#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NIFK	84365	hgsc.bcm.edu	37	2	122488590	122488590	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr2:122488590C>A	ENST00000285814.4	-	4	515	c.443G>T	c.(442-444)cGg>cTg	p.R148L	AC018737.1_ENST00000419902.1_RNA	NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		148					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						CCGATTATACCGTTTCACTGA	0.343																																					p.R148L		Atlas-SNP	.											.	MKI67IP	27	.	0			c.G443T						PASS	.						107.0	103.0	105.0					2																	122488590		2203	4299	6502	SO:0001583	missense	84365	exon4			TTATACCGTTTCA																												ENST00000285814.4:c.443G>T	chr2.hg19:g.122488590C>A	ENSP00000285814:p.Arg148Leu	125.0	0.0	.		160.0	8.0	.	NM_032390	A8K788|Q8TB66|Q96ED4	Missense_Mutation	SNP	ENST00000285814.4	hg19	CCDS2135.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.657638	0.67586	.	.	ENSG00000155438	ENST00000285814;ENST00000409201;ENST00000447132;ENST00000451734	T;T;T	0.54071	2.13;0.59;1.33	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.68686	0.3028	M	0.72894	2.215	0.80722	D	1	D;D	0.67145	0.996;0.994	P;P	0.61132	0.884;0.687	T	0.71823	-0.4476	10	0.87932	D	0	-11.903	15.2323	0.73401	0.0:1.0:0.0:0.0	.	148;148	B4DSM4;Q9BYG3	.;MK67I_HUMAN	L	148;148;43;116	ENSP00000285814:R148L;ENSP00000406227:R43L;ENSP00000398116:R116L	ENSP00000285814:R148L	R	-	2	0	MKI67IP	122205060	1.000000	0.71417	0.922000	0.36590	0.325000	0.28411	5.870000	0.69620	2.668000	0.90789	0.655000	0.94253	CGG	.	.	.	none		0.343	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254239.2		
RFTN2	130132	hgsc.bcm.edu	37	2	198511301	198511301	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr2:198511301C>A	ENST00000295049.4	-	2	765	c.229G>T	c.(229-231)Ggg>Tgg	p.G77W		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	77					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TGAATAGCCCCGACAATATAT	0.378																																					p.G77W		Atlas-SNP	.											.	RFTN2	68	.	0			c.G229T						PASS	.						116.0	117.0	116.0					2																	198511301		2203	4300	6503	SO:0001583	missense	130132	exon2			TAGCCCCGACAAT	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.229G>T	chr2.hg19:g.198511301C>A	ENSP00000295049:p.Gly77Trp	166.0	0.0	.		197.0	9.0	.	NM_144629	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	hg19	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815785	0.70912	.	.	ENSG00000162944	ENST00000295049;ENST00000429081	T;T	0.32753	1.44;1.44	5.39	4.5	0.54988	.	0.474569	0.23536	N	0.047134	T	0.47948	0.1473	L	0.51422	1.61	0.40875	D	0.983944	D	0.89917	1.0	D	0.87578	0.998	T	0.46911	-0.9157	10	0.87932	D	0	-13.4825	12.182	0.54218	0.0:0.9205:0.0:0.0795	.	77	Q52LD8	RFTN2_HUMAN	W	77	ENSP00000295049:G77W;ENSP00000398128:G77W	ENSP00000295049:G77W	G	-	1	0	RFTN2	198219546	0.387000	0.25188	0.999000	0.59377	0.943000	0.58893	2.256000	0.43231	2.687000	0.91594	0.585000	0.79938	GGG	.	.	.	none		0.378	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629	
SEPT2	4735	hgsc.bcm.edu	37	2	242277178	242277178	+	Silent	SNP	G	G	C			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr2:242277178G>C	ENST00000391973.2	+	7	1095	c.567G>C	c.(565-567)ctG>ctC	p.L189L	SEPT2_ENST00000360051.3_Silent_p.L189L|SEPT2_ENST00000402092.2_Silent_p.L189L|SEPT2_ENST00000391971.2_Silent_p.L189L|SEPT2_ENST00000407971.1_Silent_p.L149L|SEPT2_ENST00000401990.1_Silent_p.L199L	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	189	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		CTCTCACCCTGAAGGAACGGG	0.507																																					p.L189L		Atlas-SNP	.											.	SEPT2	33	.	0			c.G567C						PASS	.						76.0	71.0	73.0					2																	242277178		2203	4300	6503	SO:0001819	synonymous_variant	4735	exon8			CACCCTGAAGGAA	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.567G>C	chr2.hg19:g.242277178G>C		104.0	0.0	.		87.0	4.0	.	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Silent	SNP	ENST00000391973.2	hg19	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408628	0.25378	.	.	ENSG00000168385	ENST00000457874	.	.	.	5.23	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7547	0.62928	0.074:0.0:0.926:0.0	.	.	.	.	S	161	.	.	X	+	2	2	SEPT2	241925851	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	3.609000	0.54117	1.215000	0.43411	0.655000	0.94253	TGA	.	.	.	none		0.507	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
CCDC13	152206	hgsc.bcm.edu	37	3	42777251	42777251	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr3:42777251C>A	ENST00000310232.6	-	10	1402	c.1319G>T	c.(1318-1320)cGg>cTg	p.R440L	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	440										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TTTGGCCTCCCGCTCAGCTAC	0.602																																					p.R440L		Atlas-SNP	.											.	CCDC13	71	.	0			c.G1319T						PASS	.						119.0	104.0	109.0					3																	42777251		2203	4300	6503	SO:0001583	missense	152206	exon10			GCCTCCCGCTCAG	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1319G>T	chr3.hg19:g.42777251C>A	ENSP00000309836:p.Arg440Leu	169.0	0.0	.		163.0	10.0	.	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700694	0.68501	.	.	ENSG00000244607	ENST00000310232	T	0.27720	1.65	5.03	5.03	0.67393	.	0.085006	0.47852	D	0.000217	T	0.55353	0.1915	M	0.75447	2.3	0.38311	D	0.943263	D	0.89917	1.0	D	0.76071	0.987	T	0.57207	-0.7851	10	0.30078	T	0.28	.	17.144	0.86761	0.0:1.0:0.0:0.0	.	440	Q8IYE1	CCD13_HUMAN	L	440	ENSP00000309836:R440L	ENSP00000309836:R440L	R	-	2	0	CCDC13	42752255	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.131000	0.57970	2.345000	0.79718	0.511000	0.50034	CGG	.	.	.	none		0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
KIAA1407	57577	hgsc.bcm.edu	37	3	113737705	113737705	+	Missense_Mutation	SNP	C	C	A	rs149867008	byFrequency	TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr3:113737705C>A	ENST00000295878.3	-	8	1129	c.983G>T	c.(982-984)cGg>cTg	p.R328L	KIAA1407_ENST00000545063.1_Missense_Mutation_p.R159L	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	328								p.R328L(1)		endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						AGCGAAATACCGTTTTTGACA	0.483																																					p.R328L		Atlas-SNP	.											.	KIAA1407	80	.	1	Substitution - Missense(1)	lung(1)	c.G983T						PASS	.						174.0	176.0	175.0					3																	113737705		2203	4300	6503	SO:0001583	missense	57577	exon8			AAATACCGTTTTT	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.983G>T	chr3.hg19:g.113737705C>A	ENSP00000295878:p.Arg328Leu	391.0	0.0	.		348.0	14.0	.	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	hg19	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984892	0.74474	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.51574	1.35;0.73;0.7	5.76	4.78	0.61160	.	0.269718	0.36034	N	0.002833	T	0.59101	0.2169	M	0.64997	1.995	0.80722	D	1	D;D;D	0.76494	0.99;0.999;0.995	P;D;P	0.70487	0.796;0.969;0.879	T	0.61501	-0.7050	10	0.62326	D	0.03	.	5.5084	0.16866	0.0:0.6308:0.2044:0.1648	.	315;204;328	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	L	328;159;315	ENSP00000295878:R328L;ENSP00000446381:R159L;ENSP00000418099:R315L	ENSP00000295878:R328L	R	-	2	0	KIAA1407	115220395	0.420000	0.25457	1.000000	0.80357	0.990000	0.78478	0.674000	0.25218	2.726000	0.93360	0.655000	0.94253	CGG	.	C|1.000;T|0.000	.	alt		0.483	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
AFAP1	60312	hgsc.bcm.edu	37	4	7840357	7840357	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr4:7840357G>T	ENST00000360265.4	-	5	854	c.620C>A	c.(619-621)cCg>cAg	p.P207Q	AFAP1_ENST00000358461.2_Missense_Mutation_p.P207Q|AFAP1_ENST00000420658.1_Missense_Mutation_p.P207Q|AFAP1_ENST00000382543.3_Missense_Mutation_p.P207Q			Q8N556	AFAP1_HUMAN	actin filament associated protein 1	207	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(4)|stomach(2)	32						GCTGTCTTTCGGGATGTACGT	0.507																																					p.P207Q		Atlas-SNP	.											.	AFAP1	93	.	0			c.C620A						PASS	.						209.0	191.0	197.0					4																	7840357		2203	4300	6503	SO:0001583	missense	60312	exon6			TCTTTCGGGATGT	AB209676	CCDS3397.1, CCDS47010.1	4p16	2014-02-12	2007-02-07		ENSG00000196526	ENSG00000196526		"""Pleckstrin homology (PH) domain containing"""	24017	protein-coding gene	gene with protein product		608252				14755689, 11641786, 11607843	Standard	NM_198595		Approved	AFAP-110, AFAP	uc011bwk.1	Q8N556	OTTHUMG00000125515	ENST00000360265.4:c.620C>A	chr4.hg19:g.7840357G>T	ENSP00000353402:p.Pro207Gln	166.0	0.0	.		174.0	9.0	.	NM_001134647	A8K442|B4DMU2|E9PDT7|Q59EY5|Q9HBY1	Missense_Mutation	SNP	ENST00000360265.4	hg19	CCDS3397.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981112	0.74474	.	.	ENSG00000196526	ENST00000360265;ENST00000420658;ENST00000358461;ENST00000382543	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	4.46	4.46	0.54185	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.056876	0.64402	D	0.000001	D	0.85852	0.5793	M	0.79123	2.44	0.58432	D	0.999998	D;D	0.69078	0.997;0.988	D;D	0.70016	0.967;0.963	D	0.87651	0.2528	10	0.59425	D	0.04	-44.5193	17.4002	0.87458	0.0:0.0:1.0:0.0	.	207;207	E9PDT7;Q8N556	.;AFAP1_HUMAN	Q	207	ENSP00000353402:P207Q;ENSP00000410689:P207Q;ENSP00000351245:P207Q;ENSP00000371983:P207Q	ENSP00000351245:P207Q	P	-	2	0	AFAP1	7891257	1.000000	0.71417	0.836000	0.33094	0.629000	0.37895	7.154000	0.77437	2.344000	0.79699	0.650000	0.86243	CCG	.	.	.	none		0.507	AFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246842.2	NM_021638	
SDHA	6389	hgsc.bcm.edu	37	5	224586	224586	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr5:224586G>A	ENST00000264932.6	+	3	377	c.262G>A	c.(262-264)Gca>Aca	p.A88T	SDHA_ENST00000504309.1_Missense_Mutation_p.A88T|SDHA_ENST00000510361.1_Missense_Mutation_p.A88T	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	88					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTTTAATACAGCATGTGTTAC	0.547									Familial Paragangliomas																												p.A88T		Atlas-SNP	.											.	SDHA	80	.	0			c.G262A						PASS	.						111.0	110.0	110.0					5																	224586		2203	4300	6503	SO:0001583	missense	6389	exon3	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	AATACAGCATGTG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.262G>A	chr5.hg19:g.224586G>A	ENSP00000264932:p.Ala88Thr	215.0	0.0	.		165.0	27.0	.	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	hg19	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	g	25.0	4.594697	0.86953	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.72282	-0.64;-0.64;-0.09	5.56	5.56	0.83823	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.000000	0.85682	U	0.000000	D	0.84192	0.5418	M	0.75264	2.295	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.997;0.998	D	0.85385	0.1122	10	0.87932	D	0	.	17.4364	0.87553	0.0:0.0:1.0:0.0	.	88;88;88;88;94	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	T	88	ENSP00000264932:A88T;ENSP00000426514:A88T;ENSP00000427703:A88T	ENSP00000264932:A88T	A	+	1	0	SDHA	277586	1.000000	0.71417	0.200000	0.23457	0.418000	0.31294	9.385000	0.97223	2.794000	0.96219	0.539000	0.68188	GCA	.	.	.	none		0.547	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33596055	33596055	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr5:33596055T>G	ENST00000504830.1	-	17	2973	c.2638A>C	c.(2638-2640)Aag>Cag	p.K880Q	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.K795Q|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	880	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGACAAGCCTTTTCATGGCAC	0.507										HNSCC(64;0.19)																											p.K880Q		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.A2638C						PASS	.						225.0	189.0	201.0					5																	33596055		2203	4300	6503	SO:0001583	missense	81792	exon17			AAGCCTTTTCATG	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2638A>C	chr5.hg19:g.33596055T>G	ENSP00000422554:p.Lys880Gln	181.0	0.0	.		168.0	30.0	.	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.571445	0.28003	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.52526	0.66;0.66	5.77	3.29	0.37713	.	0.320980	0.41500	N	0.000878	T	0.20861	0.0502	N	0.03891	-0.335	0.80722	D	1	B;B	0.15473	0.013;0.001	B;B	0.13407	0.007;0.009	T	0.04178	-1.0971	10	0.15066	T	0.55	.	8.4354	0.32784	0.0:0.0654:0.3833:0.5514	.	795;880	P58397-3;P58397	.;ATS12_HUMAN	Q	880;795	ENSP00000422554:K880Q;ENSP00000344847:K795Q	ENSP00000344847:K795Q	K	-	1	0	ADAMTS12	33631812	0.975000	0.34042	1.000000	0.80357	0.993000	0.82548	0.949000	0.29109	0.494000	0.27859	0.477000	0.44152	AAG	.	.	.	none		0.507	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
DBN1	1627	hgsc.bcm.edu	37	5	176895199	176895199	+	Silent	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr5:176895199C>A	ENST00000309007.5	-	3	384	c.165G>T	c.(163-165)tcG>tcT	p.S55S	DBN1_ENST00000292385.5_Silent_p.S57S|DBN1_ENST00000393565.1_Silent_p.S55S	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	55	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.S55S(1)|p.S57S(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAAAGTGTCCCGAAAGCTCCT	0.522																																					p.S57S		Atlas-SNP	.											.	DBN1	122	.	2	Substitution - coding silent(2)	kidney(2)	c.G171T						PASS	.						153.0	158.0	156.0					5																	176895199		2203	4300	6503	SO:0001819	synonymous_variant	1627	exon4			GTGTCCCGAAAGC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.165G>T	chr5.hg19:g.176895199C>A		306.0	0.0	.		227.0	11.0	.	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Silent	SNP	ENST00000309007.5	hg19	CCDS4420.1																																																																																			.	.	.	none		0.522	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
HIST1H2BC	8347	hgsc.bcm.edu	37	6	26123936	26123936	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr6:26123936A>C	ENST00000314332.5	-	1	202	c.197T>G	c.(196-198)tTc>tGc	p.F66C	HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.F66C|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	66					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						GTCGTTAACGAAAGAATTCAT	0.557																																					p.F66C		Atlas-SNP	.											.	HIST1H2BC	35	.	0			c.T197G						PASS	.						157.0	149.0	151.0					6																	26123936		2203	4300	6503	SO:0001583	missense	8347	exon1			TTAACGAAAGAAT	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.197T>G	chr6.hg19:g.26123936A>C	ENSP00000321744:p.Phe66Cys	279.0	0.0	.		226.0	15.0	.	NM_003526	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000314332.5	hg19	CCDS4584.1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.033354	0.75504	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.27557	1.66;1.66	5.61	5.61	0.85477	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.40932	0.1137	.	.	.	0.41896	D	0.990396	P	0.47253	0.892	P	0.55749	0.783	T	0.38457	-0.9660	8	0.72032	D	0.01	.	15.2833	0.73806	1.0:0.0:0.0:0.0	.	66	P62807	H2B1C_HUMAN	C	66	ENSP00000321744:F66C;ENSP00000380180:F66C	ENSP00000321744:F66C	F	-	2	0	HIST1H2BC	26231915	1.000000	0.71417	0.998000	0.56505	0.277000	0.26821	9.051000	0.93849	2.259000	0.74868	0.528000	0.53228	TTC	.	.	.	none		0.557	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526	
SYNJ2	8871	hgsc.bcm.edu	37	6	158516906	158516906	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr6:158516906C>A	ENST00000355585.4	+	27	4076	c.4001C>A	c.(4000-4002)cCg>cAg	p.P1334Q	SYNJ2_ENST00000367112.1_Missense_Mutation_p.P419Q|SYNJ2_ENST00000367122.2_Missense_Mutation_p.P1289Q	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	1334	Pro-rich.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)	p.P1334L(1)		biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		AAGGTACCCCCGAGGAGGAAG	0.642																																					p.P1334Q		Atlas-SNP	.											SYNJ2,NS,carcinoma,0,1	SYNJ2	111	.	1	Substitution - Missense(1)	ovary(1)	c.C4001A						PASS	.						37.0	45.0	42.0					6																	158516906		2203	4300	6503	SO:0001583	missense	8871	exon27			TACCCCCGAGGAG	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.4001C>A	chr6.hg19:g.158516906C>A	ENSP00000347792:p.Pro1334Gln	102.0	0.0	.		74.0	7.0	.	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	ENST00000355585.4	hg19	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178918	0.57692	.	.	ENSG00000078269	ENST00000367122;ENST00000355585;ENST00000367112	D;D;T	0.96104	-3.78;-3.91;-0.54	5.79	4.92	0.64577	.	0.093328	0.47852	D	0.000213	D	0.95598	0.8569	L	0.59436	1.845	0.44908	D	0.997928	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	D	0.88909	0.3358	10	0.87932	D	0	.	14.599	0.68427	0.0:0.9306:0.0:0.0694	.	729;1334	B4DLC4;O15056	.;SYNJ2_HUMAN	Q	1289;1334;419	ENSP00000356089:P1289Q;ENSP00000347792:P1334Q;ENSP00000356079:P419Q	ENSP00000347792:P1334Q	P	+	2	0	SYNJ2	158436894	0.985000	0.35326	0.029000	0.17559	0.304000	0.27724	4.827000	0.62723	-2.585000	0.00460	-0.781000	0.03364	CCG	.	.	.	none		0.642	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
ELN	2006	hgsc.bcm.edu	37	7	73474352	73474352	+	Silent	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr7:73474352C>A	ENST00000252034.7	+	23	1950	c.1551C>A	c.(1549-1551)ccC>ccA	p.P517P	ELN_ENST00000380553.4_Silent_p.P381P|ELN_ENST00000380575.4_Silent_p.P488P|ELN_ENST00000458204.1_Silent_p.P507P|ELN_ENST00000380562.4_Silent_p.P523P|ELN_ENST00000357036.5_Silent_p.P522P|ELN_ENST00000320492.7_Silent_p.P436P|ELN_ENST00000380584.4_Silent_p.P484P|ELN_ENST00000380576.5_Silent_p.P498P|ELN_ENST00000429192.1_Silent_p.P503P|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000320399.6_Silent_p.P517P|ELN_ENST00000414324.1_Silent_p.P493P|ELN_ENST00000445912.1_Silent_p.P517P|ELN_ENST00000358929.4_Silent_p.P552P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GCGTGGCTCCCGGCATTGGCC	0.647			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P522P		Atlas-SNP	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	81	.	0			c.C1566A						PASS	.						109.0	104.0	105.0					7																	73474352		2203	4300	6503	SO:0001819	synonymous_variant	2006	exon23			GGCTCCCGGCATT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1551C>A	chr7.hg19:g.73474352C>A		227.0	0.0	.		182.0	9.0	.	NM_001081754	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	hg19	CCDS5562.2																																																																																			.	.	.	none		0.647	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
ELAVL2	1993	hgsc.bcm.edu	37	9	23762205	23762205	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr9:23762205T>C	ENST00000397312.2	-	2	302	c.28A>G	c.(28-30)Act>Gct	p.T10A	ELAVL2_ENST00000380110.4_Missense_Mutation_p.T39A|ELAVL2_ENST00000223951.6_Missense_Mutation_p.T10A|ELAVL2_ENST00000462649.1_5'Flank|ELAVL2_ENST00000380117.1_Missense_Mutation_p.T10A|ELAVL2_ENST00000544538.1_Missense_Mutation_p.T10A	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	10					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TTATTGCAAGTTGGCCCATTA	0.403																																					p.T10A		Atlas-SNP	.											.	ELAVL2	80	.	0			c.A28G						PASS	.						296.0	273.0	281.0					9																	23762205		2203	4299	6502	SO:0001583	missense	1993	exon2			TGCAAGTTGGCCC	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.28A>G	chr9.hg19:g.23762205T>C	ENSP00000380479:p.Thr10Ala	388.0	0.0	.		433.0	83.0	.	NM_001171195	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	hg19	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.662813	0.29515	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	T;T;T;T;T	0.13196	2.61;3.01;3.01;3.01;2.92	5.92	5.92	0.95590	.	0.225320	0.44688	D	0.000426	T	0.07728	0.0194	N	0.04508	-0.205	0.50039	D	0.999841	B;B	0.02656	0.0;0.0	B;B	0.12156	0.001;0.007	T	0.38112	-0.9676	10	0.19147	T	0.46	.	16.371	0.83361	0.0:0.0:0.0:1.0	.	10;10	Q12926;Q12926-2	ELAV2_HUMAN;.	A	10;10;10;10;10;38;10	ENSP00000223951:T10A;ENSP00000380479:T10A;ENSP00000440998:T10A;ENSP00000369460:T10A;ENSP00000412602:T10A	ENSP00000223951:T10A	T	-	1	0	ELAVL2	23752205	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.014000	0.64029	2.267000	0.75376	0.477000	0.44152	ACT	.	.	.	none		0.403	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432	
ZNF618	114991	hgsc.bcm.edu	37	9	116812343	116812343	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr9:116812343G>T	ENST00000374126.5	+	15	2860	c.2761G>T	c.(2761-2763)Ggg>Tgg	p.G921W	ZNF618_ENST00000470105.1_3'UTR|ZNF618_ENST00000288466.7_Missense_Mutation_p.G828W			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	921					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CGCCAGAAGCGGGTGTGTAAA	0.512																																					p.G828W		Atlas-SNP	.											ZNF618_ENST00000374126,NS,carcinoma,0,3	ZNF618	184	.	0			c.G2482T						PASS	.						56.0	62.0	60.0					9																	116812343		1833	4080	5913	SO:0001583	missense	114991	exon14			AGAAGCGGGTGTG	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.2761G>T	chr9.hg19:g.116812343G>T	ENSP00000363241:p.Gly921Trp	155.0	0.0	.		179.0	8.0	.	NM_133374	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	hg19		.	.	.	.	.	.	.	.	.	.	G	20.8	4.056794	0.76074	.	.	ENSG00000157657	ENST00000374126;ENST00000288466	T;T	0.21734	1.99;1.99	5.93	5.93	0.95920	Ribonuclease H-like (1);	0.099558	0.64402	D	0.000002	T	0.46308	0.1386	.	.	.	0.52501	D	0.999958	P;D;D	0.62365	0.953;0.981;0.991	P;P;P	0.59424	0.739;0.652;0.857	T	0.38499	-0.9658	9	0.87932	D	0	-36.171	19.3319	0.94293	0.0:0.0:1.0:0.0	.	888;921;828	B9EG82;Q5T7W0;Q5T7W0-2	.;ZN618_HUMAN;.	W	921;828	ENSP00000363241:G921W;ENSP00000288466:G828W	ENSP00000288466:G828W	G	+	1	0	ZNF618	115852164	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.265000	0.78442	2.815000	0.96918	0.561000	0.74099	GGG	.	.	.	none		0.512	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
PDCD11	22984	hgsc.bcm.edu	37	10	105202030	105202030	+	Missense_Mutation	SNP	C	C	A	rs576894256		TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr10:105202030C>A	ENST00000369797.3	+	32	4862	c.4768C>A	c.(4768-4770)Cgc>Agc	p.R1590S		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1590					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAACTGTCCCGCATTGAGGA	0.537																																					p.R1590S		Atlas-SNP	.											.	PDCD11	160	.	0			c.C4768A						PASS	.						107.0	109.0	109.0					10																	105202030		2203	4300	6503	SO:0001583	missense	22984	exon32			CTGTCCCGCATTG	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.4768C>A	chr10.hg19:g.105202030C>A	ENSP00000358812:p.Arg1590Ser	180.0	0.0	.		187.0	11.0	.	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	hg19	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002691	0.74932	.	.	ENSG00000148843	ENST00000369797	T	0.40756	1.02	5.27	5.27	0.74061	.	0.110569	0.64402	D	0.000014	T	0.41396	0.1157	N	0.25485	0.75	0.40880	D	0.983985	D	0.60160	0.987	P	0.55577	0.779	T	0.10382	-1.0632	10	0.20519	T	0.43	-15.7903	12.4343	0.55590	0.2802:0.7198:0.0:0.0	.	1590	Q14690	RRP5_HUMAN	S	1590	ENSP00000358812:R1590S	ENSP00000358812:R1590S	R	+	1	0	PDCD11	105192020	0.998000	0.40836	1.000000	0.80357	0.849000	0.48306	2.898000	0.48672	2.619000	0.88677	0.561000	0.74099	CGC	.	.	.	none		0.537	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
NLRX1	79671	hgsc.bcm.edu	37	11	119051968	119051968	+	Splice_Site	SNP	T	T	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr11:119051968T>A	ENST00000409109.1	+	8	2941		c.e8+2		NLRX1_ENST00000292199.2_Splice_Site|NLRX1_ENST00000409991.1_Splice_Site|NLRX1_ENST00000409265.4_Splice_Site|NLRX1_ENST00000525863.1_Splice_Site	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1						innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CACACTGCGGTGAGTGACCTG	0.582																																					.		Atlas-SNP	.											.	NLRX1	128	.	0			c.2354+2T>A						PASS	.						85.0	68.0	74.0					11																	119051968		2200	4295	6495	SO:0001630	splice_region_variant	79671	exon8			CTGCGGTGAGTGA	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.2354+2T>A	chr11.hg19:g.119051968T>A		55.0	0.0	.		59.0	16.0	.	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Splice_Site	SNP	ENST00000409109.1	hg19	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200656	0.79015	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9739	0.58527	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRX1	118557178	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.819000	0.69243	2.246000	0.74042	0.533000	0.62120	.	.	.	.	none		0.582	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	Intron
UTP20	27340	hgsc.bcm.edu	37	12	101693787	101693787	+	Silent	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr12:101693787C>A	ENST00000261637.4	+	14	1797	c.1623C>A	c.(1621-1623)acC>acA	p.T541T		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	541					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CACTCGTCACCGGCTTCATAG	0.438																																					p.T541T		Atlas-SNP	.											.	UTP20	222	.	0			c.C1623A						PASS	.						207.0	200.0	203.0					12																	101693787		2203	4300	6503	SO:0001819	synonymous_variant	27340	exon14			CGTCACCGGCTTC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1623C>A	chr12.hg19:g.101693787C>A		310.0	0.0	.		368.0	17.0	.	NM_014503	Q9H3H4	Silent	SNP	ENST00000261637.4	hg19	CCDS9081.1																																																																																			.	.	.	none		0.438	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
TSC2	7249	hgsc.bcm.edu	37	16	2129191	2129191	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr16:2129191C>A	ENST00000219476.3	+	27	3755	c.3125C>A	c.(3124-3126)cCg>cAg	p.P1042Q	TSC2_ENST00000568454.1_Missense_Mutation_p.P1009Q|TSC2_ENST00000382538.6_Missense_Mutation_p.P950Q|TSC2_ENST00000439673.2_Missense_Mutation_p.P962Q|TSC2_ENST00000353929.4_Missense_Mutation_p.P999Q|TSC2_ENST00000350773.4_Missense_Mutation_p.P1042Q|TSC2_ENST00000401874.2_Missense_Mutation_p.P998Q|TSC2_ENST00000568366.1_3'UTR	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1042					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				ACGGCTGTCCCGAAGAGGTCC	0.617			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.P1042Q		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.C3125A						PASS	.						84.0	71.0	75.0					16																	2129191		2198	4300	6498	SO:0001583	missense	7249	exon27	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CTGTCCCGAAGAG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.3125C>A	chr16.hg19:g.2129191C>A	ENSP00000219476:p.Pro1042Gln	149.0	0.0	.		101.0	7.0	.	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576568	0.65878	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.93076	-3.16;-3.02;-3.03;-3.03;-3.08	4.97	4.97	0.65823	.	0.125602	0.53938	D	0.000046	D	0.96531	0.8868	M	0.75615	2.305	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.998;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.97110	0.989;0.979;0.993;0.993;1.0;0.997	D	0.97151	0.9831	10	0.87932	D	0	-37.0385	18.23	0.89931	0.0:1.0:0.0:0.0	.	950;962;1042;998;998;1042	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	Q	1042;999;999;962;950;1042	ENSP00000219476:P1042Q;ENSP00000248099:P999Q;ENSP00000399232:P962Q;ENSP00000371978:P950Q;ENSP00000344383:P1042Q	ENSP00000219476:P1042Q	P	+	2	0	TSC2	2069192	1.000000	0.71417	0.992000	0.48379	0.052000	0.14988	7.755000	0.85180	2.306000	0.77630	0.655000	0.94253	CCG	.	.	.	none		0.617	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
CDR2	1039	hgsc.bcm.edu	37	16	22360668	22360668	+	Silent	SNP	C	C	A	rs374733638		TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr16:22360668C>A	ENST00000268383.2	-	4	745	c.438G>T	c.(436-438)ccG>ccT	p.P146P		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	146						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		CACACTTTCCCGGGCTCCTTC	0.537																																					p.P146P		Atlas-SNP	.											.	CDR2	34	.	0			c.G438T						PASS	.						112.0	113.0	113.0					16																	22360668		2197	4300	6497	SO:0001819	synonymous_variant	1039	exon4			CTTTCCCGGGCTC	M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.438G>T	chr16.hg19:g.22360668C>A		230.0	0.0	.		211.0	10.0	.	NM_001802	A8K8A8|Q13977	Silent	SNP	ENST00000268383.2	hg19	CCDS32404.1																																																																																			.	.	.	alt		0.537	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430081.1		
ZNF404	342908	hgsc.bcm.edu	37	19	44378055	44378055	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr19:44378055A>G	ENST00000587539.1	-	3	310	c.311T>C	c.(310-312)gTg>gCg	p.V104A	ZNF404_ENST00000324394.6_Missense_Mutation_p.V102A	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				AAAACATCCCACTTTAGGTCT	0.333																																					p.V101A		Atlas-SNP	.											.	ZNF404	46	.	0			c.T302C						PASS	.						137.0	146.0	143.0					19																	44378055		1838	4087	5925	SO:0001583	missense	342908	exon2			CATCCCACTTTAG	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.311T>C	chr19.hg19:g.44378055A>G	ENSP00000466051:p.Val104Ala	264.0	0.0	.		343.0	16.0	.	NM_001033719	A4FU30|K7ELF2	Missense_Mutation	SNP	ENST00000587539.1	hg19	CCDS59394.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.730337	0.00089	.	.	ENSG00000176222	ENST00000324394	T	0.06142	3.34	2.99	0.516	0.17019	.	.	.	.	.	T	0.03695	0.0105	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.45116	-0.9283	9	0.27082	T	0.32	.	7.3893	0.26901	0.6601:0.0:0.0:0.3399	.	104	Q494X3	ZN404_HUMAN	A	102	ENSP00000319479:V102A	ENSP00000319479:V102A	V	-	2	0	ZNF404	49069895	0.355000	0.24921	0.001000	0.08648	0.012000	0.07955	1.127000	0.31357	0.341000	0.23771	-0.898000	0.02899	GTG	.	.	.	none		0.333	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1	NM_001033719	
EMC10	284361	hgsc.bcm.edu	37	19	50981244	50981244	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr19:50981244A>G	ENST00000334976.6	+	2	219	c.173A>G	c.(172-174)cAc>cGc	p.H58R	EMC10_ENST00000598585.1_Missense_Mutation_p.H58R|FAM71E1_ENST00000600100.1_5'Flank|CTD-2545M3.2_ENST00000598194.1_RNA|FAM71E1_ENST00000595790.1_5'Flank|EMC10_ENST00000376918.3_Missense_Mutation_p.H58R	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10	58						ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)											CTGCTGGAGCACTCATTTGAG	0.607																																					p.H58R		Atlas-SNP	.											.	.	.	.	0			c.A173G						PASS	.						115.0	107.0	110.0					19																	50981244		2203	4300	6503	SO:0001583	missense	284361	exon2			TGGAGCACTCATT	BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.173A>G	chr19.hg19:g.50981244A>G	ENSP00000334037:p.His58Arg	132.0	0.0	.		101.0	22.0	.	NM_175063	Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Missense_Mutation	SNP	ENST00000334976.6	hg19	CCDS12796.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.991013	0.74703	.	.	ENSG00000161671	ENST00000334976;ENST00000376918;ENST00000376920	.	.	.	4.4	4.4	0.53042	.	0.108519	0.64402	D	0.000008	T	0.75788	0.3897	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;0.989;0.999	D;D;D	0.75020	0.984;0.985;0.961	T	0.78797	-0.2063	9	0.87932	D	0	-17.5433	11.7796	0.52006	1.0:0.0:0.0:0.0	.	58;58;58	Q5UCC4;Q5UCC4-2;Q5UCC4-3	INM02_HUMAN;.;.	R	58	.	ENSP00000334037:H58R	H	+	2	0	C19orf63	55673056	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.415000	0.66411	1.909000	0.55274	0.402000	0.26972	CAC	.	.	.	none		0.607	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464760.2	NM_175063	
ZNF761	388561	hgsc.bcm.edu	37	19	53959648	53959648	+	RNA	SNP	C	C	A	rs373072898		TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr19:53959648C>A	ENST00000454407.1	+	0	2340							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GACTTCATACCGGAGAGAAAC	0.408																																					p.T629T		Atlas-SNP	.											ZNF761,NS,carcinoma,0,1	ZNF761	104	.	0			c.C1887A						PASS	.						112.0	116.0	115.0					19																	53959648		2202	4300	6502			388561	exon7			TCATACCGGAGAG	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		chr19.hg19:g.53959648C>A		160.0	0.0	.		163.0	7.0	.	NM_001008401	Q6ZNB9	Silent	SNP	ENST00000454407.1	hg19																																																																																				.	.	.	alt		0.408	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
TM9SF4	9777	hgsc.bcm.edu	37	20	30723909	30723909	+	Silent	SNP	A	A	G			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr20:30723909A>G	ENST00000398022.2	+	3	397	c.162A>G	c.(160-162)ctA>ctG	p.L54L	TM9SF4_ENST00000217315.5_Silent_p.L37L	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	54						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GAACCCAGCTACCTTATGAAT	0.483																																					p.L54L		Atlas-SNP	.											.	TM9SF4	65	.	0			c.A162G						PASS	.						120.0	99.0	106.0					20																	30723909		2203	4300	6503	SO:0001819	synonymous_variant	9777	exon3			CCAGCTACCTTAT	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.162A>G	chr20.hg19:g.30723909A>G		84.0	0.0	.		109.0	5.0	.	NM_014742	B0QYT7|Q9NUA3	Silent	SNP	ENST00000398022.2	hg19	CCDS13196.2																																																																																			.	.	.	none		0.483	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
IFT52	51098	hgsc.bcm.edu	37	20	42265804	42265804	+	Missense_Mutation	SNP	G	G	T	rs145627647	byFrequency	TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr20:42265804G>T	ENST00000373030.3	+	12	1161	c.1031G>T	c.(1030-1032)cGg>cTg	p.R344L	IFT52_ENST00000373039.4_Missense_Mutation_p.R344L	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	344					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CCCAGTTTCCGGGAGTTACCA	0.418																																					p.R344L		Atlas-SNP	.											.	IFT52	40	.	0			c.G1031T						PASS	.						83.0	83.0	83.0					20																	42265804		2203	4300	6503	SO:0001583	missense	51098	exon12			GTTTCCGGGAGTT	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1031G>T	chr20.hg19:g.42265804G>T	ENSP00000362121:p.Arg344Leu	138.0	0.0	.		191.0	9.0	.	NM_016004	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	ENST00000373030.3	hg19	CCDS33470.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203933	0.79127	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	5.27	5.27	0.74061	.	0.048064	0.85682	D	0.000000	T	0.66954	0.2842	M	0.84683	2.71	0.80722	D	1	P	0.43094	0.799	B	0.37198	0.243	T	0.74618	-0.3605	9	0.52906	T	0.07	-17.1501	18.0301	0.89281	0.0:0.0:1.0:0.0	.	344	Q9Y366	IFT52_HUMAN	L	344	.	ENSP00000362121:R344L	R	+	2	0	IFT52	41699218	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.421000	0.73353	2.628000	0.89032	0.655000	0.94253	CGG	.	G|0.999;A|0.001	.	alt		0.418	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1	NM_016004	
MYH9	4627	hgsc.bcm.edu	37	22	36714304	36714304	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7049-01A-11D-1961-08	TCGA-BQ-7049-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91478a08-9bea-426b-bd0c-ca7cc87297b1	fd0fcf99-b8da-43e8-9ccb-9c792ac32047	g.chr22:36714304G>T	ENST00000216181.5	-	11	1405	c.1175C>A	c.(1174-1176)cCg>cAg	p.P392Q	RN7SL349P_ENST00000582364.1_RNA	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	392	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTTGATGCGCGGGGTGAGGAT	0.532			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.P392Q		Atlas-SNP	.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	225	.	0			c.C1175A						PASS	.						203.0	197.0	199.0					22																	36714304		2203	4300	6503	SO:0001583	missense	4627	exon11	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	ATGCGCGGGGTGA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1175C>A	chr22.hg19:g.36714304G>T	ENSP00000216181:p.Pro392Gln	322.0	0.0	.		284.0	12.0	.	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	ENST00000216181.5	hg19	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032337	0.93575	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	D	0.87729	-2.29	4.96	4.96	0.65561	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.94791	0.8318	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95721	0.8766	10	0.87932	D	0	.	18.2503	0.90000	0.0:0.0:1.0:0.0	.	392	P35579	MYH9_HUMAN	Q	256;392	ENSP00000216181:P392Q	ENSP00000216181:P392Q	P	-	2	0	MYH9	35044250	1.000000	0.71417	0.979000	0.43373	0.987000	0.75469	9.813000	0.99286	2.475000	0.83589	0.650000	0.86243	CCG	.	.	.	none		0.532	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
