#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EMC1	23065	hgsc.bcm.edu	37	1	19566346	19566346	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:19566346T>C	ENST00000477853.1	-	8	962	c.920A>G	c.(919-921)tAt>tGt	p.Y307C	EMC1_ENST00000375199.3_Missense_Mutation_p.Y307C|EMC1_ENST00000375208.3_Missense_Mutation_p.Y285C|RP1-43E13.2_ENST00000437898.1_RNA	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1	307						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											CAGCGTTCCATAATGGTACTG	0.547																																					p.Y307C		Atlas-SNP	.											.	.	.	.	0			c.A920G						PASS	.						81.0	83.0	82.0					1																	19566346		2203	4300	6503	SO:0001583	missense	23065	exon8			GTTCCATAATGGT		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.920A>G	chr1.hg19:g.19566346T>C	ENSP00000420608:p.Tyr307Cys	91.0	0.0	.		81.0	28.0	.	NM_001271427	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	Missense_Mutation	SNP	ENST00000477853.1	hg19	CCDS190.1	.	.	.	.	.	.	.	.	.	.	T	6.476	0.456042	0.12283	.	.	ENSG00000127463	ENST00000477853;ENST00000375199;ENST00000375208	T;T;T	0.21932	1.98;1.98;1.98	5.63	3.3	0.37823	.	0.510435	0.24343	N	0.039353	T	0.10252	0.0251	N	0.08118	0	0.09310	N	0.999998	B;P;P;B	0.35456	0.218;0.502;0.502;0.369	B;B;B;B	0.36418	0.161;0.161;0.224;0.112	T	0.17653	-1.0362	10	0.36615	T	0.2	-5.9075	8.4851	0.33067	0.1216:0.0:0.1381:0.7404	.	285;307;307;307	Q8N766-4;Q8N766-2;Q8N766-3;Q8N766	.;.;.;K0090_HUMAN	C	307;307;285	ENSP00000420608:Y307C;ENSP00000364345:Y307C;ENSP00000364354:Y285C	ENSP00000364345:Y307C	Y	-	2	0	KIAA0090	19438933	0.998000	0.40836	0.449000	0.26957	0.158000	0.22134	3.412000	0.52679	2.137000	0.66172	0.533000	0.62120	TAT	.	.	.	none		0.547	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007076.2	NM_015047	
GFI1	2672	hgsc.bcm.edu	37	1	92948601	92948601	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:92948601T>C	ENST00000370332.1	-	3	436	c.118A>G	c.(118-120)Agc>Ggc	p.S40G	GFI1_ENST00000294702.5_Missense_Mutation_p.S40G|GFI1_ENST00000483490.1_5'UTR|GFI1_ENST00000427103.1_Missense_Mutation_p.S40G	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	40					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		TTTGAAGTGCTGTCTGCAAAG	0.667																																					p.S40G		Atlas-SNP	.											.	GFI1	41	.	0			c.A118G						PASS	.						26.0	32.0	30.0					1																	92948601		2200	4294	6494	SO:0001583	missense	2672	exon3			AAGTGCTGTCTGC	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.118A>G	chr1.hg19:g.92948601T>C	ENSP00000359357:p.Ser40Gly	76.0	0.0	.		55.0	22.0	.	NM_005263	Q8N564	Missense_Mutation	SNP	ENST00000370332.1	hg19	CCDS30773.1	.	.	.	.	.	.	.	.	.	.	T	8.861	0.946887	0.18356	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.09255	3.0;3.0;3.0	5.18	-2.98	0.05513	.	0.726593	0.13857	N	0.357995	T	0.01029	0.0034	N	0.12182	0.205	0.19775	N	0.999954	B	0.02656	0.0	B	0.01281	0.0	T	0.46133	-0.9213	10	0.06891	T	0.86	-6.9644	7.2257	0.26014	0.1163:0.4299:0.0:0.4538	.	40	Q99684	GFI1_HUMAN	G	40	ENSP00000359357:S40G;ENSP00000399719:S40G;ENSP00000294702:S40G	ENSP00000294702:S40G	S	-	1	0	GFI1	92721189	0.003000	0.15002	0.979000	0.43373	0.161000	0.22273	-0.880000	0.04183	-0.481000	0.06792	-0.379000	0.06801	AGC	.	.	.	none		0.667	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030054.1	NM_005263	
DNM3	26052	hgsc.bcm.edu	37	1	171810797	171810797	+	Start_Codon_SNP	SNP	A	A	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:171810797A>C	ENST00000355305.5	+	1	158	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	DNM3_ENST00000358155.4_Start_Codon_SNP_p.M1L|DNM3_ENST00000520906.1_Start_Codon_SNP_p.M1L|DNM3_ENST00000367733.2_Start_Codon_SNP_p.M1L|DNM3_ENST00000367731.1_Start_Codon_SNP_p.M1L			Q9UQ16	DYN3_HUMAN	dynamin 3	1					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTCGGGCAAGATGGGGAACCG	0.692																																					p.M1L		Atlas-SNP	.											.	DNM3	85	.	0			c.A1C						PASS	.						17.0	24.0	22.0					1																	171810797		2051	4215	6266	SO:0001582	initiator_codon_variant	26052	exon1			GGCAAGATGGGGA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1A>C	chr1.hg19:g.171810797A>C	ENSP00000347457:p.Met1Leu	16.0	0.0	.		28.0	11.0	.	NM_001136127	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	hg19		.	.	.	.	.	.	.	.	.	.	a	25.2	4.614577	0.87359	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906	D;D;D;D;D	0.93307	-3.07;-2.83;-3.08;-3.1;-3.2	3.67	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.85974	0.5822	.	.	.	0.23758	N	0.996926	B;P;P;B	0.40794	0.25;0.729;0.729;0.015	B;B;B;B	0.40134	0.067;0.202;0.32;0.016	T	0.81132	-0.1072	9	0.72032	D	0.01	.	10.5782	0.45240	1.0:0.0:0.0:0.0	.	1;1;1;1	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	L	1	ENSP00000350876:M1L;ENSP00000356707:M1L;ENSP00000347457:M1L;ENSP00000356705:M1L;ENSP00000429701:M1L	ENSP00000347457:M1L	M	+	1	0	DNM3	170077420	1.000000	0.71417	0.925000	0.36789	0.899000	0.52679	4.645000	0.61404	1.656000	0.50722	0.478000	0.44815	ATG	.	.	.	none		0.692	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	Missense_Mutation
MR1	3140	hgsc.bcm.edu	37	1	181019230	181019230	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:181019230G>T	ENST00000367580.5	+	3	417	c.412G>T	c.(412-414)Ggg>Tgg	p.G138W	MR1_ENST00000438435.2_3'UTR|MR1_ENST00000282990.6_Missense_Mutation_p.G138W|MR1_ENST00000367579.3_Intron|MR1_ENST00000434571.2_Missense_Mutation_p.G138W	NM_001531.2	NP_001522.1	Q95460	HMR1_HUMAN	major histocompatibility complex, class I-related	138	Alpha-2.|Ligand-binding.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	MHC class I receptor activity (GO:0032393)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	18					Antithymocyte globulin(DB00098)	TGCATATGACGGGCAGGATTT	0.502																																					p.G138W	Colon(174;1412 1962 45296 46549 47110)	Atlas-SNP	.											.	MR1	46	.	0			c.G412T						PASS	.						128.0	115.0	120.0					1																	181019230		2203	4300	6503	SO:0001583	missense	3140	exon4			TATGACGGGCAGG	AF010446	CCDS1342.1, CCDS53440.1, CCDS53441.1, CCDS53442.1	1q25.3	2013-01-11	2003-03-05	2003-03-07	ENSG00000153029	ENSG00000153029		"""Immunoglobulin superfamily / C1-set domain containing"""	4975	protein-coding gene	gene with protein product		600764	"""major histocompatibility complex, class I-like sequence"""	HLALS		7624800, 9784382	Standard	NM_001194999		Approved		uc001goq.2	Q95460	OTTHUMG00000035175	ENST00000367580.5:c.412G>T	chr1.hg19:g.181019230G>T	ENSP00000356552:p.Gly138Trp	112.0	0.0	.		99.0	7.0	.	NM_001195035	A8K2V9|B4E3B1|O97985|O97986|Q53GM1|Q95HB8|Q9MY23|Q9NPL2|Q9TQB3|Q9TQB9|Q9TQK3	Missense_Mutation	SNP	ENST00000367580.5	hg19	CCDS1342.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.460730	0.63513	.	.	ENSG00000153029	ENST00000434571;ENST00000367580;ENST00000282990	T;T;T	0.00468	7.22;7.22;7.22	4.27	4.27	0.50696	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.317505	0.27270	N	0.020131	T	0.03136	0.0092	H	0.98426	4.23	0.42493	D	0.992906	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.03773	-1.1005	9	0.87932	D	0	.	14.5586	0.68120	0.0:0.0:1.0:0.0	.	138;138;138;138	B4E3B1;Q95460-3;Q95460;Q95460-4	.;.;HMR1_HUMAN;.	W	138	ENSP00000388504:G138W;ENSP00000356552:G138W;ENSP00000282990:G138W	ENSP00000282990:G138W	G	+	1	0	MR1	179285853	1.000000	0.71417	0.997000	0.53966	0.623000	0.37688	4.723000	0.61965	2.362000	0.80069	0.460000	0.39030	GGG	.	.	.	none		0.502	MR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085134.2	NM_001531	
NPL	80896	hgsc.bcm.edu	37	1	182775301	182775301	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr1:182775301G>C	ENST00000367553.1	+	4	208	c.164G>C	c.(163-165)gGc>gCc	p.G55A	NPL_ENST00000367552.2_Missense_Mutation_p.G55A|NPL_ENST00000258317.2_Missense_Mutation_p.G55A|NPL_ENST00000367554.3_5'UTR|NPL_ENST00000367550.2_Missense_Mutation_p.G55A|NPL_ENST00000367555.1_Missense_Mutation_p.G55A|NPL_ENST00000463899.1_3'UTR	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	55					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						ACAGGAGAAGGCCTGTCCCTG	0.532																																					p.G55A		Atlas-SNP	.											.	NPL	55	.	0			c.G164C						PASS	.						111.0	109.0	110.0					1																	182775301		2203	4300	6503	SO:0001583	missense	80896	exon5			GAGAAGGCCTGTC	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.164G>C	chr1.hg19:g.182775301G>C	ENSP00000356524:p.Gly55Ala	77.0	0.0	.		85.0	13.0	.	NM_001200052	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	ENST00000367553.1	hg19	CCDS1350.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482498	0.84747	.	.	ENSG00000135838	ENST00000367555;ENST00000367553;ENST00000367552;ENST00000258317;ENST00000367550	D;D;D;D;D	0.94897	-3.55;-1.53;-3.55;-1.53;-3.55	5.26	5.26	0.73747	Aldolase-type TIM barrel (1);	0.050750	0.85682	D	0.000000	D	0.95695	0.8600	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.969	D;D;P	0.74023	0.957;0.982;0.671	D	0.93397	0.6757	10	0.06625	T	0.88	-14.9114	15.7916	0.78369	0.0:0.0:1.0:0.0	.	55;55;55	Q9BXD5-4;Q9BXD5;Q9BXD5-3	.;NPL_HUMAN;.	A	55	ENSP00000356526:G55A;ENSP00000356524:G55A;ENSP00000356523:G55A;ENSP00000258317:G55A;ENSP00000356521:G55A	ENSP00000258317:G55A	G	+	2	0	NPL	181041924	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.722000	0.74735	2.451000	0.82905	0.563000	0.77884	GGC	.	.	.	none		0.532	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
CYP1B1	1545	hgsc.bcm.edu	37	2	38302357	38302357	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:38302357G>C	ENST00000260630.3	-	2	576	c.175C>G	c.(175-177)Ctg>Gtg	p.L59V	CYP1B1-AS1_ENST00000589303.1_RNA|CYP1B1_ENST00000494864.1_Intron|CYP1B1_ENST00000407341.1_Missense_Mutation_p.L59V|CYP1B1-AS1_ENST00000431999.1_RNA	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	59					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	TTTCCGATCAGTGGCCACGCA	0.721																																					p.L59V		Atlas-SNP	.											.	CYP1B1	39	.	0			c.C175G						PASS	.						8.0	10.0	9.0					2																	38302357		2147	4207	6354	SO:0001583	missense	1545	exon2			CGATCAGTGGCCA	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.175C>G	chr2.hg19:g.38302357G>C	ENSP00000260630:p.Leu59Val	18.0	0.0	.		12.0	6.0	.	NM_000104	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	ENST00000260630.3	hg19	CCDS1793.1	.	.	.	.	.	.	.	.	.	.	G	5.939	0.357214	0.11239	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.69561	-0.41;-0.41	4.29	2.42	0.29668	.	0.389391	0.24269	N	0.040011	T	0.50292	0.1607	N	0.20574	0.59	0.26804	N	0.969141	B	0.27910	0.193	B	0.38378	0.272	T	0.41627	-0.9498	10	0.14656	T	0.56	.	7.627	0.28218	0.0953:0.1661:0.7386:0.0	.	59	Q53TK1	.	V	59	ENSP00000260630:L59V;ENSP00000384972:L59V	ENSP00000260630:L59V	L	-	1	2	CYP1B1	38155861	0.008000	0.16893	0.990000	0.47175	0.027000	0.11550	0.123000	0.15708	0.415000	0.25817	-0.479000	0.04858	CTG	.	.	.	none		0.721	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104	
WDR33	55339	hgsc.bcm.edu	37	2	128526506	128526506	+	Splice_Site	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:128526506C>A	ENST00000322313.4	-	3	432		c.e3+1		WDR33_ENST00000393006.1_Splice_Site|WDR33_ENST00000409658.3_Splice_Site	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CATGTACTTACATCATTGTAA	0.323																																					.		Atlas-SNP	.											.	WDR33	136	.	0			c.273+1G>T						PASS	.						138.0	126.0	130.0					2																	128526506		2203	4300	6503	SO:0001630	splice_region_variant	55339	exon4			TACTTACATCATT		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.273+1G>T	chr2.hg19:g.128526506C>A		142.0	0.0	.		126.0	48.0	.	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Splice_Site	SNP	ENST00000322313.4	hg19	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530432	0.85706	.	.	ENSG00000136709	ENST00000322313;ENST00000436787;ENST00000393006;ENST00000409658;ENST00000408998	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8826	0.92362	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR33	128242976	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.506000	0.81665	2.627000	0.88993	0.655000	0.94253	.	.	.	.	none		0.323	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	Intron
PRICKLE2	166336	hgsc.bcm.edu	37	3	64084893	64084893	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:64084893A>G	ENST00000295902.6	-	8	2954	c.2369T>C	c.(2368-2370)tTc>tCc	p.F790S	RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2_ENST00000564377.1_Missense_Mutation_p.F846S	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	790					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TTCTCCTAGGAAATAGCCCTC	0.567																																					p.F790S		Atlas-SNP	.											.	PRICKLE2	88	.	0			c.T2369C						PASS	.						76.0	77.0	77.0					3																	64084893		2203	4300	6503	SO:0001583	missense	166336	exon8			CCTAGGAAATAGC	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2369T>C	chr3.hg19:g.64084893A>G	ENSP00000295902:p.Phe790Ser	82.0	0.0	.		84.0	39.0	.	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	hg19	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039965	0.75732	.	.	ENSG00000163637	ENST00000295902	D	0.88046	-2.33	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.92004	0.7467	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	D	0.92874	0.6317	10	0.87932	D	0	-40.9764	15.8395	0.78835	1.0:0.0:0.0:0.0	.	790	Q7Z3G6	PRIC2_HUMAN	S	790	ENSP00000295902:F790S	ENSP00000295902:F790S	F	-	2	0	PRICKLE2	64059933	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.152000	0.67230	0.533000	0.62120	TTC	.	.	.	none		0.567	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
PLD1	5337	hgsc.bcm.edu	37	3	171394619	171394619	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr3:171394619G>A	ENST00000351298.4	-	18	2127	c.2001C>T	c.(1999-2001)ttC>ttT	p.F667F	PLD1_ENST00000340989.4_Silent_p.F667F|PLD1_ENST00000342215.6_Missense_Mutation_p.S558L|PLD1_ENST00000356327.5_Silent_p.F629F	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	667	Catalytic.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ACCTGTCAATGAAATCTGCCC	0.542																																					p.F667F	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											.	PLD1	134	.	0			c.C2001T						PASS	.						52.0	46.0	48.0					3																	171394619		2203	4300	6503	SO:0001819	synonymous_variant	5337	exon18			GTCAATGAAATCT	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.2001C>T	chr3.hg19:g.171394619G>A		39.0	0.0	.		47.0	19.0	.	NM_002662		Silent	SNP	ENST00000351298.4	hg19	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505561	0.64410	.	.	ENSG00000075651	ENST00000342215	T	0.34275	1.37	5.81	4.94	0.65067	.	.	.	.	.	T	0.46073	0.1374	.	.	.	0.28598	N	0.90932	.	.	.	.	.	.	T	0.42515	-0.9447	6	0.49607	T	0.09	-20.5851	14.4529	0.67397	0.0699:0.0:0.9301:0.0	.	.	.	.	L	558	ENSP00000339936:S558L	ENSP00000339936:S558L	S	-	2	0	PLD1	172877313	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.889000	0.56212	1.464000	0.47987	0.557000	0.71058	TCA	.	.	.	none		0.542	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
SEL1L3	23231	hgsc.bcm.edu	37	4	25806261	25806261	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:25806261A>T	ENST00000399878.3	-	10	1800	c.1678T>A	c.(1678-1680)Ttt>Att	p.F560I	SEL1L3_ENST00000264868.5_Missense_Mutation_p.F525I|SEL1L3_ENST00000502949.1_Missense_Mutation_p.F407I	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	560						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TCCGTCAGAAAGGGGACGATA	0.433																																					p.F560I		Atlas-SNP	.											.	SEL1L3	62	.	0			c.T1678A						PASS	.						93.0	89.0	90.0					4																	25806261		1896	4134	6030	SO:0001583	missense	23231	exon10			TCAGAAAGGGGAC	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1678T>A	chr4.hg19:g.25806261A>T	ENSP00000382767:p.Phe560Ile	55.0	0.0	.		55.0	23.0	.	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	hg19	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.076787	0.36662	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.13538	2.79;2.8;2.58	6.02	2.18	0.27775	Tetratricopeptide-like helical (1);	0.882014	0.10506	N	0.666713	T	0.12732	0.0309	L	0.47716	1.5	0.26551	N	0.973918	B	0.19445	0.036	B	0.12837	0.008	T	0.35375	-0.9791	10	0.20519	T	0.43	-0.7039	10.2524	0.43377	0.7466:0.0:0.2534:0.0	.	560	Q68CR1	SE1L3_HUMAN	I	560;525;407	ENSP00000382767:F560I;ENSP00000264868:F525I;ENSP00000425438:F407I	ENSP00000264868:F525I	F	-	1	0	SEL1L3	25415359	0.998000	0.40836	0.775000	0.31657	0.911000	0.54048	2.508000	0.45450	0.151000	0.19162	0.533000	0.62120	TTT	.	.	.	none		0.433	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
FAM218A	152756	hgsc.bcm.edu	37	4	165878576	165878576	+	Silent	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr4:165878576T>C	ENST00000513876.2	+	1	477	c.402T>C	c.(400-402)ccT>ccC	p.P134P	TRIM61_ENST00000329314.5_Intron	NM_153027.1	NP_694572.1	Q96MZ4	F218A_HUMAN	family with sequence similarity 218, member A	134																	GGTCCCAGCCTCTTTTTGTGA	0.572																																					p.P134P		Atlas-SNP	.											C4orf39,right_upper_lobe,carcinoma,0,1	.	.	.	0			c.T402C						PASS	.						73.0	74.0	74.0					4																	165878576		2203	4300	6503	SO:0001819	synonymous_variant	152756	exon1			CCAGCCTCTTTTT	AK056221	CCDS3807.1	4q32.3	2012-03-01	2012-03-01	2012-03-01	ENSG00000250486	ENSG00000250486			26466	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 39"""	C4orf39		12477932	Standard	NM_153027		Approved	FLJ31659	uc003iqx.1	Q96MZ4	OTTHUMG00000161252	ENST00000513876.2:c.402T>C	chr4.hg19:g.165878576T>C		79.0	1.0	.		93.0	4.0	.	NM_153027		Silent	SNP	ENST00000513876.2	hg19	CCDS3807.1																																																																																			.	.	.	none		0.572	FAM218A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364308.1	NM_153027	
CTNND2	1501	hgsc.bcm.edu	37	5	11117619	11117619	+	Silent	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:11117619C>A	ENST00000304623.8	-	13	2409	c.2220G>T	c.(2218-2220)acG>acT	p.T740T	CTNND2_ENST00000458100.2_Silent_p.T307T|CTNND2_ENST00000503622.1_Silent_p.T403T|CTNND2_ENST00000359640.2_Silent_p.T740T|CTNND2_ENST00000511377.1_Silent_p.T649T|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	740					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.T740T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCAAGGCATCCGTAAGCCCAT	0.507																																					p.T740T		Atlas-SNP	.											CTNND2,caecum,carcinoma,0,1	CTNND2	289	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2220T						PASS	.						215.0	174.0	188.0					5																	11117619		2203	4300	6503	SO:0001819	synonymous_variant	1501	exon13			GGCATCCGTAAGC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2220G>T	chr5.hg19:g.11117619C>A		205.0	1.0	.		198.0	9.0	.	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	hg19	CCDS3881.1																																																																																			.	.	.	none		0.507	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
TNPO1	3842	hgsc.bcm.edu	37	5	72151675	72151675	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:72151675G>A	ENST00000337273.5	+	4	706	c.280G>A	c.(280-282)Ggt>Agt	p.G94S	TNPO1_ENST00000506351.2_Missense_Mutation_p.G86S|TNPO1_ENST00000454282.1_Intron|TNPO1_ENST00000513944.1_3'UTR|TNPO1_ENST00000523768.1_Intron|TNPO1_ENST00000447967.2_Missense_Mutation_p.G86S	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	94	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CTTCCCAAATGGTGTAACAGA	0.328																																					p.G94S		Atlas-SNP	.											TNPO1,colon,carcinoma,0,1	TNPO1	90	.	0			c.G280A						PASS	.						62.0	62.0	62.0					5																	72151675		2203	4297	6500	SO:0001583	missense	3842	exon4			CCAAATGGTGTAA	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.280G>A	chr5.hg19:g.72151675G>A	ENSP00000336712:p.Gly94Ser	95.0	0.0	.		81.0	20.0	.	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	hg19	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737401	0.49045	.	.	ENSG00000083312	ENST00000337273;ENST00000447967;ENST00000506351	T;T;T	0.65549	-0.16;-0.16;-0.16	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.095869	0.64402	D	0.000001	T	0.43255	0.1239	N	0.10685	0.025	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29852	-0.9998	10	0.18276	T	0.48	-2.9577	18.4554	0.90718	0.0:0.0:1.0:0.0	.	94	Q92973	TNPO1_HUMAN	S	94;86;86	ENSP00000336712:G94S;ENSP00000415164:G86S;ENSP00000425118:G86S	ENSP00000336712:G94S	G	+	1	0	TNPO1	72187431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.320000	0.96346	2.430000	0.82344	0.650000	0.86243	GGT	.	.	.	none		0.328	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
FGF1	2246	hgsc.bcm.edu	37	5	141974869	141974869	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:141974869C>A	ENST00000359370.6	-	4	533	c.454G>T	c.(454-456)Gtc>Ttc	p.V152F	FGF1_ENST00000337706.2_Missense_Mutation_p.V152F|FGF1_ENST00000378046.1_Missense_Mutation_p.V152F|FGF1_ENST00000360966.5_3'UTR|AC005592.2_ENST00000414314.1_RNA|AC005592.2_ENST00000443800.1_RNA|FGF1_ENST00000407758.1_3'UTR|FGF1_ENST00000419524.2_Missense_Mutation_p.V152F|FGF1_ENST00000494579.1_5'UTR	NM_000800.4|NM_001144892.2|NM_001144934.1|NM_001144935.1|NM_001257205.1|NM_001257206.1|NM_001257207.1|NM_001257210.1|NM_001257212.1|NM_033137.2	NP_000791.1|NP_001138364.1|NP_001138406.1|NP_001138407.1|NP_001244134.1|NP_001244135.1|NP_001244136.1|NP_001244139.1|NP_001244141.1|NP_149128.1	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic)	152					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|branch elongation involved in ureteric bud branching (GO:0060681)|cell differentiation (GO:0030154)|cellular response to heat (GO:0034605)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesonephric epithelium development (GO:0072163)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	fibroblast growth factor receptor binding (GO:0005104)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|S100 protein binding (GO:0044548)			large_intestine(1)|lung(2)	3		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Amlexanox(DB01025)|Pazopanib(DB06589)|Pentosan Polysulfate(DB00686)	TCAGAAGAGACTGGCAGGGGG	0.493																																					p.V152F		Atlas-SNP	.											.	FGF1	9	.	0			c.G454T						PASS	.						65.0	66.0	66.0					5																	141974869		2203	4300	6503	SO:0001583	missense	2246	exon4			AAGAGACTGGCAG	X59065	CCDS4275.1, CCDS4276.1	5q31.3-q33.2	2014-01-30			ENSG00000113578	ENSG00000113578		"""Endogenous ligands"""	3665	protein-coding gene	gene with protein product	"""heparin-binding growth factor 1"", ""endothelial cell growth factor, alpha"", ""endothelial cell growth factor, beta"""	131220		FGFA		1697263, 3523756	Standard	NM_033137		Approved	AFGF, ECGF, ECGFA, ECGFB, HBGF1, ECGF-beta, FGF-alpha, GLIO703	uc031slo.1	P05230	OTTHUMG00000059703	ENST00000359370.6:c.454G>T	chr5.hg19:g.141974869C>A	ENSP00000352329:p.Val152Phe	104.0	0.0	.		105.0	36.0	.	NM_001257209	B2R5T0|D3DQF2|P07502|Q16588	Missense_Mutation	SNP	ENST00000359370.6	hg19	CCDS4275.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694692	0.68386	.	.	ENSG00000113578	ENST00000359370;ENST00000378046;ENST00000337706;ENST00000441680;ENST00000419524	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.87	5.87	0.94306	.	0.081539	0.51477	D	0.000089	T	0.58133	0.2101	M	0.80982	2.52	0.54753	D	0.999984	P;D	0.53745	0.465;0.962	B;P	0.48189	0.132;0.57	T	0.64495	-0.6394	10	0.87932	D	0	.	20.2084	0.98285	0.0:1.0:0.0:0.0	.	151;152	A8K147;P05230	.;FGF1_HUMAN	F	152	ENSP00000352329:V152F;ENSP00000367285:V152F;ENSP00000338548:V152F;ENSP00000404742:V152F;ENSP00000396195:V152F	ENSP00000338548:V152F	V	-	1	0	FGF1	141955053	0.996000	0.38824	0.940000	0.37924	0.841000	0.47740	4.573000	0.60893	2.774000	0.95407	0.650000	0.86243	GTC	.	.	.	none		0.493	FGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132735.2	NM_000800	
XPO5	57510	hgsc.bcm.edu	37	6	43541219	43541219	+	Silent	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:43541219G>C	ENST00000265351.7	-	2	435	c.225C>G	c.(223-225)gtC>gtG	p.V75V	POLH_ENST00000372236.4_5'Flank|POLH_ENST00000372226.1_5'Flank|POLH_ENST00000535400.1_5'Flank	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	75	Necessary for interaction with Ran.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			CTCCTTACTTGACAACGTGTT	0.433																																					p.V75V		Atlas-SNP	.											.	XPO5	79	.	0			c.C225G						PASS	.						87.0	85.0	86.0					6																	43541219		1910	4111	6021	SO:0001819	synonymous_variant	57510	exon2			TTACTTGACAACG	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.225C>G	chr6.hg19:g.43541219G>C		84.0	0.0	.		433.0	223.0	.	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	ENST00000265351.7	hg19	CCDS47430.1																																																																																			.	.	.	none		0.433	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
LATS1	9113	hgsc.bcm.edu	37	6	150005370	150005370	+	Silent	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:150005370G>T	ENST00000543571.1	-	4	1402	c.855C>A	c.(853-855)atC>atA	p.I285I	LATS1_ENST00000253339.5_Silent_p.I285I|LATS1_ENST00000392273.3_Silent_p.I285I|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AGATTCGGGAGATTACGTATT	0.532																																					p.I285I		Atlas-SNP	.											.	LATS1	241	.	0			c.C855A						PASS	.						153.0	144.0	147.0					6																	150005370		2203	4300	6503	SO:0001819	synonymous_variant	9113	exon4			TCGGGAGATTACG	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.855C>A	chr6.hg19:g.150005370G>T		179.0	0.0	.		172.0	77.0	.	NM_001270519		Silent	SNP	ENST00000543571.1	hg19	CCDS34551.1																																																																																			.	.	.	none		0.532	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
ESR1	2099	hgsc.bcm.edu	37	6	152201893	152201893	+	Silent	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:152201893A>G	ENST00000206249.3	+	3	1109	c.747A>G	c.(745-747)ggA>ggG	p.G249G	ESR1_ENST00000440973.1_Silent_p.G249G|ESR1_ENST00000456483.2_Silent_p.G249G|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000338799.5_Silent_p.G249G|ESR1_ENST00000427531.2_Silent_p.G76G|ESR1_ENST00000443427.1_Silent_p.G249G	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	249	Mediates interaction with DNTTIP2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	ACGAAGTGGGAATGATGAAAG	0.547																																					p.G249G		Atlas-SNP	.											.	ESR1	94	.	0			c.A747G						PASS	.						50.0	50.0	50.0					6																	152201893		2203	4300	6503	SO:0001819	synonymous_variant	2099	exon3			AGTGGGAATGATG	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.747A>G	chr6.hg19:g.152201893A>G		52.0	0.0	.		41.0	13.0	.	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Silent	SNP	ENST00000206249.3	hg19	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	A	9.711	1.157115	0.21454	.	.	ENSG00000091831	ENST00000427531	.	.	.	5.42	-10.8	0.00216	.	.	.	.	.	T	0.33089	0.0851	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58918	-0.7551	4	.	.	.	.	11.1314	0.48349	0.3958:0.3957:0.2085:0.0	.	.	.	.	G	154	.	.	E	+	2	0	ESR1	152243586	0.000000	0.05858	0.469000	0.27204	0.972000	0.66771	-2.223000	0.01214	-2.121000	0.00825	-1.074000	0.02243	GAA	.	.	.	none		0.547	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
MYCT1	80177	hgsc.bcm.edu	37	6	153043198	153043198	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:153043198G>T	ENST00000367245.5	+	2	526	c.518G>T	c.(517-519)tGt>tTt	p.C173F	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	173						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		TTTCTGCAATGTCCACCACTT	0.498																																					p.C173F		Atlas-SNP	.											.	MYCT1	48	.	0			c.G518T						PASS	.						89.0	87.0	88.0					6																	153043198		2203	4300	6503	SO:0001583	missense	80177	exon2			TGCAATGTCCACC	AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.518G>T	chr6.hg19:g.153043198G>T	ENSP00000356214:p.Cys173Phe	117.0	0.0	.		103.0	46.0	.	NM_025107	Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	ENST00000367245.5	hg19	CCDS5239.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.28|18.28	3.589712|3.589712	0.66105|0.66105	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000367245|ENST00000532295	T|.	0.32753|.	1.44|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.364348|.	0.35838|.	N|.	0.002941|.	T|T	0.64875|0.64875	0.2638|0.2638	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	P;P|.	0.50617|.	0.937;0.853|.	P;P|.	0.49999|.	0.628;0.628|.	T|T	0.61907|0.61907	-0.6966|-0.6966	10|5	0.51188|.	T|.	0.08|.	-9.8469|-9.8469	16.985|16.985	0.86338|0.86338	0.0:0.1271:0.8729:0.0|0.0:0.1271:0.8729:0.0	.|.	125;173|.	D6Q1S4;Q8N699|.	.;MYCT1_HUMAN|.	F|F	173|154	ENSP00000356214:C173F|.	ENSP00000356214:C173F|.	C|V	+|+	2|1	0|0	MYCT1|MYCT1	153084891|153084891	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.964000|0.964000	0.63967|0.63967	5.162000|5.162000	0.64942|0.64942	2.727000|2.727000	0.93392|0.93392	0.579000|0.579000	0.79373|0.79373	TGT|GTC	.	.	.	none		0.498	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042750.2	NM_025107	
TTLL2	83887	hgsc.bcm.edu	37	6	167755036	167755036	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr6:167755036G>T	ENST00000239587.5	+	3	1736	c.1648G>T	c.(1648-1650)Gat>Tat	p.D550Y		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	550					cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CAAAGCTCCAGATCCCCAAGC	0.502																																					p.D550Y		Atlas-SNP	.											.	TTLL2	82	.	0			c.G1648T						PASS	.						113.0	104.0	107.0					6																	167755036		2203	4300	6503	SO:0001583	missense	83887	exon3			GCTCCAGATCCCC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1648G>T	chr6.hg19:g.167755036G>T	ENSP00000239587:p.Asp550Tyr	142.0	0.0	.		135.0	51.0	.	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	hg19	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	G	4.684	0.127134	0.08981	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02395	4.31	4.04	-7.0	0.01599	.	2.486670	0.01433	N	0.014832	T	0.00552	0.0018	N	0.14661	0.345	0.09310	N	1	B	0.23185	0.081	B	0.16722	0.016	T	0.45659	-0.9246	10	0.56958	D	0.05	.	3.3015	0.06984	0.368:0.3942:0.1298:0.108	.	550	Q9BWV7	TTLL2_HUMAN	Y	550;477	ENSP00000239587:D550Y	ENSP00000239587:D550Y	D	+	1	0	TTLL2	167675026	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.123000	0.15708	-1.248000	0.02503	0.491000	0.48974	GAT	.	.	.	none		0.502	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
FOXK1	221937	hgsc.bcm.edu	37	7	4780549	4780549	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:4780549C>A	ENST00000328914.4	+	2	641	c.641C>A	c.(640-642)cCg>cAg	p.P214Q	FOXK1_ENST00000446823.1_Missense_Mutation_p.P51Q	NM_001037165.1	NP_001032242.1			forkhead box K1									p.P40L(1)|p.P214L(1)|p.P40Q(1)|p.P214Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CCAGCCTCCCCGCTGCGGCCA	0.647																																					p.P214Q		Atlas-SNP	.											KIAA0415_ENST00000450194,colon,carcinoma,0,2	FOXK1	64	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C641A						PASS	.						105.0	113.0	110.0					7																	4780549		2203	4300	6503	SO:0001583	missense	221937	exon2			CCTCCCCGCTGCG	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.641C>A	chr7.hg19:g.4780549C>A	ENSP00000328720:p.Pro214Gln	199.0	1.0	.		174.0	10.0	.	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	hg19	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240773	0.79912	.	.	ENSG00000164916	ENST00000446823;ENST00000328914;ENST00000545598	D;D	0.96136	-3.63;-3.92	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97284	0.9112	M	0.68317	2.08	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.845	D;D;P	0.91635	0.999;0.995;0.513	D	0.97390	0.9988	10	0.51188	T	0.08	.	17.8708	0.88810	0.0:1.0:0.0:0.0	.	214;97;51	P85037;F5H8G8;P85037-2	FOXK1_HUMAN;.;.	Q	51;214;97	ENSP00000394442:P51Q;ENSP00000328720:P214Q	ENSP00000328720:P214Q	P	+	2	0	FOXK1	4747075	1.000000	0.71417	0.679000	0.29978	0.718000	0.41266	7.684000	0.84104	2.449000	0.82847	0.563000	0.77884	CCG	.	.	.	none		0.647	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
TBL2	26608	hgsc.bcm.edu	37	7	72988278	72988278	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:72988278G>A	ENST00000305632.5	-	3	677	c.436C>T	c.(436-438)Cct>Tct	p.P146S	TBL2_ENST00000459913.1_5'UTR|TBL2_ENST00000452475.1_Missense_Mutation_p.P146S|TBL2_ENST00000432538.1_Missense_Mutation_p.P110S	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	146							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTGCAGTCAGGGCTGAAGCGC	0.612																																					p.P146S		Atlas-SNP	.											.	TBL2	47	.	0			c.C436T						PASS	.						95.0	75.0	82.0					7																	72988278		2203	4300	6503	SO:0001583	missense	26608	exon3			AGTCAGGGCTGAA	AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.436C>T	chr7.hg19:g.72988278G>A	ENSP00000307260:p.Pro146Ser	110.0	0.0	.		89.0	27.0	.	NM_012453	Q9UQE2	Missense_Mutation	SNP	ENST00000305632.5	hg19	CCDS5551.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841121	0.91197	.	.	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538;ENST00000452475	T;T;T	0.38077	1.16;1.16;1.16	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63803	0.2542	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.66701	-0.5857	10	0.49607	T	0.09	-9.9847	16.4333	0.83861	0.0:0.0:1.0:0.0	.	110;146	E9PF19;Q9Y4P3	.;TBL2_HUMAN	S	146;146;110;146	ENSP00000307260:P146S;ENSP00000413979:P110S;ENSP00000407371:P146S	ENSP00000307260:P146S	P	-	1	0	TBL2	72626214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.735000	0.98825	2.491000	0.84063	0.561000	0.74099	CCT	.	.	.	none		0.612	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252233.3	NM_012453	
MFHAS1	9258	hgsc.bcm.edu	37	8	8750559	8750559	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr8:8750559T>C	ENST00000276282.6	-	1	596	c.10A>G	c.(10-12)Atg>Gtg	p.M4V	RNU6-682P_ENST00000363843.1_RNA	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	4										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CCACTGTCCATCCCAGCCATG	0.756																																					p.M4V	Melanoma(103;1201 2045 17515 28966)	Atlas-SNP	.											.	MFHAS1	58	.	0			c.A10G						PASS	.						3.0	3.0	3.0					8																	8750559		1577	3199	4776	SO:0001583	missense	9258	exon1			TGTCCATCCCAGC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.10A>G	chr8.hg19:g.8750559T>C	ENSP00000276282:p.Met4Val	3.0	0.0	.		15.0	5.0	.	NM_004225	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	hg19	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878455	0.33162	.	.	ENSG00000147324	ENST00000276282	T	0.33216	1.42	3.87	2.66	0.31614	.	1.223050	0.06260	N	0.693747	T	0.17152	0.0412	N	0.08118	0	0.21105	N	0.99978	B	0.02656	0.0	B	0.01281	0.0	T	0.28744	-1.0034	10	0.23891	T	0.37	.	8.696	0.34296	0.0:0.0:0.1918:0.8082	.	4	Q9Y4C4	MFHA1_HUMAN	V	4	ENSP00000276282:M4V	ENSP00000276282:M4V	M	-	1	0	MFHAS1	8787969	0.980000	0.34600	0.977000	0.42913	0.611000	0.37282	2.561000	0.45905	0.513000	0.28278	0.369000	0.22263	ATG	.	.	.	none		0.756	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
MTUS1	57509	hgsc.bcm.edu	37	8	17581310	17581310	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr8:17581310A>G	ENST00000262102.6	-	4	2544	c.2320T>C	c.(2320-2322)Tca>Cca	p.S774P	MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_5'Flank|MTUS1_ENST00000381861.3_5'Flank|MTUS1_ENST00000519263.1_Intron	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	774					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TTCACCCATGACGACTGTGCA	0.463																																					p.S774P		Atlas-SNP	.											.	MTUS1	144	.	0			c.T2320C						PASS	.						152.0	141.0	144.0					8																	17581310		1865	4099	5964	SO:0001583	missense	57509	exon4			CCCATGACGACTG	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2320T>C	chr8.hg19:g.17581310A>G	ENSP00000262102:p.Ser774Pro	235.0	1.0	.		137.0	59.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	hg19	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	A	15.94	2.980872	0.53827	.	.	ENSG00000129422	ENST00000262102	T	0.42900	0.96	3.8	3.8	0.43715	.	2.627820	0.01895	N	0.038843	T	0.55081	0.1898	L	0.32530	0.975	0.53688	D	0.999979	D	0.69078	0.997	D	0.64410	0.925	T	0.44528	-0.9322	10	0.29301	T	0.29	-2.2162	12.137	0.53977	1.0:0.0:0.0:0.0	.	774	Q9ULD2	MTUS1_HUMAN	P	774	ENSP00000262102:S774P	ENSP00000262102:S774P	S	-	1	0	MTUS1	17625590	0.099000	0.21834	0.064000	0.19789	0.885000	0.51271	2.939000	0.48995	1.933000	0.56026	0.533000	0.62120	TCA	.	.	.	none		0.463	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
TGFBR1	7046	hgsc.bcm.edu	37	9	101894937	101894937	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:101894937C>G	ENST00000374994.4	+	3	607	c.490C>G	c.(490-492)Cct>Gct	p.P164A	TGFBR1_ENST00000550253.1_Missense_Mutation_p.P95A|TGFBR1_ENST00000374990.2_Intron|TGFBR1_ENST00000552516.1_Missense_Mutation_p.P168A	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	164					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TGAAGAGGACCCTTCATTAGA	0.438																																					p.P164A		Atlas-SNP	.											.	TGFBR1	70	.	0			c.C490G						PASS	.						160.0	135.0	144.0					9																	101894937		2203	4300	6503	SO:0001583	missense	7046	exon3			GAGGACCCTTCAT		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.490C>G	chr9.hg19:g.101894937C>G	ENSP00000364133:p.Pro164Ala	161.0	0.0	.		137.0	43.0	.	NM_004612	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	hg19	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864541	0.51482	.	.	ENSG00000106799	ENST00000547314;ENST00000552573;ENST00000374994;ENST00000540092;ENST00000552516;ENST00000548365;ENST00000550253;ENST00000546584	T;T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.68495	0.3007	L	0.58583	1.82	0.80722	D	1	B	0.28850	0.225	B	0.31290	0.127	T	0.63310	-0.6666	10	0.11182	T	0.66	.	19.3122	0.94192	0.0:1.0:0.0:0.0	.	164	P36897	TGFR1_HUMAN	A	95;99;164;164;168;99;95;161	ENSP00000449934:P95A;ENSP00000447182:P99A;ENSP00000364133:P164A;ENSP00000447297:P168A;ENSP00000448518:P99A;ENSP00000450052:P95A;ENSP00000447707:P161A	ENSP00000364133:P164A	P	+	1	0	TGFBR1	100934758	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	CCT	.	.	.	none		0.438	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
ANK3	288	hgsc.bcm.edu	37	10	61829643	61829643	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:61829643T>C	ENST00000280772.2	-	37	11187	c.10996A>G	c.(10996-10998)Act>Gct	p.T3666A	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3666					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTTCTACAGTGGTGTCCCCT	0.532																																					p.T3666A		Atlas-SNP	.											.	ANK3	703	.	0			c.A10996G						PASS	.						105.0	110.0	108.0					10																	61829643		2203	4300	6503	SO:0001583	missense	288	exon37			CTACAGTGGTGTC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10996A>G	chr10.hg19:g.61829643T>C	ENSP00000280772:p.Thr3666Ala	70.0	0.0	.		69.0	32.0	.	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	7.641	0.680808	0.14907	.	.	ENSG00000151150	ENST00000280772	T	0.18016	2.24	5.67	1.95	0.26073	.	0.170468	0.27831	N	0.017678	T	0.09730	0.0239	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16748	-1.0392	10	0.41790	T	0.15	.	4.0495	0.09788	0.2679:0.1431:0.0:0.589	.	3666	Q12955	ANK3_HUMAN	A	3666	ENSP00000280772:T3666A	ENSP00000280772:T3666A	T	-	1	0	ANK3	61499649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.468000	0.35332	0.366000	0.24427	0.533000	0.62120	ACT	.	.	.	none		0.532	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
SFTPD	6441	hgsc.bcm.edu	37	10	81702148	81702148	+	Silent	SNP	G	G	C	rs2077117		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:81702148G>C	ENST00000372292.3	-	4	469	c.429C>G	c.(427-429)ccC>ccG	p.P143P		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	143	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			ACCTACCTTTGGGCCCAGCTT	0.607																																					p.P143P		Atlas-SNP	.											.	SFTPD	43	.	0			c.C429G						PASS	.						82.0	75.0	77.0					10																	81702148		2203	4300	6503	SO:0001819	synonymous_variant	6441	exon4			ACCTTTGGGCCCA	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.429C>G	chr10.hg19:g.81702148G>C		74.0	0.0	.		59.0	22.0	.	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Silent	SNP	ENST00000372292.3	hg19	CCDS7362.1																																																																																			.	.	.	alt		0.607	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		
CALHM2	51063	hgsc.bcm.edu	37	10	105209181	105209181	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:105209181C>A	ENST00000260743.5	-	3	1041	c.518G>T	c.(517-519)cGg>cTg	p.R173L	CALHM2_ENST00000393235.1_Missense_Mutation_p.R173L|RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000369788.3_Missense_Mutation_p.R173L|CALHM2_ENST00000494180.1_5'Flank	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	173					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						GACCTCCTCCCGGAAGTCTGA	0.602																																					p.R173L		Atlas-SNP	.											CALHM2,NS,carcinoma,0,1	CALHM2	30	.	0			c.G518T						PASS	.						63.0	65.0	64.0					10																	105209181		2202	4298	6500	SO:0001583	missense	51063	exon3			TCCTCCCGGAAGT	BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.518G>T	chr10.hg19:g.105209181C>A	ENSP00000260743:p.Arg173Leu	110.0	0.0	.		111.0	8.0	.	NM_015916	D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	ENST00000260743.5	hg19	CCDS7549.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623943	0.46840	.	.	ENSG00000138172	ENST00000369788;ENST00000260743;ENST00000393235	T;T;T	0.19394	2.15;2.15;2.15	5.45	2.22	0.28083	.	0.419984	0.23239	N	0.050361	T	0.19287	0.0463	L	0.56199	1.76	0.30873	N	0.732274	P;B;B	0.37573	0.6;0.312;0.267	B;B;B	0.37304	0.193;0.103;0.246	T	0.11842	-1.0571	10	0.56958	D	0.05	-35.5257	7.6922	0.28575	0.0:0.5628:0.0:0.4372	.	173;173;173	Q9HA72-2;Q9HA72-3;Q9HA72	.;.;CAHM2_HUMAN	L	173	ENSP00000358803:R173L;ENSP00000260743:R173L;ENSP00000376927:R173L	ENSP00000260743:R173L	R	-	2	0	CALHM2	105199171	0.974000	0.33945	1.000000	0.80357	0.887000	0.51463	0.723000	0.25939	0.689000	0.31550	-0.215000	0.12644	CGG	.	.	.	none		0.602	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050159.1	NM_015916	
ADD3	120	hgsc.bcm.edu	37	10	111878343	111878343	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr10:111878343A>G	ENST00000356080.4	+	6	934		c.e6-1		ADD3_ENST00000497125.1_Splice_Site|ADD3_ENST00000360162.3_Splice_Site|ADD3_ENST00000277900.8_Splice_Site	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)							cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GATTTTTTCCAGGTGAAAGTC	0.378																																					.		Atlas-SNP	.											.	ADD3	89	.	0			c.568-2A>G						PASS	.						102.0	104.0	103.0					10																	111878343		2203	4300	6503	SO:0001630	splice_region_variant	120	exon6			TTTTCCAGGTGAA	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.568-1A>G	chr10.hg19:g.111878343A>G		102.0	0.0	.		82.0	35.0	.	NM_019903	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Splice_Site	SNP	ENST00000356080.4	hg19	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.241968	0.58995	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	.	.	.	5.28	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8604	0.52463	0.8691:0.0:0.0:0.1309	.	.	.	.	.	-1	.	.	.	+	.	.	ADD3	111868333	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.423000	0.80229	0.905000	0.36596	0.460000	0.39030	.	.	.	.	none		0.378	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	Intron
MICALCL	84953	hgsc.bcm.edu	37	11	12316190	12316190	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:12316190C>T	ENST00000256186.2	+	3	1503	c.1212C>T	c.(1210-1212)gaC>gaT	p.D404D		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	404					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GACTCAAAGACAAATCTTTTG	0.468																																					p.D404D		Atlas-SNP	.											.	MICALCL	59	.	0			c.C1212T						PASS	.						121.0	123.0	122.0					11																	12316190		1848	4097	5945	SO:0001819	synonymous_variant	84953	exon3			CAAAGACAAATCT	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.1212C>T	chr11.hg19:g.12316190C>T		238.0	0.0	.		181.0	65.0	.	NM_032867	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	hg19	CCDS41620.1																																																																																			.	.	.	none		0.468	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
OR8U1	219417	hgsc.bcm.edu	37	11	56143937	56143937	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:56143937G>C	ENST00000302270.1	+	1	838	c.838G>C	c.(838-840)Gtg>Ctg	p.V280L		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CTTCTACACAGTGATCATTCC	0.413																																					p.V280L		Atlas-SNP	.											.	OR8U1	59	.	0			c.G838C						PASS	.						143.0	148.0	146.0					11																	56143937		2044	4227	6271	SO:0001583	missense	219417	exon1			TACACAGTGATCA	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.838G>C	chr11.hg19:g.56143937G>C	ENSP00000304188:p.Val280Leu	337.0	0.0	.		303.0	13.0	.	NM_001005204		Missense_Mutation	SNP	ENST00000302270.1	hg19	CCDS41647.1	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.254672	0.01457	.	.	ENSG00000172199	ENST00000302270	T	0.00279	8.33	5.69	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.174841	0.27411	N	0.019484	T	0.00178	0.0005	N	0.21448	0.665	0.09310	N	1	B	0.28933	0.228	B	0.41666	0.363	T	0.23940	-1.0174	10	0.11794	T	0.64	.	7.9511	0.30014	0.1954:0.1192:0.6855:0.0	.	280	Q8NH10	OR8U1_HUMAN	L	280	ENSP00000304188:V280L	ENSP00000304188:V280L	V	+	1	0	OR8U1	55900513	0.061000	0.20836	0.998000	0.56505	0.181000	0.23173	0.606000	0.24194	1.425000	0.47237	-0.245000	0.11935	GTG	.	.	.	none		0.413	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
C1QTNF5	114902	hgsc.bcm.edu	37	11	119210071	119210071	+	Silent	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr11:119210071G>C	ENST00000528368.1	-	3	933	c.702C>G	c.(700-702)tcC>tcG	p.S234S	C1QTNF5_ENST00000445041.2_Silent_p.S234S|RP11-334E6.10_ENST00000501918.2_RNA|MFRP_ENST00000555262.1_3'UTR|MFRP_ENST00000530681.1_3'UTR|C1QTNF5_ENST00000525657.1_5'UTR	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	234	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TGTGCCAGTCGGAGTACACCA	0.552																																					p.S234S		Atlas-SNP	.											.	C1QTNF5	12	.	0			c.C702G						PASS	.						100.0	93.0	96.0					11																	119210071		2199	4295	6494	SO:0001819	synonymous_variant	114902	exon15			CCAGTCGGAGTAC	AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.702C>G	chr11.hg19:g.119210071G>C		79.0	0.0	.		75.0	26.0	.	NM_015645	A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Silent	SNP	ENST00000528368.1	hg19	CCDS8420.1																																																																																			.	.	.	none		0.552	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388354.1	NM_015645	
LRP6	4040	hgsc.bcm.edu	37	12	12302076	12302076	+	Silent	SNP	C	C	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:12302076C>T	ENST00000261349.4	-	14	3082	c.3006G>A	c.(3004-3006)gtG>gtA	p.V1002V	LRP6_ENST00000543091.1_Silent_p.V1002V	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1002	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AGCTCACAACCACAGTAAAGC	0.453																																					p.V1002V		Atlas-SNP	.											.	LRP6	170	.	0			c.G3006A						PASS	.						135.0	137.0	136.0					12																	12302076		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon14			CACAACCACAGTA	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3006G>A	chr12.hg19:g.12302076C>T		282.0	0.0	.		262.0	115.0	.	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	hg19	CCDS8647.1																																																																																			.	.	.	none		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
C12orf54	121273	hgsc.bcm.edu	37	12	48888593	48888593	+	Silent	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:48888593T>C	ENST00000548364.1	+	7	312	c.255T>C	c.(253-255)ccT>ccC	p.P85P	RP11-722P11.4_ENST00000551847.1_RNA|C12orf54_ENST00000314014.2_Silent_p.P85P			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54	85										endometrium(1)|large_intestine(4)	5						GCATAAGGCCTCCAGATTCCT	0.488																																					p.P85P		Atlas-SNP	.											.	C12orf54	11	.	0			c.T255C						PASS	.						114.0	116.0	116.0					12																	48888593		2203	4300	6503	SO:0001819	synonymous_variant	121273	exon8			AAGGCCTCCAGAT	BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.255T>C	chr12.hg19:g.48888593T>C		186.0	0.0	.		183.0	75.0	.	NM_152319	Q6X4S9|Q8N5S2	Silent	SNP	ENST00000548364.1	hg19	CCDS8764.1																																																																																			.	.	.	none		0.488	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406875.1	NM_152319	
KMT2D	8085	hgsc.bcm.edu	37	12	49437679	49437679	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr12:49437679A>G	ENST00000301067.7	-	22	5290	c.5291T>C	c.(5290-5292)cTg>cCg	p.L1764P		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1764					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CATGTCCTCCAGTTTGCTCTT	0.567											OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1764P		Atlas-SNP	.											.	MLL2	1173	.	0			c.T5291C						PASS	.						166.0	177.0	174.0					12																	49437679		2147	4242	6389	SO:0001583	missense	8085	exon22			TCCTCCAGTTTGC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5291T>C	chr12.hg19:g.49437679A>G	ENSP00000301067:p.Leu1764Pro	147.0	0.0	.	962	119.0	38.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	14.19	2.462524	0.43736	.	.	ENSG00000167548	ENST00000301067	D	0.92199	-2.99	4.93	4.93	0.64822	.	.	.	.	.	D	0.94925	0.8359	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95361	0.8455	9	0.87932	D	0	.	13.5598	0.61782	1.0:0.0:0.0:0.0	.	1764	O14686	MLL2_HUMAN	P	1764	ENSP00000301067:L1764P	ENSP00000301067:L1764P	L	-	2	0	MLL2	47723946	1.000000	0.71417	0.941000	0.38009	0.935000	0.57460	9.259000	0.95561	1.846000	0.53633	0.260000	0.18958	CTG	.	.	.	none		0.567	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KLHDC1	122773	hgsc.bcm.edu	37	14	50196254	50196254	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:50196254C>G	ENST00000359332.2	+	8	788	c.698C>G	c.(697-699)aCt>aGt	p.T233S	KLHDC1_ENST00000554512.1_3'UTR	NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	233						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					GACACCTGGACTTGGTCTGGA	0.348																																					p.T233S		Atlas-SNP	.											.	KLHDC1	24	.	0			c.C698G						PASS	.						115.0	104.0	108.0					14																	50196254		2203	4299	6502	SO:0001583	missense	122773	exon8			CCTGGACTTGGTC	AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.698C>G	chr14.hg19:g.50196254C>G	ENSP00000352282:p.Thr233Ser	80.0	0.0	.		61.0	24.0	.	NM_172193	B3KXD9|Q8WYI1	Missense_Mutation	SNP	ENST00000359332.2	hg19	CCDS9692.1	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190260	0.21954	.	.	ENSG00000197776	ENST00000359332;ENST00000557128	T;T	0.67523	-0.27;-0.27	5.78	1.34	0.21922	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.164679	0.53938	D	0.000057	T	0.48241	0.1489	N	0.25485	0.75	0.23636	N	0.997233	B;B	0.30361	0.277;0.085	B;B	0.31547	0.132;0.038	T	0.30297	-0.9983	10	0.21014	T	0.42	-0.3182	9.4425	0.38677	0.0:0.5979:0.0:0.4021	.	104;233	G3V3T1;Q8N7A1	.;KLDC1_HUMAN	S	233;104	ENSP00000352282:T233S;ENSP00000451407:T104S	ENSP00000352282:T233S	T	+	2	0	KLHDC1	49266004	0.933000	0.31639	0.991000	0.47740	0.956000	0.61745	0.163000	0.16520	-0.028000	0.13850	-0.237000	0.12165	ACT	.	.	.	none		0.348	KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276882.2	NM_172193	
GABRG3	2567	hgsc.bcm.edu	37	15	27777965	27777965	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:27777965T>C	ENST00000333743.6	+	10	1596	c.1342T>C	c.(1342-1344)Ttt>Ctt	p.F448L	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	448					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTCCCGGGTCTTTTTCCCCAC	0.473																																					p.F448L	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											GABRG3,right_upper_lobe,carcinoma,0,1	GABRG3	115	.	0			c.T1342C						PASS	.						72.0	73.0	73.0					15																	27777965		1952	4142	6094	SO:0001583	missense	2567	exon10			CGGGTCTTTTTCC		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1342T>C	chr15.hg19:g.27777965T>C	ENSP00000331912:p.Phe448Leu	65.0	0.0	.		62.0	3.0	.	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	hg19	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954120	0.53293	.	.	ENSG00000182256	ENST00000333743	T	0.80824	-1.42	5.75	3.4	0.38934	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.175067	0.50627	D	0.000109	T	0.65080	0.2657	N	0.20401	0.57	0.80722	D	1	B	0.25206	0.12	B	0.33196	0.159	T	0.49504	-0.8933	10	0.08837	T	0.75	.	7.9945	0.30261	0.0:0.0709:0.1369:0.7922	.	448	Q99928	GBRG3_HUMAN	L	448	ENSP00000331912:F448L	ENSP00000331912:F448L	F	+	1	0	GABRG3	25451560	1.000000	0.71417	0.319000	0.25293	0.894000	0.52154	4.846000	0.62860	0.422000	0.26005	0.528000	0.53228	TTT	.	.	.	none		0.473	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
MESDC2	23184	hgsc.bcm.edu	37	15	81282037	81282037	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr15:81282037G>A	ENST00000261758.4	-	1	182	c.96C>T	c.(94-96)tgC>tgT	p.C32C	RP11-775C24.3_ENST00000563737.1_lincRNA	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	32	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						CTTCGGCCGCGCAGGACCCAG	0.637																																					p.C32C		Atlas-SNP	.											.	MESDC2	23	.	0			c.C96T						PASS	.						35.0	35.0	35.0					15																	81282037		2203	4298	6501	SO:0001819	synonymous_variant	23184	exon1			GGCCGCGCAGGAC	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.96C>T	chr15.hg19:g.81282037G>A		64.0	0.0	.		68.0	33.0	.	NM_015154	B4DW84|D3DW96|Q969U1	Silent	SNP	ENST00000261758.4	hg19	CCDS32308.1																																																																																			.	.	.	none		0.637	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
RNF157	114804	hgsc.bcm.edu	37	17	74158077	74158077	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:74158077C>A	ENST00000269391.6	-	10	931	c.799G>T	c.(799-801)Gaa>Taa	p.E267*	RNF157_ENST00000319945.6_Nonsense_Mutation_p.E267*	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	267							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			ACTTCGTCTTCAGCCACCTGG	0.527																																					p.E267X	GBM(186;507 2120 27388 27773 52994)	Atlas-SNP	.											.	RNF157	66	.	0			c.G799T						PASS	.						96.0	68.0	78.0					17																	74158077		2203	4300	6503	SO:0001587	stop_gained	114804	exon10			CGTCTTCAGCCAC	AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.799G>T	chr17.hg19:g.74158077C>A	ENSP00000269391:p.Glu267*	89.0	0.0	.		67.0	31.0	.	NM_052916	Q8NB72|Q96N56	Nonsense_Mutation	SNP	ENST00000269391.6	hg19	CCDS32740.1	.	.	.	.	.	.	.	.	.	.	C	38	6.984953	0.97983	.	.	ENSG00000141576	ENST00000269391;ENST00000319945;ENST00000301610	.	.	.	5.73	5.73	0.89815	.	0.044080	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-18.6068	19.893	0.96937	0.0:1.0:0.0:0.0	.	.	.	.	X	267;267;229	.	ENSP00000269391:E267X	E	-	1	0	RNF157	71669672	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.782000	0.85680	2.693000	0.91896	0.655000	0.94253	GAA	.	.	.	none		0.527	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255874.2	XM_290732	
TMC6	11322	hgsc.bcm.edu	37	17	76115385	76115385	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr17:76115385G>C	ENST00000590602.1	-	14	1963	c.1804C>G	c.(1804-1806)Ctg>Gtg	p.L602V	TMC6_ENST00000592076.1_Intron|TMC6_ENST00000322933.4_Missense_Mutation_p.L181V|TMC6_ENST00000306591.7_Intron|TMC6_ENST00000322914.3_Missense_Mutation_p.L602V|TMC6_ENST00000591436.1_Missense_Mutation_p.L181V|TMC6_ENST00000392467.3_Missense_Mutation_p.L602V			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	602					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CACCAGGTCAGAGTCTGCCCA	0.622																																					p.L602V		Atlas-SNP	.											.	TMC6	42	.	0			c.C1804G						PASS	.						133.0	117.0	123.0					17																	76115385		2203	4300	6503	SO:0001583	missense	11322	exon14			AGGTCAGAGTCTG	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1804C>G	chr17.hg19:g.76115385G>C	ENSP00000465261:p.Leu602Val	130.0	0.0	.		100.0	31.0	.	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	hg19	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.992746	0.74703	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000322933;ENST00000392466	T;T;T	0.67698	-0.28;-0.28;-0.28	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000002	T	0.79707	0.4492	L	0.60904	1.88	0.47994	D	0.999565	D;D	0.89917	0.998;1.0	D;D	0.83275	0.98;0.996	T	0.82232	-0.0559	10	0.72032	D	0.01	-16.0397	17.6365	0.88123	0.0:0.0:1.0:0.0	.	602;181	Q7Z403;Q7Z403-3	TMC6_HUMAN;.	V	602;602;181;68	ENSP00000313408:L602V;ENSP00000376260:L602V;ENSP00000313479:L181V	ENSP00000313408:L602V	L	-	1	2	TMC6	73626980	1.000000	0.71417	0.980000	0.43619	0.951000	0.60555	3.385000	0.52485	2.164000	0.68074	0.555000	0.69702	CTG	.	.	.	none		0.622	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
LGI4	163175	hgsc.bcm.edu	37	19	35617832	35617832	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr19:35617832G>T	ENST00000310123.3	-	7	1237	c.718C>A	c.(718-720)Ccc>Acc	p.P240T	LGI4_ENST00000392225.3_Missense_Mutation_p.P240T|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	240					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCGGCGAAGGGCTGTGCCAGC	0.662																																					p.P240T		Atlas-SNP	.											.	LGI4	32	.	0			c.C718A						PASS	.						40.0	46.0	44.0					19																	35617832		2203	4300	6503	SO:0001583	missense	163175	exon7			CGAAGGGCTGTGC	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.718C>A	chr19.hg19:g.35617832G>T	ENSP00000312273:p.Pro240Thr	87.0	0.0	.		334.0	26.0	.	NM_139284	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	hg19	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222746	0.58668	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	D;D	0.81579	-1.51;-1.51	3.94	3.94	0.45596	.	0.000000	0.64402	D	0.000013	D	0.87245	0.6129	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88525	0.3099	10	0.72032	D	0.01	.	13.5039	0.61474	0.0:0.0:1.0:0.0	.	151;240	Q658V8;Q8N135	.;LGI4_HUMAN	T	240	ENSP00000312273:P240T;ENSP00000376059:P240T	ENSP00000312273:P240T	P	-	1	0	LGI4	40309672	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	7.564000	0.82326	2.025000	0.59659	0.313000	0.20887	CCC	.	.	.	none		0.662	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
ZNF335	63925	hgsc.bcm.edu	37	20	44579218	44579218	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr20:44579218T>C	ENST00000322927.2	-	21	3306	c.3206A>G	c.(3205-3207)cAc>cGc	p.H1069R	ZNF335_ENST00000426788.1_Missense_Mutation_p.H914R	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1069					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TAGGCTTGAGTGCTGTGCCAT	0.592																																					p.H1069R		Atlas-SNP	.											.	ZNF335	115	.	0			c.A3206G						PASS	.						126.0	137.0	133.0					20																	44579218		2203	4300	6503	SO:0001583	missense	63925	exon21			CTTGAGTGCTGTG	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3206A>G	chr20.hg19:g.44579218T>C	ENSP00000325326:p.His1069Arg	256.0	0.0	.		229.0	25.0	.	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.613272	0.66672	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	D;D	0.88975	-2.45;-2.45	4.82	4.82	0.62117	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	H	0.99783	4.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.98479	1.0604	10	0.87932	D	0	-30.0634	14.0159	0.64523	0.0:0.0:0.0:1.0	.	914;1069	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	R	1069;846;914	ENSP00000325326:H1069R;ENSP00000397098:H914R	ENSP00000243961:H846R	H	-	2	0	ZNF335	44012625	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.442000	0.80503	2.166000	0.68216	0.460000	0.39030	CAC	.	.	.	none		0.592	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZBTB46	140685	hgsc.bcm.edu	37	20	62421455	62421455	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr20:62421455C>G	ENST00000245663.4	-	2	806	c.656G>C	c.(655-657)gGa>gCa	p.G219A	ZBTB46_ENST00000395104.1_Missense_Mutation_p.G219A|ZBTB46_ENST00000302995.2_Missense_Mutation_p.G219A|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	219					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GCCCACGTCTCCAGGCCATAG	0.602																																					p.G219A		Atlas-SNP	.											.	ZBTB46	72	.	0			c.G656C						PASS	.						65.0	61.0	62.0					20																	62421455		2203	4300	6503	SO:0001583	missense	140685	exon2			ACGTCTCCAGGCC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.656G>C	chr20.hg19:g.62421455C>G	ENSP00000245663:p.Gly219Ala	84.0	0.0	.		59.0	23.0	.	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	hg19	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	C	7.452	0.642959	0.14451	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.08807	3.05;3.05;3.05	5.53	5.53	0.82687	.	0.168310	0.53938	D	0.000060	T	0.08846	0.0219	L	0.40543	1.245	0.26386	N	0.976659	B	0.12630	0.006	B	0.10450	0.005	T	0.34428	-0.9829	10	0.08837	T	0.75	.	18.4243	0.90604	0.0:1.0:0.0:0.0	.	219	Q86UZ6	ZBT46_HUMAN	A	219	ENSP00000245663:G219A;ENSP00000303102:G219A;ENSP00000378536:G219A	ENSP00000245663:G219A	G	-	2	0	ZBTB46	61891899	0.511000	0.26179	0.923000	0.36655	0.092000	0.18411	3.313000	0.51935	2.609000	0.88269	0.650000	0.86243	GGA	.	.	.	none		0.602	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
KRTAP27-1	643812	hgsc.bcm.edu	37	21	31709825	31709825	+	Silent	SNP	G	G	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr21:31709825G>A	ENST00000382835.2	-	1	187	c.162C>T	c.(160-162)tgC>tgT	p.C54C		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	54						intermediate filament (GO:0005882)				endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TGGTTTCATTGCAGGTTTCTT	0.448																																					p.C54C		Atlas-SNP	.											.	KRTAP27-1	53	.	0			c.C162T						PASS	.						159.0	150.0	153.0					21																	31709825		2203	4300	6503	SO:0001819	synonymous_variant	643812	exon1			TTCATTGCAGGTT	AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.162C>T	chr21.hg19:g.31709825G>A		150.0	0.0	.		145.0	50.0	.	NM_001077711		Silent	SNP	ENST00000382835.2	hg19	CCDS33532.1																																																																																			.	.	.	none		0.448	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
SMARCB1	6598	hgsc.bcm.edu	37	22	24145544	24145544	+	Missense_Mutation	SNP	C	C	T	rs137986695		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:24145544C>T	ENST00000263121.7	+	5	759	c.563C>T	c.(562-564)cCc>cTc	p.P188L	SMARCB1_ENST00000407422.3_Missense_Mutation_p.P179L|SMARCB1_ENST00000407082.3_Missense_Mutation_p.P142L|SMARCB1_ENST00000344921.6_Missense_Mutation_p.P197L	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	188	2 X approximate tandem repeats.|HIV-1 integrase-binding.|MYC-binding.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(6)|p.P188L(1)|p.V185_M193del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GTGCTGGTCCCCATCCGGCTG	0.592			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.P188L		Atlas-SNP	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	SMARCB1,arm,malignant_melanoma,0,1	SMARCB1	586	.	8	Unknown(3)|Deletion - Frameshift(3)|Substitution - Missense(1)|Deletion - In frame(1)	soft_tissue(5)|central_nervous_system(2)|skin(1)	c.C563T						PASS	.						114.0	103.0	107.0					22																	24145544		2203	4300	6503	SO:0001583	missense	6598	exon5			TGGTCCCCATCCG	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.563C>T	chr22.hg19:g.24145544C>T	ENSP00000263121:p.Pro188Leu	127.0	0.0	.		114.0	10.0	.	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	hg19	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	C	34	5.321447	0.95682	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.98251	0.9421	M	0.92784	3.345	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.993;0.999	D;D;D;D	0.97110	0.982;1.0;0.983;0.997	D	0.99323	1.0907	10	0.72032	D	0.01	-25.3436	17.5295	0.87810	0.0:1.0:0.0:0.0	.	197;179;188;206	G5E975;Q17S11;Q12824;C9JTA6	.;.;SNF5_HUMAN;.	L	206;197;188;179;142	ENSP00000388489:P206L;ENSP00000340883:P197L;ENSP00000263121:P188L;ENSP00000383984:P179L;ENSP00000385226:P142L	ENSP00000263121:P188L	P	+	2	0	SMARCB1	22475544	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.810000	0.86072	2.472000	0.83506	0.644000	0.83932	CCC	.	.	.	weak		0.592	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
ENTPD5	957	hgsc.bcm.edu	37	14	74443764	74443765	+	Splice_Site	INS	-	-	A			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr14:74443764_74443765insA	ENST00000334696.6	-	8	837		c.e8-2		ENTPD5_ENST00000557325.1_Splice_Site	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5						'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		CTAATATGCCTAAAAAGAAAGA	0.366																																					.		Atlas-INDEL	.											.	ENTPD5	26	.	0			c.518-2->T						PASS	.																																			SO:0001630	splice_region_variant	957	exon9			.	AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.518-2->T	chr14.hg19:g.74443769_74443769dupA		144.0	0.0	0		100.0	38.0	0.38	NM_001249	A1L4C5|Q96RX0	Splice_Site	INS	ENST00000334696.6	hg19	CCDS9825.1																																																																																			.	.	.	none		0.366	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412637.1	NM_001249	Intron
FNIP1	96459	hgsc.bcm.edu	37	5	131007378	131007379	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr5:131007378_131007379delCT	ENST00000510461.1	-	14	2853_2854	c.2758_2759delAG	c.(2758-2760)agtfs	p.S921fs	FNIP1_ENST00000307968.7_Frame_Shift_Del_p.S893fs|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307954.8_Frame_Shift_Del_p.S876fs	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	921					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TTTATCTGAACTCTCTTTATCC	0.416																																					p.920_920del		Atlas-INDEL	.											.	FNIP1	104	.	0			c.2759_2760del						PASS	.																																			SO:0001589	frameshift_variant	96459	exon14			.	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.2758_2759delAG	chr5.hg19:g.131007382_131007383delCT	ENSP00000421985:p.Ser921fs	139.0	0.0	0		144.0	61.0	0.423611	NM_133372	D6RJH5|Q86T47|Q9BUT0	Frame_Shift_Del	DEL	ENST00000510461.1	hg19	CCDS34227.1																																																																																			.	.	.	none		0.416	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
BCL2L11	10018	hgsc.bcm.edu	37	2	111921708	111921716	+	Splice_Site	DEL	AGGTATTTT	AGGTATTTT	-	rs142125092		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	AGGTATTTT	AGGTATTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:111921708_111921716delAGGTATTTT	ENST00000393256.3	+	4	771_778	c.498_505delAGGTATTTT	c.(496-507)agaggtattttt>agtt	p.166_169RGIF>S	BCL2L11_ENST00000308659.8_Splice_Site_p.106_109RGIF>S	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	166					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						TTGTTGTTTCAGGTATTTTTGAATAATTA	0.445																																					p.167_168del		Atlas-INDEL	.											.	BCL2L11	36	.	0			c.499_504del						PASS	.																																			SO:0001630	splice_region_variant	10018	exon4			.	AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.499-1AGGTATTTT>-	chr2.hg19:g.111921708_111921716delAGGTATTTT		97.0	0.0	0		58.0	13.0	0.224138	NM_138621	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	In_Frame_Del	DEL	ENST00000393256.3	hg19	CCDS2089.1																																																																																			.	.	.	none		0.445	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254022.3		In_Frame_Del
CLTA	1211	hgsc.bcm.edu	37	9	36211662	36211662	+	Frame_Shift_Del	DEL	G	G	-	rs192679731		TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr9:36211662delG	ENST00000242285.6	+	7	758	c.638delG	c.(637-639)cggfs	p.R213fs	CLTA_ENST00000345519.5_Frame_Shift_Del_p.R183fs|CLTA_ENST00000538225.1_Frame_Shift_Del_p.R195fs|CLTA_ENST00000433436.2_Frame_Shift_Del_p.R213fs|CLTA_ENST00000470744.1_Frame_Shift_Del_p.R195fs|CLTA_ENST00000466396.1_Frame_Shift_Del_p.R161fs|CLTA_ENST00000540080.1_Frame_Shift_Del_p.R131fs|CLTA_ENST00000396603.2_Frame_Shift_Del_p.R201fs			P09496	CLCA_HUMAN	clathrin, light chain A	213					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	clathrin heavy chain binding (GO:0032050)|peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	6			STAD - Stomach adenocarcinoma(86;0.228)			GAGTGGGAACGGGTGGCCCGG	0.542																																					p.R213fs		Atlas-INDEL	.											CLTA,NS,carcinoma,0,1	CLTA	18	.	0			c.637delC						PASS	.						99.0	94.0	96.0					9																	36211662		2203	4300	6503	SO:0001589	frameshift_variant	1211	exon7			.		CCDS6600.1, CCDS6601.1, CCDS43802.1, CCDS55306.1, CCDS55307.1	9p13.3	2010-05-11	2010-05-11		ENSG00000122705	ENSG00000122705			2090	protein-coding gene	gene with protein product		118960	"""clathrin, light polypeptide (Lca)"""			7713494	Standard	NM_007096		Approved	Lca	uc003zzc.3	P09496	OTTHUMG00000019896	ENST00000242285.6:c.638delG	chr9.hg19:g.36211662delG	ENSP00000242285:p.Arg213fs	153.0	0.0	0		111.0	41.0	0.369369	NM_007096	A8K4W3|B4DIN1|F5H6N3|Q2XPN5|Q53XZ1	Frame_Shift_Del	DEL	ENST00000242285.6	hg19	CCDS6601.1																																																																																			.	.	.	none		0.542	CLTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052405.1	NM_007096	
KCTD4	386618	hgsc.bcm.edu	37	13	45768267	45768269	+	In_Frame_Del	DEL	TTA	TTA	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	TTA	TTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr13:45768267_45768269delTTA	ENST00000379108.1	-	1	583_585	c.434_436delTAA	c.(433-438)ataaca>aca	p.I145del	GTF2F2_ENST00000340473.6_Intron|KCTD4_ENST00000405872.1_In_Frame_Del_p.I145del			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	145					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		TGGTTATCTGTTATTTCCAAGAA	0.414																																					p.145_146del		Atlas-INDEL	.											.	KCTD4	18	.	0			c.435_437del						PASS	.																																			SO:0001651	inframe_deletion	386618	exon2			.	BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.434_436delTAA	chr13.hg19:g.45768267_45768269delTTA	ENSP00000368402:p.Ile145del	173.0	0.0	0		162.0	15.0	0.0925926	NM_198404	Q5W0P9	In_Frame_Del	DEL	ENST00000379108.1	hg19	CCDS9396.1																																																																																			.	.	.	none		0.414	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044757.1		
MKL1	57591	hgsc.bcm.edu	37	22	40816560	40816562	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr22:40816560_40816562delCCC	ENST00000355630.3	-	11	1490_1492	c.900_902delGGG	c.(898-903)ctggga>cta	p.G301del	MKL1_ENST00000402042.1_In_Frame_Del_p.G251del|MKL1_ENST00000396617.3_In_Frame_Del_p.G301del|MKL1_ENST00000407029.1_In_Frame_Del_p.G301del	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	301					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CCCGCTGCTTCCCAGGGCCTCGC	0.665			T	RBM15	acute megakaryocytic leukemia																																p.301_301del		Atlas-INDEL	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1	69	.	0			c.901_903del						PASS	.																																			SO:0001651	inframe_deletion	57591	exon11			.	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.900_902delGGG	chr22.hg19:g.40816560_40816562delCCC	ENSP00000347847:p.Gly301del	139.0	0.0	0		97.0	39.0	0.402062	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	In_Frame_Del	DEL	ENST00000355630.3	hg19	CCDS14003.1																																																																																			.	.	.	none		0.665	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
TRIP12	9320	hgsc.bcm.edu	37	2	230701700	230701702	+	Splice_Site	DEL	ACT	ACT	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	ACT	ACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr2:230701700_230701702delACT	ENST00000283943.5	-	5	1186	c.1008delAGT	c.(1006-1008)aga>ag	p.R338del	TRIP12_ENST00000409677.1_Splice_Site_p.R380del|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Splice_Site_p.R35del|TRIP12_ENST00000389044.4_Splice_Site_p.R380del	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	338					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGCCTCGCCGACTACAACAGAAA	0.483																																					p.336_337del		Atlas-INDEL	.											TRIP12,colon,carcinoma,0,1	TRIP12	207	.	0			c.1008_1009del						PASS	.																																			SO:0001630	splice_region_variant	9320	exon5			.	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1008-1AGT>-	chr2.hg19:g.230701700_230701702delACT		54.0	0.0	0		47.0	23.0	0.489362	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Del	DEL	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.	.	none		0.483	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	In_Frame_Del
AUTS2	26053	hgsc.bcm.edu	37	7	70255838	70255838	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7048-01A-11D-1961-08	TCGA-BQ-7048-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2ee5ae28-9eb8-4f46-b9d9-13c5246297eb	71fbff51-4f0d-4d4f-8083-f64c0ac772b8	g.chr7:70255838delT	ENST00000342771.4	+	19	3957	c.3636delT	c.(3634-3636)cctfs	p.P1213fs	AUTS2_ENST00000406775.2_Frame_Shift_Del_p.P1189fs	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1213										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACAAGACCCCTCCGACAGCAG	0.677																																					p.P1212fs		Atlas-INDEL	.											.	AUTS2	173	.	0			c.3635delC						PASS	.						43.0	48.0	46.0					7																	70255838		2203	4299	6502	SO:0001589	frameshift_variant	26053	exon19			.	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3636delT	chr7.hg19:g.70255838delT	ENSP00000344087:p.Pro1213fs	45.0	0.0	0		45.0	13.0	0.288889	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Frame_Shift_Del	DEL	ENST00000342771.4	hg19	CCDS5539.1																																																																																			.	.	.	none		0.677	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
