENSP00000264192:p.Asn156Ser	78.0	0.0	.		87.0	17.0	.	NM_004288	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	hg19	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427467	0.62733	.	.	ENSG00000115165	ENST00000264192;ENST00000540637;ENST00000418920	T;T;T	0.24908	1.83;1.83;1.83	5.87	4.71	0.59529	PDZ/DHR/GLGF (4);	0.040138	0.85682	N	0.000000	T	0.34366	0.0895	N	0.26162	0.8	0.40568	D	0.981273	D	0.61080	0.989	D	0.77557	0.99	T	0.15838	-1.0423	10	0.59425	D	0.04	-24.1417	8.8383	0.35126	0.0:0.0847:0.0:0.9153	.	156	O60759	CYTIP_HUMAN	S	156;50;50	ENSP00000264192:N156S;ENSP00000440801:N50S;ENSP00000394308:N50S	ENSP00000264192:N156S	N	-	2	0	CYTIP	157995326	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	2.314000	0.43743	1.149000	0.42402	0.533000	0.62120	AAC	.	.	.	none		0.428	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
PDZD2	23037	hgsc.bcm.edu	37	5	32108131	32108131	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr5:32108131A>G	ENST00000438447.1	+	25	8798	c.8410A>G	c.(8410-8412)Aat>Gat	p.N2804D	CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000282493.3_Missense_Mutation_p.N2804D|PDZD2_ENST00000513490.1_3'UTR			O15018	PDZD2_HUMAN	PDZ domain containing 2	2804	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCTTGCTATTAATGGGAAACC	0.403																																					p.N2804D		Atlas-SNP	.											.	PDZD2	306	.	0			c.A8410G						PASS	.						134.0	139.0	137.0					5																	32108131		2203	4300	6503	SO:0001583	missense	23037	exon24			GCTATTAATGGGA	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8410A>G	chr5.hg19:g.32108131A>G	ENSP00000402033:p.Asn2804Asp	159.0	0.0	.		126.0	53.0	.	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	hg19	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.233379	0.79688	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.56776	0.44;0.44	5.88	5.88	0.94601	PDZ/DHR/GLGF (4);	0.097034	0.45867	D	0.000337	T	0.59742	0.2216	L	0.41415	1.275	0.35013	D	0.757058	D	0.76494	0.999	D	0.71870	0.975	T	0.68269	-0.5453	10	0.39692	T	0.17	.	8.7229	0.34452	0.9164:0.0:0.0836:0.0	.	2804	O15018	PDZD2_HUMAN	D	2804;2605;2804	ENSP00000402033:N2804D;ENSP00000282493:N2804D	ENSP00000282493:N2804D	N	+	1	0	PDZD2	32143888	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	3.761000	0.55242	2.242000	0.73789	0.533000	0.62120	AAT	.	.	.	none		0.403	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
SLIT3	6586	hgsc.bcm.edu	37	5	168098301	168098301	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr5:168098301G>C	ENST00000519560.1	-	34	4448	c.4029C>G	c.(4027-4029)tgC>tgG	p.C1343W	SLIT3_ENST00000332966.8_Missense_Mutation_p.C1350W|SLIT3_ENST00000404867.3_Missense_Mutation_p.C1343W	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1343	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.C1343*(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCACGGAGCGGCACAGGCCGT	0.677																																					p.C1350W	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											SLIT3,NS,carcinoma,0,1	SLIT3	224	.	1	Substitution - Nonsense(1)	lung(1)	c.C4050G						PASS	.						43.0	35.0	37.0					5																	168098301		2203	4300	6503	SO:0001583	missense	6586	exon34			GGAGCGGCACAGG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.4029C>G	chr5.hg19:g.168098301G>C	ENSP00000430333:p.Cys1343Trp	50.0	0.0	.		36.0	2.0	.	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	14.96	2.692168	0.48202	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.82433	-1.6;-1.61;-1.59	5.16	-3.59	0.04583	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.91952	0.7451	H	0.95004	3.61	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.91550	0.5256	10	0.72032	D	0.01	.	15.2185	0.73288	0.6215:0.0:0.3785:0.0	.	1343	O75094	SLIT3_HUMAN	W	1343;1350;1343	ENSP00000430333:C1343W;ENSP00000332164:C1350W;ENSP00000384890:C1343W	ENSP00000332164:C1350W	C	-	3	2	SLIT3	168030879	0.999000	0.42202	0.356000	0.25785	0.910000	0.53928	0.533000	0.23082	-0.956000	0.03631	-1.598000	0.00824	TGC	.	.	.	none		0.677	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
GMDS	2762	hgsc.bcm.edu	37	6	1930387	1930387	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:1930387C>T	ENST00000380815.4	-	7	990	c.721G>A	c.(721-723)Gga>Aga	p.G241R	GMDS_ENST00000530927.1_Missense_Mutation_p.G211R	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	241					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TCCAGATTTCCCAAACTGAAA	0.408																																					p.G241R		Atlas-SNP	.											.	GMDS	44	.	0			c.G721A						PASS	.						143.0	124.0	131.0					6																	1930387		2203	4300	6503	SO:0001583	missense	2762	exon7			GATTTCCCAAACT	AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.721G>A	chr6.hg19:g.1930387C>T	ENSP00000370194:p.Gly241Arg	163.0	0.0	.		134.0	33.0	.	NM_001500	E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Missense_Mutation	SNP	ENST00000380815.4	hg19	CCDS4474.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953109	0.92660	.	.	ENSG00000112699	ENST00000530927;ENST00000380815	D;D	0.95656	-3.77;-3.77	5.63	5.63	0.86233	NAD-dependent epimerase/dehydratase (1);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	H	0.99415	4.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99198	1.0872	10	0.87932	D	0	-19.5481	19.6914	0.96002	0.0:1.0:0.0:0.0	.	241	O60547	GMDS_HUMAN	R	211;241	ENSP00000436726:G211R;ENSP00000370194:G241R	ENSP00000370194:G241R	G	-	1	0	GMDS	1875386	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.644000	0.89710	0.563000	0.77884	GGA	.	.	.	none		0.408	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043380.3		
MEP1A	4224	hgsc.bcm.edu	37	6	46801054	46801054	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:46801054A>G	ENST00000230588.4	+	11	1397	c.1388A>G	c.(1387-1389)gAg>gGg	p.E463G		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	463	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TACAATTCGGAGGGATATGGT	0.498																																					p.E463G		Atlas-SNP	.											.	MEP1A	93	.	0			c.A1388G						PASS	.						74.0	76.0	75.0					6																	46801054		2203	4300	6503	SO:0001583	missense	4224	exon11			ATTCGGAGGGATA		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.1388A>G	chr6.hg19:g.46801054A>G	ENSP00000230588:p.Glu463Gly	157.0	0.0	.		130.0	19.0	.	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	ENST00000230588.4	hg19	CCDS4918.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.965894	0.53507	.	.	ENSG00000112818	ENST00000230588	T	0.42900	0.96	5.72	5.72	0.89469	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73269	-0.4036	10	0.72032	D	0.01	-31.3608	15.9995	0.80280	1.0:0.0:0.0:0.0	.	491;463	B7ZL91;Q16819	.;MEP1A_HUMAN	G	463	ENSP00000230588:E463G	ENSP00000230588:E463G	E	+	2	0	MEP1A	46909013	1.000000	0.71417	0.998000	0.56505	0.073000	0.16967	9.339000	0.96797	2.186000	0.69663	0.528000	0.53228	GAG	.	.	.	none		0.498	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
OPN5	221391	hgsc.bcm.edu	37	6	47754339	47754339	+	Silent	SNP	C	C	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:47754339C>A	ENST00000371211.2	+	2	247	c.219C>A	c.(217-219)atC>atA	p.I73I	OPN5_ENST00000489301.2_Silent_p.I73I|OPN5_ENST00000393699.2_Silent_p.I73I	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	73					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.I73I(1)		endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						TAATGACTATCAATTTAGCAG	0.403																																					p.I73I	Melanoma(28;740 973 10870 42660 45347)	Atlas-SNP	.											OPN5,NS,carcinoma,0,1	OPN5	58	.	1	Substitution - coding silent(1)	lung(1)	c.C219A						PASS	.						139.0	128.0	132.0					6																	47754339		2203	4300	6503	SO:0001819	synonymous_variant	221391	exon2			GACTATCAATTTA	AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.219C>A	chr6.hg19:g.47754339C>A		137.0	1.0	.		123.0	43.0	.	NM_181744	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Silent	SNP	ENST00000371211.2	hg19	CCDS4923.1																																																																																			.	.	.	none		0.403	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359451.1	NM_181744	
COL19A1	1310	hgsc.bcm.edu	37	6	70639518	70639518	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr6:70639518G>T	ENST00000322773.4	+	6	694	c.592G>T	c.(592-594)Gat>Tat	p.D198Y		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	198	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GAGGCAGACTGATGAAAAGGA	0.423																																					p.D198Y		Atlas-SNP	.											.	COL19A1	232	.	0			c.G592T						PASS	.						111.0	106.0	108.0					6																	70639518		2203	4300	6503	SO:0001583	missense	1310	exon6			CAGACTGATGAAA		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.592G>T	chr6.hg19:g.70639518G>T	ENSP00000316030:p.Asp198Tyr	150.0	0.0	.		93.0	16.0	.	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	hg19	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	3.418	-0.118699	0.06838	.	.	ENSG00000082293	ENST00000322773	T	0.02525	4.26	5.64	3.86	0.44501	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.564051	0.17635	N	0.167232	T	0.01800	0.0057	L	0.50333	1.59	0.80722	D	1	P	0.52842	0.956	B	0.41723	0.365	T	0.57648	-0.7775	10	0.66056	D	0.02	.	11.8431	0.52366	0.1408:0.0:0.8592:0.0	.	198	Q14993	COJA1_HUMAN	Y	198	ENSP00000316030:D198Y	ENSP00000316030:D198Y	D	+	1	0	COL19A1	70696239	0.997000	0.39634	0.001000	0.08648	0.020000	0.10135	5.263000	0.65507	0.732000	0.32470	0.655000	0.94253	GAT	.	.	.	none		0.423	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
KIAA2026	158358	hgsc.bcm.edu	37	9	5922386	5922386	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr9:5922386T>G	ENST00000399933.3	-	8	3609	c.3610A>C	c.(3610-3612)Agc>Cgc	p.S1204R	KIAA2026_ENST00000381461.2_Missense_Mutation_p.S1174R	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1204										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCACTCTGGCTAGTCTTAACT	0.453																																					p.S1204R		Atlas-SNP	.											.	KIAA2026	231	.	0			c.A3610C						PASS	.						115.0	112.0	113.0					9																	5922386		2013	4183	6196	SO:0001583	missense	158358	exon8			TCTGGCTAGTCTT	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.3610A>C	chr9.hg19:g.5922386T>G	ENSP00000382815:p.Ser1204Arg	115.0	0.0	.		97.0	32.0	.	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	hg19		.	.	.	.	.	.	.	.	.	.	T	14.67	2.603738	0.46423	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.99	4.99	0.66335	.	0.365571	0.26975	N	0.021550	T	0.30665	0.0772	L	0.27053	0.805	0.28046	N	0.933557	P	0.35908	0.527	B	0.35470	0.203	T	0.32214	-0.9915	9	0.62326	D	0.03	-2.703	11.277	0.49172	0.1362:0.0:0.0:0.8638	.	1204	Q5HYC2	K2026_HUMAN	R	1204;1174	.	ENSP00000370870:S1174R	S	-	1	0	KIAA2026	5912386	0.984000	0.35163	0.997000	0.53966	0.663000	0.39108	3.354000	0.52254	2.102000	0.63906	0.454000	0.30748	AGC	.	.	.	none		0.453	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
STAM	8027	hgsc.bcm.edu	37	10	17747670	17747670	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr10:17747670T>A	ENST00000377524.3	+	12	1354	c.1139T>A	c.(1138-1140)aTg>aAg	p.M380K	STAM_ENST00000540523.1_Missense_Mutation_p.M269K	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	380	ITAM.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						GAAGATCCGATGTATTCCATG	0.368																																					p.M380K		Atlas-SNP	.											.	STAM	60	.	0			c.T1139A						PASS	.						160.0	153.0	156.0					10																	17747670		2203	4300	6503	SO:0001583	missense	8027	exon12			ATCCGATGTATTC	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.1139T>A	chr10.hg19:g.17747670T>A	ENSP00000366746:p.Met380Lys	228.0	0.0	.		166.0	48.0	.	NM_003473	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	hg19	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.077571	0.55753	.	.	ENSG00000136738	ENST00000377524;ENST00000540523	T;T	0.38722	1.47;1.12	5.64	4.49	0.54785	.	0.132590	0.64402	D	0.000002	T	0.33089	0.0851	L	0.48642	1.525	0.52501	D	0.999957	P;B	0.36048	0.534;0.173	B;B	0.32211	0.142;0.031	T	0.11494	-1.0585	10	0.28530	T	0.3	-5.6897	11.8463	0.52387	0.0:0.0697:0.0:0.9303	.	269;380	B4DZT2;Q92783	.;STAM1_HUMAN	K	380;269	ENSP00000366746:M380K;ENSP00000438073:M269K	ENSP00000366746:M380K	M	+	2	0	STAM	17787676	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	7.698000	0.84413	2.152000	0.67230	0.533000	0.62120	ATG	.	.	.	none		0.368	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
OR52N5	390075	hgsc.bcm.edu	37	11	5799428	5799428	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:5799428G>T	ENST00000317093.2	-	1	469	c.437C>A	c.(436-438)aCc>aAc	p.T146N	TRIM5_ENST00000380027.1_Intron	NM_001001922.2	NP_001001922.2	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N, member 5	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(1)|lung(17)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GATAGGGTTGGTGAGTGTGGT	0.507																																					p.T146N		Atlas-SNP	.											.	OR52N5	58	.	0			c.C437A						PASS	.						146.0	115.0	126.0					11																	5799428		2125	4095	6220	SO:0001583	missense	390075	exon1			GGGTTGGTGAGTG	AB065535	CCDS31397.1	11p15.4	2012-08-09			ENSG00000181009	ENSG00000181009		"""GPCR / Class A : Olfactory receptors"""	15231	protein-coding gene	gene with protein product							Standard	NM_001001922		Approved	OR52N5Q	uc010qzn.2	Q8NH56	OTTHUMG00000168799	ENST00000317093.2:c.437C>A	chr11.hg19:g.5799428G>T	ENSP00000322866:p.Thr146Asn	54.0	0.0	.		34.0	11.0	.	NM_001001922	B9EH12|Q6IFG2	Missense_Mutation	SNP	ENST00000317093.2	hg19	CCDS31397.1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245082	0.39697	.	.	ENSG00000181009	ENST00000317093	T	0.01051	5.4	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31697	U	0.007215	T	0.04048	0.0113	L	0.50919	1.6	0.38487	D	0.947868	D	0.62365	0.991	D	0.65010	0.931	T	0.54715	-0.8252	10	0.51188	T	0.08	.	14.1011	0.65056	0.0:0.0:1.0:0.0	.	146	Q8NH56	O52N5_HUMAN	N	146	ENSP00000322866:T146N	ENSP00000322866:T146N	T	-	2	0	OR52N5	5756004	0.994000	0.37717	0.771000	0.31576	0.554000	0.35429	2.842000	0.48230	1.952000	0.56665	0.494000	0.49563	ACC	.	.	.	none		0.507	OR52N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401141.1	NM_001001922	
BUD13	84811	hgsc.bcm.edu	37	11	116633298	116633298	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr11:116633298A>G	ENST00000260210.4	-	4	1030	c.1007T>C	c.(1006-1008)tTt>tCt	p.F336S	BUD13_ENST00000375445.3_Intron	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	336					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		CTTGTCTCCAAAATGGGATTT	0.443																																					p.F336S		Atlas-SNP	.											.	BUD13	41	.	0			c.T1007C						PASS	.						134.0	120.0	125.0					11																	116633298		2201	4296	6497	SO:0001583	missense	84811	exon4			TCTCCAAAATGGG	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.1007T>C	chr11.hg19:g.116633298A>G	ENSP00000260210:p.Phe336Ser	267.0	0.0	.		213.0	66.0	.	NM_032725	A8K0S0|Q96LS7	Missense_Mutation	SNP	ENST00000260210.4	hg19	CCDS8374.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503865	0.44558	.	.	ENSG00000137656	ENST00000260210	T	0.16597	2.33	4.83	-1.94	0.07571	.	1.189750	0.05897	N	0.629384	T	0.12008	0.0292	L	0.31926	0.97	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.41502	-0.9505	10	0.87932	D	0	-0.611	3.4276	0.07416	0.4025:0.0:0.1998:0.3978	.	336;336	A8K4Z6;Q9BRD0	.;BUD13_HUMAN	S	336	ENSP00000260210:F336S	ENSP00000260210:F336S	F	-	2	0	BUD13	116138508	0.000000	0.05858	0.276000	0.24689	0.974000	0.67602	0.121000	0.15667	0.010000	0.14839	0.533000	0.62120	TTT	.	.	.	none		0.443	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725	
HECTD4	283450	hgsc.bcm.edu	37	12	112694159	112694159	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr12:112694159C>T	ENST00000430131.2	-	20	3141	c.1996G>A	c.(1996-1998)Gat>Aat	p.D666N	HECTD4_ENST00000550722.1_Missense_Mutation_p.D952N|HECTD4_ENST00000377560.5_Missense_Mutation_p.D916N|RP3-521E19.2_ENST00000547401.1_RNA			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	666					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CATCTGCTATCAAATCTAAGG	0.423																																					p.D954N		Atlas-SNP	.											.	.	.	.	0			c.G2860A						PASS	.						126.0	129.0	128.0					12																	112694159		2203	4300	6503	SO:0001583	missense	283450	exon21			TGCTATCAAATCT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1996G>A	chr12.hg19:g.112694159C>T	ENSP00000404379:p.Asp666Asn	191.0	0.0	.		177.0	55.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.948543	0.97134	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.65178	-0.02;0.0;-0.14	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.70919	0.3279	L	0.27053	0.805	0.58432	D	0.999995	D;D;D	0.67145	0.996;0.993;0.996	D;D;D	0.73708	0.981;0.971;0.981	T	0.73202	-0.4057	10	0.87932	D	0	.	19.4096	0.94665	0.0:1.0:0.0:0.0	.	666;666;666	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	N	916;666;952	ENSP00000366783:D916N;ENSP00000404379:D666N;ENSP00000449784:D952N	ENSP00000366783:D916N	D	-	1	0	C12orf51	111178542	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.298000	0.78815	2.820000	0.97059	0.655000	0.94253	GAT	.	.	.	none		0.423	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
WDR45B	56270	hgsc.bcm.edu	37	17	80579499	80579499	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr17:80579499T>C	ENST00000392325.4	-	6	798	c.604A>G	c.(604-606)Act>Gct	p.T202A	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	202																	TCGGATGCAGTTGCAATTCTT	0.542																																					p.T202A		Atlas-SNP	.											.	.	.	.	0			c.A604G						PASS	.						127.0	97.0	107.0					17																	80579499		2203	4300	6503	SO:0001583	missense	56270	exon6			ATGCAGTTGCAAT	AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.604A>G	chr17.hg19:g.80579499T>C	ENSP00000376139:p.Thr202Ala	103.0	0.0	.		81.0	11.0	.	NM_019613	O95328|Q2MCP6|Q6IBN2	Missense_Mutation	SNP	ENST00000392325.4	hg19	CCDS11815.2	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618375	0.66787	.	.	ENSG00000141580	ENST00000392325;ENST00000539012	T	0.57907	0.37	4.82	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81327	0.4799	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87771	0.2605	10	0.72032	D	0.01	-25.7216	14.6708	0.68942	0.0:0.0:0.0:1.0	.	202	Q5MNZ6	WIPI3_HUMAN	A	202;174	ENSP00000376139:T202A	ENSP00000376139:T202A	T	-	1	0	WDR45L	78172788	1.000000	0.71417	0.910000	0.35882	0.534000	0.34807	7.503000	0.81632	1.935000	0.56089	0.460000	0.39030	ACT	.	.	.	none		0.542	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316536.1	NM_019613	
KLK3	354	hgsc.bcm.edu	37	19	51359636	51359636	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr19:51359636G>T	ENST00000326003.2	+	2	228	c.187G>T	c.(187-189)Gct>Tct	p.A63S	KLK3_ENST00000593997.1_Missense_Mutation_p.A63S|KLK3_ENST00000595952.1_Missense_Mutation_p.A63S|KLK3_ENST00000597483.1_Missense_Mutation_p.A63S|KLK3_ENST00000360617.3_Missense_Mutation_p.A63S	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	63	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GGTCCTCACAGCTGCCCACTG	0.617																																					p.A63S	Colon(185;1767 2023 13025 30120 37630)	Atlas-SNP	.											.	KLK3	76	.	0			c.G187T						PASS	.						76.0	77.0	77.0					19																	51359636		2203	4300	6503	SO:0001583	missense	354	exon2			CTCACAGCTGCCC	X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.187G>T	chr19.hg19:g.51359636G>T	ENSP00000314151:p.Ala63Ser	172.0	0.0	.		144.0	42.0	.	NM_001030050	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	ENST00000326003.2	hg19	CCDS12807.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281163	0.40394	.	.	ENSG00000142515	ENST00000326003;ENST00000422986;ENST00000360617;ENST00000435152;ENST00000326052	D;D;D	0.95272	-3.66;-3.66;-3.66	2.91	1.81	0.25067	.	0.000000	0.32041	N	0.006661	D	0.96231	0.8771	M	0.77486	2.375	0.27490	N	0.952326	D;D;D;D	0.89917	0.998;0.987;0.999;1.0	D;D;D;D	0.91635	0.951;0.923;0.976;0.999	D	0.90785	0.4682	10	0.87932	D	0	.	8.8252	0.35050	0.0:0.0:0.7734:0.2266	.	63;63;63;63	Q8NCW4;G3XAE3;G3V0H4;C9JXH3	.;.;.;.	S	63	ENSP00000314151:A63S;ENSP00000393628:A63S;ENSP00000353829:A63S	ENSP00000314151:A63S	A	+	1	0	KLK3	56051448	0.999000	0.42202	0.987000	0.45799	0.256000	0.26092	6.780000	0.75063	0.516000	0.28340	0.436000	0.28706	GCT	.	.	.	none		0.617	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464067.1	NM_145864	
SLC23A2	9962	hgsc.bcm.edu	37	20	4854628	4854628	+	Silent	SNP	C	C	T			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:4854628C>T	ENST00000379333.1	-	11	1448	c.1056G>A	c.(1054-1056)agG>agA	p.R352R	SLC23A2_ENST00000338244.1_Silent_p.R352R|SLC23A2_ENST00000424750.2_Silent_p.R238R|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	352					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCACGCCTTGCCTGGCATCTG	0.547																																					p.R352R		Atlas-SNP	.											.	SLC23A2	62	.	0			c.G1056A						PASS	.						117.0	103.0	108.0					20																	4854628		2203	4300	6503	SO:0001819	synonymous_variant	9962	exon11			GCCTTGCCTGGCA	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1056G>A	chr20.hg19:g.4854628C>T		176.0	0.0	.		161.0	7.0	.	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Silent	SNP	ENST00000379333.1	hg19	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	C	0.340	-0.951260	0.02285	.	.	ENSG00000089057	ENST00000423430	.	.	.	5.72	-2.31	0.06765	.	.	.	.	.	T	0.50650	0.1628	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.46721	-0.9171	4	.	.	.	-23.1993	6.8431	0.23973	0.0:0.4114:0.1221:0.4665	.	.	.	.	T	109	.	.	A	-	1	0	SLC23A2	4802628	0.430000	0.25538	0.065000	0.19835	0.002000	0.02628	-0.233000	0.09041	-0.035000	0.13691	-0.140000	0.14226	GCA	.	.	.	none		0.547	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
JAG1	182	hgsc.bcm.edu	37	20	10621489	10621489	+	Silent	SNP	C	C	A	rs202075581	byFrequency	TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr20:10621489C>A	ENST00000254958.5	-	25	3656	c.3141G>T	c.(3139-3141)tcG>tcT	p.S1047S	JAG1_ENST00000423891.2_Silent_p.S888S	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1047					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CAGCAATCAGCGAGCTGTTTC	0.448									Alagille Syndrome																												p.S1047S		Atlas-SNP	.											.	JAG1	213	.	0			c.G3141T						PASS	.						113.0	100.0	104.0					20																	10621489		2203	4300	6503	SO:0001819	synonymous_variant	182	exon25	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AATCAGCGAGCTG	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3141G>T	chr20.hg19:g.10621489C>A		101.0	0.0	.		74.0	5.0	.	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Silent	SNP	ENST00000254958.5	hg19	CCDS13112.1																																																																																			.	C|0.999;T|0.001	.	alt		0.448	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
KCNJ4	3761	hgsc.bcm.edu	37	22	38823432	38823433	+	In_Frame_Ins	INS	-	-	GGA			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr22:38823432_38823433insGGA	ENST00000303592.3	-	2	963_964	c.705_706insTCC	c.(703-708)ctgccc>ctgTCCccc	p.235_236LP>LSP	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	235					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					TGGTCCAGGGGCAGGTACTCGC	0.629																																					p.P236delinsSP		Atlas-INDEL	.											.	KCNJ4	74	.	0			c.706_707insTCC						PASS	.																																			SO:0001652	inframe_insertion	3761	exon2			.	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.705_706insTCC	chr22.hg19:g.38823432_38823433insGGA	ENSP00000306497:p.Leu235_Pro236insSer	72.0	0.0	0		54.0	13.0	0.240741	NM_004981	Q14D44	In_Frame_Ins	INS	ENST00000303592.3	hg19	CCDS13971.1																																																																																			.	.	.	none		0.629	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
DUSP12	11266	hgsc.bcm.edu	37	1	161726704	161726704	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-5894-01A-11D-1589-08	TCGA-BQ-5894-11A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91c4ab90-4133-4ba6-a47b-c71a8401b3eb	2cdd7b73-3fff-470a-81b6-2d03e2025874	g.chr1:161726704delG	ENST00000367943.4	+	6	1022	c.990delG	c.(988-990)ttgfs	p.L330fs		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	330					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TGAAAATATTGCCTGTTTTGG	0.373																																					p.L330fs		Atlas-INDEL	.											.	DUSP12	20	.	0			c.989delT						PASS	.																																			SO:0001589	frameshift_variant	11266	exon6			.	AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.990delG	chr1.hg19:g.161726704delG	ENSP00000356920:p.Leu330fs	82.0	0.0	0		68.0	23.0	0.338235	NM_007240	Q5VXA8	Frame_Shift_Del	DEL	ENST00000367943.4	hg19	CCDS1234.1																																																																																			.	.	.	none		0.373	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083588.1	NM_007240	
