#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu	37	1	34180229	34180229	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:34180229C>T	ENST00000373381.4	-	21	3540	c.3364G>A	c.(3364-3366)Ggc>Agc	p.G1122S		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1082	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGCCGTCTGCCCCCCAGGCAC	0.607																																					p.G1082S		Atlas-SNP	.											.	CSMD2	946	.	0			c.G3244A						PASS	.						120.0	136.0	131.0					1																	34180229		2203	4300	6503	SO:0001583	missense	114784	exon21			GTCTGCCCCCCAG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.3364G>A	chr1.hg19:g.34180229C>T	ENSP00000362479:p.Gly1122Ser	302.0	0.0	.		106.0	71.0	.	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.810255	0.96975	.	.	ENSG00000121904	ENST00000373381	T	0.24151	1.87	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.48040	0.1478	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	0.998;1.0	T	0.21075	-1.0256	10	0.46703	T	0.11	.	19.1531	0.93496	0.0:1.0:0.0:0.0	.	1082;1122	Q7Z408;E7EUA6	CSMD2_HUMAN;.	S	1122	ENSP00000362479:G1122S	ENSP00000241312:G1082S	G	-	1	0	CSMD2	33952816	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.753000	0.94483	0.655000	0.94253	GGC	.	.	.	none		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
ENSA	2029	hgsc.bcm.edu	37	1	150601936	150601936	+	Missense_Mutation	SNP	T	T	G	rs148754482		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr1:150601936T>G	ENST00000369014.5	-	1	136	c.11A>C	c.(10-12)aAa>aCa	p.K4T	ENSA_ENST00000503345.1_Missense_Mutation_p.K4T|ENSA_ENST00000362052.7_Missense_Mutation_p.K4T|ENSA_ENST00000339643.5_Missense_Mutation_p.K4T|ENSA_ENST00000369016.4_Missense_Mutation_p.K4T|ENSA_ENST00000361532.5_5'Flank|ENSA_ENST00000503241.1_Missense_Mutation_p.K4T|ENSA_ENST00000354702.3_5'Flank|ENSA_ENST00000361631.5_5'Flank|ENSA_ENST00000271690.8_Missense_Mutation_p.K4T|ENSA_ENST00000513281.1_5'Flank|ENSA_ENST00000356527.5_Missense_Mutation_p.K4T|ENSA_ENST00000369009.3_Missense_Mutation_p.K4T			O43768	ENSA_HUMAN	endosulfine alpha	4					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|regulation of catalytic activity (GO:0050790)|regulation of insulin secretion (GO:0050796)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|transport (GO:0006810)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ion channel inhibitor activity (GO:0008200)|phosphatase inhibitor activity (GO:0019212)|potassium channel inhibitor activity (GO:0019870)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)	4	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;9.85e-23)|all cancers(9;5.06e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.67e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000701)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTCTTCTTGTTTCTGGGACAT	0.662																																					p.K4T	Esophageal Squamous(188;763 2078 3002 3411 26027)	Atlas-SNP	.											.	ENSA	41	.	0			c.A11C						PASS	.						59.0	61.0	60.0					1																	150601936		2203	4300	6503	SO:0001583	missense	2029	exon1			TCTTGTTTCTGGG	X99906	CCDS958.1, CCDS959.1, CCDS960.1, CCDS961.1, CCDS962.1, CCDS963.1, CCDS964.1, CCDS965.1	1q21.3	2010-03-11			ENSG00000143420	ENSG00000143420			3360	protein-coding gene	gene with protein product		603061				9653196	Standard	NM_004436		Approved	MGC4319, MGC8394, MGC78563, ARPP-19e	uc001eve.3	O43768	OTTHUMG00000035004	ENST00000369014.5:c.11A>C	chr1.hg19:g.150601936T>G	ENSP00000358010:p.Lys4Thr	108.0	0.0	.		76.0	35.0	.	NM_004436	A8K1Z9|E9PB69|Q5T5H2|Q68D48|Q6FHW0|Q6IAM4|Q6NUL2|Q6VUC6|Q6VUC7|Q6VUC8|Q6VUC9|Q6VUD0|Q6VUD1|Q9NRZ0	Missense_Mutation	SNP	ENST00000369014.5	hg19	CCDS958.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543606	0.65198	.	.	ENSG00000143420	ENST00000369016;ENST00000369014;ENST00000369009;ENST00000339643;ENST00000271690;ENST00000356527;ENST00000502246;ENST00000503345;ENST00000503241;ENST00000362052	T	0.46063	0.88	5.78	3.46	0.39613	.	0.177686	0.48286	D	0.000183	T	0.26702	0.0653	L	0.40543	1.245	0.33054	D	0.533083	D;P;D;P;D	0.76494	0.999;0.728;0.982;0.534;0.99	P;B;P;B;P	0.60012	0.867;0.372;0.628;0.154;0.794	T	0.06679	-1.0813	10	0.16420	T	0.52	.	5.8762	0.18830	0.1492:0.0804:0.0:0.7704	.	4;4;4;4;4	A6NMQ3;O43768-8;E9PB69;O43768;O43768-3	.;.;.;ENSA_HUMAN;.	T	4	ENSP00000358012:K4T	ENSP00000271690:K4T	K	-	2	0	ENSA	148868560	1.000000	0.71417	0.998000	0.56505	0.671000	0.39405	3.104000	0.50306	1.004000	0.39156	-0.710000	0.03640	AAA	.	T|1.000;C|0.000	.	alt		0.662	ENSA-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084720.2	NM_207042	
C2orf16	84226	hgsc.bcm.edu	37	2	27802751	27802751	+	Silent	SNP	C	C	A	rs375978019	byFrequency	TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:27802751C>A	ENST00000408964.2	+	1	3363	c.3312C>A	c.(3310-3312)ccC>ccA	p.P1104P	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1104						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)		p.P1104P(2)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AAATACCCCCCGATGTGCCTC	0.448																																					p.P1104P		Atlas-SNP	.											C2orf16_ENST00000408964,NS,carcinoma,0,2	C2orf16	357	.	2	Substitution - coding silent(2)	lung(2)	c.C3312A						PASS	.						83.0	85.0	85.0					2																	27802751		1910	4127	6037	SO:0001819	synonymous_variant	84226	exon1			ACCCCCCGATGTG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.3312C>A	chr2.hg19:g.27802751C>A		159.0	2.0	.		155.0	9.0	.	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	hg19	CCDS42666.1																																																																																			.	.	.	alt		0.448	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
HEATR5B	54497	hgsc.bcm.edu	37	2	37235951	37235951	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:37235951G>A	ENST00000233099.5	-	28	4420	c.4325C>T	c.(4324-4326)tCa>tTa	p.S1442L	HEATR5B_ENST00000354531.2_Missense_Mutation_p.S1442L	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1442						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTTTGGTTTTGACTCTGCTTC	0.323																																					p.S1442L		Atlas-SNP	.											.	HEATR5B	185	.	0			c.C4325T						PASS	.						275.0	252.0	260.0					2																	37235951		2203	4300	6503	SO:0001583	missense	54497	exon28			GGTTTTGACTCTG	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.4325C>T	chr2.hg19:g.37235951G>A	ENSP00000233099:p.Ser1442Leu	243.0	0.0	.		196.0	83.0	.	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	hg19	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096063	0.56075	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.48201	0.82;0.82	5.75	4.87	0.63330	Armadillo-like helical (1);Armadillo-type fold (1);	0.421246	0.25753	N	0.028524	T	0.31071	0.0785	L	0.29908	0.895	0.35398	D	0.79138	B;B	0.28933	0.228;0.0	B;B	0.21546	0.035;0.002	T	0.33059	-0.9883	10	0.23891	T	0.37	-16.3124	9.1639	0.37038	0.0727:0.0:0.7809:0.1464	.	1442;1442	Q9P2D3-3;Q9P2D3	.;HTR5B_HUMAN	L	1442	ENSP00000233099:S1442L;ENSP00000346531:S1442L	ENSP00000233099:S1442L	S	-	2	0	HEATR5B	37089455	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.382000	0.66213	2.716000	0.92895	0.655000	0.94253	TCA	.	.	.	none		0.323	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
CLASP1	23332	hgsc.bcm.edu	37	2	122122716	122122716	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:122122716A>C	ENST00000263710.4	-	36	4420	c.4031T>G	c.(4030-4032)tTc>tGc	p.F1344C	CLASP1_ENST00000397587.3_Missense_Mutation_p.F1284C|CLASP1_ENST00000545861.1_Missense_Mutation_p.F1051C|CLASP1_ENST00000409078.3_Missense_Mutation_p.F1277C|CLASP1_ENST00000541377.1_Missense_Mutation_p.F1283C|CLASP1_ENST00000541859.1_Missense_Mutation_p.F1061C|CLASP1_ENST00000455322.2_Missense_Mutation_p.F1300C	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1344	Interaction with CLIP2. {ECO:0000250}.|Interaction with PHLDB2 and RSN.|Localization to kinetochores.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AATGGTCTTGAAGTGCTCCTC	0.557																																					p.F1344C		Atlas-SNP	.											.	CLASP1	135	.	0			c.T4031G						PASS	.						69.0	75.0	73.0					2																	122122716		2086	4216	6302	SO:0001583	missense	23332	exon35			GTCTTGAAGTGCT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.4031T>G	chr2.hg19:g.122122716A>C	ENSP00000263710:p.Phe1344Cys	40.0	0.0	.		39.0	20.0	.	NM_015282	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	hg19		.	.	.	.	.	.	.	.	.	.	a	27.0	4.794213	0.90453	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.80616	2.505	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.995;0.999;0.997;0.997	D	0.85278	0.1060	10	0.87932	D	0	-10.7425	16.0196	0.80472	1.0:0.0:0.0:0.0	.	1277;1284;1285;1344	E7EUA5;F5GWS0;A2RU21;Q7Z460	.;.;.;CLAP1_HUMAN	C	1344;1300;1284;1283;1061;1277;1051	ENSP00000263710:F1344C;ENSP00000389372:F1300C;ENSP00000380717:F1284C;ENSP00000441625:F1283C;ENSP00000441770:F1061C;ENSP00000386442:F1277C;ENSP00000438620:F1051C	ENSP00000263710:F1344C	F	-	2	0	CLASP1	121839186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.927000	0.92846	2.249000	0.74217	0.454000	0.30748	TTC	.	.	.	none		0.557	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098800	178098800	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:178098800T>C	ENST00000397062.3	-	2	799	c.245A>G	c.(244-246)gAa>gGa	p.E82G	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82G(3)|p.G81_F83delGEF(1)|p.E82V(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TGGGAGAAATTCACCTGTCTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82G		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,+1,7	NFE2L2	225	.	5	Substitution - Missense(4)|Deletion - In frame(1)	liver(3)|lung(1)|oesophagus(1)	c.A245G						PASS	.						137.0	137.0	137.0					2																	178098800		1900	4105	6005	SO:0001583	missense	4780	exon2			AGAAATTCACCTG		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.245A>G	chr2.hg19:g.178098800T>C	ENSP00000380252:p.Glu82Gly	118.0	0.0	.		99.0	41.0	.	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.048793	0.93740	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.38077	1.57;1.57;1.57;1.16;1.16;1.57	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.997;0.994;0.998;0.997	T	0.72959	-0.4133	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	66;82;66;66;66;66	ENSP00000380253:E66G;ENSP00000380252:E82G;ENSP00000411575:E66G;ENSP00000400073:E66G;ENSP00000412191:E66G;ENSP00000410015:E66G	ENSP00000380252:E82G	E	-	2	0	NFE2L2	177807046	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.503000	0.81632	2.210000	0.71456	0.460000	0.39030	GAA	.	.	.	none		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
ATIC	471	hgsc.bcm.edu	37	2	216211585	216211585	+	Nonsense_Mutation	SNP	C	C	A	rs139340343	byFrequency	TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:216211585C>A	ENST00000236959.9	+	14	1750	c.1424C>A	c.(1423-1425)tCg>tAg	p.S475*	ATIC_ENST00000540518.1_Nonsense_Mutation_p.S416*|ATIC_ENST00000435675.1_Nonsense_Mutation_p.S474*	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	475					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	CAAGTGCTTTCGATGAAGTTT	0.473			T	ALK	ALCL																																p.S475X		Atlas-SNP	.		Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	ATIC_ENST00000236959,NS,carcinoma,-1,1	ATIC	84	.	0			c.C1424A						PASS	.						163.0	146.0	152.0					2																	216211585		2203	4300	6503	SO:0001587	stop_gained	471	exon14			TGCTTTCGATGAA		CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.1424C>A	chr2.hg19:g.216211585C>A	ENSP00000236959:p.Ser475*	147.0	1.0	.		121.0	5.0	.	NM_004044	A8K202|E9PBU3|Q13856|Q53S28	Nonsense_Mutation	SNP	ENST00000236959.9	hg19	CCDS2398.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.03|19.03	3.747041|3.747041	0.69418|0.69418	.|.	.|.	ENSG00000138363|ENSG00000138363	ENST00000446622;ENST00000426233|ENST00000236959;ENST00000540518;ENST00000435675	.|.	.|.	.|.	5.8|5.8	4.93|4.93	0.64822|0.64822	.|.	.|0.384948	.|0.29602	.|N	.|0.011699	T|.	0.44477|.	0.1295|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.52139|.	-0.8615|.	3|.	.|0.13853	.|T	.|0.58	-11.5275|-11.5275	10.9721|10.9721	0.47444|0.47444	0.0:0.8039:0.1284:0.0676|0.0:0.8039:0.1284:0.0676	.|.	.|.	.|.	.|.	L|X	168;143|475;416;474	.|.	.|ENSP00000236959:S475X	F|S	+|+	3|2	2|0	ATIC|ATIC	215919830|215919830	0.821000|0.821000	0.29204|0.29204	0.383000|0.383000	0.26132|0.26132	0.933000|0.933000	0.57130|0.57130	1.281000|1.281000	0.33214|0.33214	1.608000|1.608000	0.50180|0.50180	-0.128000|-0.128000	0.14901|0.14901	TTC|TCG	.	C|1.000;T|0.000	.	alt		0.473	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256610.1	NM_004044	
FN1	2335	hgsc.bcm.edu	37	2	216289927	216289927	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr2:216289927A>C	ENST00000359671.1	-	7	1191	c.926T>G	c.(925-927)gTc>gGc	p.V309G	FN1_ENST00000443816.1_Missense_Mutation_p.V309G|FN1_ENST00000357009.2_Missense_Mutation_p.V309G|FN1_ENST00000426059.1_Missense_Mutation_p.V309G|FN1_ENST00000346544.3_Missense_Mutation_p.V309G|FN1_ENST00000421182.1_Missense_Mutation_p.V309G|FN1_ENST00000345488.5_Missense_Mutation_p.V309G|FN1_ENST00000357867.4_Missense_Mutation_p.V309G|FN1_ENST00000446046.1_Missense_Mutation_p.V309G|FN1_ENST00000356005.4_Missense_Mutation_p.V309G|FN1_ENST00000354785.4_Missense_Mutation_p.V309G|FN1_ENST00000323926.6_Missense_Mutation_p.V309G|FN1_ENST00000336916.4_Missense_Mutation_p.V309G|FN1_ENST00000432072.2_Missense_Mutation_p.V309G			P02751	FINC_HUMAN	fibronectin 1	309	Collagen-binding.|Fibronectin type-I 6. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ACTGTCTGTGACACAGTGGCC	0.557																																					p.V309G		Atlas-SNP	.											.	FN1	521	.	0			c.T926G						PASS	.						138.0	138.0	138.0					2																	216289927		2203	4300	6503	SO:0001583	missense	2335	exon7			TCTGTGACACAGT		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.926T>G	chr2.hg19:g.216289927A>C	ENSP00000352696:p.Val309Gly	267.0	1.0	.		224.0	90.0	.	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	A	21.6	4.179602	0.78564	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000426059	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.83	4.69	0.59074	.	0.187265	0.36303	N	0.002672	T	0.52108	0.1714	L	0.36672	1.1	0.80722	D	1	B;D;B;P;B;B;P;D;B;B;P	0.69078	0.055;0.997;0.09;0.891;0.25;0.294;0.593;0.97;0.25;0.25;0.935	B;D;B;P;B;B;B;P;B;B;P	0.80764	0.092;0.994;0.072;0.621;0.092;0.149;0.21;0.839;0.092;0.092;0.736	T	0.54609	-0.8268	10	0.87932	D	0	.	11.3208	0.49421	0.9296:0.0:0.0704:0.0	.	309;309;309;309;309;309;309;309;309;309;309	E9PG29;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.	G	309	ENSP00000394423:V309G;ENSP00000323534:V309G;ENSP00000338200:V309G;ENSP00000350534:V309G;ENSP00000346839:V309G;ENSP00000352696:V309G;ENSP00000265312:V309G;ENSP00000273049:V309G;ENSP00000349509:V309G;ENSP00000410422:V309G;ENSP00000415018:V309G;ENSP00000399538:V309G;ENSP00000348285:V309G;ENSP00000398907:V309G	ENSP00000265313:V309G	V	-	2	0	FN1	215998172	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.190000	0.58365	2.231000	0.72958	0.460000	0.39030	GTC	.	.	.	none		0.557	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
SCN5A	6331	hgsc.bcm.edu	37	3	38645417	38645417	+	Missense_Mutation	SNP	G	G	A	rs199473575		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr3:38645417G>A	ENST00000333535.4	-	12	1825	c.1676C>T	c.(1675-1677)aCa>aTa	p.T559I	SCN5A_ENST00000449557.2_Missense_Mutation_p.T559I|SCN5A_ENST00000451551.2_Missense_Mutation_p.T559I|SCN5A_ENST00000413689.1_Missense_Mutation_p.T559I|SCN5A_ENST00000423572.2_Missense_Mutation_p.T559I|SCN5A_ENST00000443581.1_Missense_Mutation_p.T559I|SCN5A_ENST00000425664.1_Missense_Mutation_p.T559I|SCN5A_ENST00000450102.2_Missense_Mutation_p.T559I|SCN5A_ENST00000414099.2_Missense_Mutation_p.T559I|SCN5A_ENST00000455624.2_Missense_Mutation_p.T559I			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	559					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CAGCAGTGATGTGTGGTGGCT	0.622																																					p.T559I		Atlas-SNP	.											.	SCN5A	634	.	0			c.C1676T						PASS	.						49.0	55.0	53.0					3																	38645417		2086	4212	6298	SO:0001583	missense	6331	exon12			AGTGATGTGTGGT	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1676C>T	chr3.hg19:g.38645417G>A	ENSP00000328968:p.Thr559Ile	77.0	0.0	.		67.0	35.0	.	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	hg19	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780662	0.49891	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	4.27	2.43	0.29744	Domain of unknown function DUF3451 (1);	0.879266	0.09862	N	0.746040	D	0.87014	0.6072	L	0.44542	1.39	0.29849	N	0.828558	B;P;B;B;P;P;P	0.43231	0.259;0.801;0.418;0.259;0.801;0.799;0.763	B;B;B;B;B;B;B	0.43360	0.041;0.417;0.051;0.059;0.192;0.371;0.293	T	0.81636	-0.0843	10	0.72032	D	0.01	.	6.1048	0.20067	0.1921:0.2795:0.5284:0.0	.	559;559;559;559;559;559;559	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	I	559	ENSP00000398962:T559I;ENSP00000398266:T559I;ENSP00000410257:T559I;ENSP00000388797:T559I;ENSP00000397915:T559I;ENSP00000416634:T559I;ENSP00000328968:T559I;ENSP00000399524:T559I;ENSP00000403355:T559I;ENSP00000413996:T559I	ENSP00000328968:T559I	T	-	2	0	SCN5A	38620421	0.911000	0.30947	0.896000	0.35187	0.619000	0.37552	1.714000	0.37961	1.020000	0.39573	-0.224000	0.12420	ACA	.	.	.	weak		0.622	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
AFAP1	60312	hgsc.bcm.edu	37	4	7857226	7857226	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:7857226T>G	ENST00000360265.4	-	3	535	c.301A>C	c.(301-303)Agc>Cgc	p.S101R	AFAP1_ENST00000382543.3_Missense_Mutation_p.S101R|AFAP1_ENST00000358461.2_Missense_Mutation_p.S101R|AFAP1_ENST00000420658.1_Missense_Mutation_p.S101R			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	101	Pro-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						TTTCCGGGGCTCAGCGGCACA	0.562																																					p.S101R		Atlas-SNP	.											.	AFAP1	93	.	0			c.A301C						PASS	.						89.0	76.0	81.0					4																	7857226		2203	4300	6503	SO:0001583	missense	60312	exon4			CGGGGCTCAGCGG	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.301A>C	chr4.hg19:g.7857226T>G	ENSP00000353402:p.Ser101Arg	88.0	0.0	.		60.0	26.0	.	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	hg19	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	T	19.26	3.793690	0.70452	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	4.79	4.79	0.61399	.	0.087086	0.85682	D	0.000000	T	0.52403	0.1732	L	0.34521	1.04	0.43326	D	0.995356	D;D	0.67145	0.996;0.99	P;P	0.58577	0.719;0.841	T	0.56347	-0.7994	10	0.66056	D	0.02	-20.9708	13.3262	0.60461	0.0:0.0:0.0:1.0	.	101;101	E9PDT7;Q8N556	.;AFAP1_HUMAN	R	101	ENSP00000353402:S101R;ENSP00000410689:S101R;ENSP00000351245:S101R;ENSP00000371983:S101R	ENSP00000351245:S101R	S	-	1	0	AFAP1	7908126	1.000000	0.71417	0.975000	0.42487	0.988000	0.76386	3.466000	0.53071	1.780000	0.52325	0.459000	0.35465	AGC	.	.	.	none		0.562	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
SMARCAD1	56916	hgsc.bcm.edu	37	4	95191935	95191935	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:95191935A>G	ENST00000354268.4	+	11	1611	c.1538A>G	c.(1537-1539)aAa>aGa	p.K513R	SMARCAD1_ENST00000509418.1_Missense_Mutation_p.K83R|SMARCAD1_ENST00000457823.2_Missense_Mutation_p.K513R			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	513	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		TTGGTACATAAACATGGACTT	0.343																																					p.K513R		Atlas-SNP	.											.	SMARCAD1	97	.	0			c.A1538G						PASS	.						198.0	186.0	190.0					4																	95191935		2203	4300	6503	SO:0001583	missense	56916	exon11			TACATAAACATGG	AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.1538A>G	chr4.hg19:g.95191935A>G	ENSP00000346217:p.Lys513Arg	164.0	0.0	.		123.0	47.0	.	NM_001128429	B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	ENST00000354268.4	hg19	CCDS3639.1	.	.	.	.	.	.	.	.	.	.	A	17.84	3.488315	0.64074	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.86	5.86	0.93980	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.46442	D	0.000282	D	0.85660	0.5748	N	0.03294	-0.36	0.54753	D	0.999987	B;B	0.32753	0.256;0.383	B;B	0.37091	0.241;0.155	D	0.84661	0.0706	10	0.23302	T	0.38	-27.7438	16.2652	0.82574	1.0:0.0:0.0:0.0	.	513;513	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	R	513;513;513;83	ENSP00000351947:K513R;ENSP00000415576:K513R;ENSP00000346217:K513R;ENSP00000423286:K83R	ENSP00000346217:K513R	K	+	2	0	SMARCAD1	95410958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.861000	0.75478	2.241000	0.73720	0.528000	0.53228	AAA	.	.	.	none		0.343	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253583.1	NM_020159	
PDZD2	23037	hgsc.bcm.edu	37	5	32108145	32108145	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:32108145G>A	ENST00000438447.1	+	25	8812	c.8424G>A	c.(8422-8424)ctG>ctA	p.L2808L	PDZD2_ENST00000282493.3_Silent_p.L2808L|CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000513490.1_3'UTR			O15018	PDZD2_HUMAN	PDZ domain containing 2	2808	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GGAAACCTCTGGTTGGGCTCA	0.388																																					p.L2808L		Atlas-SNP	.											.	PDZD2	306	.	0			c.G8424A						PASS	.						129.0	134.0	133.0					5																	32108145		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon24			ACCTCTGGTTGGG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8424G>A	chr5.hg19:g.32108145G>A		125.0	0.0	.		125.0	54.0	.	NM_178140	Q9BXD4	Silent	SNP	ENST00000438447.1	hg19	CCDS34137.1																																																																																			.	.	.	none		0.388	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
POLK	51426	hgsc.bcm.edu	37	5	74872636	74872636	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:74872636A>C	ENST00000241436.4	+	6	744	c.572A>C	c.(571-573)aAt>aCt	p.N191T	POLK_ENST00000506928.1_3'UTR|POLK_ENST00000515295.1_Missense_Mutation_p.N191T|POLK_ENST00000352007.5_Missense_Mutation_p.N191T|POLK_ENST00000508526.1_Missense_Mutation_p.N191T|POLK_ENST00000380481.3_Missense_Mutation_p.N101T|POLK_ENST00000504026.1_Missense_Mutation_p.N191T	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	191	UmuC.				DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TATGATCCCAATTTTATGGCC	0.328								DNA polymerases (catalytic subunits)																													p.N191T		Atlas-SNP	.											.	POLK	123	.	0			c.A572C						PASS	.						72.0	70.0	71.0					5																	74872636		2203	4299	6502	SO:0001583	missense	51426	exon6			ATCCCAATTTTAT	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.572A>C	chr5.hg19:g.74872636A>C	ENSP00000241436:p.Asn191Thr	79.0	0.0	.		54.0	24.0	.	NM_016218	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	hg19	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883355	0.72410	.	.	ENSG00000122008	ENST00000241436;ENST00000352007;ENST00000515295;ENST00000504026;ENST00000508526;ENST00000380481	T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99;-0.99	5.34	5.34	0.76211	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.296696	0.40064	N	0.001200	T	0.77987	0.4213	L	0.38175	1.15	0.42098	D	0.991328	P;P;P;D	0.53885	0.804;0.607;0.597;0.963	P;P;P;P	0.62740	0.663;0.653;0.624;0.906	T	0.80415	-0.1392	10	0.87932	D	0	-10.8466	11.291	0.49250	0.9266:0.0:0.0734:0.0	.	191;191;191;191	Q9UBT6-3;Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;.;POLK_HUMAN	T	191;191;191;191;191;101	ENSP00000241436:N191T;ENSP00000342256:N191T;ENSP00000424174:N191T;ENSP00000425075:N191T;ENSP00000426853:N191T;ENSP00000369848:N101T	ENSP00000241436:N191T	N	+	2	0	POLK	74908392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.254000	0.65457	2.018000	0.59344	0.460000	0.39030	AAT	.	.	.	none		0.328	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
MAML1	9794	hgsc.bcm.edu	37	5	179192887	179192887	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr5:179192887G>A	ENST00000292599.3	+	2	1139	c.876G>A	c.(874-876)ttG>ttA	p.L292L	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAACCCCCTTGGCACAGGACA	0.527																																					p.L292L		Atlas-SNP	.											.	MAML1	118	.	0			c.G876A						PASS	.						63.0	71.0	68.0					5																	179192887		2203	4300	6503	SO:0001819	synonymous_variant	9794	exon2			CCCCTTGGCACAG	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.876G>A	chr5.hg19:g.179192887G>A		164.0	0.0	.		146.0	68.0	.	NM_014757		Silent	SNP	ENST00000292599.3	hg19	CCDS34315.1																																																																																			.	.	.	none		0.527	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
PRRC2A	7916	hgsc.bcm.edu	37	6	31595867	31595867	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr6:31595867C>T	ENST00000376033.2	+	12	1850	c.1616C>T	c.(1615-1617)gCc>gTc	p.A539V	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A539V	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	539	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCAGCATCAGCCCCAACACCA	0.627																																					p.A539V		Atlas-SNP	.											.	PRRC2A	152	.	0			c.C1616T						PASS	.						127.0	114.0	119.0					6																	31595867		1511	2709	4220	SO:0001583	missense	7916	exon12			CATCAGCCCCAAC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1616C>T	chr6.hg19:g.31595867C>T	ENSP00000365201:p.Ala539Val	159.0	0.0	.		136.0	55.0	.	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	hg19	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	9.670	1.146580	0.21288	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.08102	3.13;3.13	4.62	0.771	0.18504	.	0.843533	0.10340	N	0.686385	T	0.00967	0.0032	N	0.02011	-0.69	0.24306	N	0.995104	B	0.02656	0.0	B	0.04013	0.001	T	0.48269	-0.9050	10	0.87932	D	0	-0.1078	6.2328	0.20744	0.0:0.5543:0.0:0.4457	.	539	P48634	PRC2A_HUMAN	V	539;528;539;539	ENSP00000365175:A539V;ENSP00000365201:A539V	ENSP00000365175:A539V	A	+	2	0	PRRC2A	31703846	0.098000	0.21812	0.464000	0.27143	0.840000	0.47671	1.319000	0.33655	0.269000	0.21961	0.561000	0.74099	GCC	.	.	.	none		0.627	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
PKHD1	5314	hgsc.bcm.edu	37	6	51917922	51917922	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr6:51917922C>T	ENST00000371117.3	-	21	2367	c.2092G>A	c.(2092-2094)Ggc>Agc	p.G698S	PKHD1_ENST00000340994.4_Missense_Mutation_p.G698S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	698					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TAGAACAGGCCCGTCTCCTGG	0.517																																					p.G698S		Atlas-SNP	.											.	PKHD1	927	.	0			c.G2092A						PASS	.						72.0	73.0	73.0					6																	51917922		2203	4300	6503	SO:0001583	missense	5314	exon21			ACAGGCCCGTCTC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2092G>A	chr6.hg19:g.51917922C>T	ENSP00000360158:p.Gly698Ser	85.0	0.0	.		62.0	25.0	.	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.511891	0.44660	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86865	-1.97;-2.18	5.63	3.77	0.43336	.	0.810468	0.11546	N	0.553288	T	0.63141	0.2486	L	0.33485	1.01	0.09310	N	1	B;B	0.20887	0.047;0.049	B;B	0.16289	0.015;0.012	T	0.50734	-0.8793	10	0.13108	T	0.6	.	9.2695	0.37661	0.0:0.7612:0.0:0.2388	.	698;698	P08F94-2;P08F94	.;PKHD1_HUMAN	S	698	ENSP00000360158:G698S;ENSP00000341097:G698S	ENSP00000341097:G698S	G	-	1	0	PKHD1	52025881	0.000000	0.05858	0.012000	0.15200	0.396000	0.30629	0.272000	0.18644	1.462000	0.47948	0.655000	0.94253	GGC	.	.	.	none		0.517	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
CLIP2	7461	hgsc.bcm.edu	37	7	73752800	73752800	+	Silent	SNP	A	A	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:73752800A>T	ENST00000395060.1	+	2	144	c.144A>T	c.(142-144)tcA>tcT	p.S48S	CLIP2_ENST00000223398.6_Silent_p.S48S|CLIP2_ENST00000361545.5_Silent_p.S48S			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	48						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						ACAAACAGTCATCTGGACCCT	0.657																																					p.S48S		Atlas-SNP	.											.	CLIP2	134	.	0			c.A144T						PASS	.						21.0	17.0	18.0					7																	73752800		2195	4292	6487	SO:0001819	synonymous_variant	7461	exon3			ACAGTCATCTGGA	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.144A>T	chr7.hg19:g.73752800A>T		19.0	0.0	.		29.0	18.0	.	NM_032421	O14527|O43611	Silent	SNP	ENST00000395060.1	hg19	CCDS5569.1																																																																																			.	.	.	none		0.657	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
CHCHD3	54927	hgsc.bcm.edu	37	7	132754922	132754922	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:132754922G>A	ENST00000262570.5	-	2	293	c.149C>T	c.(148-150)tCt>tTt	p.S50F	CHCHD3_ENST00000542753.1_Missense_Mutation_p.S50F|CHCHD3_ENST00000476546.1_Intron|CHCHD3_ENST00000448878.1_Missense_Mutation_p.S50F	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	50					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						ATAAGCACCAGAATACCGCTG	0.353																																					p.S50F		Atlas-SNP	.											.	CHCHD3	21	.	0			c.C149T						PASS	.						79.0	69.0	72.0					7																	132754922		2203	4300	6503	SO:0001583	missense	54927	exon2			GCACCAGAATACC	BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.149C>T	chr7.hg19:g.132754922G>A	ENSP00000262570:p.Ser50Phe	71.0	0.0	.		82.0	17.0	.	NM_017812		Missense_Mutation	SNP	ENST00000262570.5	hg19	CCDS5828.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975118	0.34848	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.46451	0.87;0.87;0.87	6.03	6.03	0.97812	.	0.483083	0.24301	N	0.039727	T	0.55513	0.1925	L	0.43152	1.355	0.23841	N	0.996695	B;D;B	0.65815	0.006;0.995;0.004	B;D;B	0.63283	0.006;0.913;0.007	T	0.51553	-0.8691	10	0.66056	D	0.02	-0.3383	16.0569	0.80812	0.0:0.0:1.0:0.0	.	50;50;50	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	F	50	ENSP00000262570:S50F;ENSP00000389297:S50F;ENSP00000440267:S50F	ENSP00000262570:S50F	S	-	2	0	CHCHD3	132405462	1.000000	0.71417	0.739000	0.30968	0.676000	0.39594	3.255000	0.51484	2.861000	0.98227	0.655000	0.94253	TCT	.	.	.	none		0.353	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338899.1	NM_017812	
EXOC4	60412	hgsc.bcm.edu	37	7	133692515	133692515	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:133692515A>G	ENST00000253861.4	+	17	2643	c.2614A>G	c.(2614-2616)Agg>Ggg	p.R872G	EXOC4_ENST00000539845.1_Missense_Mutation_p.R771G|EXOC4_ENST00000545148.1_Missense_Mutation_p.R482G|EXOC4_ENST00000541309.1_Missense_Mutation_p.R160G	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	872					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GAAAATGTGTAGGAACATTTT	0.502																																					p.R872G		Atlas-SNP	.											.	EXOC4	118	.	0			c.A2614G						PASS	.						85.0	71.0	76.0					7																	133692515		2203	4300	6503	SO:0001583	missense	60412	exon17			ATGTGTAGGAACA	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.2614A>G	chr7.hg19:g.133692515A>G	ENSP00000253861:p.Arg872Gly	63.0	0.0	.		83.0	36.0	.	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation	SNP	ENST00000253861.4	hg19	CCDS5829.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.958834	0.74016	.	.	ENSG00000131558	ENST00000253861;ENST00000546185;ENST00000539845;ENST00000545148;ENST00000541309	.	.	.	5.45	2.87	0.33458	.	0.000000	0.85682	D	0.000000	T	0.78020	0.4218	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.984;0.998;0.996	T	0.81075	-0.1097	9	0.66056	D	0.02	.	11.6561	0.51320	0.7492:0.2508:0.0:0.0	.	404;482;872	B7Z689;F5GZT1;Q96A65	.;.;EXOC4_HUMAN	G	872;491;771;482;160	.	ENSP00000253861:R872G	R	+	1	2	EXOC4	133343055	0.966000	0.33281	0.990000	0.47175	0.984000	0.73092	1.330000	0.33781	2.078000	0.62432	0.482000	0.46254	AGG	.	.	.	none		0.502	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
MGAM	8972	hgsc.bcm.edu	37	7	141750617	141750617	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:141750617G>T	ENST00000549489.2	+	24	2853	c.2758G>T	c.(2758-2760)Gtc>Ttc	p.V920F	MGAM_ENST00000475668.2_Missense_Mutation_p.V920F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	920					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACACAATGGTGTCCCAAGTCA	0.388																																					p.V920F		Atlas-SNP	.											.	MGAM	767	.	0			c.G2758T						PASS	.						105.0	95.0	98.0					7																	141750617		1869	4101	5970	SO:0001583	missense	8972	exon24			AATGGTGTCCCAA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2758G>T	chr7.hg19:g.141750617G>T	ENSP00000447378:p.Val920Phe	147.0	0.0	.		196.0	41.0	.	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560136	0.27827	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.89681	-2.55	5.81	0.962	0.19643	.	1.575090	0.03884	N	0.277575	D	0.86464	0.5939	M	0.62266	1.93	0.09310	N	1	B	0.27791	0.189	B	0.18561	0.022	T	0.66296	-0.5959	10	0.24483	T	0.36	.	9.7694	0.40580	0.4125:0.0:0.5875:0.0	.	920	O43451	MGA_HUMAN	F	920;920;797	ENSP00000447378:V920F	ENSP00000316431:V797F	V	+	1	0	MGAM	141397086	0.000000	0.05858	0.000000	0.03702	0.389000	0.30415	0.254000	0.18314	-0.105000	0.12132	-0.336000	0.08194	GTC	.	.	.	none		0.388	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
LZTS1	11178	hgsc.bcm.edu	37	8	20107305	20107305	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:20107305G>A	ENST00000381569.1	-	4	2076	c.1719C>T	c.(1717-1719)gcC>gcT	p.A573A	LZTS1_ENST00000265801.6_Silent_p.A573A|LZTS1_ENST00000522290.1_Silent_p.A514A			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	573					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		AGGGCTCCCCGGCGCTGTCCC	0.632																																					p.A573A		Atlas-SNP	.											.	LZTS1	72	.	0			c.C1719T						PASS	.						83.0	82.0	82.0					8																	20107305		2203	4300	6503	SO:0001819	synonymous_variant	11178	exon3			CTCCCCGGCGCTG	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1719C>T	chr8.hg19:g.20107305G>A		132.0	0.0	.		124.0	56.0	.	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	hg19	CCDS6015.1																																																																																			.	.	.	none		0.632	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110451259	110451259	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:110451259G>A	ENST00000378402.5	+	32	3998	c.3894G>A	c.(3892-3894)aaG>aaA	p.K1298K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1298	IPT/TIG 6.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTTGCCCAAGTTGTCTCCTG	0.393										HNSCC(38;0.096)																											p.K1298K		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G3894A						PASS	.						141.0	137.0	138.0					8																	110451259		1844	4085	5929	SO:0001819	synonymous_variant	93035	exon32			GCCCAAGTTGTCT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3894G>A	chr8.hg19:g.110451259G>A		249.0	0.0	.		212.0	81.0	.	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	hg19	CCDS47911.1																																																																																			.	.	.	none		0.393	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
NMT2	9397	hgsc.bcm.edu	37	10	15154953	15154953	+	Missense_Mutation	SNP	C	C	A	rs201047504		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:15154953C>A	ENST00000378165.4	-	10	1260	c.1180G>T	c.(1180-1182)Ggt>Tgt	p.G394C	RPP38_ENST00000451677.1_Intron|NMT2_ENST00000535341.1_Missense_Mutation_p.G381C|NMT2_ENST00000540259.1_Missense_Mutation_p.G206C|NMT2_ENST00000378150.1_Missense_Mutation_p.G381C	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	394					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)	p.G394S(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GTCAGTTTACCGTTGGGGCTC	0.512																																					p.G394C	Melanoma(117;1345 1645 4130 12688 30625)	Atlas-SNP	.											NMT2,NS,carcinoma,0,1	NMT2	44	.	1	Substitution - Missense(1)	lung(1)	c.G1180T						PASS	.						153.0	150.0	151.0					10																	15154953		2203	4300	6503	SO:0001583	missense	9397	exon10			GTTTACCGTTGGG	AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1180G>T	chr10.hg19:g.15154953C>A	ENSP00000367407:p.Gly394Cys	144.0	2.0	.		121.0	8.0	.	NM_004808	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Missense_Mutation	SNP	ENST00000378165.4	hg19	CCDS7109.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557561	0.65425	.	.	ENSG00000152465	ENST00000378165;ENST00000378150;ENST00000378143;ENST00000540259;ENST00000535341	T	0.50813	0.73	5.74	5.74	0.90152	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.095052	0.64402	D	0.000001	T	0.77718	0.4172	M	0.92169	3.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76071	0.987;0.984;0.984	T	0.82653	-0.0351	10	0.87932	D	0	-20.1679	19.9332	0.97128	0.0:1.0:0.0:0.0	.	394;381;394	B2RCF3;Q5VUC6;O60551	.;.;NMT2_HUMAN	C	394;381;425;206;381	ENSP00000367407:G394C	ENSP00000367385:G425C	G	-	1	0	NMT2	15194959	1.000000	0.71417	0.995000	0.50966	0.124000	0.20399	7.380000	0.79704	2.702000	0.92279	0.655000	0.94253	GGT	.	.	.	alt		0.512	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046958.2	NM_004808	
SLC16A9	220963	hgsc.bcm.edu	37	10	61413807	61413807	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:61413807A>G	ENST00000395348.3	-	5	1613	c.977T>C	c.(976-978)cTt>cCt	p.L326P	SLC16A9_ENST00000395347.1_Missense_Mutation_p.L326P	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	326					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						ATCTTCCATAAGTAATGAAGG	0.363																																					p.L326P		Atlas-SNP	.											.	SLC16A9	58	.	0			c.T977C						PASS	.						55.0	52.0	53.0					10																	61413807		2203	4300	6503	SO:0001583	missense	220963	exon5			TCCATAAGTAATG	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.977T>C	chr10.hg19:g.61413807A>G	ENSP00000378757:p.Leu326Pro	55.0	0.0	.		77.0	29.0	.	NM_194298	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	ENST00000395348.3	hg19	CCDS7256.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362232	0.61403	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.34472	1.36;1.36	4.73	4.73	0.59995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.164197	0.56097	D	0.000037	T	0.51534	0.1680	L	0.44542	1.39	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.54186	-0.8331	10	0.66056	D	0.02	.	14.2093	0.65755	1.0:0.0:0.0:0.0	.	326	Q7RTY1	MOT9_HUMAN	P	326	ENSP00000378757:L326P;ENSP00000378756:L326P	ENSP00000378756:L326P	L	-	2	0	SLC16A9	61083813	1.000000	0.71417	0.974000	0.42286	0.984000	0.73092	8.962000	0.93254	1.751000	0.51876	0.482000	0.46254	CTT	.	.	.	none		0.363	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
PDLIM1	9124	hgsc.bcm.edu	37	10	96998413	96998413	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:96998413T>G	ENST00000329399.6	-	6	823	c.715A>C	c.(715-717)Agt>Cgt	p.S239R	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	239					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GCTTTAACACTTCTGAATCCT	0.468																																					p.S239R		Atlas-SNP	.											.	PDLIM1	33	.	0			c.A715C						PASS	.						94.0	84.0	87.0					10																	96998413		2203	4300	6503	SO:0001583	missense	9124	exon6			TAACACTTCTGAA	U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.715A>C	chr10.hg19:g.96998413T>G	ENSP00000360305:p.Ser239Arg	64.0	0.0	.		66.0	26.0	.	NM_020992	B2RBS6|Q5VZH5|Q9BPZ9	Missense_Mutation	SNP	ENST00000329399.6	hg19	CCDS7441.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.985379	0.93044	.	.	ENSG00000107438	ENST00000329399	T	0.22134	1.97	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	M	0.85859	2.78	0.80722	D	1	D	0.61697	0.99	P	0.57101	0.813	T	0.53578	-0.8419	10	0.66056	D	0.02	-13.9009	14.2967	0.66318	0.0:0.0:0.0:1.0	.	239	O00151	PDLI1_HUMAN	R	239	ENSP00000360305:S239R	ENSP00000360305:S239R	S	-	1	0	PDLIM1	96988403	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.927000	0.87577	1.978000	0.57642	0.454000	0.30748	AGT	.	.	.	none		0.468	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049508.1		
DNMBP	23268	hgsc.bcm.edu	37	10	101646325	101646325	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:101646325G>C	ENST00000324109.4	-	13	3441	c.3350C>G	c.(3349-3351)cCc>cGc	p.P1117R	DNMBP_ENST00000540316.1_Missense_Mutation_p.P53R|DNMBP_ENST00000472036.1_5'UTR|DNMBP_ENST00000342239.3_Missense_Mutation_p.P1141R|DNMBP_ENST00000543621.1_Missense_Mutation_p.P363R	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1117	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CAGCTTATGGGGCCCTGTAAA	0.502																																					p.P1117R		Atlas-SNP	.											.	DNMBP	173	.	0			c.C3350G						PASS	.						116.0	115.0	115.0					10																	101646325		2203	4300	6503	SO:0001583	missense	23268	exon13			TTATGGGGCCCTG	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3350C>G	chr10.hg19:g.101646325G>C	ENSP00000315659:p.Pro1117Arg	256.0	0.0	.		236.0	80.0	.	NM_015221	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	ENST00000324109.4	hg19	CCDS7485.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.990069	0.93106	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.82	5.82	0.92795	BAR (3);	0.000000	0.48286	D	0.000199	T	0.82019	0.4946	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.83050	-0.0153	10	0.62326	D	0.03	-22.7596	19.7034	0.96065	0.0:0.0:1.0:0.0	.	1117;363;1141	Q6XZF7;Q6XZF7-2;Q5SVK8	DNMBP_HUMAN;.;.	R	1141;1117;363;363;53	ENSP00000344914:P1141R;ENSP00000315659:P1117R;ENSP00000443657:P363R;ENSP00000443573:P53R	ENSP00000315659:P1117R	P	-	2	0	DNMBP	101636315	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.866000	0.99616	2.756000	0.94617	0.561000	0.74099	CCC	.	.	.	none		0.502	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
SLK	9748	hgsc.bcm.edu	37	10	105750528	105750528	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr10:105750528A>G	ENST00000369755.3	+	2	791	c.246A>G	c.(244-246)atA>atG	p.I82M	SLK_ENST00000335753.4_Missense_Mutation_p.I82M	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	82	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGATTGACATATTAGCATCTT	0.363																																					p.I82M	NSCLC(111;540 1651 1927 4474 17706)	Atlas-SNP	.											.	SLK	107	.	0			c.A246G						PASS	.						132.0	123.0	126.0					10																	105750528		2203	4300	6503	SO:0001583	missense	9748	exon2			TGACATATTAGCA		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.246A>G	chr10.hg19:g.105750528A>G	ENSP00000358770:p.Ile82Met	75.0	0.0	.		69.0	29.0	.	NM_014720	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	hg19	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.480734	0.63849	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69435	-0.4;-0.4	6.17	-1.34	0.09143	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	L	0.41961	1.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.64067	-0.6494	10	0.42905	T	0.14	.	7.0526	0.25081	0.3492:0.3447:0.0:0.3061	.	82;82	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	M	82	ENSP00000336824:I82M;ENSP00000358770:I82M	ENSP00000336824:I82M	I	+	3	3	SLK	105740518	0.793000	0.28825	0.997000	0.53966	0.966000	0.64601	-0.030000	0.12308	-0.051000	0.13334	-0.313000	0.08912	ATA	.	.	.	none		0.363	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720	
MUC5B	727897	hgsc.bcm.edu	37	11	1247945	1247945	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr11:1247945C>G	ENST00000529681.1	+	4	358	c.300C>G	c.(298-300)aaC>aaG	p.N100K	MUC5B_ENST00000447027.1_Missense_Mutation_p.N100K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	100	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.			FPGLCN -> LPCLCK (in Ref. 2; AAC67545). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCTTTGCAACTACGTGTTCT	0.632																																					p.N100K		Atlas-SNP	.											.	MUC5B	473	.	0			c.C300G						PASS	.						43.0	45.0	44.0					11																	1247945		2150	4262	6412	SO:0001583	missense	727897	exon4			TTGCAACTACGTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.300C>G	chr11.hg19:g.1247945C>G	ENSP00000436812:p.Asn100Lys	37.0	0.0	.		36.0	7.0	.	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708565	0.30322	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.58797	0.31;0.31	3.68	0.662	0.17880	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.67515	0.2901	L	0.59912	1.85	0.36644	D	0.876996	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.79784	0.958;0.993;0.993	T	0.70513	-0.4851	9	0.87932	D	0	.	8.7992	0.34898	0.0:0.6325:0.0:0.3675	.	100;756;100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	K	100;100;100;133	ENSP00000436812:N100K;ENSP00000415793:N100K	ENSP00000343037:N100K	N	+	3	2	MUC5B	1204521	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	0.972000	0.29409	0.261000	0.21753	0.561000	0.74099	AAC	.	.	.	none		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PRKRIR	5612	hgsc.bcm.edu	37	11	76063689	76063689	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr11:76063689G>C	ENST00000260045.3	-	5	610	c.505C>G	c.(505-507)Cta>Gta	p.L169V	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	169					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						ATTTCAAATAGAGATTTTAGG	0.413																																					p.L169V		Atlas-SNP	.											.	PRKRIR	65	.	0			c.C505G						PASS	.						44.0	39.0	40.0					11																	76063689		2200	4292	6492	SO:0001583	missense	5612	exon5			CAAATAGAGATTT	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.505C>G	chr11.hg19:g.76063689G>C	ENSP00000260045:p.Leu169Val	54.0	0.0	.		29.0	21.0	.	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	ENST00000260045.3	hg19	CCDS8243.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904821	0.33628	.	.	ENSG00000137492	ENST00000260045	.	.	.	4.99	-0.031	0.13911	.	0.157256	0.45606	D	0.000351	T	0.52948	0.1766	M	0.67953	2.075	0.34998	D	0.755717	P	0.46277	0.875	P	0.50082	0.63	T	0.59306	-0.7479	9	0.23302	T	0.38	.	9.0537	0.36392	0.5611:0.0:0.4389:0.0	.	169	O43422	P52K_HUMAN	V	169	.	ENSP00000260045:L169V	L	-	1	2	PRKRIR	75741337	0.470000	0.25854	0.991000	0.47740	0.952000	0.60782	1.098000	0.31000	0.038000	0.15604	0.586000	0.80456	CTA	.	.	.	none		0.413	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
DIP2B	57609	hgsc.bcm.edu	37	12	51019819	51019819	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:51019819C>A	ENST00000301180.5	+	2	195	c.161C>A	c.(160-162)cCg>cAg	p.P54Q		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	54	DMAP-interaction.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.P54Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCTTACAGCCCGCAGACACAA	0.378																																					p.P54Q		Atlas-SNP	.											DIP2B,NS,carcinoma,0,1	DIP2B	167	.	1	Substitution - Missense(1)	lung(1)	c.C161A						PASS	.						107.0	105.0	105.0					12																	51019819		2203	4300	6503	SO:0001583	missense	57609	exon2			ACAGCCCGCAGAC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.161C>A	chr12.hg19:g.51019819C>A	ENSP00000301180:p.Pro54Gln	128.0	2.0	.		142.0	10.0	.	NM_173602	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	hg19	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	c	14.24	2.476710	0.44044	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.46819	0.86	4.75	3.87	0.44632	DMAP1-binding (1);	0.212294	0.49916	D	0.000135	T	0.46756	0.1409	L	0.49350	1.555	0.37755	D	0.926104	B;B	0.32800	0.385;0.182	B;B	0.41723	0.365;0.147	T	0.54430	-0.8295	10	0.56958	D	0.05	-5.0148	9.2742	0.37690	0.0:0.9016:0.0:0.0984	.	54;54	Q9P265;E9PHD6	DIP2B_HUMAN;.	Q	54	ENSP00000301180:P54Q	ENSP00000301180:P54Q	P	+	2	0	DIP2B	49306086	0.994000	0.37717	0.994000	0.49952	0.851000	0.48451	3.511000	0.53400	1.369000	0.46134	-0.213000	0.12676	CCG	.	.	.	none		0.378	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
MON2	23041	hgsc.bcm.edu	37	12	62959064	62959064	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr12:62959064A>G	ENST00000393632.2	+	27	4471	c.4080A>G	c.(4078-4080)atA>atG	p.I1360M	MON2_ENST00000280379.6_Missense_Mutation_p.I1361M|MON2_ENST00000393629.2_Missense_Mutation_p.I1360M|MON2_ENST00000552738.1_Missense_Mutation_p.I1337M|MON2_ENST00000393630.3_Missense_Mutation_p.I1361M|MON2_ENST00000546600.1_Missense_Mutation_p.I1360M	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1360					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ATCCAGCTATATTTGACCAGT	0.348																																					p.I1360M		Atlas-SNP	.											.	MON2	160	.	0			c.A4080G						PASS	.						193.0	193.0	193.0					12																	62959064		2203	4300	6503	SO:0001583	missense	23041	exon27			AGCTATATTTGAC		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4080A>G	chr12.hg19:g.62959064A>G	ENSP00000377252:p.Ile1360Met	227.0	1.0	.		199.0	91.0	.	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770800	0.49680	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	5.44	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.71358	0.3330	L	0.48642	1.525	0.58432	D	0.999998	D;D;D;P;D	0.76494	0.998;0.998;0.998;0.655;0.999	D;D;D;B;D	0.67900	0.919;0.954;0.954;0.295;0.954	T	0.66921	-0.5801	9	.	.	.	-21.3568	8.7848	0.34814	0.4208:0.4646:0.0:0.1146	.	1360;1337;1360;235;1360	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	M	1360;1361;1361;1360;1337;1360	ENSP00000377252:I1360M;ENSP00000377250:I1361M;ENSP00000280379:I1361M;ENSP00000447407:I1360M;ENSP00000449215:I1337M;ENSP00000377249:I1360M	.	I	+	3	3	MON2	61245331	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.341000	0.43983	0.409000	0.25649	-0.316000	0.08728	ATA	.	.	.	none		0.348	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
DOCK9	23348	hgsc.bcm.edu	37	13	99540613	99540613	+	Splice_Site	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:99540613C>T	ENST00000376460.1	-	17	2058		c.e17+1		DOCK9_ENST00000448493.2_Splice_Site|DOCK9_ENST00000339416.2_Splice_Site|DOCK9_ENST00000442173.1_Splice_Site	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTCACACTCACCTTGGCAAAA	0.398																																					.		Atlas-SNP	.											.	DOCK9	311	.	0			c.1980+1G>A						PASS	.						167.0	158.0	161.0					13																	99540613		1931	4118	6049	SO:0001630	splice_region_variant	23348	exon18			CACTCACCTTGGC	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.1977+1G>A	chr13.hg19:g.99540613C>T		227.0	0.0	.		224.0	24.0	.	NM_015296	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Splice_Site	SNP	ENST00000376460.1	hg19	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474160	0.84640	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK9	98338614	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.438000	0.80431	2.680000	0.91292	0.655000	0.94253	.	.	.	.	none		0.398	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	Intron
FAM71D	161142	hgsc.bcm.edu	37	14	67688507	67688507	+	3'UTR	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:67688507C>A	ENST00000556046.1	+	0	1713							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		AGCTTGAGAACTGAATCAAAC	0.353																																					p.T391N		Atlas-SNP	.											.	FAM71D	33	.	0			c.C1172A						PASS	.						87.0	82.0	84.0					14																	67688507		2203	4300	6503	SO:0001624	3_prime_UTR_variant	161142	exon7			TGAGAACTGAATC		CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*1228C>A	chr14.hg19:g.67688507C>A		63.0	0.0	.		54.0	11.0	.	NM_173526	Q86VN4	Missense_Mutation	SNP	ENST00000556046.1	hg19		.	.	.	.	.	.	.	.	.	.	C	6.948	0.544670	0.13312	.	.	ENSG00000172717	ENST00000556117;ENST00000557671	.	.	.	5.95	1.59	0.23543	.	.	.	.	.	T	0.25306	0.0615	N	0.24115	0.695	.	.	.	.	.	.	.	.	.	T	0.25082	-1.0142	4	.	.	.	0.0	2.5085	0.04651	0.3418:0.4102:0.1494:0.0986	.	.	.	.	M	52;49	.	.	L	+	1	2	FAM71D	66758260	1.000000	0.71417	0.283000	0.24790	0.059000	0.15707	0.853000	0.27777	0.750000	0.32877	-0.345000	0.07892	CTG	.	.	.	none		0.353	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	protein_coding	OTTHUMT00000412390.1	NM_173526	
DPF3	8110	hgsc.bcm.edu	37	14	73238479	73238479	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:73238479T>G	ENST00000556509.1	-	2	154	c.155A>C	c.(154-156)aAc>aCc	p.N52T	DPF3_ENST00000546183.1_Missense_Mutation_p.N62T|DPF3_ENST00000541685.1_Missense_Mutation_p.N52T	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	52					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GATGTAGCAGTTGTTCTGGGC	0.622																																					p.N52T		Atlas-SNP	.											DPF3_ENST00000541685,NS,carcinoma,0,3	DPF3	117	.	0			c.A155C						PASS	.						87.0	95.0	92.0					14																	73238479		2195	4299	6494	SO:0001583	missense	8110	exon2			TAGCAGTTGTTCT	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.155A>C	chr14.hg19:g.73238479T>G	ENSP00000450518:p.Asn52Thr	158.0	1.0	.		90.0	38.0	.	NM_012074	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	hg19		.	.	.	.	.	.	.	.	.	.	t	30	5.056952	0.93846	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.91068	-2.78;-0.26;-0.26	5.54	5.54	0.83059	.	.	.	.	.	D	0.94251	0.8154	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.991	D;D;D	0.74023	0.97;0.958;0.982	D	0.94833	0.7998	9	0.87932	D	0	.	15.693	0.77469	0.0:0.0:0.0:1.0	.	62;52;52	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	T	52;52;51;52;62	ENSP00000450518:N52T;ENSP00000441640:N52T;ENSP00000444662:N62T	ENSP00000381791:N107T	N	-	2	0	DPF3	72308232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.026000	0.88783	2.116000	0.64780	0.529000	0.55759	AAC	.	.	.	none		0.622	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2		
PPP4R4	57718	hgsc.bcm.edu	37	14	94741788	94741788	+	Missense_Mutation	SNP	C	C	A	rs550716897		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr14:94741788C>A	ENST00000304338.3	+	24	2681	c.2527C>A	c.(2527-2529)Cgt>Agt	p.R843S		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	843					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						GAGTACTTCCCGTGGGACAGG	0.448																																					p.R843S		Atlas-SNP	.											.	PPP4R4	107	.	0			c.C2527A						PASS	.						206.0	193.0	197.0					14																	94741788		2203	4300	6503	SO:0001583	missense	57718	exon24			ACTTCCCGTGGGA	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.2527C>A	chr14.hg19:g.94741788C>A	ENSP00000305924:p.Arg843Ser	204.0	0.0	.		186.0	9.0	.	NM_058237	Q9BUF8|Q9HCF0	Missense_Mutation	SNP	ENST00000304338.3	hg19	CCDS9921.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200451	0.79015	.	.	ENSG00000119698	ENST00000304338	.	.	.	6.02	6.02	0.97574	.	0.066833	0.64402	D	0.000017	T	0.55226	0.1907	L	0.34521	1.04	0.80722	D	1	P	0.48016	0.904	B	0.44108	0.441	T	0.56872	-0.7907	9	0.56958	D	0.05	-13.6956	20.5373	0.99239	0.0:1.0:0.0:0.0	.	843	Q6NUP7	PP4R4_HUMAN	S	843	.	ENSP00000305924:R843S	R	+	1	0	PPP4R4	93811541	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	5.457000	0.66672	2.857000	0.98124	0.650000	0.86243	CGT	.	.	.	none		0.448	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
ZNF609	23060	hgsc.bcm.edu	37	15	64966235	64966235	+	Silent	SNP	G	G	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:64966235G>T	ENST00000326648.3	+	4	1310	c.1182G>T	c.(1180-1182)ggG>ggT	p.G394G	RNU6-549P_ENST00000384433.1_RNA|ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	394						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACAGCAAAGGGACCAGTAACA	0.577																																					p.G394G		Atlas-SNP	.											.	ZNF609	106	.	0			c.G1182T						PASS	.						96.0	97.0	97.0					15																	64966235		2203	4299	6502	SO:0001819	synonymous_variant	23060	exon4			CAAAGGGACCAGT	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1182G>T	chr15.hg19:g.64966235G>T		191.0	0.0	.		150.0	55.0	.	NM_015042	Q0D2I2	Silent	SNP	ENST00000326648.3	hg19	CCDS32270.1																																																																																			.	.	.	none		0.577	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
THSD4	79875	hgsc.bcm.edu	37	15	72063439	72063439	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:72063439G>C	ENST00000355327.3	+	17	2940	c.2806G>C	c.(2806-2808)Gaa>Caa	p.E936Q	THSD4_ENST00000261862.6_Missense_Mutation_p.E936Q|THSD4_ENST00000357769.4_Missense_Mutation_p.E576Q			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	936	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TCGGGTCCGGGAAGTGCGGTG	0.507																																					p.E936Q		Atlas-SNP	.											.	THSD4	75	.	0			c.G2806C						PASS	.						157.0	149.0	151.0					15																	72063439		1899	4126	6025	SO:0001583	missense	79875	exon16			GTCCGGGAAGTGC	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2806G>C	chr15.hg19:g.72063439G>C	ENSP00000347484:p.Glu936Gln	172.0	0.0	.		143.0	63.0	.	NM_024817	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	ENST00000355327.3	hg19	CCDS10238.2	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724411	0.68959	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	T;T;T	0.50813	0.73;0.73;0.73	5.05	5.05	0.67936	.	.	.	.	.	T	0.56761	0.2007	L	0.28649	0.875	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.54596	-0.8270	9	0.35671	T	0.21	.	15.9236	0.79592	0.0:0.0:1.0:0.0	.	576;936	B4DR13;Q6ZMP0	.;THSD4_HUMAN	Q	936;936;576	ENSP00000347484:E936Q;ENSP00000261862:E936Q;ENSP00000350413:E576Q	ENSP00000261862:E936Q	E	+	1	0	THSD4	69850493	1.000000	0.71417	1.000000	0.80357	0.252000	0.25951	9.638000	0.98445	2.353000	0.79882	0.557000	0.71058	GAA	.	.	.	none		0.507	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
BNC1	646	hgsc.bcm.edu	37	15	83932666	83932666	+	Missense_Mutation	SNP	G	G	A	rs377611889		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:83932666G>A	ENST00000345382.2	-	4	1422	c.1337C>T	c.(1336-1338)aCg>aTg	p.T446M	BNC1_ENST00000569704.1_Missense_Mutation_p.T439M|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	446					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GTCTGGGGACGTCACTGTGAA	0.527																																					p.T446M		Atlas-SNP	.											.	BNC1	149	.	0			c.C1337T						PASS	.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	129.0	118.0	122.0		1337	0.3	0.0	15		122	0,8600		0,0,4300	no	missense	BNC1	NM_001717.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	446/995	83932666	1,13005	2203	4300	6503	SO:0001583	missense	646	exon4			GGGGACGTCACTG	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1337C>T	chr15.hg19:g.83932666G>A	ENSP00000307041:p.Thr446Met	92.0	0.0	.		71.0	27.0	.	NM_001717	Q15840	Missense_Mutation	SNP	ENST00000345382.2	hg19	CCDS10324.1	.	.	.	.	.	.	.	.	.	.	G	0.574	-0.839807	0.02692	2.27E-4	0.0	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.47869	0.83	4.98	0.334	0.15948	.	0.605786	0.17317	N	0.178658	T	0.32376	0.0827	L	0.39397	1.21	0.09310	N	1	B;B	0.23806	0.008;0.091	B;B	0.16289	0.004;0.015	T	0.16958	-1.0385	10	0.51188	T	0.08	-1.7277	5.5626	0.17152	0.2685:0.4447:0.2868:0.0	.	439;446	F5GY04;Q01954	.;BNC1_HUMAN	M	446;439	ENSP00000307041:T446M	ENSP00000307041:T446M	T	-	2	0	BNC1	81723670	0.001000	0.12720	0.001000	0.08648	0.136000	0.21042	0.733000	0.26087	-0.119000	0.11830	0.655000	0.94253	ACG	.	.	.	weak		0.527	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	
AKAP13	11214	hgsc.bcm.edu	37	15	86125257	86125257	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:86125257G>C	ENST00000394518.2	+	7	4053	c.3958G>C	c.(3958-3960)Ggg>Cgg	p.G1320R	AKAP13_ENST00000361243.2_Missense_Mutation_p.G1320R|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1320					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GGAAGCCACGGGGAGCCTTGC	0.507																																					p.G1320R	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.G3958C						PASS	.						55.0	53.0	53.0					15																	86125257		2202	4299	6501	SO:0001583	missense	11214	exon7			GCCACGGGGAGCC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.3958G>C	chr15.hg19:g.86125257G>C	ENSP00000378026:p.Gly1320Arg	115.0	0.0	.		89.0	4.0	.	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305937	0.40795	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.16597	2.33;2.33	4.87	2.96	0.34315	.	.	.	.	.	T	0.19446	0.0467	M	0.62723	1.935	0.09310	N	0.999996	P;P	0.49090	0.718;0.919	B;B	0.43052	0.168;0.406	T	0.13442	-1.0509	9	0.87932	D	0	.	6.6634	0.23027	0.0987:0.1806:0.7206:0.0	.	1320;1320	Q12802;Q12802-2	AKP13_HUMAN;.	R	1320;1320;1319;1319	ENSP00000354718:G1320R;ENSP00000378026:G1320R	ENSP00000354718:G1320R	G	+	1	0	AKAP13	83926261	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	0.156000	0.16382	0.448000	0.26722	-0.176000	0.13171	GGG	.	.	.	none		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100871170	100871170	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:100871170G>A	ENST00000268070.4	-	3	645	c.540C>T	c.(538-540)atC>atT	p.I180I		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	180						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ATTTGCGCCTGATCAGATGTT	0.582																																					p.I180I		Atlas-SNP	.											.	ADAMTS17	127	.	0			c.C540T						PASS	.						129.0	122.0	125.0					15																	100871170		2203	4300	6503	SO:0001819	synonymous_variant	170691	exon3			GCGCCTGATCAGA	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.540C>T	chr15.hg19:g.100871170G>A		99.0	0.0	.		87.0	47.0	.	NM_139057	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	hg19	CCDS10383.1																																																																																			.	.	.	none		0.582	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
PDILT	204474	hgsc.bcm.edu	37	16	20410442	20410442	+	Missense_Mutation	SNP	G	G	T	rs368369154		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:20410442G>T	ENST00000302451.4	-	2	429	c.181C>A	c.(181-183)Cgc>Agc	p.R61S		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	61					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)	p.R61S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ATGAGGAAGCGGGTCTGGTTC	0.562																																					p.R61S		Atlas-SNP	.											PDILT,NS,carcinoma,+1,1	PDILT	120	.	1	Substitution - Missense(1)	lung(1)	c.C181A						PASS	.						100.0	91.0	94.0					16																	20410442		2203	4300	6503	SO:0001583	missense	204474	exon2			GGAAGCGGGTCTG		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.181C>A	chr16.hg19:g.20410442G>T	ENSP00000305465:p.Arg61Ser	68.0	1.0	.		105.0	7.0	.	NM_174924	Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	hg19	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027180	0.75390	.	.	ENSG00000169340	ENST00000302451	T	0.03212	4.01	4.21	4.21	0.49690	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.357715	0.30134	N	0.010336	T	0.05135	0.0137	L	0.34521	1.04	0.33941	D	0.643194	P	0.48834	0.916	P	0.48454	0.578	T	0.46034	-0.9220	10	0.21014	T	0.42	.	12.3542	0.55165	0.0:0.0:1.0:0.0	.	61	Q8N807	PDILT_HUMAN	S	61	ENSP00000305465:R61S	ENSP00000305465:R61S	R	-	1	0	PDILT	20317943	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.640000	0.54350	2.623000	0.88846	0.591000	0.81541	CGC	.	.	.	alt		0.562	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
IRX6	79190	hgsc.bcm.edu	37	16	55360382	55360382	+	Silent	SNP	G	G	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:55360382G>A	ENST00000290552.7	+	2	1512	c.180G>A	c.(178-180)gcG>gcA	p.A60A	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	60					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TGGGCAGTGCGCGACCGGAGC	0.657																																					p.A60A		Atlas-SNP	.											.	IRX6	66	.	0			c.G180A						PASS	.						26.0	24.0	25.0					16																	55360382		2198	4300	6498	SO:0001819	synonymous_variant	79190	exon2			CAGTGCGCGACCG	AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.180G>A	chr16.hg19:g.55360382G>A		40.0	0.0	.		48.0	28.0	.	NM_024335	B2RN06|Q7Z2K0	Silent	SNP	ENST00000290552.7	hg19	CCDS32449.1																																																																																			.	.	.	none		0.657	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
CDH5	1003	hgsc.bcm.edu	37	16	66413245	66413245	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:66413245A>C	ENST00000341529.3	+	2	153	c.5A>C	c.(4-6)cAg>cCg	p.Q2P	CDH5_ENST00000563425.2_Missense_Mutation_p.Q2P	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	2					adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GGGAAGATGCAGAGGCTCATG	0.572																																					p.Q2P		Atlas-SNP	.											.	CDH5	111	.	0			c.A5C						PASS	.						79.0	83.0	82.0					16																	66413245		2200	4299	6499	SO:0001583	missense	1003	exon2			AGATGCAGAGGCT	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.5A>C	chr16.hg19:g.66413245A>C	ENSP00000344115:p.Gln2Pro	231.0	0.0	.		268.0	61.0	.	NM_001795	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	hg19	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791839	0.31685	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.56103	0.48	4.38	2.03	0.26663	.	.	.	.	.	T	0.27169	0.0666	N	0.08118	0	0.42316	D	0.992239	B	0.11235	0.004	B	0.06405	0.002	T	0.04386	-1.0955	9	0.42905	T	0.14	.	4.3874	0.11323	0.6928:0.2005:0.1067:0.0	.	2	P33151	CADH5_HUMAN	P	2	ENSP00000344115:Q2P	ENSP00000344115:Q2P	Q	+	2	0	CDH5	64970746	0.837000	0.29446	0.481000	0.27354	0.805000	0.45488	1.348000	0.33987	0.204000	0.20548	0.379000	0.24179	CAG	.	.	.	none		0.572	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ZC3H18	124245	hgsc.bcm.edu	37	16	88666335	88666335	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr16:88666335C>A	ENST00000301011.5	+	6	1267	c.1067C>A	c.(1066-1068)cCg>cAg	p.P356Q	ZC3H18_ENST00000452588.2_Missense_Mutation_p.P380Q	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	356						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		TCTCGGATCCCGAGAGATGTC	0.517																																					p.P356Q	Ovarian(121;375 2276 20373 38669)	Atlas-SNP	.											.	ZC3H18	90	.	0			c.C1067A						PASS	.						97.0	105.0	102.0					16																	88666335		2198	4300	6498	SO:0001583	missense	124245	exon6			GGATCCCGAGAGA	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1067C>A	chr16.hg19:g.88666335C>A	ENSP00000301011:p.Pro356Gln	153.0	0.0	.		184.0	9.0	.	NM_144604	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	hg19	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108621	0.37242	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	T;T	0.30448	1.53;1.56	5.16	5.16	0.70880	.	0.103761	0.64402	D	0.000003	T	0.30727	0.0774	L	0.34521	1.04	0.37331	D	0.909979	P;P;P	0.41569	0.755;0.459;0.755	B;B;B	0.43360	0.417;0.299;0.417	T	0.21621	-1.0240	10	0.46703	T	0.11	-3.6361	16.815	0.85732	0.0:1.0:0.0:0.0	.	380;380;356	E7ERS3;B4DTK7;Q86VM9	.;.;ZCH18_HUMAN	Q	356;380;380;239	ENSP00000301011:P356Q;ENSP00000416951:P380Q	ENSP00000289509:P380Q	P	+	2	0	ZC3H18	87193836	1.000000	0.71417	0.028000	0.17463	0.747000	0.42532	5.110000	0.64622	2.390000	0.81377	0.561000	0.74099	CCG	.	.	.	none		0.517	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
SREBF1	6720	hgsc.bcm.edu	37	17	17722461	17722461	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:17722461T>C	ENST00000261646.5	-	5	1118	c.934A>G	c.(934-936)Agc>Ggc	p.S312G	SREBF1_ENST00000338854.5_Missense_Mutation_p.S312G|SREBF1_ENST00000395757.1_Missense_Mutation_p.S58G|SREBF1_ENST00000583732.1_5'UTR|SREBF1_ENST00000355815.4_Missense_Mutation_p.S342G|SREBF1_ENST00000435530.2_Missense_Mutation_p.S312G	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	312	Interaction with LMNA. {ECO:0000250}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						GGGGCCTTGCTGCCAGCTGCG	0.607																																					p.S342G		Atlas-SNP	.											.	SREBF1	47	.	0			c.A1024G						PASS	.						62.0	60.0	60.0					17																	17722461		2203	4300	6503	SO:0001583	missense	6720	exon6			CCTTGCTGCCAGC	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.934A>G	chr17.hg19:g.17722461T>C	ENSP00000261646:p.Ser312Gly	92.0	0.0	.		83.0	34.0	.	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	hg19	CCDS11189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.54|11.54	1.668371|1.668371	0.29604|0.29604	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000395751|ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530	.|T;T;T;T;T	.|0.76578	.|0.66;0.65;0.66;1.02;-1.03	4.41|4.41	0.985|0.985	0.19779|0.19779	.|.	.|0.390138	.|0.18906	.|N	.|0.127893	T|T	0.43809|0.43809	0.1264|0.1264	N|N	0.01091|0.01091	-1.02|-1.02	0.27003|0.27003	N|N	0.964868|0.964868	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.04013	.|0.001;0.001;0.0;0.001	T|T	0.37150|0.37150	-0.9718|-0.9718	5|10	.|0.14656	.|T	.|0.56	-6.3745|-6.3745	8.5495|8.5495	0.33442|0.33442	0.0:0.7314:0.0:0.2686|0.0:0.7314:0.0:0.2686	.|.	.|312;288;312;342	.|B0I4X3;B0I4X4;P36956;P36956-4	.|.;.;SRBP1_HUMAN;.	R|G	319|312;342;312;58;149;238;312	.|ENSP00000345822:S312G;ENSP00000348069:S342G;ENSP00000261646:S312G;ENSP00000379106:S58G;ENSP00000413389:S312G	.|ENSP00000261646:S312G	Q|S	-|-	2|1	0|0	SREBF1|SREBF1	17663186|17663186	0.654000|0.654000	0.27367|0.27367	0.484000|0.484000	0.27391|0.27391	0.781000|0.781000	0.44180|0.44180	1.287000|1.287000	0.33284|0.33284	-0.124000|-0.124000	0.11724|0.11724	0.459000|0.459000	0.35465|0.35465	CAG|AGC	.	.	.	none		0.607	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
POLG2	11232	hgsc.bcm.edu	37	17	62486981	62486981	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:62486981C>G	ENST00000539111.2	-	4	968	c.901G>C	c.(901-903)Gaa>Caa	p.E301Q		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	301					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			CACAGGGTTTCTATTAACTCC	0.408																																					p.E301Q	Colon(3;18 21 435 17652 48887)	Atlas-SNP	.											.	POLG2	29	.	0			c.G901C						PASS	.						118.0	105.0	110.0					17																	62486981		2203	4300	6503	SO:0001583	missense	11232	exon4			GGGTTTCTATTAA	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.901G>C	chr17.hg19:g.62486981C>G	ENSP00000442563:p.Glu301Gln	86.0	0.0	.		81.0	39.0	.	NM_007215	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	hg19	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048199	0.75846	.	.	ENSG00000256525	ENST00000539111	T	0.79554	-1.28	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.88194	0.6371	M	0.81341	2.54	0.58432	D	0.999998	D;D	0.71674	0.998;0.998	P;P	0.55713	0.782;0.782	D	0.88758	0.3255	10	0.51188	T	0.08	-11.7483	19.247	0.93906	0.0:1.0:0.0:0.0	.	301;301	E5KS15;Q9UHN1	.;DPOG2_HUMAN	Q	301	ENSP00000442563:E301Q	ENSP00000442563:E301Q	E	-	1	0	POLG2	59917443	1.000000	0.71417	0.997000	0.53966	0.239000	0.25481	6.697000	0.74603	2.516000	0.84829	0.655000	0.94253	GAA	.	.	.	none		0.408	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1	NM_007215	
RNF213	57674	hgsc.bcm.edu	37	17	78293016	78293016	+	Silent	SNP	C	C	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:78293016C>G	ENST00000582970.1	+	17	3071	c.2928C>G	c.(2926-2928)gcC>gcG	p.A976A	RNF213_ENST00000319921.4_Silent_p.A976A|RNF213_ENST00000508628.2_Silent_p.A1025A|RNF213_ENST00000456466.1_Silent_p.A976A|CTD-2047H16.2_ENST00000576808.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	976					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGATCACTGCCTACTGCAATA	0.522																																					p.A976A		Atlas-SNP	.											.	RNF213	766	.	0			c.C2928G						PASS	.						122.0	122.0	122.0					17																	78293016		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon17			CACTGCCTACTGC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2928C>G	chr17.hg19:g.78293016C>G		217.0	0.0	.		218.0	79.0	.	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	hg19	CCDS58606.1																																																																																			.	.	.	none		0.522	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
LPHN1	22859	hgsc.bcm.edu	37	19	14268166	14268166	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:14268166C>A	ENST00000340736.6	-	15	2954	c.2657G>T	c.(2656-2658)cGg>cTg	p.R886L	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.R881L	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	886					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.R886L(1)		central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CTGCAGCCCCCGCAGGAAGCA	0.587																																					p.R886L		Atlas-SNP	.											LPHN1,NS,carcinoma,0,1	LPHN1	107	.	1	Substitution - Missense(1)	endometrium(1)	c.G2657T						PASS	.						138.0	126.0	130.0					19																	14268166		2203	4300	6503	SO:0001583	missense	22859	exon15			AGCCCCCGCAGGA	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.2657G>T	chr19.hg19:g.14268166C>A	ENSP00000340688:p.Arg886Leu	113.0	1.0	.		135.0	7.0	.	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	hg19	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275126	0.80580	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.58652	0.32;0.32	4.62	3.57	0.40892	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.80059	0.4554	M	0.92555	3.32	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	D	0.84354	0.0534	10	0.87932	D	0	.	12.6877	0.56956	0.0:0.8322:0.1678:0.0	.	881;886	O94910-2;O94910	.;LPHN1_HUMAN	L	886;881	ENSP00000340688:R886L;ENSP00000355328:R881L	ENSP00000340688:R886L	R	-	2	0	LPHN1	14129166	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.754000	0.85163	1.038000	0.40049	0.491000	0.48974	CGG	.	.	.	none		0.587	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
EPS15L1	58513	hgsc.bcm.edu	37	19	16503123	16503124	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:16503123_16503124GT>AA	ENST00000248070.6	-	19	2233_2234	c.2094_2095AC>TT	c.(2092-2097)ttACct>ttTTct	p.698_699LP>FS	EPS15L1_ENST00000594975.1_Missense_Mutation_p.700_701LP>FS|EPS15L1_ENST00000455140.2_Missense_Mutation_p.698_699LP>FS|EPS15L1_ENST00000535753.2_Missense_Mutation_p.698_699LP>FS	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	698	15 X 3 AA repeats of D-P-F.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						ACCTTCGAAGGTAAGGAAGGGT	0.559																																					p.P699S|p.L698F		Atlas-SNP	.											.	EPS15L1	81	.	0			c.C2095T|c.A2094T						PASS	.																																			SO:0001583	missense	58513	exon19			TCGAAGGTAAGGA|CGAAGGTAAGGAA	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.2094_2095delinsAA	chr19.hg19:g.16503123_16503124delinsAA	ENSP00000248070:p.L698_P699delinsFS	82.0|84.0	0.0	.		80.0|79.0	43.0	.	NM_021235	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	hg19	CCDS32944.1																																																																																			.	.	.	none		0.559	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
EPS15L1	58513	hgsc.bcm.edu	37	19	16551694	16551694	+	Silent	SNP	A	A	G			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:16551694A>G	ENST00000248070.6	-	4	331	c.192T>C	c.(190-192)ggT>ggC	p.G64G	CTD-2013N17.4_ENST00000587343.1_RNA|EPS15L1_ENST00000594975.1_Silent_p.G64G|EPS15L1_ENST00000455140.2_Silent_p.G64G|EPS15L1_ENST00000535753.2_Silent_p.G64G|EPS15L1_ENST00000597937.1_Silent_p.G64G	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	64	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						AGAACCCTTTACCTTCTGGAT	0.527																																					p.G64G		Atlas-SNP	.											.	EPS15L1	81	.	0			c.T192C						PASS	.						270.0	276.0	274.0					19																	16551694		2203	4300	6503	SO:0001819	synonymous_variant	58513	exon4			CCCTTTACCTTCT	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.192T>C	chr19.hg19:g.16551694A>G		541.0	1.0	.		503.0	186.0	.	NM_021235	A2RRF3|A5PL29|B4DKA3	Silent	SNP	ENST00000248070.6	hg19	CCDS32944.1																																																																																			.	.	.	none		0.527	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
BCAM	4059	hgsc.bcm.edu	37	19	45322619	45322619	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:45322619C>T	ENST00000270233.6	+	12	1512	c.1490C>T	c.(1489-1491)cCc>cTc	p.P497L	BCAM_ENST00000589651.1_Missense_Mutation_p.P497L	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	497	Ig-like C2-type 3.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GAGCCAATCCCCGGACGGCAG	0.662																																					p.P497L		Atlas-SNP	.											.	BCAM	53	.	0			c.C1490T						PASS	.						59.0	64.0	62.0					19																	45322619		2203	4300	6503	SO:0001583	missense	4059	exon12			CAATCCCCGGACG	X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1490C>T	chr19.hg19:g.45322619C>T	ENSP00000270233:p.Pro497Leu	84.0	0.0	.		46.0	22.0	.	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	hg19	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.487632	0.01018	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.03124	4.04;4.04	4.31	0.796	0.18648	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.02533	0.0077	L	0.28694	0.88	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.49532	-0.8930	9	0.13853	T	0.58	-6.5334	3.4865	0.07622	0.1986:0.5733:0.0:0.2281	.	497	P50895	BCAM_HUMAN	L	497	ENSP00000270233:P497L;ENSP00000375817:P497L	ENSP00000270233:P497L	P	+	2	0	BCAM	50014459	0.003000	0.15002	0.001000	0.08648	0.113000	0.19764	-0.023000	0.12456	0.031000	0.15407	0.543000	0.68304	CCC	.	.	.	none		0.662	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
FCAR	2204	hgsc.bcm.edu	37	19	55385758	55385758	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:55385758C>T	ENST00000355524.3	+	1	23	c.13C>T	c.(13-15)Cag>Tag	p.Q5*	FCAR_ENST00000391725.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000353758.4_Nonsense_Mutation_p.Q5*|FCAR_ENST00000345937.4_Nonsense_Mutation_p.Q5*|FCAR_ENST00000391726.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000469767.1_Nonsense_Mutation_p.Q5*|FCAR_ENST00000391724.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000391723.3_Nonsense_Mutation_p.Q5*|FCAR_ENST00000359272.4_Nonsense_Mutation_p.Q5*	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	5					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GGACCCCAAACAGACCACCCT	0.483																																					p.Q5X		Atlas-SNP	.											.	FCAR	110	.	0			c.C13T						PASS	.						135.0	122.0	127.0					19																	55385758		2203	4300	6503	SO:0001587	stop_gained	2204	exon1			CCCAAACAGACCA	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.13C>T	chr19.hg19:g.55385758C>T	ENSP00000347714:p.Gln5*	138.0	0.0	.		136.0	59.0	.	NM_133279	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Nonsense_Mutation	SNP	ENST00000355524.3	hg19	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549835	0.65311	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000353758;ENST00000359272;ENST00000391723;ENST00000391724	.	.	.	2.76	1.72	0.24424	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	7.8266	0.29318	0.0:0.2588:0.7412:0.0	.	.	.	.	X	5	.	ENSP00000338257:Q5X	Q	+	1	0	FCAR	60077570	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-0.054000	0.11826	0.725000	0.32318	-0.226000	0.12346	CAG	.	.	.	none		0.483	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
LNX2	222484	hgsc.bcm.edu	37	13	28136573	28136575	+	In_Frame_Del	DEL	CCG	CCG	-	rs377695945		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr13:28136573_28136575delCCG	ENST00000316334.3	-	5	1328_1330	c.1199_1201delCGG	c.(1198-1203)ccggag>cag	p.400_401PE>Q		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	400	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		GCAGCAAGCTCCGGAGTTCCATA	0.512																																					p.400_401del		Atlas-INDEL	.											.	LNX2	70	.	0			c.1200_1202del						PASS	.																																			SO:0001651	inframe_deletion	222484	exon5			.	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1199_1201delCGG	chr13.hg19:g.28136573_28136575delCCG	ENSP00000325929:p.Pro400_Glu401delinsGln	175.0	0.0	0		143.0	58.0	0.405594	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	In_Frame_Del	DEL	ENST00000316334.3	hg19	CCDS9323.1																																																																																			.	.	.	none		0.512	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
PORCN	64840	hgsc.bcm.edu	37	X	48371012	48371012	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chrX:48371012delG	ENST00000326194.6	+	5	634	c.591delG	c.(589-591)ctgfs	p.L197fs	PORCN_ENST00000537758.1_Frame_Shift_Del_p.L197fs|PORCN_ENST00000361988.3_Frame_Shift_Del_p.L197fs|PORCN_ENST00000359882.4_Frame_Shift_Del_p.L197fs|PORCN_ENST00000355092.3_Frame_Shift_Del_p.L197fs|PORCN_ENST00000355961.4_Frame_Shift_Del_p.L197fs|PORCN_ENST00000367574.4_Frame_Shift_Del_p.L126fs	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	197					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCCGGAGCCTGGCACTGGCCC	0.647																																					p.L197fs		Atlas-INDEL	.											.	PORCN	61	.	0			c.590delT						PASS	.						54.0	48.0	50.0					X																	48371012		2203	4300	6503	SO:0001589	frameshift_variant	64840	exon5			.	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.591delG	chrX.hg19:g.48371012delG	ENSP00000322304:p.Leu197fs	15.0	0.0	0		11.0	11.0	1	NM_203475	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Frame_Shift_Del	DEL	ENST00000326194.6	hg19	CCDS14299.1																																																																																			.	.	.	none		0.647	PORCN-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356990.1	NM_022825	
C15orf43	145645	hgsc.bcm.edu	37	15	45270783	45270783	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:45270783delA	ENST00000340827.3	+	7	637	c.620delA	c.(619-621)gaafs	p.E207fs		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	207										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GTTCAAAATGAAATTAATATG	0.294																																					p.E207fs		Atlas-INDEL	.											.	C15orf43	19	.	0			c.619delG						PASS	.						40.0	43.0	42.0					15																	45270783		2193	4282	6475	SO:0001589	frameshift_variant	145645	exon7			.	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.620delA	chr15.hg19:g.45270783delA	ENSP00000340644:p.Glu207fs	52.0	0.0	0		44.0	18.0	0.409091	NM_152448		Frame_Shift_Del	DEL	ENST00000340827.3	hg19	CCDS10115.1																																																																																			.	.	.	none		0.294	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
C19orf45	374877	hgsc.bcm.edu	37	19	7570473	7570475	+	In_Frame_Del	DEL	CGG	CGG	-	rs568541151		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CGG	CGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr19:7570473_7570475delCGG	ENST00000361664.2	+	6	1107_1109	c.966_968delCGG	c.(964-969)cccggc>ccc	p.G323del	CTD-2207O23.12_ENST00000599312.1_5'Flank	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45	323										endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						GCCCCGGCCCCGGCAGTCTGGAC	0.571																																					p.322_323del		Atlas-INDEL	.											.	C19orf45	36	.	0			c.965_967del						PASS	.																																			SO:0001651	inframe_deletion	374877	exon6			.	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.966_968delCGG	chr19.hg19:g.7570473_7570475delCGG	ENSP00000355241:p.Gly323del	97.0	0.0	0		71.0	25.0	0.352113	NM_198534	Q8N115	In_Frame_Del	DEL	ENST00000361664.2	hg19	CCDS12179.2																																																																																			.	.	.	none		0.571	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347808.1	NM_198534	
PARD6B	84612	hgsc.bcm.edu	37	20	49366983	49366991	+	In_Frame_Del	DEL	TCAAAAACT	TCAAAAACT	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	TCAAAAACT	TCAAAAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr20:49366983_49366991delTCAAAAACT	ENST00000371610.2	+	3	1320_1328	c.1077_1085delTCAAAAACT	c.(1075-1086)gatcaaaaactc>gac	p.QKL360del	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	360					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						ATGCTCCAGATCAAAAACTCTTAGAAGAA	0.397																																					p.359_362del		Atlas-INDEL	.											.	PARD6B	31	.	0			c.1076_1084del						PASS	.																																			SO:0001651	inframe_deletion	84612	exon3			.	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.1077_1085delTCAAAAACT	chr20.hg19:g.49366983_49366991delTCAAAAACT	ENSP00000360672:p.Gln360_Leu362del	66.0	0.0	0		74.0	22.0	0.297297	NM_032521	A2A2A7|Q9Y510	In_Frame_Del	DEL	ENST00000371610.2	hg19	CCDS33485.1																																																																																			.	.	.	none		0.397	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521	
NF1	4763	hgsc.bcm.edu	37	17	29552188	29552189	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:29552188_29552189delAG	ENST00000358273.4	+	17	2304_2305	c.1921_1922delAG	c.(1921-1923)agtfs	p.S641fs	NF1_ENST00000356175.3_Frame_Shift_Del_p.S641fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	641					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGGAAATACCAGTCAAATGTCC	0.406			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.640_641del		Atlas-INDEL	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.1920_1921del						PASS	.																																			SO:0001589	frameshift_variant	4763	exon17	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1921_1922delAG	chr17.hg19:g.29552188_29552189delAG	ENSP00000351015:p.Ser641fs	171.0	0.0	0		177.0	70.0	0.39548	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	hg19	CCDS42292.1																																																																																			.	.	.	none		0.406	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ITPKA	3706	hgsc.bcm.edu	37	15	41794669	41794670	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr15:41794669_41794670insA	ENST00000260386.5	+	5	1131_1132	c.1078_1079insA	c.(1078-1080)gaafs	p.E360fs		NM_002220.2	NP_002211.1	P23677	IP3KA_HUMAN	inositol-trisphosphate 3-kinase A	360					actin cytoskeleton organization (GO:0030036)|dendritic spine maintenance (GO:0097062)|inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|positive regulation of dendritic spine morphogenesis (GO:0061003)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendritic spine (GO:0043197)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			kidney(1)|lung(3)|skin(1)	5		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;7.63e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TCGCGTCTTTGAAGAGTTTGTG	0.604																																					p.E360fs		Atlas-INDEL	.											.	ITPKA	19	.	0			c.1078_1079insA						PASS	.																																			SO:0001589	frameshift_variant	3706	exon5			.	X54938	CCDS10076.1	15q15.1	2011-04-28	2011-04-28		ENSG00000137825	ENSG00000137825	2.7.1.127		6178	protein-coding gene	gene with protein product		147521	"""inositol 1,4,5-trisphosphate 3-kinase A"""			1330886, 2175886	Standard	NM_002220		Approved	IP3KA, IP3-3KA	uc001znz.3	P23677	OTTHUMG00000130343	ENST00000260386.5:c.1080dupA	chr15.hg19:g.41794671_41794671dupA	ENSP00000260386:p.Glu360fs	67.0	0.0	0		80.0	29.0	0.3625	NM_002220	Q8TAN3	Frame_Shift_Ins	INS	ENST00000260386.5	hg19	CCDS10076.1																																																																																			.	.	.	none		0.604	ITPKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252695.3	NM_002220	
NF1	4763	hgsc.bcm.edu	37	17	29490388	29490388	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr17:29490388delC	ENST00000358273.4	+	4	856	c.473delC	c.(472-474)tctfs	p.S158fs	NF1_ENST00000431387.4_Frame_Shift_Del_p.S158fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.S158fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	158					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGTCGCATTTCTACCAGGTTA	0.368			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.S158fs		Atlas-INDEL	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)	c.472delT						PASS	.						53.0	52.0	52.0					17																	29490388		2203	4300	6503	SO:0001589	frameshift_variant	4763	exon4	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.473delC	chr17.hg19:g.29490388delC	ENSP00000351015:p.Ser158fs	110.0	0.0	0		104.0	56.0	0.538462	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	hg19	CCDS42292.1																																																																																			.	.	.	none		0.368	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
SLC10A4	201780	hgsc.bcm.edu	37	4	48490947	48490948	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr4:48490947_48490948insTC	ENST00000273861.4	+	3	1524_1525	c.1305_1306insTC	c.(1306-1308)tctfs	p.S436fs	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	436						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						CCGCTCAGACTTCTCTCTAAAT	0.351																																					p.T435fs		Atlas-INDEL	.											.,1	SLC10A4	23	.	0			c.1305_1306insTC						PASS	.																																			SO:0001589	frameshift_variant	201780	exon3			.	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.1310_1311dupTC	chr4.hg19:g.48490952_48490953dupTC	ENSP00000273861:p.Ser436fs	63.0	0.0	0		67.0	16.0	0.238806	NM_152679	Q8WUZ2	Frame_Shift_Ins	INS	ENST00000273861.4	hg19	CCDS3482.1																																																																																			.	.	.	none		0.351	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	
UFSP1	402682	hgsc.bcm.edu	37	7	100486530	100486530	+	Frame_Shift_Del	DEL	G	G	-	rs372960530		TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr7:100486530delG	ENST00000388761.2	-	1	809	c.363delC	c.(361-363)cccfs	p.P121fs		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	121						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					AGAAGGAGTTGGGGTCAAAGG	0.567																																					p.N122fs		Atlas-INDEL	.											.	UFSP1	8	.	0			c.364delA						PASS	.						181.0	154.0	163.0					7																	100486530		2203	4300	6503	SO:0001589	frameshift_variant	402682	exon1			.	AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.363delC	chr7.hg19:g.100486530delG	ENSP00000373413:p.Pro121fs	153.0	0.0	0		197.0	106.0	0.538071	NM_001015072	A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Frame_Shift_Del	DEL	ENST00000388761.2	hg19	CCDS34710.1																																																																																			.	.	.	none		0.567	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356751.1	NM_001015072	
PPP2R2A	5520	hgsc.bcm.edu	37	8	26227846	26227849	+	Frame_Shift_Del	DEL	CACA	CACA	-			TCGA-BQ-7044-01A-11D-1961-08	TCGA-BQ-7044-11A-01D-1961-08	CACA	CACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0589e51-4685-4613-8004-44efad45180f	12341a8c-b9d0-445d-b2fd-ed077738ba31	g.chr8:26227846_26227849delCACA	ENST00000380737.3	+	10	1590_1593	c.1261_1264delCACA	c.(1261-1266)cacacafs	p.HT421fs	PPP2R2A_ENST00000315985.7_Frame_Shift_Del_p.HT431fs	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	421					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		GAAAATCCTTCACACAGCCTGGCA	0.426																																					p.430_431del		Atlas-INDEL	.											.	PPP2R2A	44	.	0			c.1290_1293del						PASS	.																																			SO:0001589	frameshift_variant	5520	exon10			.	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.1261_1264delCACA	chr8.hg19:g.26227846_26227849delCACA	ENSP00000370113:p.His421fs	51.0	0.0	0		45.0	11.0	0.244444	NM_001177591	B2RBU8|B4E1T7|P50409|Q00007	Frame_Shift_Del	DEL	ENST00000380737.3	hg19	CCDS34867.1																																																																																			.	.	.	none		0.426	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375954.2	NM_002717	
