#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ASH1L	55870	hgsc.bcm.edu	37	1	155317614	155317614	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:155317614A>G	ENST00000368346.3	-	20	8290	c.7651T>C	c.(7651-7653)Tca>Cca	p.S2551P	ASH1L_ENST00000392403.3_Missense_Mutation_p.S2546P|MIR555_ENST00000384987.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2551					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATCTGGGCTGATGCCTCATGC	0.488																																					p.S2546P		Atlas-SNP	.											.	ASH1L	279	.	0			c.T7636C						PASS	.						197.0	160.0	173.0					1																	155317614		2203	4300	6503	SO:0001583	missense	55870	exon20			GGGCTGATGCCTC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7651T>C	chr1.hg19:g.155317614A>G	ENSP00000357330:p.Ser2551Pro	146.0	0.0	.		137.0	59.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	A	17.35	3.367145	0.61513	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.16743	2.32;2.32	5.4	5.4	0.78164	Bromodomain (3);	0.058282	0.64402	D	0.000002	T	0.07007	0.0178	N	0.08118	0	0.80722	D	1	P;P	0.50272	0.89;0.933	B;P	0.49752	0.417;0.621	T	0.21177	-1.0253	10	0.45353	T	0.12	.	10.9753	0.47463	0.7253:0.2747:0.0:0.0	.	2551;2546	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	P	2551;2546	ENSP00000357330:S2551P;ENSP00000376204:S2546P	ENSP00000357330:S2551P	S	-	1	0	ASH1L	153584238	0.923000	0.31300	1.000000	0.80357	0.998000	0.95712	2.017000	0.40981	2.266000	0.75297	0.533000	0.62120	TCA	.	.	.	none		0.488	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
NEK7	140609	hgsc.bcm.edu	37	1	198231718	198231718	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:198231718T>G	ENST00000367385.4	+	4	554	c.212T>G	c.(211-213)aTg>aGg	p.M71R	NEK7_ENST00000538004.1_Missense_Mutation_p.M71R	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	71	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						TTTGATTTAATGGATGCCAAA	0.289																																					p.M71R		Atlas-SNP	.											.	NEK7	42	.	0			c.T212G						PASS	.						125.0	134.0	131.0					1																	198231718		2203	4292	6495	SO:0001583	missense	140609	exon4			ATTTAATGGATGC	AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.212T>G	chr1.hg19:g.198231718T>G	ENSP00000356355:p.Met71Arg	208.0	0.0	.		173.0	28.0	.	NM_133494	A6NGT8	Missense_Mutation	SNP	ENST00000367385.4	hg19	CCDS1394.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394506	0.83011	.	.	ENSG00000151414	ENST00000367385;ENST00000538004;ENST00000391974	T;T;T	0.63913	-0.07;-0.07;3.21	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67924	0.2945	L	0.28192	0.835	0.80722	D	1	D	0.57257	0.979	D	0.65573	0.936	T	0.71751	-0.4498	10	0.66056	D	0.02	.	15.4982	0.75673	0.0:0.0:0.0:1.0	.	71	Q8TDX7	NEK7_HUMAN	R	71	ENSP00000356355:M71R;ENSP00000444621:M71R;ENSP00000375835:M71R	ENSP00000356355:M71R	M	+	2	0	NEK7	196498341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.506000	0.81665	2.198000	0.70561	0.528000	0.53228	ATG	.	.	.	none		0.289	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086550.2	NM_133494	
LRRC3B	116135	hgsc.bcm.edu	37	3	26751861	26751861	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:26751861G>T	ENST00000396641.2	+	2	1290	c.698G>T	c.(697-699)cGg>cTg	p.R233L	AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000456208.2_Missense_Mutation_p.R233L|LRRC3B_ENST00000417744.1_Missense_Mutation_p.R233L	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	233						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						GAGGATGCCCGGAGACACCTC	0.448																																					p.R233L		Atlas-SNP	.											.	LRRC3B	51	.	0			c.G698T						PASS	.						78.0	76.0	76.0					3																	26751861		2203	4300	6503	SO:0001583	missense	116135	exon2			ATGCCCGGAGACA	AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.698G>T	chr3.hg19:g.26751861G>T	ENSP00000379880:p.Arg233Leu	35.0	0.0	.		42.0	4.0	.	NM_052953	Q5M8T0	Missense_Mutation	SNP	ENST00000396641.2	hg19	CCDS2644.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309657	0.81247	.	.	ENSG00000179796	ENST00000396641;ENST00000417744;ENST00000456208	T;T;T	0.64803	-0.12;-0.12;-0.12	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.79667	0.4485	M	0.75777	2.31	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.80641	-0.1292	10	0.87932	D	0	-10.319	19.2859	0.94069	0.0:0.0:1.0:0.0	.	233	Q96PB8	LRC3B_HUMAN	L	233	ENSP00000379880:R233L;ENSP00000406370:R233L;ENSP00000394940:R233L	ENSP00000379880:R233L	R	+	2	0	LRRC3B	26726865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.873000	0.98535	0.563000	0.77884	CGG	.	.	.	none		0.448	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
DNAJC13	23317	hgsc.bcm.edu	37	3	132184844	132184844	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:132184844T>C	ENST00000260818.6	+	18	2146	c.1898T>C	c.(1897-1899)cTa>cCa	p.L633P	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	633					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTCAGACAGCTAAGTAGACAT	0.338																																					p.L633P		Atlas-SNP	.											.	DNAJC13	253	.	0			c.T1898C						PASS	.						72.0	70.0	70.0					3																	132184844		2203	4300	6503	SO:0001583	missense	23317	exon18			GACAGCTAAGTAG	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1898T>C	chr3.hg19:g.132184844T>C	ENSP00000260818:p.Leu633Pro	38.0	0.0	.		42.0	12.0	.	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	hg19	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419736	0.83559	.	.	ENSG00000138246	ENST00000260818	T	0.34859	1.34	5.53	5.53	0.82687	Armadillo-type fold (1);	0.000000	0.64402	D	0.000007	T	0.64159	0.2573	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.70226	-0.4930	10	0.87932	D	0	.	15.6649	0.77221	0.0:0.0:0.0:1.0	.	633;633	A7E2Y5;O75165	.;DJC13_HUMAN	P	633	ENSP00000260818:L633P	ENSP00000260818:L633P	L	+	2	0	DNAJC13	133667534	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.813000	0.86123	2.103000	0.63969	0.528000	0.53228	CTA	.	.	.	none		0.338	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
XRN1	54464	hgsc.bcm.edu	37	3	142141468	142141468	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr3:142141468G>C	ENST00000264951.4	-	8	1040	c.923C>G	c.(922-924)cCt>cGt	p.P308R	XRN1_ENST00000392981.2_Missense_Mutation_p.P308R|XRN1_ENST00000463916.1_Missense_Mutation_p.P308R|RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000544157.1_Missense_Mutation_p.P98R	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	308					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ATAAAGAAGAGGCAGTGCATC	0.358																																					p.P308R		Atlas-SNP	.											.	XRN1	138	.	0			c.C923G						PASS	.						84.0	86.0	85.0					3																	142141468		2203	4298	6501	SO:0001583	missense	54464	exon8			AGAAGAGGCAGTG	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.923C>G	chr3.hg19:g.142141468G>C	ENSP00000264951:p.Pro308Arg	99.0	0.0	.		118.0	10.0	.	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	hg19	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716498	0.89205	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157	T;T	0.30448	1.53;1.53	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.997;0.997;0.994	D;D;P;D;D	0.87578	0.998;0.998;0.887;0.984;0.963	T	0.68659	-0.5350	10	0.59425	D	0.04	-9.0623	19.3082	0.94173	0.0:0.0:1.0:0.0	.	98;308;169;308;308	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	R	308;308;308;98	ENSP00000264951:P308R;ENSP00000376707:P308R	ENSP00000264951:P308R	P	-	2	0	XRN1	143624158	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.363000	0.97131	2.572000	0.86782	0.650000	0.86243	CCT	.	.	.	none		0.358	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
TCERG1	10915	hgsc.bcm.edu	37	5	145836845	145836845	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr5:145836845G>A	ENST00000296702.5	+	3	423	c.385G>A	c.(385-387)Gca>Aca	p.A129T	TCERG1_ENST00000394421.2_Missense_Mutation_p.A129T	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	129	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTACTCCAGCACTACCTCC	0.458																																					p.A129T		Atlas-SNP	.											.	TCERG1	148	.	0			c.G385A						PASS	.						101.0	95.0	97.0					5																	145836845		2203	4300	6503	SO:0001583	missense	10915	exon3			ACTCCAGCACTAC	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.385G>A	chr5.hg19:g.145836845G>A	ENSP00000296702:p.Ala129Thr	145.0	0.0	.		120.0	41.0	.	NM_006706	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	hg19	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742261	0.49151	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.25912	1.77;1.77	5.28	4.29	0.51040	.	0.308756	0.35124	N	0.003438	T	0.15392	0.0371	N	0.21282	0.65	0.33542	D	0.595008	B;B;B	0.17038	0.02;0.003;0.001	B;B;B	0.09377	0.004;0.004;0.002	T	0.11324	-1.0592	10	0.27082	T	0.32	-18.8301	9.1164	0.36760	0.1984:0.0:0.8016:0.0	.	129;129;129	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	T	129	ENSP00000296702:A129T;ENSP00000377943:A129T	ENSP00000296702:A129T	A	+	1	0	TCERG1	145817038	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.771000	0.38542	2.463000	0.83235	0.491000	0.48974	GCA	.	.	.	none		0.458	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
DSP	1832	hgsc.bcm.edu	37	6	7579570	7579570	+	Silent	SNP	G	G	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr6:7579570G>T	ENST00000379802.3	+	23	3488	c.3147G>T	c.(3145-3147)tcG>tcT	p.S1049S	DSP_ENST00000418664.2_Silent_p.S1049S	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1049	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.S1049S(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATGCCAACTCGGAAAACTGTA	0.448																																					p.S1049S		Atlas-SNP	.											DSP,colon,NS,0,1	DSP	306	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3147T						PASS	.						41.0	46.0	44.0					6																	7579570		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon23			CAACTCGGAAAAC	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3147G>T	chr6.hg19:g.7579570G>T		58.0	1.0	.		65.0	3.0	.	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.	.	none		0.448	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
EPHB6	2051	hgsc.bcm.edu	37	7	142568111	142568111	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr7:142568111A>G	ENST00000392957.2	+	18	3539	c.2752A>G	c.(2752-2754)Atg>Gtg	p.M918V	EPHB6_ENST00000411471.2_Missense_Mutation_p.M641V|EPHB6_ENST00000442129.1_Missense_Mutation_p.M918V|EPHB6_ENST00000476059.1_3'UTR	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	918	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					ATTTGACAAGATGATCCGCAA	0.577																																					p.M918V		Atlas-SNP	.											.	EPHB6	168	.	0			c.A2752G						PASS	.						65.0	75.0	72.0					7																	142568111		2203	4300	6503	SO:0001583	missense	2051	exon18			GACAAGATGATCC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2752A>G	chr7.hg19:g.142568111A>G	ENSP00000376684:p.Met918Val	190.0	0.0	.		190.0	19.0	.	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	hg19	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	A	16.64	3.180826	0.57800	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.61392	0.11;0.11;0.11	5.58	5.58	0.84498	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	T	0.60625	0.2283	L	0.49126	1.545	0.42496	D	0.992913	P;P	0.52463	0.953;0.946	P;P	0.51101	0.458;0.659	T	0.65561	-0.6138	10	0.87932	D	0	.	11.0016	0.47609	0.8441:0.1559:0.0:0.0	.	918;641	O15197;O15197-2	EPHB6_HUMAN;.	V	918;918;641	ENSP00000376684:M918V;ENSP00000410789:M918V;ENSP00000409061:M641V	ENSP00000376684:M918V	M	+	1	0	EPHB6	142278233	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.307000	0.33516	2.107000	0.64212	0.533000	0.62120	ATG	.	.	.	none		0.577	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
ASB10	136371	hgsc.bcm.edu	37	7	150878332	150878332	+	Silent	SNP	G	G	T	rs61743170	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr7:150878332G>T	ENST00000420175.2	-	3	822	c.798C>A	c.(796-798)gcC>gcA	p.A266A	ASB10_ENST00000275838.1_Silent_p.A266A|ASB10_ENST00000434669.1_Silent_p.A311A|ASB10_ENST00000377867.3_Silent_p.A251A|ASB10_ENST00000422024.1_Silent_p.A311A			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	266					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGTGGCCTCGGCATCGGTGA	0.657																																					p.A266A		Atlas-SNP	.											.	ASB10	99	.	0			c.C798A						PASS	.						31.0	33.0	32.0					7																	150878332		2203	4298	6501	SO:0001819	synonymous_variant	136371	exon3			GGCCTCGGCATCG	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.798C>A	chr7.hg19:g.150878332G>T		66.0	0.0	.		63.0	6.0	.	NM_001142459	A0AVH0|Q6ZUL6	Silent	SNP	ENST00000420175.2	hg19	CCDS47750.2																																																																																			.	G|0.914;A|0.086	.	alt		0.657	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
EPPK1	83481	hgsc.bcm.edu	37	8	144940482	144940482	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr8:144940482A>G	ENST00000525985.1	-	2	7011	c.6940T>C	c.(6940-6942)Tac>Cac	p.Y2314H				P58107	EPIPL_HUMAN	epiplakin 1	2314						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCCCGGTGTAGGGGTCGGTG	0.711																																					p.Y2314H		Atlas-SNP	.											.	EPPK1	199	.	0			c.T6940C						PASS	.						190.0	184.0	186.0					8																	144940482		2184	4264	6448	SO:0001583	missense	83481	exon1			CGGTGTAGGGGTC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6940T>C	chr8.hg19:g.144940482A>G	ENSP00000436337:p.Tyr2314His	352.0	0.0	.		336.0	27.0	.	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	A	19.61	3.860098	0.71834	.	.	ENSG00000227184	ENST00000525985	T	0.69040	-0.37	4.63	4.63	0.57726	.	.	.	.	.	T	0.78666	0.4319	M	0.74881	2.28	0.27571	N	0.949888	D	0.60575	0.988	D	0.74674	0.984	T	0.69289	-0.5184	9	0.20046	T	0.44	.	12.1078	0.53821	1.0:0.0:0.0:0.0	.	2314	E9PPU0	.	H	2314	ENSP00000436337:Y2314H	ENSP00000436337:Y2314H	Y	-	1	0	EPPK1	145012470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.597000	0.54031	1.957000	0.56846	0.477000	0.44152	TAC	.	.	.	none		0.711	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
NTRK2	4915	hgsc.bcm.edu	37	9	87342656	87342656	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:87342656C>G	ENST00000323115.4	+	8	1294	c.941C>G	c.(940-942)gCg>gGg	p.A314G	NTRK2_ENST00000359847.3_Missense_Mutation_p.A314G|NTRK2_ENST00000376213.1_Missense_Mutation_p.A314G|NTRK2_ENST00000395866.2_Missense_Mutation_p.A158G|NTRK2_ENST00000304053.6_Missense_Mutation_p.A314G|NTRK2_ENST00000376208.1_Missense_Mutation_p.A314G|NTRK2_ENST00000376214.1_Missense_Mutation_p.A314G|NTRK2_ENST00000395882.1_Missense_Mutation_p.A314G|NTRK2_ENST00000277120.3_Missense_Mutation_p.A314G			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	314	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCCAAACCAGCGCTTCAGTGG	0.443										TSP Lung(25;0.17)																											p.A314G		Atlas-SNP	.											.	NTRK2	331	.	0			c.C941G						PASS	.						94.0	96.0	95.0					9																	87342656		2203	4300	6503	SO:0001583	missense	4915	exon9			AACCAGCGCTTCA	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.941C>G	chr9.hg19:g.87342656C>G	ENSP00000314586:p.Ala314Gly	94.0	0.0	.		87.0	33.0	.	NM_001018065	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	hg19	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321558	0.60634	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.385251	0.29900	N	0.010905	T	0.58090	0.2098	N	0.14661	0.345	0.30052	N	0.811719	B;B;B;B;B;B;B;B	0.27316	0.045;0.009;0.009;0.011;0.11;0.011;0.175;0.009	B;B;B;B;B;B;B;B	0.36766	0.064;0.022;0.022;0.039;0.232;0.043;0.148;0.023	T	0.52351	-0.8587	10	0.23891	T	0.37	.	20.2873	0.98536	0.0:1.0:0.0:0.0	.	158;314;314;314;314;314;360;314	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	G	314;314;314;314;314;314;314;314;158	ENSP00000365387:A314G;ENSP00000365386:A314G;ENSP00000379221:A314G;ENSP00000365381:A314G;ENSP00000306167:A314G;ENSP00000277120:A314G;ENSP00000314586:A314G;ENSP00000352906:A314G;ENSP00000379207:A158G	ENSP00000277120:A314G	A	+	2	0	NTRK2	86532476	0.561000	0.26578	1.000000	0.80357	0.998000	0.95712	2.910000	0.48766	2.799000	0.96334	0.585000	0.79938	GCG	.	.	.	none		0.443	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
CYLC2	1539	hgsc.bcm.edu	37	9	105767702	105767702	+	Missense_Mutation	SNP	T	T	A	rs2298052	byFrequency	TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr9:105767702T>A	ENST00000374798.3	+	5	859	c.789T>A	c.(787-789)gaT>gaA	p.D263E	CYLC2_ENST00000487798.1_Missense_Mutation_p.D263E	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	263	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D263D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				CCAAGAAAGATGCAAAGGAGA	0.388																																					p.D263E		Atlas-SNP	.											CYLC2,NS,carcinoma,0,1	CYLC2	109	.	1	Substitution - coding silent(1)	stomach(1)	c.T789A						PASS	.						117.0	112.0	114.0					9																	105767702		2203	4300	6503	SO:0001583	missense	1539	exon5			GAAAGATGCAAAG	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.789T>A	chr9.hg19:g.105767702T>A	ENSP00000420256:p.Asp263Glu	71.0	0.0	.		70.0	14.0	.	NM_001340	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	ENST00000374798.3	hg19	CCDS35085.1	.	.	.	.	.	.	.	.	.	.	T	2.261	-0.369199	0.05069	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.14022	2.54;2.54	4.21	-5.98	0.02220	.	1.421110	0.04878	N	0.447237	T	0.06050	0.0157	L	0.29908	0.895	0.80722	P	0.0	B	0.23891	0.093	B	0.23574	0.047	T	0.37244	-0.9714	9	0.02654	T	1	-0.742	0.3139	0.00292	0.3842:0.1819:0.2128:0.221	.	263	Q14093	CYLC2_HUMAN	E	263	ENSP00000420256:D263E;ENSP00000417674:D263E	ENSP00000420256:D263E	D	+	3	2	CYLC2	104807523	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-0.647000	0.05397	-0.974000	0.03550	0.477000	0.44152	GAT	.	T|0.972;C|0.028	.	alt		0.388	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340	
DDB1	1642	hgsc.bcm.edu	37	11	61077796	61077796	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr11:61077796A>G	ENST00000301764.7	-	19	2769	c.2372T>C	c.(2371-2373)cTa>cCa	p.L791P	DDB1_ENST00000450997.2_Missense_Mutation_p.L102P	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	791	Interaction with CDT1 and CUL4A.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						AATGATAAGTAGGTTGTGCAC	0.507								Nucleotide excision repair (NER)																													p.L791P		Atlas-SNP	.											.	DDB1	100	.	0			c.T2372C						PASS	.						137.0	119.0	125.0					11																	61077796		2203	4299	6502	SO:0001583	missense	1642	exon19			ATAAGTAGGTTGT	AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2372T>C	chr11.hg19:g.61077796A>G	ENSP00000301764:p.Leu791Pro	103.0	0.0	.		95.0	4.0	.	NM_001923	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	ENST00000301764.7	hg19	CCDS31576.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.963370	0.92791	.	.	ENSG00000167986	ENST00000301764;ENST00000450997;ENST00000543658;ENST00000535147	T;T;T	0.50813	0.73;1.23;0.73	5.87	5.87	0.94306	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72145	0.3424	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76509	-0.2933	10	0.87932	D	0	-20.9791	16.5764	0.84681	1.0:0.0:0.0:0.0	.	102;791	B4DG00;Q16531	.;DDB1_HUMAN	P	791;102;102;258	ENSP00000301764:L791P;ENSP00000388705:L102P;ENSP00000445844:L102P	ENSP00000301764:L791P	L	-	2	0	DDB1	60834372	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	CTA	.	.	.	none		0.507	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398816.1	NM_001923	
PCF11	51585	hgsc.bcm.edu	37	11	82875304	82875304	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr11:82875304C>T	ENST00000298281.4	+	4	1015	c.563C>T	c.(562-564)cCt>cTt	p.P188L		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	188					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						ATCTCCACTCCTCCAATTGTT	0.393																																					p.P188L		Atlas-SNP	.											.	PCF11	220	.	0			c.C563T						PASS	.						64.0	59.0	60.0					11																	82875304		1868	4092	5960	SO:0001583	missense	51585	exon4			CCACTCCTCCAAT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.563C>T	chr11.hg19:g.82875304C>T	ENSP00000298281:p.Pro188Leu	57.0	0.0	.		53.0	14.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.462969	0.63513	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.49432	1.74;0.78;0.79	5.73	5.73	0.89815	.	0.118143	0.39687	N	0.001292	T	0.36580	0.0972	L	0.36672	1.1	0.80722	D	1	P;B	0.35328	0.495;0.421	B;B	0.28849	0.095;0.058	T	0.13176	-1.0519	9	.	.	.	.	15.3998	0.74830	0.0:0.8614:0.1386:0.0	.	188;188	E9PQ01;O94913	.;PCF11_HUMAN	L	188	ENSP00000298281:P188L;ENSP00000434540:P188L;ENSP00000431567:P188L	.	P	+	2	0	PCF11	82552952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.304000	0.65744	2.710000	0.92621	0.650000	0.86243	CCT	.	.	.	none		0.393	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
RIMKLB	57494	hgsc.bcm.edu	37	12	8906675	8906675	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr12:8906675G>T	ENST00000538135.1	+	5	1508	c.683G>T	c.(682-684)aGc>aTc	p.S228I	RIMKLB_ENST00000535829.1_Missense_Mutation_p.S228I|RIMKLB_ENST00000357529.3_Missense_Mutation_p.S228I|RIMKLB_ENST00000299673.5_3'UTR			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	228	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGAATGCAAAGCAACTGCTCA	0.383																																					p.S228I		Atlas-SNP	.											.	RIMKLB	47	.	0			c.G683T						PASS	.						155.0	137.0	143.0					12																	8906675		1908	4124	6032	SO:0001583	missense	57494	exon6			TGCAAAGCAACTG	AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.683G>T	chr12.hg19:g.8906675G>T	ENSP00000440943:p.Ser228Ile	158.0	0.0	.		139.0	7.0	.	NM_020734	B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	ENST00000538135.1	hg19	CCDS41748.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477042	0.84640	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	4.82	4.82	0.62117	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	U	0.000000	D	0.84584	0.5504	M	0.89534	3.04	0.80722	D	1	D;D	0.69078	0.997;0.993	D;D	0.69824	0.966;0.94	D	0.88278	0.2934	9	0.87932	D	0	.	16.8175	0.85738	0.0:0.0:1.0:0.0	.	228;228	Q9ULI2-2;Q9ULI2	.;RIMKB_HUMAN	I	228	.	ENSP00000350136:S228I	S	+	2	0	RIMKLB	8797942	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.835000	0.92100	2.375000	0.81037	0.585000	0.79938	AGC	.	.	.	none		0.383	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398874.1	NM_020734	
PAN2	9924	hgsc.bcm.edu	37	12	56720460	56720460	+	Silent	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr12:56720460T>C	ENST00000425394.2	-	7	1579	c.1203A>G	c.(1201-1203)ccA>ccG	p.P401P	PAN2_ENST00000548043.1_Silent_p.P401P|PAN2_ENST00000257931.5_Silent_p.P401P|PAN2_ENST00000440411.3_Silent_p.P401P	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	CAGTGGTGAGTGGGACAGGGA	0.597																																					p.P401P		Atlas-SNP	.											.	PAN2	107	.	0			c.A1203G						PASS	.						70.0	61.0	64.0					12																	56720460		2203	4300	6503	SO:0001819	synonymous_variant	9924	exon7			GGTGAGTGGGACA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1203A>G	chr12.hg19:g.56720460T>C		51.0	0.0	.		47.0	22.0	.	NM_014871		Silent	SNP	ENST00000425394.2	hg19	CCDS44922.1																																																																																			.	.	.	none		0.597	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72017888	72017888	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr12:72017888A>T	ENST00000378743.3	-	23	4860	c.4502T>A	c.(4501-4503)tTa>tAa	p.L1501*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1501					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCTTACCTGTAAAATTGCCAG	0.358																																					p.L1501X		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.T4502A						PASS	.						153.0	145.0	147.0					12																	72017888		1838	4095	5933	SO:0001587	stop_gained	196441	exon23			ACCTGTAAAATTG	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4502T>A	chr12.hg19:g.72017888A>T	ENSP00000368017:p.Leu1501*	243.0	0.0	.		218.0	40.0	.	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	A	45	11.914642	0.99617	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4122	0.74937	1.0:0.0:0.0:0.0	.	.	.	.	X	1501	.	ENSP00000368017:L1501X	L	-	2	0	ZFC3H1	70304155	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.262000	0.89862	2.038000	0.60285	0.533000	0.62120	TTA	.	.	.	none		0.358	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
THBS1	7057	hgsc.bcm.edu	37	15	39882095	39882095	+	Silent	SNP	C	C	G			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr15:39882095C>G	ENST00000260356.5	+	13	2181	c.2016C>G	c.(2014-2016)ccC>ccG	p.P672P		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	672	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ATAGCGACCCCATGTACCGCT	0.607																																					p.P672P		Atlas-SNP	.											.	THBS1	106	.	0			c.C2016G						PASS	.						111.0	92.0	99.0					15																	39882095		2200	4297	6497	SO:0001819	synonymous_variant	7057	exon13			CGACCCCATGTAC		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2016C>G	chr15.hg19:g.39882095C>G		48.0	0.0	.		48.0	9.0	.	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	hg19	CCDS32194.1																																																																																			.	.	.	none		0.607	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
ZNF532	55205	hgsc.bcm.edu	37	18	56586514	56586514	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr18:56586514C>T	ENST00000336078.4	+	4	1771	c.995C>T	c.(994-996)cCg>cTg	p.P332L	ZNF532_ENST00000589288.1_Missense_Mutation_p.P332L|ZNF532_ENST00000591808.1_Missense_Mutation_p.P332L|ZNF532_ENST00000591083.1_Missense_Mutation_p.P332L|ZNF532_ENST00000591230.1_Missense_Mutation_p.P332L	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	332					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CTGAAGCAACCGGATAGTCCC	0.522																																					p.P332L		Atlas-SNP	.											.	ZNF532	108	.	0			c.C995T						PASS	.						97.0	100.0	99.0					18																	56586514		2203	4300	6503	SO:0001583	missense	55205	exon4			AGCAACCGGATAG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.995C>T	chr18.hg19:g.56586514C>T	ENSP00000338217:p.Pro332Leu	139.0	0.0	.		152.0	61.0	.	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	hg19	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	c	14.64	2.595026	0.46318	.	.	ENSG00000074657	ENST00000336078	T	0.02158	4.42	4.97	4.97	0.65823	.	0.114354	0.64402	N	0.000009	T	0.05456	0.0144	M	0.76574	2.34	0.80722	D	1	D	0.58620	0.983	B	0.41135	0.348	T	0.24657	-1.0154	10	0.87932	D	0	-11.3748	17.8864	0.88856	0.0:1.0:0.0:0.0	.	332	Q9HCE3	ZN532_HUMAN	L	332	ENSP00000338217:P332L	ENSP00000338217:P332L	P	+	2	0	ZNF532	54737494	1.000000	0.71417	0.494000	0.27515	0.027000	0.11550	7.737000	0.84957	2.320000	0.78422	0.550000	0.68814	CCG	.	.	.	none		0.522	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
LMNB2	84823	hgsc.bcm.edu	37	19	2435072	2435072	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:2435072T>C	ENST00000582871.1	-	5	808	c.722A>G	c.(721-723)gAg>gGg	p.E241G	LMNB2_ENST00000325327.3_Missense_Mutation_p.E261G	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	241	Coil 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCAGCTCCTCCAGCGCCTG	0.701																																					p.E261G		Atlas-SNP	.											.	LMNB2	40	.	0			c.A782G						PASS	.						37.0	39.0	38.0					19																	2435072		2200	4299	6499	SO:0001583	missense	84823	exon5			AGCTCCTCCAGCG	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.722A>G	chr19.hg19:g.2435072T>C	ENSP00000462730:p.Glu241Gly	101.0	0.0	.		90.0	4.0	.	NM_032737	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	ENST00000582871.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.18	3.050050	0.55218	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.83	4.83	0.62350	Filament (1);	0.116455	0.64402	D	0.000017	T	0.56529	0.1991	L	0.47016	1.485	0.46149	D	0.998892	B	0.09022	0.002	B	0.16722	0.016	T	0.57505	-0.7800	9	0.72032	D	0.01	.	13.2379	0.59979	0.0:0.0:0.0:1.0	.	241	Q03252	LMNB2_HUMAN	G	241	.	ENSP00000327054:E241G	E	-	2	0	LMNB2	2386072	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.335000	0.52105	1.807000	0.52817	0.459000	0.35465	GAG	.	.	.	none		0.701	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737	
ZFP36	7538	hgsc.bcm.edu	37	19	39898403	39898403	+	Silent	SNP	T	T	C			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:39898403T>C	ENST00000248673.3	+	2	103	c.45T>C	c.(43-45)ccT>ccC	p.P15P	ZFP36_ENST00000594045.1_3'UTR|ZFP36_ENST00000597629.1_Silent_p.P21P|MIR4530_ENST00000581459.1_RNA	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	15					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGCTGAGCCCTGACGTGCCCG	0.667																																					p.P21P	NSCLC(67;1164 1324 12056 21056 30097)	Atlas-SNP	.											.	ZFP36	19	.	0			c.T63C						PASS	.						102.0	114.0	110.0					19																	39898403		2202	4298	6500	SO:0001819	synonymous_variant	7538	exon2			GAGCCCTGACGTG	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.45T>C	chr19.hg19:g.39898403T>C		331.0	0.0	.		295.0	105.0	.	NM_003407	B2RA54	Silent	SNP	ENST00000248673.3	hg19																																																																																				.	.	.	none		0.667	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ATP1B1	481	hgsc.bcm.edu	37	1	169076130	169076130	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr1:169076130delG	ENST00000367816.1	+	2	592	c.63delG	c.(61-63)aagfs	p.K22fs	RP5-1018K9.1_ENST00000415637.1_RNA|ATP1B1_ENST00000367815.4_Frame_Shift_Del_p.K22fs|ATP1B1_ENST00000499679.3_5'Flank			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	22					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					ACTCAGAGAAGAAGGAGTTTC	0.657																																					p.K21fs		Atlas-INDEL	.											.	ATP1B1	29	.	0			c.62delA						PASS	.						51.0	57.0	55.0					1																	169076130		2203	4300	6503	SO:0001589	frameshift_variant	481	exon1			.	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.63delG	chr1.hg19:g.169076130delG	ENSP00000356790:p.Lys22fs	44.0	0.0	0		42.0	10.0	0.238095	NM_001677	Q5TGZ3	Frame_Shift_Del	DEL	ENST00000367816.1	hg19	CCDS1276.1																																																																																			.	.	.	none		0.657	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
ZNF440	126070	hgsc.bcm.edu	37	19	11943483	11943485	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-BQ-7050-01A-11D-1961-08	TCGA-BQ-7050-11A-01D-1961-08	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b6b349c-fb1d-44a6-abcf-da2951066a9b	ecae3b13-cf72-4058-8385-cb3bf34bec83	g.chr19:11943483_11943485delGTT	ENST00000304060.5	+	4	1656_1658	c.1492_1494delGTT	c.(1492-1494)gttdel	p.V498del		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TCCTTCAGTAGTTCCAGTTCCTT	0.404																																					p.497_498del		Atlas-INDEL	.											.	ZNF440	56	.	0			c.1491_1493del						PASS	.																																			SO:0001651	inframe_deletion	126070	exon4			.	AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.1492_1494delGTT	chr19.hg19:g.11943483_11943485delGTT	ENSP00000305373:p.Val498del	81.0	0.0	0		45.0	18.0	0.4	NM_152357	Q8N1R9	In_Frame_Del	DEL	ENST00000304060.5	hg19	CCDS42503.1																																																																																			.	.	.	none		0.404	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344508.1	NM_152357	
