#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	hgsc.bcm.edu	37	1	2436173	2436173	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:2436173G>A	ENST00000419816.2	+	22	4046	c.3772G>A	c.(3772-3774)Ggc>Agc	p.G1258S	PLCH2_ENST00000449969.1_3'UTR|PLCH2_ENST00000378486.3_Missense_Mutation_p.G1258S|PLCH2_ENST00000378488.3_Missense_Mutation_p.G1222S			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1258					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CAAGAGCCTGGGCGACCTCAC	0.701																																					p.G1258S		Atlas-SNP	.											.	PLCH2	131	.	0			c.G3772A						PASS	.						28.0	34.0	32.0					1																	2436173		2066	4170	6236	SO:0001583	missense	9651	exon22			AGCCTGGGCGACC	AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3772G>A	chr1.hg19:g.2436173G>A	ENSP00000389803:p.Gly1258Ser	46.0	0.0	.		48.0	19.0	.	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.88|18.88	3.718362|3.718362	0.68844|0.68844	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000378486;ENST00000378488;ENST00000278878|ENST00000419816	T;T|.	0.76578|.	-0.69;-1.03|.	4.41|4.41	4.41|4.41	0.53225|0.53225	.|.	1.629000|.	0.03724|.	N|.	0.252361|.	T|.	0.74504|.	0.3725|.	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|.	0.76214|.	-0.3041|.	10|.	0.87932|.	D|.	0|.	.|.	15.9517|15.9517	0.79843|0.79843	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1010;1258|.	B9DI82;O75038|.	.;PLCH2_HUMAN|.	S|X	1258;1222;1010|552	ENSP00000367747:G1258S;ENSP00000367749:G1222S|.	ENSP00000278878:G1010S|.	G|W	+|+	1|3	0|0	PLCH2|PLCH2	2426033|2426033	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.712000|0.712000	0.41017|0.41017	5.901000|5.901000	0.69861|0.69861	1.999000|1.999000	0.58509|0.58509	0.491000|0.491000	0.48974|0.48974	GGC|TGG	.	.	.	none		0.701	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
HSPG2	3339	hgsc.bcm.edu	37	1	22214014	22214014	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:22214014C>A	ENST00000374695.3	-	8	936	c.857G>T	c.(856-858)gGg>gTg	p.G286V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	286	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CTCCTGGGGCCCACAGGGCAG	0.657																																					p.G286V		Atlas-SNP	.											.	HSPG2	311	.	0			c.G857T						PASS	.						67.0	82.0	77.0					1																	22214014		2203	4299	6502	SO:0001583	missense	3339	exon8			TGGGGCCCACAGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.857G>T	chr1.hg19:g.22214014C>A	ENSP00000363827:p.Gly286Val	70.0	0.0	.		80.0	37.0	.	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.61|18.61	3.661500|3.661500	0.67700|0.67700	.|.	.|.	ENSG00000142798|ENSG00000142798	ENST00000412328;ENST00000374673|ENST00000374695	T;D|D	0.95918|0.95853	0.35;-3.85|-3.83	5.09|5.09	3.22|3.22	0.36961|0.36961	.|.	0.178923|0.178923	0.27027|0.27027	N|N	0.021295|0.021295	D|D	0.94771|0.94771	0.8312|0.8312	M|M	0.80183|0.80183	2.485|2.485	0.52501|0.52501	D|D	0.999955|0.999955	D|P	0.89917|0.36683	1.0|0.565	D|B	0.69479|0.41374	0.964|0.355	D|D	0.91702|0.91702	0.5374|0.5374	10|10	0.59425|0.38643	D|T	0.04|0.18	.|.	9.1776|9.1776	0.37120|0.37120	0.0:0.8213:0.0:0.1787|0.0:0.8213:0.0:0.1787	.|.	209|286	Q5SZI5|P98160	.|PGBM_HUMAN	C|V	209;113|286	ENSP00000405412:G209C;ENSP00000363805:G113C|ENSP00000363827:G286V	ENSP00000363805:G113C|ENSP00000363827:G286V	G|G	-|-	1|2	0|0	HSPG2|HSPG2	22086601|22086601	0.001000|0.001000	0.12720|0.12720	0.995000|0.995000	0.50966|0.50966	0.549000|0.549000	0.35272|0.35272	0.204000|0.204000	0.17335|0.17335	0.566000|0.566000	0.29273|0.29273	0.462000|0.462000	0.41574|0.41574	GGC|GGG	.	.	.	none		0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HIVEP3	59269	hgsc.bcm.edu	37	1	42048585	42048585	+	Silent	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:42048585A>T	ENST00000372583.1	-	4	2769	c.1884T>A	c.(1882-1884)ctT>ctA	p.L628L	HIVEP3_ENST00000429157.2_Silent_p.L628L|HIVEP3_ENST00000247584.5_Silent_p.L628L|HIVEP3_ENST00000372584.1_Silent_p.L628L	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	628	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCTTTTTGGTAAGCTCGCTTT	0.493																																					p.L628L		Atlas-SNP	.											.	HIVEP3	235	.	0			c.T1884A						PASS	.						123.0	120.0	121.0					1																	42048585		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			TTTGGTAAGCTCG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1884T>A	chr1.hg19:g.42048585A>T		183.0	0.0	.		152.0	61.0	.	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.	.	none		0.493	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
CYP4A11	1579	hgsc.bcm.edu	37	1	47402352	47402352	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:47402352G>C	ENST00000310638.4	-	4	525	c.494C>G	c.(493-495)tCt>tGt	p.S165C	CYP4A11_ENST00000371905.1_Missense_Mutation_p.S165C|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371904.4_Missense_Mutation_p.S165C|CYP4A11_ENST00000457840.2_Missense_Mutation_p.S61C|CYP4A11_ENST00000462347.1_Missense_Mutation_p.S165C	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	165					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CACTCGTACAGAGTCTGCCAT	0.562																																					p.S165C		Atlas-SNP	.											CYP4A11,NS,carcinoma,0,1	CYP4A11	77	.	0			c.C494G						PASS	.						88.0	70.0	76.0					1																	47402352		2203	4300	6503	SO:0001583	missense	1579	exon4			CGTACAGAGTCTG	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.494C>G	chr1.hg19:g.47402352G>C	ENSP00000311095:p.Ser165Cys	79.0	0.0	.		62.0	23.0	.	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	hg19	CCDS543.1	.	.	.	.	.	.	.	.	.	.	N	18.30	3.593520	0.66219	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905;ENST00000457840	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	L	0.48642	1.525	0.41496	D	0.988252	P	0.45768	0.866	P	0.53988	0.739	T	0.71517	-0.4569	10	0.45353	T	0.12	.	15.1292	0.72507	0.0:0.1409:0.859:0.0	.	165	Q02928	CP4AB_HUMAN	C	165;165;165;61	ENSP00000311095:S165C;ENSP00000360971:S165C;ENSP00000360972:S165C;ENSP00000406272:S61C	ENSP00000311095:S165C	S	-	2	0	CYP4A11	47174939	1.000000	0.71417	0.448000	0.26945	0.053000	0.15095	4.950000	0.63603	2.640000	0.89533	0.644000	0.83932	TCT	.	.	.	none		0.562	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
ZCCHC11	23318	hgsc.bcm.edu	37	1	52902541	52902541	+	Silent	SNP	G	G	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:52902541G>T	ENST00000371544.3	-	26	4307	c.4045C>A	c.(4045-4047)Cga>Aga	p.R1349R	ZCCHC11_ENST00000257177.4_Silent_p.R1350R	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1349					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						CTAAAGTCTCGAGTATCGTGG	0.483																																					p.R1350R		Atlas-SNP	.											.	ZCCHC11	151	.	0			c.C4048A						PASS	.						185.0	188.0	187.0					1																	52902541		2203	4300	6503	SO:0001819	synonymous_variant	23318	exon26			AGTCTCGAGTATC	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4045C>A	chr1.hg19:g.52902541G>T		178.0	0.0	.		160.0	72.0	.	NM_001009881	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Silent	SNP	ENST00000371544.3	hg19	CCDS30716.1	.	.	.	.	.	.	.	.	.	.	G	8.051	0.765950	0.15983	.	.	ENSG00000134744	ENST00000474453	.	.	.	3.77	2.84	0.33178	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.7235	0.34456	0.0:0.0:0.7739:0.2261	.	.	.	.	X	194	.	.	S	-	2	0	ZCCHC11	52675129	1.000000	0.71417	0.958000	0.39756	0.893000	0.52053	1.976000	0.40579	1.155000	0.42497	0.655000	0.94253	TCG	.	.	.	none		0.483	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
CEP350	9857	hgsc.bcm.edu	37	1	180000535	180000535	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:180000535A>C	ENST00000367607.3	+	15	4049	c.3631A>C	c.(3631-3633)Aaa>Caa	p.K1211Q		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1211	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCAAGGAAAGAAATCTGGGAC	0.398																																					p.K1211Q		Atlas-SNP	.											.	CEP350	418	.	0			c.A3631C						PASS	.						50.0	52.0	51.0					1																	180000535		2203	4300	6503	SO:0001583	missense	9857	exon15			GGAAAGAAATCTG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3631A>C	chr1.hg19:g.180000535A>C	ENSP00000356579:p.Lys1211Gln	36.0	0.0	.		38.0	16.0	.	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.816051	0.90790	.	.	ENSG00000135837	ENST00000367607	T	0.59906	0.23	6.02	6.02	0.97574	.	0.000000	0.49916	D	0.000133	T	0.66616	0.2807	L	0.32530	0.975	0.42214	D	0.991828	D;D	0.76494	0.999;0.998	D;P	0.78314	0.991;0.796	T	0.64884	-0.6302	9	.	.	.	.	16.2108	0.82158	1.0:0.0:0.0:0.0	.	1211;1211	E7EU22;Q5VT06	.;CE350_HUMAN	Q	1211	ENSP00000356579:K1211Q	.	K	+	1	0	CEP350	178267158	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.354000	0.73036	2.299000	0.77371	0.528000	0.53228	AAA	.	.	.	none		0.398	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
PTPN14	5784	hgsc.bcm.edu	37	1	214556993	214556993	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:214556993G>A	ENST00000366956.5	-	13	2399	c.2205C>T	c.(2203-2205)gcC>gcT	p.A735A	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	735					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CCTGCAGCTGGGCACTGTACT	0.632																																					p.A735A	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.C2205T						PASS	.						35.0	41.0	39.0					1																	214556993		2201	4295	6496	SO:0001819	synonymous_variant	5784	exon13			CAGCTGGGCACTG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2205C>T	chr1.hg19:g.214556993G>A		78.0	0.0	.		67.0	30.0	.	NM_005401	Q5VSI0	Silent	SNP	ENST00000366956.5	hg19	CCDS1514.1																																																																																			.	.	.	none		0.632	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
SULT1C4	27233	hgsc.bcm.edu	37	2	109002781	109002781	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:109002781T>C	ENST00000272452.2	+	6	1075	c.749T>C	c.(748-750)aTt>aCt	p.I250T	SULT1C4_ENST00000409309.3_Missense_Mutation_p.I175T	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	250					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						TATTCATCGATTCCTGCTGAA	0.299																																					p.I250T		Atlas-SNP	.											.	SULT1C4	41	.	0			c.T749C						PASS	.						92.0	89.0	90.0					2																	109002781		2203	4300	6503	SO:0001583	missense	27233	exon6			CATCGATTCCTGC	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.749T>C	chr2.hg19:g.109002781T>C	ENSP00000272452:p.Ile250Thr	111.0	0.0	.		119.0	59.0	.	NM_006588	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	hg19	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502652	0.26949	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	D;D	0.82344	-1.6;-1.6	4.69	3.51	0.40186	Sulfotransferase domain (1);	0.823783	0.10424	N	0.676268	T	0.81034	0.4739	L	0.39147	1.195	0.09310	N	1	P;B	0.39480	0.675;0.05	P;B	0.47603	0.551;0.131	T	0.69650	-0.5088	10	0.54805	T	0.06	.	6.7246	0.23348	0.1598:0.0:0.1461:0.6941	.	175;250	Q08AS5;O75897	.;ST1C4_HUMAN	T	250;175	ENSP00000272452:I250T;ENSP00000387225:I175T	ENSP00000272452:I250T	I	+	2	0	SULT1C4	108369213	0.086000	0.21541	0.001000	0.08648	0.087000	0.18053	3.039000	0.49791	0.904000	0.36572	0.496000	0.49642	ATT	.	.	.	none		0.299	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr2:178098803C>A	ENST00000397062.3	-	2	796	c.242G>T	c.(241-243)gGt>gTt	p.G81V	NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65V|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65V|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65V|NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65V	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.G81V		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,-1,11	NFE2L2	225	.	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)	c.G242T						PASS	.						143.0	142.0	142.0					2																	178098803		1901	4105	6006	SO:0001583	missense	4780	exon2			AATTCACCTGTCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>T	chr2.hg19:g.178098803C>A	ENSP00000380252:p.Gly81Val	68.0	0.0	.		98.0	51.0	.	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.883817|4.883817	0.91814|0.91814	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.52983	.|1.19;1.19;1.19;0.64;0.64;1.19	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75110	.|0.3805	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;1.0;0.999	.|T	.|0.78563	.|-0.2156	.|10	.|0.87932	.|D	.|0	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|V	-1|65;81;65;65;65;65	.|ENSP00000380253:G65V;ENSP00000380252:G81V;ENSP00000411575:G65V;ENSP00000400073:G65V;ENSP00000412191:G65V;ENSP00000410015:G65V	.|ENSP00000380252:G81V	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	.	.	.	none		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
SLC22A13	9390	hgsc.bcm.edu	37	3	38317429	38317429	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:38317429T>C	ENST00000311856.4	+	7	1128	c.1079T>C	c.(1078-1080)cTg>cCg	p.L360P	SLC22A13_ENST00000450935.2_3'UTR	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	360					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		GACTTCGGCCTGGACGTCTAT	0.572																																					p.L360P		Atlas-SNP	.											.	SLC22A13	42	.	0			c.T1079C						PASS	.						80.0	77.0	78.0					3																	38317429		2203	4300	6503	SO:0001583	missense	9390	exon7			TCGGCCTGGACGT	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.1079T>C	chr3.hg19:g.38317429T>C	ENSP00000310241:p.Leu360Pro	77.0	0.0	.		77.0	29.0	.	NM_004256	B2RCV9|Q8IYG1	Missense_Mutation	SNP	ENST00000311856.4	hg19	CCDS2676.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652783	0.67472	.	.	ENSG00000172940	ENST00000311856	T	0.62639	0.01	5.04	5.04	0.67666	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	T	0.81408	0.4816	M	0.91196	3.185	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.70227	0.945;0.968	T	0.82623	-0.0366	10	0.28530	T	0.3	.	14.2827	0.66224	0.0:0.0:0.0:1.0	.	360;360	Q9Y226-2;Q9Y226	.;S22AD_HUMAN	P	360	ENSP00000310241:L360P	ENSP00000310241:L360P	L	+	2	0	SLC22A13	38292433	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	5.806000	0.69150	2.040000	0.60383	0.533000	0.62120	CTG	.	.	.	none		0.572	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253746.2	NM_004256	
SACM1L	22908	hgsc.bcm.edu	37	3	45773632	45773632	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:45773632A>T	ENST00000389061.5	+	13	1293	c.1089A>T	c.(1087-1089)caA>caT	p.Q363H	SACM1L_ENST00000541314.1_Missense_Mutation_p.Q302H|SACM1L_ENST00000418611.1_Missense_Mutation_p.Q260H	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	363	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		CAGAAATGCAAGATGAATTAA	0.338																																					p.Q363H		Atlas-SNP	.											.	SACM1L	38	.	0			c.A1089T						PASS	.						105.0	115.0	112.0					3																	45773632		2203	4299	6502	SO:0001583	missense	22908	exon13			AATGCAAGATGAA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.1089A>T	chr3.hg19:g.45773632A>T	ENSP00000373713:p.Gln363His	151.0	0.0	.		146.0	69.0	.	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	hg19	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391717	0.42410	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314;ENST00000433336	T;T;T;T	0.43294	0.95;0.95;0.95;1.53	5.99	-5.27	0.02763	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.88031	2.925	0.52501	D	0.999958	D;D	0.76494	0.999;0.998	D;D	0.65987	0.94;0.912	T	0.68716	-0.5335	10	0.36615	T	0.2	-3.4019	15.7038	0.77563	0.4825:0.0:0.5175:0.0	.	302;363	B4DK71;Q9NTJ5	.;SAC1_HUMAN	H	260;363;302;40	ENSP00000396387:Q260H;ENSP00000373713:Q363H;ENSP00000443373:Q302H;ENSP00000412883:Q40H	ENSP00000373713:Q363H	Q	+	3	2	SACM1L	45748636	0.993000	0.37304	0.874000	0.34290	0.998000	0.95712	0.423000	0.21313	-1.249000	0.02500	0.533000	0.62120	CAA	.	.	.	none		0.338	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
SLC38A3	10991	hgsc.bcm.edu	37	3	50252997	50252997	+	RNA	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:50252997T>C	ENST00000420502.1	+	0	548									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		TATGAGCAGCTGGGCTACCGT	0.622																																					p.L132P		Atlas-SNP	.											.	SLC38A3	22	.	0			c.T395C						PASS	.						47.0	51.0	50.0					3																	50252997		2095	4216	6311			10991	exon6			AGCAGCTGGGCTA	U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		chr3.hg19:g.50252997T>C		85.0	0.0	.		65.0	29.0	.	NM_006841		Missense_Mutation	SNP	ENST00000420502.1	hg19																																																																																				.	.	.	none		0.622	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000345635.2	NM_006841	
PPM1M	132160	hgsc.bcm.edu	37	3	52282683	52282683	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:52282683C>T	ENST00000296487.4	+	7	866	c.462C>T	c.(460-462)ctC>ctT	p.L154L	PPM1M_ENST00000323588.4_Silent_p.L154L|PPM1M_ENST00000457351.2_Silent_p.L315L|PPM1M_ENST00000409502.3_Silent_p.L103L			Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1M	154	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			prostate(1)|urinary_tract(1)	2				BRCA - Breast invasive adenocarcinoma(193;2.4e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)		AATCGGATCTCAAGTACCCAC	0.572																																					p.L315L	NSCLC(151;810 2688 34365 49863)	Atlas-SNP	.											.	PPM1M	9	.	0			c.C945T						PASS	.						156.0	139.0	145.0					3																	52282683		2203	4300	6503	SO:0001819	synonymous_variant	132160	exon7			GGATCTCAAGTAC	AK096681	CCDS46840.1	3p21.31	2012-04-17	2010-03-05		ENSG00000164088	ENSG00000164088		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26506	protein-coding gene	gene with protein product	"""protein phosphatase 2C eta"""	608979	"""protein phosphatase 1M (PP2C domain containing)"""			12477932	Standard	NM_001122870		Approved	PP2Ceta, FLJ32332	uc011bed.2	Q96MI6	OTTHUMG00000153046	ENST00000296487.4:c.462C>T	chr3.hg19:g.52282683C>T		140.0	0.0	.		150.0	70.0	.	NM_144641	Q8N8J9|Q96DB8	Silent	SNP	ENST00000296487.4	hg19		.	.	.	.	.	.	.	.	.	.	C	9.454	1.091407	0.20471	.	.	ENSG00000164088	ENST00000457454	.	.	.	4.78	3.9	0.45041	.	.	.	.	.	T	0.58337	0.2115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54957	-0.8215	4	.	.	.	.	8.0844	0.30762	0.0:0.7542:0.1611:0.0848	.	.	.	.	L	210	.	.	S	+	2	0	PPM1M	52257723	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.991000	0.29654	1.205000	0.43262	0.561000	0.74099	TCA	.	.	.	none		0.572	PPM1M-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000329230.2	NM_144641	
SLMAP	7871	hgsc.bcm.edu	37	3	57827089	57827089	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:57827089T>C	ENST00000428312.1	+	3	504	c.410T>C	c.(409-411)cTc>cCc	p.L137P	SLMAP_ENST00000295951.3_Missense_Mutation_p.L137P|SLMAP_ENST00000449503.2_Missense_Mutation_p.L137P|SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000295952.3_Missense_Mutation_p.L137P|SLMAP_ENST00000383718.3_Missense_Mutation_p.L137P			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	137	Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GAAGCCCGGCTCCGCTCAGAG	0.338																																					p.L137P		Atlas-SNP	.											.	SLMAP	46	.	0			c.T410C						PASS	.						67.0	70.0	69.0					3																	57827089		2203	4300	6503	SO:0001583	missense	7871	exon3			CCCGGCTCCGCTC	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.410T>C	chr3.hg19:g.57827089T>C	ENSP00000398661:p.Leu137Pro	73.0	0.0	.		81.0	39.0	.	NM_007159	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	ENST00000428312.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.27	1.589587	0.28357	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	T;T;T;T;T	0.47177	1.45;1.45;0.85;1.44;1.49	4.85	4.85	0.62838	.	0.259220	0.31438	N	0.007646	T	0.24586	0.0596	N	0.01874	-0.695	0.80722	D	1	P;P;P;B	0.50369	0.816;0.934;0.898;0.002	P;B;B;B	0.45712	0.491;0.418;0.434;0.005	T	0.11299	-1.0593	10	0.26408	T	0.33	-2.0339	10.587	0.45288	0.0:0.0:0.1615:0.8385	.	137;137;137;137	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	P	137	ENSP00000295951:L137P;ENSP00000295952:L137P;ENSP00000373224:L137P;ENSP00000398661:L137P;ENSP00000412945:L137P	ENSP00000295951:L137P	L	+	2	0	SLMAP	57802129	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.864000	0.69575	1.799000	0.52666	0.533000	0.62120	CTC	.	.	.	none		0.338	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
KIAA1524	57650	hgsc.bcm.edu	37	3	108282018	108282018	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:108282018C>A	ENST00000295746.8	-	13	1665	c.1589G>T	c.(1588-1590)aGa>aTa	p.R530I	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.R371I	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	530					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R530T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CAATAATATTCTCAGTCCAGA	0.393																																					p.R530I		Atlas-SNP	.											KIAA1524,colon,carcinoma,+1,1	KIAA1524	82	.	1	Substitution - Missense(1)	ovary(1)	c.G1589T						PASS	.						154.0	159.0	158.0					3																	108282018		2203	4300	6503	SO:0001583	missense	57650	exon13			AATATTCTCAGTC	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1589G>T	chr3.hg19:g.108282018C>A	ENSP00000295746:p.Arg530Ile	252.0	0.0	.		204.0	74.0	.	NM_020890	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	ENST00000295746.8	hg19	CCDS33812.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770678	0.69992	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.35048	1.33;1.33	5.3	4.43	0.53597	.	0.494865	0.23127	N	0.051633	T	0.40067	0.1102	L	0.53249	1.67	0.53005	D	0.999964	P	0.46706	0.883	P	0.46172	0.506	T	0.31024	-0.9958	10	0.62326	D	0.03	-4.6479	11.7182	0.51666	0.0:0.8541:0.0:0.1459	.	530	Q8TCG1	CIP2A_HUMAN	I	371;530	ENSP00000419487:R371I;ENSP00000295746:R530I	ENSP00000295746:R530I	R	-	2	0	KIAA1524	109764708	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.617000	0.46385	1.237000	0.43756	0.563000	0.77884	AGA	.	.	.	none		0.393	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353975.2	NM_020890	
ZNF721	170960	hgsc.bcm.edu	37	4	436019	436019	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:436019A>C	ENST00000338977.5	-	2	2249	c.2201T>G	c.(2200-2202)aTt>aGt	p.I734S	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000511833.2_Missense_Mutation_p.I746S|ZNF721_ENST00000506646.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	734					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TCCAGTATGAATTTTCTTATA	0.378																																					p.T746R		Atlas-SNP	.											.	ZNF721	205	.	0			c.C2237G						PASS	.						31.0	33.0	32.0					4																	436019		1990	4173	6163	SO:0001583	missense	170960	exon3			GTATGAATTTTCT	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2201T>G	chr4.hg19:g.436019A>C	ENSP00000340524:p.Ile734Ser	29.0	0.0	.		33.0	12.0	.	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	hg19		.	.	.	.	.	.	.	.	.	.	A	10.61	1.397775	0.25205	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.00949	5.51;5.51	1.28	-0.782	0.10961	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01558	0.0050	L	0.52266	1.64	0.09310	N	1	P;P;P	0.41569	0.65;0.755;0.711	P;B;B	0.47102	0.537;0.239;0.154	T	0.44651	-0.9314	9	0.56958	D	0.05	.	4.9522	0.14021	0.6885:0.3115:0.0:0.0	.	734;746;746	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	S	734;746	ENSP00000340524:I734S;ENSP00000428878:I746S	ENSP00000340524:I734S	I	-	2	0	ZNF721	426019	0.000000	0.05858	0.003000	0.11579	0.055000	0.15305	0.796000	0.26986	-0.422000	0.07405	0.155000	0.16302	ATT	.	.	.	none		0.378	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
NSUN7	79730	hgsc.bcm.edu	37	4	40778094	40778094	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:40778094C>A	ENST00000381782.2	+	7	1349	c.854C>A	c.(853-855)tCt>tAt	p.S285Y	NSUN7_ENST00000316607.5_Missense_Mutation_p.S285Y|NSUN7_ENST00000463952.1_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	285							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GCTGTCCATTCTGTAAAGGCT	0.333																																					p.S285Y		Atlas-SNP	.											.	NSUN7	70	.	0			c.C854A						PASS	.						92.0	92.0	92.0					4																	40778094		2202	4298	6500	SO:0001583	missense	79730	exon7			TCCATTCTGTAAA	BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.854C>A	chr4.hg19:g.40778094C>A	ENSP00000371201:p.Ser285Tyr	52.0	0.0	.		41.0	19.0	.	NM_024677	C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	ENST00000381782.2	hg19	CCDS3461.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318911	0.81469	.	.	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.09163	3.01;3.01	5.61	5.61	0.85477	.	0.180007	0.49305	D	0.000151	T	0.31918	0.0812	L	0.59436	1.845	0.51767	D	0.999938	D;D	0.71674	0.997;0.998	D;D	0.72075	0.931;0.976	T	0.00666	-1.1619	10	0.66056	D	0.02	-20.3807	19.2661	0.93985	0.0:1.0:0.0:0.0	.	285;285	Q8NE18;Q8NE18-2	NSUN7_HUMAN;.	Y	285	ENSP00000371201:S285Y;ENSP00000319127:S285Y	ENSP00000319127:S285Y	S	+	2	0	NSUN7	40472851	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.610000	0.67668	2.643000	0.89663	0.557000	0.71058	TCT	.	.	.	none		0.333	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250454.2	NM_024677	
POLR2B	5431	hgsc.bcm.edu	37	4	57891054	57891054	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr4:57891054A>G	ENST00000381227.1	+	23	3380	c.2967A>G	c.(2965-2967)gtA>gtG	p.V989V	POLR2B_ENST00000314595.5_Silent_p.V989V|POLR2B_ENST00000431623.2_Silent_p.V914V|POLR2B_ENST00000441246.2_Silent_p.V982V			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	989					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TTTAAAAGGTATCGGCTAACA	0.313																																					p.V989V		Atlas-SNP	.											.	POLR2B	108	.	0			c.A2967G						PASS	.						118.0	119.0	119.0					4																	57891054		2203	4300	6503	SO:0001819	synonymous_variant	5431	exon22			AAAGGTATCGGCT		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.2967A>G	chr4.hg19:g.57891054A>G		91.0	0.0	.		86.0	38.0	.	NM_000938	A8K1A8|Q8IZ61	Silent	SNP	ENST00000381227.1	hg19	CCDS3511.1																																																																																			.	.	.	none		0.313	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
DHX29	54505	hgsc.bcm.edu	37	5	54591351	54591351	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:54591351A>G	ENST00000251636.5	-	5	655	c.507T>C	c.(505-507)gaT>gaC	p.D169D	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	169						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CAGGAAGTGCATCTTAAAATA	0.348																																					p.D169D		Atlas-SNP	.											.	DHX29	116	.	0			c.T507C						PASS	.						73.0	74.0	74.0					5																	54591351		2203	4300	6503	SO:0001630	splice_region_variant	54505	exon5			AAGTGCATCTTAA	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.506-1T>C	chr5.hg19:g.54591351A>G		67.0	0.0	.		58.0	24.0	.	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Silent	SNP	ENST00000251636.5	hg19	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781171	0.31502	.	.	ENSG00000067248	ENST00000508346	.	.	.	5.95	3.44	0.39384	.	.	.	.	.	T	0.57873	0.2083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53746	-0.8395	4	.	.	.	.	8.1903	0.31363	0.7953:0.1348:0.07:0.0	.	.	.	.	R	134	.	.	C	-	1	0	DHX29	54627108	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.848000	0.39309	1.075000	0.40932	0.528000	0.53228	TGC	.	.	.	none		0.348	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	Silent
CTNNA1	1495	hgsc.bcm.edu	37	5	138268291	138268291	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:138268291G>A	ENST00000302763.7	+	17	2413	c.2323G>A	c.(2323-2325)Gac>Aac	p.D775N	CTNNA1_ENST00000355078.5_Missense_Mutation_p.D672N|CTNNA1_ENST00000518825.1_Missense_Mutation_p.D775N|CTNNA1_ENST00000540387.1_Missense_Mutation_p.D405N	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	775					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTGCAAGCAGGACCTGCTGGC	0.607																																					p.D775N		Atlas-SNP	.											.	CTNNA1	114	.	0			c.G2323A						PASS	.						53.0	46.0	49.0					5																	138268291		2203	4300	6503	SO:0001583	missense	1495	exon17			AAGCAGGACCTGC	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2323G>A	chr5.hg19:g.138268291G>A	ENSP00000304669:p.Asp775Asn	43.0	0.0	.		34.0	19.0	.	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	hg19	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	G	35	5.472975	0.96274	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	M	0.65677	2.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.977	D;D;P	0.87578	0.996;0.998;0.893	T	0.45614	-0.9249	10	0.13108	T	0.6	-22.7863	19.2223	0.93803	0.0:0.0:1.0:0.0	.	775;652;775	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	N	672;775;775;760;775;405	ENSP00000347190:D672N;ENSP00000304669:D775N;ENSP00000427821:D775N;ENSP00000438476:D405N	ENSP00000304669:D775N	D	+	1	0	CTNNA1	138296190	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.635000	0.98437	2.873000	0.98535	0.563000	0.77884	GAC	.	.	.	none		0.607	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
ANKHD1	54882	hgsc.bcm.edu	37	5	139864824	139864824	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:139864824T>C	ENST00000360839.2	+	12	2143	c.1989T>C	c.(1987-1989)caT>caC	p.H663H	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.H663H|ANKHD1_ENST00000297183.6_Silent_p.H663H	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	663						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTACTCATCGACTCAAGG	0.498																																					p.H663H		Atlas-SNP	.											.	ANKHD1	233	.	0			c.T1989C						PASS	.						85.0	75.0	78.0					5																	139864824		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon12			TACTCATCGACTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.1989T>C	chr5.hg19:g.139864824T>C		49.0	0.0	.		46.0	18.0	.	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	hg19	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	T	9.851	1.193672	0.22037	.	.	ENSG00000131503	ENST00000246149	.	.	.	5.29	2.6	0.31112	.	.	.	.	.	T	0.58864	0.2152	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54807	-0.8238	4	.	.	.	.	9.6999	0.40180	0.0:0.2399:0.0:0.7601	.	.	.	.	T	158	.	.	I	+	2	0	ANKHD1	139845008	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.439000	0.44846	0.939000	0.37446	0.459000	0.35465	ATC	.	.	.	none		0.498	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
TMCO6	55374	hgsc.bcm.edu	37	5	140021512	140021512	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr5:140021512G>A	ENST00000394671.3	+	4	473	c.372G>A	c.(370-372)ctG>ctA	p.L124L	TMCO6_ENST00000511410.1_3'UTR|TMCO6_ENST00000252100.6_Silent_p.L124L|NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000537378.1_Intron	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	124					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGCCCTGCTGCAGCTTGAGG	0.622																																					p.L124L		Atlas-SNP	.											.	TMCO6	30	.	0			c.G372A						PASS	.						40.0	45.0	44.0					5																	140021512		2033	4188	6221	SO:0001819	synonymous_variant	55374	exon4			CCTGCTGCAGCTT	BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.372G>A	chr5.hg19:g.140021512G>A		88.0	0.0	.		89.0	37.0	.	NM_018502	Q9BUU0|Q9P198	Silent	SNP	ENST00000394671.3	hg19	CCDS4233.2																																																																																			.	.	.	none		0.622	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251666.2	NM_018502	
C6orf47	57827	hgsc.bcm.edu	37	6	31627425	31627425	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:31627425A>G	ENST00000375911.1	-	1	1124	c.300T>C	c.(298-300)acT>acC	p.T100T	C6orf47-AS1_ENST00000422049.1_RNA	NM_021184.3	NP_067007.3	O95873	CF047_HUMAN	chromosome 6 open reading frame 47	100						cytoplasm (GO:0005737)				NS(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9						CAGACTCTTGAGTGCTAGAGA	0.577																																					p.T100T		Atlas-SNP	.											.	C6orf47	15	.	0			c.T300C						PASS	.						61.0	65.0	64.0					6																	31627425		1510	2708	4218	SO:0001819	synonymous_variant	57827	exon1			CTCTTGAGTGCTA	AF129756	CCDS34399.1	6p21.3	2011-12-13			ENSG00000204439	ENSG00000204439			19076	protein-coding gene	gene with protein product						2477242	Standard	NM_021184		Approved	D6S53E, G4	uc003nvm.1	O95873	OTTHUMG00000031172	ENST00000375911.1:c.300T>C	chr6.hg19:g.31627425A>G		83.0	0.0	.		86.0	35.0	.	NM_021184	B0UXA1|B0UZ50|Q5SSS6|Q95IG0	Silent	SNP	ENST00000375911.1	hg19	CCDS34399.1																																																																																			.	.	.	none		0.577	C6orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076324.1	NM_021184	
PHF1	5252	hgsc.bcm.edu	37	6	33380325	33380325	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:33380325A>T	ENST00000374516.3	+	3	471	c.200A>T	c.(199-201)gAt>gTt	p.D67V	PHF1_ENST00000374512.3_Missense_Mutation_p.D67V|PHF1_ENST00000459809.1_3'UTR	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	67	Tudor.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				CAGTTTGAGGATGATTCGCAG	0.478																																					p.D67V		Atlas-SNP	.											.	PHF1	42	.	0			c.A200T						PASS	.						166.0	162.0	163.0					6																	33380325		2203	4300	6503	SO:0001583	missense	5252	exon3			TTGAGGATGATTC	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.200A>T	chr6.hg19:g.33380325A>T	ENSP00000363640:p.Asp67Val	146.0	0.0	.		114.0	45.0	.	NM_024165	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	hg19	CCDS4777.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967657	0.74131	.	.	ENSG00000112511	ENST00000427004;ENST00000428274;ENST00000374512;ENST00000374516	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.58	4.58	0.56647	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.73651	0.3614	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.99	T	0.77910	-0.2411	10	0.87932	D	0	-21.3302	11.944	0.52918	1.0:0.0:0.0:0.0	.	67;67	O43189-2;O43189	.;PHF1_HUMAN	V	67	ENSP00000410494:D67V;ENSP00000392697:D67V;ENSP00000363636:D67V;ENSP00000363640:D67V	ENSP00000363636:D67V	D	+	2	0	PHF1	33488303	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	8.976000	0.93442	1.928000	0.55862	0.460000	0.39030	GAT	.	.	.	none		0.478	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3		
GUCA1B	2979	hgsc.bcm.edu	37	6	42152609	42152609	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:42152609C>A	ENST00000230361.3	-	4	642	c.547G>T	c.(547-549)Gac>Tac	p.D183Y		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	183					body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			GGATTCATGTCCATCTGCAGC	0.587																																					p.D183Y		Atlas-SNP	.											.	GUCA1B	19	.	0			c.G547T						PASS	.						131.0	112.0	118.0					6																	42152609		2203	4300	6503	SO:0001583	missense	2979	exon4			TCATGTCCATCTG	AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.547G>T	chr6.hg19:g.42152609C>A	ENSP00000230361:p.Asp183Tyr	112.0	0.0	.		89.0	46.0	.	NM_002098	Q9NU15	Missense_Mutation	SNP	ENST00000230361.3	hg19	CCDS4865.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274245	0.80580	.	.	ENSG00000112599	ENST00000230361	T	0.53640	0.61	4.36	4.36	0.52297	EF-hand-like domain (1);	0.102162	0.64402	D	0.000004	T	0.38719	0.1051	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.52711	-0.8539	10	0.54805	T	0.06	.	15.1849	0.72993	0.0:1.0:0.0:0.0	.	183	Q9UMX6	GUC1B_HUMAN	Y	183	ENSP00000230361:D183Y	ENSP00000230361:D183Y	D	-	1	0	GUCA1B	42260587	1.000000	0.71417	0.992000	0.48379	0.874000	0.50279	5.791000	0.69045	2.361000	0.80049	0.655000	0.94253	GAC	.	.	.	none		0.587	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040550.1	NM_002098	
SYNJ2	8871	hgsc.bcm.edu	37	6	158450005	158450005	+	Silent	SNP	C	C	T	rs372960799		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr6:158450005C>T	ENST00000355585.4	+	3	507	c.432C>T	c.(430-432)gtC>gtT	p.V144V	SYNJ2_ENST00000367122.2_Silent_p.V144V|SYNJ2_ENST00000367121.3_Silent_p.V144V|SYNJ2_ENST00000449859.2_Silent_p.V93V	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	144	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		ACCTGACTGTCCGCACGCAGA	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16943	0.0		0.0	False		,,,				2504	0.0				p.V144V		Atlas-SNP	.											.	SYNJ2	111	.	0			c.C432T						PASS	.	C	,	1,4405	2.1+/-5.4	0,1,2202	65.0	67.0	66.0		,432	-0.5	0.7	6		66	0,8600		0,0,4300	no	utr-5,coding-synonymous	SYNJ2	NM_001178088.1,NM_003898.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	,144/1497	158450005	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8871	exon3			GACTGTCCGCACG	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.432C>T	chr6.hg19:g.158450005C>T		76.0	0.0	.		89.0	34.0	.	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	ENST00000355585.4	hg19	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	C	0.979	-0.697726	0.03279	2.27E-4	0.0	ENSG00000078269	ENST00000367113	.	.	.	4.62	-0.532	0.11890	.	.	.	.	.	T	0.45875	0.1364	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51857	-0.8652	4	.	.	.	.	11.4359	0.50068	0.0:0.2478:0.6114:0.1408	.	.	.	.	F	119	.	.	S	+	2	0	SYNJ2	158369993	0.753000	0.28349	0.672000	0.29872	0.084000	0.17831	0.009000	0.13219	1.108000	0.41662	0.655000	0.94253	TCC	.	.	.	weak		0.582	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
ARMC10	83787	hgsc.bcm.edu	37	7	102724230	102724230	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:102724230A>G	ENST00000323716.3	+	3	738	c.346A>G	c.(346-348)Aga>Gga	p.R116G	ARMC10_ENST00000441711.2_Missense_Mutation_p.R81G|ARMC10_ENST00000454559.1_Missense_Mutation_p.R81G|ARMC10_ENST00000541300.1_Missense_Mutation_p.R81G|ARMC10_ENST00000428183.2_Missense_Mutation_p.R116G|ARMC10_ENST00000425331.1_Missense_Mutation_p.R81G	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	116					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						AATTATTGAAAGAGCTTTGAT	0.398																																					p.R116G		Atlas-SNP	.											.	ARMC10	25	.	0			c.A346G						PASS	.						94.0	96.0	95.0					7																	102724230		2203	4300	6503	SO:0001583	missense	83787	exon3			ATTGAAAGAGCTT	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.346A>G	chr7.hg19:g.102724230A>G	ENSP00000319412:p.Arg116Gly	76.0	0.0	.		98.0	32.0	.	NM_031905	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	hg19	CCDS5728.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017384	0.54576	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153	T;T;T;T;T;T;T	0.47869	1.5;1.6;1.5;1.6;1.5;1.6;0.83	5.28	4.11	0.48088	Armadillo-like helical (1);Armadillo-type fold (1);	0.413848	0.28209	N	0.016195	T	0.54464	0.1860	L	0.59436	1.845	0.23809	N	0.996789	P;B;B;D;P;P	0.58268	0.741;0.039;0.096;0.982;0.852;0.863	P;B;B;P;B;P	0.54889	0.497;0.05;0.073;0.763;0.436;0.627	T	0.47799	-0.9089	10	0.49607	T	0.09	-8.0575	9.962	0.41701	0.6711:0.3289:0.0:0.0	.	81;81;81;116;81;116	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	G	116;116;81;81;81;81;116	ENSP00000319412:R116G;ENSP00000396654:R116G;ENSP00000413619:R81G;ENSP00000405612:R81G;ENSP00000397969:R81G;ENSP00000440463:R81G;ENSP00000398201:R116G	ENSP00000319412:R116G	R	+	1	2	ARMC10	102511466	0.988000	0.35896	0.991000	0.47740	0.941000	0.58515	1.811000	0.38942	0.948000	0.37687	0.456000	0.33151	AGA	.	.	.	none		0.398	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905	
RP1	6101	hgsc.bcm.edu	37	8	55534829	55534829	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:55534829A>G	ENST00000220676.1	+	3	916	c.768A>G	c.(766-768)gcA>gcG	p.A256A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	256					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGGGAAATGCAAAGTCAGAAA	0.403																																					p.A256A	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.A768G						PASS	.						78.0	80.0	80.0					8																	55534829		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon3			AAATGCAAAGTCA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.768A>G	chr8.hg19:g.55534829A>G		51.0	0.0	.		51.0	18.0	.	NM_006269		Silent	SNP	ENST00000220676.1	hg19	CCDS6160.1																																																																																			.	.	.	none		0.403	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SLC45A4	57210	hgsc.bcm.edu	37	8	142238284	142238284	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:142238284G>A	ENST00000024061.3	-	1	389	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	SLC45A4_ENST00000519067.1_Nonsense_Mutation_p.Q28*|SLC45A4_ENST00000517878.1_Intron|SLC45A4_ENST00000433583.2_Intron	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			TAACCTTTCTGAAGACTCCAT	0.537																																					p.Q28X		Atlas-SNP	.											.	SLC45A4	71	.	0			c.C82T						PASS	.						191.0	177.0	181.0					8																	142238284		2203	4300	6503	SO:0001587	stop_gained	57210	exon1			CTTTCTGAAGACT	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.82C>T	chr8.hg19:g.142238284G>A	ENSP00000024061:p.Gln28*	217.0	0.0	.		187.0	83.0	.	NM_001080431	Q6ZRI2|Q9ULU3	Nonsense_Mutation	SNP	ENST00000024061.3	hg19	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134082	0.77662	.	.	ENSG00000022567	ENST00000519067;ENST00000024061	.	.	.	1.79	-1.83	0.07833	.	0.589005	0.15260	U	0.271852	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	4.245	0.10667	0.1675:0.4643:0.3682:0.0	.	.	.	.	X	28	.	ENSP00000024061:Q28X	Q	-	1	0	SLC45A4	142307466	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.632000	0.02024	-0.542000	0.06249	0.556000	0.70494	CAG	.	.	.	none		0.537	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
PITRM1	10531	hgsc.bcm.edu	37	10	3206029	3206029	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:3206029G>A	ENST00000224949.4	-	7	713	c.679C>T	c.(679-681)Cct>Tct	p.P227S	PITRM1-AS1_ENST00000601046.1_RNA|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.P227S|PITRM1_ENST00000451104.2_Missense_Mutation_p.P195S			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	227					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GTGTGGTCAGGAAGAAGTCTG	0.448																																					p.P227S		Atlas-SNP	.											.	PITRM1	109	.	0			c.C679T						PASS	.						124.0	122.0	123.0					10																	3206029		1934	4132	6066	SO:0001583	missense	10531	exon7			GGTCAGGAAGAAG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.679C>T	chr10.hg19:g.3206029G>A	ENSP00000224949:p.Pro227Ser	79.0	0.0	.		63.0	28.0	.	NM_014889	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	hg19	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	g	19.62	3.860856	0.71834	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.31247	1.5;1.5;1.5	5.7	5.7	0.88788	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.88241	2.94	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.995;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.927;0.947;1.0;0.998;0.998;0.998	T	0.70960	-0.4730	10	0.87932	D	0	.	19.8478	0.96722	0.0:0.0:1.0:0.0	.	220;195;227;227;227;220	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	S	227;220;227;195	ENSP00000224949:P227S;ENSP00000370377:P227S;ENSP00000401201:P195S	ENSP00000224949:P227S	P	-	1	0	PITRM1	3196029	1.000000	0.71417	0.997000	0.53966	0.075000	0.17131	9.162000	0.94745	2.698000	0.92095	0.655000	0.94253	CCT	.	.	.	none		0.448	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
NCOA4	8031	hgsc.bcm.edu	37	10	51586276	51586276	+	Silent	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:51586276A>T	ENST00000443446.1	+	9	1933	c.1704A>T	c.(1702-1704)gtA>gtT	p.V568V	NCOA4_ENST00000344348.6_Silent_p.V568V|NCOA4_ENST00000430396.2_Silent_p.V468V|NCOA4_ENST00000374082.1_Missense_Mutation_p.Y523F|NCOA4_ENST00000414907.2_Silent_p.V402V|NCOA4_ENST00000374087.4_Silent_p.V568V|NCOA4_ENST00000438493.1_Silent_p.V584V|NCOA4_ENST00000452682.1_Silent_p.V584V	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	568					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						TGCAGGAAGTATTACTTAATT	0.398			T	RET	papillary thyroid																																p.V584V		Atlas-SNP	.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4	58	.	0			c.A1752T						PASS	.						114.0	111.0	112.0					10																	51586276		2203	4300	6503	SO:0001819	synonymous_variant	8031	exon10			GGAAGTATTACTT	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1704A>T	chr10.hg19:g.51586276A>T		137.0	0.0	.		127.0	48.0	.	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Silent	SNP	ENST00000443446.1	hg19	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	A	3.664	-0.068949	0.07228	.	.	ENSG00000138293	ENST00000374082	T	0.26223	1.75	5.41	1.78	0.24846	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29181	-1.0020	6	0.02654	T	1	-2.9612	2.9009	0.05705	0.482:0.309:0.077:0.132	.	.	.	.	F	523	ENSP00000363195:Y523F	ENSP00000363195:Y523F	Y	+	2	0	NCOA4	51256282	0.994000	0.37717	0.999000	0.59377	0.958000	0.62258	0.292000	0.19011	0.141000	0.18875	0.533000	0.62120	TAT	.	.	.	none		0.398	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
PTEN	5728	hgsc.bcm.edu	37	10	89717669	89717669	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr10:89717669A>G	ENST00000371953.3	+	7	2051	c.694A>G	c.(694-696)Aca>Gca	p.T232A	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	232	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCAGGACCCACACGACGGGA	0.423		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.T232A		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.,1	PTEN	3652	.	48	Whole gene deletion(37)|Deletion - Frameshift(9)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)	c.A694G						PASS	.						155.0	133.0	140.0					10																	89717669		2203	4300	6503	SO:0001583	missense	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	GGACCCACACGAC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.694A>G	chr10.hg19:g.89717669A>G	ENSP00000361021:p.Thr232Ala	116.0	1.0	.		91.0	30.0	.	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.030305	0.35797	.	.	ENSG00000171862	ENST00000371953	D	0.85773	-2.03	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.158008	0.56097	D	0.000030	T	0.74711	0.3752	N	0.25647	0.755	0.51482	D	0.999926	B	0.16802	0.019	B	0.16289	0.015	T	0.68519	-0.5387	9	.	.	.	-10.0511	10.8662	0.46856	0.8504:0.0:0.0:0.1496	.	232	P60484	PTEN_HUMAN	A	232	ENSP00000361021:T232A	.	T	+	1	0	PTEN	89707649	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.612000	0.67681	1.928000	0.55862	0.477000	0.44152	ACA	.	.	.	none		0.423	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
DRD4	1815	hgsc.bcm.edu	37	11	639919	639919	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:639919G>A	ENST00000176183.5	+	3	682	c.670G>A	c.(670-672)Gtg>Atg	p.V224M		NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	224					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	GCGCTGGGAGGTGGCACGTCG	0.741																																					p.V224M		Atlas-SNP	.											.	DRD4	17	.	0			c.G670A						PASS	.						30.0	23.0	25.0					11																	639919		2194	4290	6484	SO:0001583	missense	1815	exon3			TGGGAGGTGGCAC	L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.670G>A	chr11.hg19:g.639919G>A	ENSP00000176183:p.Val224Met	39.0	0.0	.		33.0	15.0	.	NM_000797	B0M0J7|Q7Z7Q5|Q8NGM5	Missense_Mutation	SNP	ENST00000176183.5	hg19	CCDS7710.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506330	0.44558	.	.	ENSG00000069696	ENST00000176183	T	0.37915	1.17	2.79	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	0.391968	0.24476	N	0.038200	T	0.30916	0.0780	.	.	.	0.24791	N	0.992753	P	0.47604	0.898	B	0.42138	0.377	T	0.14811	-1.0459	9	0.56958	D	0.05	.	10.3373	0.43858	0.0:0.2038:0.7962:0.0	.	224	P21917	DRD4_HUMAN	M	224	ENSP00000176183:V224M	ENSP00000176183:V224M	V	+	1	0	DRD4	629919	1.000000	0.71417	0.365000	0.25901	0.758000	0.43043	4.570000	0.60872	0.461000	0.27071	0.313000	0.20887	GTG	.	.	.	none		0.741	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257109.1	NM_000797	
OR4A16	81327	hgsc.bcm.edu	37	11	55110978	55110978	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:55110978T>C	ENST00000314721.2	+	1	352	c.302T>C	c.(301-303)aTa>aCa	p.I101T		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CAGCTCTTCATAGAACACTTA	0.443																																					p.I101T		Atlas-SNP	.											.	OR4A16	120	.	0			c.T302C						PASS	.						203.0	189.0	193.0					11																	55110978		2201	4296	6497	SO:0001583	missense	81327	exon1			TCTTCATAGAACA	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.302T>C	chr11.hg19:g.55110978T>C	ENSP00000325128:p.Ile101Thr	317.0	0.0	.		268.0	22.0	.	NM_001005274	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	hg19	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	t	0.119	-1.128496	0.01756	.	.	ENSG00000181961	ENST00000314721	T	0.00864	5.6	2.57	1.45	0.22620	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	L	0.39085	1.19	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46317	-0.9200	9	0.20519	T	0.43	.	5.5053	0.16850	0.0:0.1562:0.0:0.8438	.	101	Q8NH70	O4A16_HUMAN	T	101	ENSP00000325128:I101T	ENSP00000325128:I101T	I	+	2	0	OR4A16	54867554	0.000000	0.05858	0.009000	0.14445	0.018000	0.09664	0.028000	0.13644	1.186000	0.42985	0.346000	0.21813	ATA	.	.	.	none		0.443	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
UBE4A	9354	hgsc.bcm.edu	37	11	118250228	118250228	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:118250228C>T	ENST00000431736.2	+	11	1732	c.1660C>T	c.(1660-1662)Cag>Tag	p.Q554*	UBE4A_ENST00000252108.3_Nonsense_Mutation_p.Q547*|UBE4A_ENST00000545354.1_Nonsense_Mutation_p.Q19*					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GCGGGATGCTCAGCAAAGTTC	0.493																																					p.Q554X		Atlas-SNP	.											.	UBE4A	97	.	0			c.C1660T						PASS	.						107.0	101.0	103.0					11																	118250228		2200	4296	6496	SO:0001587	stop_gained	9354	exon11			GATGCTCAGCAAA	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1660C>T	chr11.hg19:g.118250228C>T	ENSP00000387362:p.Gln554*	144.0	0.0	.		97.0	51.0	.	NM_004788		Nonsense_Mutation	SNP	ENST00000431736.2	hg19	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	40	8.417745	0.98803	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2921	19.4627	0.94924	0.0:1.0:0.0:0.0	.	.	.	.	X	547;554;19	.	ENSP00000252108:Q547X	Q	+	1	0	UBE4A	117755438	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.588000	0.87417	0.655000	0.94253	CAG	.	.	.	none		0.493	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
NLRX1	79671	hgsc.bcm.edu	37	11	119044337	119044337	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:119044337C>T	ENST00000409109.1	+	5	966	c.379C>T	c.(379-381)Ccc>Tcc	p.P127S	NLRX1_ENST00000474751.2_3'UTR|NLRX1_ENST00000409991.1_Missense_Mutation_p.P127S|NLRX1_ENST00000409265.4_Missense_Mutation_p.P127S|NLRX1_ENST00000292199.2_Missense_Mutation_p.P127S|NLRX1_ENST00000525863.1_Missense_Mutation_p.P127S	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	127	Required for interaction with MAVS.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ACTTCGCCCACCCGCGGAGCT	0.667																																					p.P127S		Atlas-SNP	.											.	NLRX1	128	.	0			c.C379T						PASS	.						43.0	44.0	44.0					11																	119044337		2200	4295	6495	SO:0001583	missense	79671	exon5			CGCCCACCCGCGG	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.379C>T	chr11.hg19:g.119044337C>T	ENSP00000387334:p.Pro127Ser	71.0	0.0	.		46.0	18.0	.	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	hg19	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.139675	0.00335	.	.	ENSG00000160703	ENST00000454811;ENST00000449394;ENST00000422249;ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T;T;T;T	0.69561	1.73;1.73;1.17;-0.31;-0.31;-0.41;-0.31;-0.41	5.6	-7.76	0.01232	.	1.215480	0.05625	N	0.580711	T	0.32406	0.0828	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.13953	-1.0490	10	0.18710	T	0.47	.	3.4574	0.07521	0.0971:0.1552:0.1941:0.5535	.	127;127	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	S	127	ENSP00000400268:P127S;ENSP00000402801:P127S;ENSP00000402381:P127S;ENSP00000386851:P127S;ENSP00000292199:P127S;ENSP00000386858:P127S;ENSP00000387334:P127S;ENSP00000433442:P127S	ENSP00000292199:P127S	P	+	1	0	NLRX1	118549547	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.553000	0.06012	-1.611000	0.01581	-0.459000	0.05422	CCC	.	.	.	none		0.667	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
TRIM29	23650	hgsc.bcm.edu	37	11	119988941	119988941	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:119988941G>A	ENST00000341846.5	-	7	2038	c.1617C>T	c.(1615-1617)ttC>ttT	p.F539F	TRIM29_ENST00000529044.1_Silent_p.F278F|TRIM29_ENST00000528870.1_Silent_p.F72F|TRIM29_ENST00000524816.3_Silent_p.F105F|TRIM29_ENST00000541857.1_Silent_p.F272F|TRIM29_ENST00000525887.1_5'UTR	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	539					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		CTTTCAGGGAGAAGGAGGAGC	0.592																																					p.F539F		Atlas-SNP	.											.	TRIM29	78	.	0			c.C1617T						PASS	.						100.0	85.0	90.0					11																	119988941		2199	4295	6494	SO:0001819	synonymous_variant	23650	exon7			CAGGGAGAAGGAG	AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1617C>T	chr11.hg19:g.119988941G>A		37.0	0.0	.		33.0	12.0	.	NM_012101	Q96AA9|Q9BZY7	Silent	SNP	ENST00000341846.5	hg19	CCDS8428.1	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089611	0.20390	.	.	ENSG00000137699	ENST00000525327;ENST00000524956	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	T	0.69187	0.3083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68135	-0.5489	4	.	.	.	.	13.87	0.63612	0.0:0.0:1.0:0.0	.	.	.	.	F	132;77	.	.	L	-	1	0	TRIM29	119494151	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.287000	0.51732	2.343000	0.79666	0.407000	0.27541	CTC	.	.	.	none		0.592	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277108.2	NM_012101	
FKBP4	2288	hgsc.bcm.edu	37	12	2909052	2909052	+	Silent	SNP	A	A	G	rs201311104		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:2909052A>G	ENST00000001008.4	+	6	895	c.708A>G	c.(706-708)caA>caG	p.Q236Q	RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	236	PPIase FKBP-type 2. {ECO:0000255|PROSITE- ProRule:PRU00277}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			AAAAGTTCCAAATCCCACCAA	0.438																																					p.Q236Q		Atlas-SNP	.											.	FKBP4	29	.	0			c.A708G						PASS	.						86.0	89.0	88.0					12																	2909052		2203	4300	6503	SO:0001819	synonymous_variant	2288	exon6			GTTCCAAATCCCA	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.708A>G	chr12.hg19:g.2909052A>G		39.0	0.0	.		33.0	19.0	.	NM_002014	D3DUQ1|Q9UCP1|Q9UCV7	Silent	SNP	ENST00000001008.4	hg19	CCDS8512.1																																																																																			.	A|0.999;G|0.001	0.001	weak		0.438	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		
DPPA3	359787	hgsc.bcm.edu	37	12	7867786	7867786	+	Silent	SNP	T	T	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:7867786T>A	ENST00000345088.2	+	2	207	c.90T>A	c.(88-90)tcT>tcA	p.S30S		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	30					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		CAGGGGCCTCTCAAATCTCCT	0.468																																					p.S30S		Atlas-SNP	.											.	DPPA3	26	.	0			c.T90A						PASS	.						122.0	136.0	131.0					12																	7867786		2203	4300	6503	SO:0001819	synonymous_variant	359787	exon2			GGCCTCTCAAATC	AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.90T>A	chr12.hg19:g.7867786T>A		235.0	0.0	.		223.0	102.0	.	NM_199286	Q0P5U3|Q6JZS6	Silent	SNP	ENST00000345088.2	hg19	CCDS8582.1																																																																																			.	.	.	none		0.468	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399718.1	NM_199286	
CNTN1	1272	hgsc.bcm.edu	37	12	41323760	41323760	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:41323760A>G	ENST00000551295.2	+	7	776	c.659A>G	c.(658-660)aAg>aGg	p.K220R	CNTN1_ENST00000360099.3_Missense_Mutation_p.K220R|CNTN1_ENST00000547849.1_Missense_Mutation_p.K220R|CNTN1_ENST00000547702.1_Missense_Mutation_p.K220R|CNTN1_ENST00000347616.1_Missense_Mutation_p.K220R|CNTN1_ENST00000348761.2_Missense_Mutation_p.K209R	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	220	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TCTATTACAAAGAGCGTGTTC	0.383																																					p.K220R		Atlas-SNP	.											.	CNTN1	207	.	0			c.A659G						PASS	.						174.0	169.0	171.0					12																	41323760		2203	4300	6503	SO:0001583	missense	1272	exon7			TTACAAAGAGCGT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.659A>G	chr12.hg19:g.41323760A>G	ENSP00000447006:p.Lys220Arg	219.0	0.0	.		210.0	85.0	.	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.375898	0.61735	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.39	5.39	0.77823	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.78534	0.4298	L	0.53671	1.685	0.58432	D	0.99999	P;P;D	0.53151	0.61;0.948;0.958	B;P;P	0.53593	0.298;0.611;0.73	T	0.77059	-0.2728	10	0.33141	T	0.24	.	15.7149	0.77661	1.0:0.0:0.0:0.0	.	220;209;220	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	R	220;220;220;220;220;209	ENSP00000448004:K220R;ENSP00000447006:K220R;ENSP00000448653:K220R;ENSP00000325660:K220R;ENSP00000353213:K220R;ENSP00000261160:K209R	ENSP00000325660:K220R	K	+	2	0	CNTN1	39610027	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.180000	0.69256	0.533000	0.62120	AAG	.	.	.	none		0.383	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
CCNT1	904	hgsc.bcm.edu	37	12	49087909	49087909	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:49087909G>T	ENST00000261900.3	-	9	1310	c.1088C>A	c.(1087-1089)tCc>tAc	p.S363Y		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	363					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						CTGTGGTAAGGAATGATCAAC	0.458																																					p.S363Y		Atlas-SNP	.											.	CCNT1	55	.	0			c.C1088A						PASS	.						177.0	170.0	172.0					12																	49087909		2203	4300	6503	SO:0001583	missense	904	exon9			GGTAAGGAATGAT	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1088C>A	chr12.hg19:g.49087909G>T	ENSP00000261900:p.Ser363Tyr	154.0	0.0	.		176.0	78.0	.	NM_001240	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	ENST00000261900.3	hg19	CCDS8766.1	.	.	.	.	.	.	.	.	.	.	G	14.46	2.543525	0.45280	.	.	ENSG00000129315	ENST00000261900	T	0.52057	0.68	5.49	4.54	0.55810	.	0.669254	0.16281	N	0.221349	T	0.44623	0.1302	N	0.22421	0.69	0.37399	D	0.912769	D	0.63880	0.993	P	0.50440	0.641	T	0.52815	-0.8525	10	0.56958	D	0.05	-7.9232	14.673	0.68958	0.0:0.1463:0.8536:0.0	.	363	O60563	CCNT1_HUMAN	Y	363	ENSP00000261900:S363Y	ENSP00000261900:S363Y	S	-	2	0	CCNT1	47374176	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.968000	0.56809	2.587000	0.87381	0.491000	0.48974	TCC	.	.	.	none		0.458	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
FREM2	341640	hgsc.bcm.edu	37	13	39450406	39450406	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr13:39450406T>G	ENST00000280481.7	+	20	8647	c.8431T>G	c.(8431-8433)Tat>Gat	p.Y2811D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2811					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTCAGGGACCTATACTGTGAA	0.448																																					p.Y2811D		Atlas-SNP	.											.	FREM2	385	.	0			c.T8431G						PASS	.						124.0	112.0	116.0					13																	39450406		2203	4300	6503	SO:0001583	missense	341640	exon20			GGGACCTATACTG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.8431T>G	chr13.hg19:g.39450406T>G	ENSP00000280481:p.Tyr2811Asp	97.0	0.0	.		82.0	42.0	.	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	T	18.86	3.712772	0.68730	.	.	ENSG00000150893	ENST00000280481	T	0.47528	0.84	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.73853	0.3640	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.79769	-0.1664	10	0.87932	D	0	.	15.9477	0.79806	0.0:0.0:0.0:1.0	.	2811	Q5SZK8	FREM2_HUMAN	D	2811	ENSP00000280481:Y2811D	ENSP00000280481:Y2811D	Y	+	1	0	FREM2	38348406	1.000000	0.71417	0.984000	0.44739	0.366000	0.29705	7.967000	0.87967	2.179000	0.69175	0.460000	0.39030	TAT	.	.	.	none		0.448	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
TEP1	7011	hgsc.bcm.edu	37	14	20845481	20845481	+	Silent	SNP	G	G	A	rs375172392		TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:20845481G>A	ENST00000262715.5	-	41	6086	c.6046C>T	c.(6046-6048)Cta>Tta	p.L2016L	TEP1_ENST00000556935.1_Silent_p.L1908L|TEP1_ENST00000545983.1_Silent_p.L354L	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2016					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GCCAGTCCTAGCACAGGCTTC	0.507																																					p.L2016L		Atlas-SNP	.											.	TEP1	224	.	0			c.C6046T						PASS	.						36.0	36.0	36.0					14																	20845481		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon41			GTCCTAGCACAGG		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.6046C>T	chr14.hg19:g.20845481G>A		41.0	0.0	.		49.0	22.0	.	NM_007110	A0AUV9	Silent	SNP	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.	.	alt		0.507	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
PNP	4860	hgsc.bcm.edu	37	14	20944608	20944608	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:20944608C>T	ENST00000361505.5	+	6	864	c.718C>T	c.(718-720)Ctc>Ttc	p.L240F	RP11-203M5.8_ENST00000554678.1_lincRNA	NM_000270.3	NP_000261.2	P01298	PAHO_HUMAN	purine nucleoside phosphorylase	0					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(2)	10						TGGCTTCTCACTCATCACTAA	0.458																																					p.L240F		Atlas-SNP	.											.	PNP	21	.	0			c.C718T						PASS	.						150.0	128.0	135.0					14																	20944608		2203	4300	6503	SO:0001583	missense	4860	exon6			TTCTCACTCATCA		CCDS9552.1	14q11.2	2014-09-17	2009-12-02	2009-12-02	ENSG00000198805	ENSG00000198805	2.4.2.1		7892	protein-coding gene	gene with protein product		164050	"""nucleoside phosphorylase"""	NP		6087295	Standard	NM_000270		Approved	PUNP	uc001vxo.4	P00491	OTTHUMG00000029546	ENST00000361505.5:c.718C>T	chr14.hg19:g.20944608C>T	ENSP00000354532:p.Leu240Phe	94.0	0.0	.		93.0	43.0	.	NM_000270		Missense_Mutation	SNP	ENST00000361505.5	hg19	CCDS9552.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542982	0.86022	.	.	ENSG00000198805	ENST00000361505	D	0.88046	-2.33	4.88	4.88	0.63580	Nucleoside phosphorylase domain (1);	0.064044	0.64402	D	0.000003	D	0.93762	0.8006	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94473	0.7686	10	0.72032	D	0.01	-21.5214	16.9641	0.86281	0.0:1.0:0.0:0.0	.	240	P00491	PNPH_HUMAN	F	240	ENSP00000354532:L240F	ENSP00000354532:L240F	L	+	1	0	PNP	20014448	0.999000	0.42202	0.994000	0.49952	0.951000	0.60555	4.327000	0.59247	2.528000	0.85240	0.655000	0.94253	CTC	.	.	.	none		0.458	PNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073646.2	NM_000270.2	
RNF31	55072	hgsc.bcm.edu	37	14	24626550	24626550	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:24626550C>T	ENST00000324103.6	+	15	2865	c.2545C>T	c.(2545-2547)Cgc>Tgc	p.R849C	RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.R324C|RNF31_ENST00000559275.1_Missense_Mutation_p.R698C|RNF31_ENST00000382687.3_Missense_Mutation_p.R698C|RNA5SP383_ENST00000362934.1_RNA	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	849					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GAACTGGAAACGCATGAACGA	0.567																																					p.R849C		Atlas-SNP	.											.	RNF31	95	.	0			c.C2545T						PASS	.						75.0	81.0	79.0					14																	24626550		1988	4157	6145	SO:0001583	missense	55072	exon15			TGGAAACGCATGA	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.2545C>T	chr14.hg19:g.24626550C>T	ENSP00000315112:p.Arg849Cys	37.0	0.0	.		28.0	16.0	.	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997602	0.54147	.	.	ENSG00000092098	ENST00000382682;ENST00000324103;ENST00000382687	T;T	0.77877	-1.13;-1.13	5.34	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.85296	0.5664	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.951;0.996;0.998	D	0.86555	0.1837	10	0.87932	D	0	-19.6302	12.2841	0.54783	0.308:0.692:0.0:0.0	.	849;608;849;698	A0A962;B3KV71;Q96EP0;Q96EP0-3	.;.;RNF31_HUMAN;.	C	282;849;698	ENSP00000315112:R849C;ENSP00000372134:R698C	ENSP00000315112:R849C	R	+	1	0	RNF31	23696390	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	0.675000	0.25232	1.467000	0.48044	-0.203000	0.12734	CGC	.	.	.	none		0.567	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
KIAA0391	9692	hgsc.bcm.edu	37	14	35592664	35592664	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:35592664T>G	ENST00000557565.1	+	2	594	c.213T>G	c.(211-213)gaT>gaG	p.D71E	KIAA0391_ENST00000603544.1_Missense_Mutation_p.D71E|KIAA0391_ENST00000250377.7_De_novo_Start_OutOfFrame|KIAA0391_ENST00000321130.10_Missense_Mutation_p.D71E|KIAA0391_ENST00000605870.1_Intron|PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000534898.4_Missense_Mutation_p.D71E|KIAA0391_ENST00000603588.1_Intron|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000604948.1_Intron	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	71					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TCAGGAAAGATGAGGGCAGTA	0.408																																					p.D71E		Atlas-SNP	.											.	KIAA0391	35	.	0			c.T213G						PASS	.						65.0	62.0	63.0					14																	35592664		2203	4300	6503	SO:0001583	missense	9692	exon2			GAAAGATGAGGGC	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.213T>G	chr14.hg19:g.35592664T>G	ENSP00000454657:p.Asp71Glu	61.0	0.0	.		52.0	25.0	.	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	hg19	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	T	2.705	-0.270055	0.05716	.	.	ENSG00000100890	ENST00000321130;ENST00000534898;ENST00000556121	T;T	0.40756	1.03;1.02	5.25	-5.42	0.02640	.	0.854894	0.10131	N	0.712121	T	0.21509	0.0518	N	0.22421	0.69	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18116	-1.0347	10	0.25751	T	0.34	-0.2169	6.1442	0.20276	0.2948:0.0:0.2418:0.4635	.	71;71	O15091-2;O15091	.;MRRP3_HUMAN	E	71	ENSP00000324697:D71E;ENSP00000440915:D71E	ENSP00000324697:D71E	D	+	3	2	KIAA0391	34662415	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.292000	0.08332	-1.164000	0.02790	-1.783000	0.00646	GAT	.	.	.	none		0.408	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
VTI1B	10490	hgsc.bcm.edu	37	14	68118141	68118141	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr14:68118141C>T	ENST00000554659.1	-	6	1001	c.660G>A	c.(658-660)ctG>ctA	p.L220L	ARG2_ENST00000261783.3_3'UTR	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	220					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		CCAGGCCTCCCAGGATGGCGA	0.453																																					p.L220L		Atlas-SNP	.											.	VTI1B	15	.	0			c.G660A						PASS	.						69.0	71.0	70.0					14																	68118141		2203	4300	6503	SO:0001819	synonymous_variant	10490	exon6			GCCTCCCAGGATG	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.660G>A	chr14.hg19:g.68118141C>T		98.0	0.0	.		89.0	48.0	.	NM_006370	O43547|Q96J28	Silent	SNP	ENST00000554659.1	hg19	CCDS9786.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.801303	0.70567	.	.	ENSG00000100568	ENST00000554636	.	.	.	6.17	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6819	0.28518	0.1315:0.7266:0.0:0.1419	.	.	.	.	X	98	.	.	W	-	2	0	VTI1B	67187894	0.123000	0.22298	1.000000	0.80357	0.996000	0.88848	-0.529000	0.06186	1.560000	0.49568	0.655000	0.94253	TGG	.	.	.	none		0.453	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412558.2		
SIN3A	25942	hgsc.bcm.edu	37	15	75664533	75664533	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:75664533G>A	ENST00000394947.3	-	21	3923	c.3609C>T	c.(3607-3609)agC>agT	p.S1203S	RP11-817O13.8_ENST00000563278.1_lincRNA|SIN3A_ENST00000394949.4_Silent_p.S1203S|SIN3A_ENST00000360439.4_Silent_p.S1203S	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						GTAGACGCTTGCTTACACGCT	0.433																																					p.S1203S		Atlas-SNP	.											.	SIN3A	152	.	0			c.C3609T						PASS	.						109.0	105.0	106.0					15																	75664533		2197	4294	6491	SO:0001819	synonymous_variant	25942	exon21			ACGCTTGCTTACA	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3609C>T	chr15.hg19:g.75664533G>A		151.0	0.0	.		135.0	47.0	.	NM_001145358		Silent	SNP	ENST00000394947.3	hg19	CCDS10279.1																																																																																			.	.	.	none		0.433	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
TICRR	90381	hgsc.bcm.edu	37	15	90138745	90138745	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:90138745T>C	ENST00000268138.7	+	7	1908	c.1803T>C	c.(1801-1803)gaT>gaC	p.D601D	TICRR_ENST00000560985.1_Silent_p.D600D			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	601					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCAGTCCGGATGTGGCTGGGG	0.443																																					p.D601D		Atlas-SNP	.											.	.	.	.	0			c.T1803C						PASS	.						112.0	107.0	108.0					15																	90138745		1888	4113	6001	SO:0001819	synonymous_variant	90381	exon7			TCCGGATGTGGCT	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1803T>C	chr15.hg19:g.90138745T>C		119.0	0.0	.		88.0	40.0	.	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	hg19	CCDS10352.2																																																																																			.	.	.	none		0.443	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
SPAG5	10615	hgsc.bcm.edu	37	17	26911390	26911390	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:26911390A>G	ENST00000321765.5	-	12	2602	c.2270T>C	c.(2269-2271)cTc>cCc	p.L757P		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	757	Gln-rich.|Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					AAGCTGGCAGAGTAACTCATC	0.522																																					p.L757P		Atlas-SNP	.											.	SPAG5	92	.	0			c.T2270C						PASS	.						218.0	200.0	206.0					17																	26911390		2203	4300	6503	SO:0001583	missense	10615	exon12			TGGCAGAGTAACT	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2270T>C	chr17.hg19:g.26911390A>G	ENSP00000323300:p.Leu757Pro	291.0	0.0	.		368.0	253.0	.	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	hg19	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.998487	0.54147	.	.	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	6.02	6.02	0.97574	.	0.363685	0.23744	N	0.044981	T	0.64394	0.2594	L	0.34521	1.04	0.48901	D	0.999721	D	0.76494	0.999	D	0.66497	0.944	T	0.65030	-0.6267	9	0.49607	T	0.09	-0.4993	12.9338	0.58303	1.0:0.0:0.0:0.0	.	757	Q96R06	SPAG5_HUMAN	P	757;254	.	ENSP00000323300:L757P	L	-	2	0	SPAG5	23935517	0.987000	0.35691	1.000000	0.80357	0.573000	0.36030	4.247000	0.58750	2.304000	0.77564	0.528000	0.53228	CTC	.	.	.	none		0.522	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
KRT27	342574	hgsc.bcm.edu	37	17	38938378	38938378	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:38938378A>G	ENST00000301656.3	-	1	408	c.368T>C	c.(367-369)tTt>tCt	p.F123S		NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				ACCAGGTCCAAATTTCTCATA	0.498																																					p.F123S		Atlas-SNP	.											.	KRT27	41	.	0			c.T368C						PASS	.						154.0	135.0	141.0					17																	38938378		2203	4300	6503	SO:0001583	missense	342574	exon1			GGTCCAAATTTCT	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.368T>C	chr17.hg19:g.38938378A>G	ENSP00000301656:p.Phe123Ser	129.0	0.0	.		190.0	10.0	.	NM_181537		Missense_Mutation	SNP	ENST00000301656.3	hg19	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	A	6.807	0.517981	0.13005	.	.	ENSG00000171446	ENST00000301656	D	0.87729	-2.29	5.66	1.89	0.25635	Filament (1);	0.279078	0.31290	N	0.007902	T	0.74030	0.3663	N	0.12182	0.205	0.30019	N	0.814529	B	0.13145	0.007	B	0.15870	0.014	T	0.67496	-0.5656	10	0.49607	T	0.09	.	10.0469	0.42192	0.5272:0.0:0.0:0.4728	.	123	Q7Z3Y8	K1C27_HUMAN	S	123	ENSP00000301656:F123S	ENSP00000301656:F123S	F	-	2	0	KRT27	36191904	0.001000	0.12720	0.987000	0.45799	0.444000	0.32077	0.662000	0.25038	0.449000	0.26747	-0.344000	0.07964	TTT	.	.	.	none		0.498	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
HEXDC	284004	hgsc.bcm.edu	37	17	80382347	80382347	+	Silent	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:80382347T>C	ENST00000327949.9	+	2	173	c.162T>C	c.(160-162)ccT>ccC	p.P54P	HEXDC_ENST00000577944.1_Silent_p.P54P|HEXDC_ENST00000337014.6_Silent_p.P54P			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	54					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			ACGAGGGCCCTCTGAGGCTGC	0.612																																					p.P54P		Atlas-SNP	.											.	HEXDC	43	.	0			c.T162C						PASS	.						97.0	92.0	94.0					17																	80382347		1940	4131	6071	SO:0001819	synonymous_variant	284004	exon3			GGGCCCTCTGAGG	AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.162T>C	chr17.hg19:g.80382347T>C		115.0	0.0	.		139.0	38.0	.	NM_173620	B7UUP6|Q8IYN4|Q8TE81	Silent	SNP	ENST00000327949.9	hg19																																																																																				.	.	.	none		0.612	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1	NM_173620	
TIMM21	29090	hgsc.bcm.edu	37	18	71816322	71816322	+	Silent	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr18:71816322C>G	ENST00000169551.6	+	1	577	c.279C>G	c.(277-279)acC>acG	p.T93T	FBXO15_ENST00000269500.5_5'Flank|TIMM21_ENST00000580087.1_Silent_p.T93T|FBXO15_ENST00000419743.2_5'Flank	NM_014177.2	NP_054896.2	Q9BVV7	TIM21_HUMAN	translocase of inner mitochondrial membrane 21 homolog (yeast)	93					cellular protein metabolic process (GO:0044267)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane presequence translocase complex (GO:0005744)											GAGGGGGAACCGCCGTCCCAA	0.498																																					p.T93T		Atlas-SNP	.											.	.	.	.	0			c.C279G						PASS	.						57.0	58.0	58.0					18																	71816322		2203	4300	6503	SO:0001819	synonymous_variant	29090	exon1			GGGAACCGCCGTC	BC000892	CCDS12003.1	18q22.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000075336	ENSG00000075336			25010	protein-coding gene	gene with protein product		615180	"""chromosome 18 open reading frame 55"""	C18orf55		11042152	Standard	NM_014177		Approved	HSPC154, TIM21	uc010dqr.1	Q9BVV7	OTTHUMG00000132844	ENST00000169551.6:c.279C>G	chr18.hg19:g.71816322C>G		72.0	0.0	.		67.0	32.0	.	NM_014177	Q9P010	Silent	SNP	ENST00000169551.6	hg19	CCDS12003.1																																																																																			.	.	.	none		0.498	TIMM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256318.1	NM_014177	
STXBP2	6813	hgsc.bcm.edu	37	19	7712265	7712265	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:7712265A>T	ENST00000221283.5	+	18	1595	c.1564A>T	c.(1564-1566)Aac>Tac	p.N522Y	STXBP2_ENST00000441779.2_Missense_Mutation_p.N533Y|STXBP2_ENST00000414284.2_Missense_Mutation_p.N519Y|STXBP2_ENST00000602355.1_Missense_Mutation_p.N57Y	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	522					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						CTGGCACAAGAACAAGGCTGG	0.662																																					p.N533Y		Atlas-SNP	.											.	STXBP2	63	.	0			c.A1597T						PASS	.						24.0	33.0	30.0					19																	7712265		2192	4284	6476	SO:0001583	missense	6813	exon18			CACAAGAACAAGG	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1564A>T	chr19.hg19:g.7712265A>T	ENSP00000221283:p.Asn522Tyr	57.0	0.0	.		52.0	21.0	.	NM_001272034	B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	ENST00000221283.5	hg19	CCDS12181.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.846916	0.71603	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.80480	-1.38;-1.38;-1.38	5.26	4.18	0.49190	.	0.112112	0.64402	D	0.000017	D	0.82761	0.5107	L	0.55481	1.735	0.44611	D	0.997588	P;P;P;P	0.48407	0.91;0.91;0.889;0.91	P;P;P;P	0.55161	0.689;0.77;0.562;0.689	D	0.84034	0.0361	10	0.72032	D	0.01	-1.3267	10.063	0.42286	0.8312:0.1688:0.0:0.0	.	533;488;519;522	E7EQD5;B4DY46;Q15833-2;Q15833	.;.;.;STXB2_HUMAN	Y	522;519;533;522	ENSP00000221283:N522Y;ENSP00000409471:N519Y;ENSP00000413606:N533Y	ENSP00000221283:N522Y	N	+	1	0	STXBP2	7618265	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	5.775000	0.68915	2.003000	0.58678	0.454000	0.30748	AAC	.	.	.	none		0.662	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949	
DOCK6	57572	hgsc.bcm.edu	37	19	11312640	11312640	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:11312640C>A	ENST00000294618.7	-	44	5624	c.5613G>T	c.(5611-5613)aaG>aaT	p.K1871N	DOCK6_ENST00000319867.7_Missense_Mutation_p.K1210N|DOCK6_ENST00000586702.1_5'UTR|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1871	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCGTCTTACGCTTGTGTTGCT	0.637																																					p.K1871N		Atlas-SNP	.											.	DOCK6	104	.	0			c.G5613T						PASS	.						75.0	82.0	80.0					19																	11312640		2150	4243	6393	SO:0001583	missense	57572	exon44			CTTACGCTTGTGT		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5613G>T	chr19.hg19:g.11312640C>A	ENSP00000294618:p.Lys1871Asn	16.0	0.0	.		20.0	11.0	.	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	hg19	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205580	0.79127	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.20200	2.09;2.09	4.98	2.85	0.33270	.	0.000000	0.85682	D	0.000000	T	0.48750	0.1517	M	0.90082	3.085	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.988;0.99;0.997	T	0.49153	-0.8969	10	0.87932	D	0	-31.2742	7.885	0.29644	0.0:0.7188:0.0:0.2812	.	1210;1871;1210	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	N	1871;1210	ENSP00000294618:K1871N;ENSP00000321556:K1210N	ENSP00000294618:K1871N	K	-	3	2	DOCK6	11173640	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.212000	0.32394	0.478000	0.27488	0.491000	0.48974	AAG	.	.	.	none		0.637	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
DOCK6	57572	hgsc.bcm.edu	37	19	11312680	11312680	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:11312680G>C	ENST00000294618.7	-	44	5584	c.5573C>G	c.(5572-5574)cCg>cGg	p.P1858R	DOCK6_ENST00000319867.7_Missense_Mutation_p.P1197R|DOCK6_ENST00000586702.1_5'UTR|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1858	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GCGCCCATCCGGCGTGAACGG	0.597																																					p.P1858R		Atlas-SNP	.											.	DOCK6	104	.	0			c.C5573G						PASS	.						85.0	91.0	89.0					19																	11312680		2135	4244	6379	SO:0001583	missense	57572	exon44			CCATCCGGCGTGA		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.5573C>G	chr19.hg19:g.11312680G>C	ENSP00000294618:p.Pro1858Arg	42.0	0.0	.		35.0	10.0	.	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	hg19	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	4.448	0.083033	0.08533	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.16457	2.34;2.34	4.84	3.8	0.43715	.	0.164262	0.43747	D	0.000521	T	0.09686	0.0238	N	0.20986	0.625	0.34097	D	0.661381	B;B;B	0.23058	0.026;0.079;0.055	B;B;B	0.32149	0.017;0.141;0.064	T	0.19063	-1.0317	10	0.07325	T	0.83	-15.5866	5.6208	0.17455	0.2773:0.0:0.7227:0.0	.	1197;1858;1197	C9IZV6;Q96HP0;B4DIL4	.;DOCK6_HUMAN;.	R	1858;1197	ENSP00000294618:P1858R;ENSP00000321556:P1197R	ENSP00000294618:P1858R	P	-	2	0	DOCK6	11173680	1.000000	0.71417	0.710000	0.30468	0.153000	0.21895	5.138000	0.64795	2.213000	0.71641	0.491000	0.48974	CCG	.	.	.	none		0.597	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
OR7A17	26333	hgsc.bcm.edu	37	19	14991895	14991895	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:14991895G>A	ENST00000327462.2	-	1	369	c.273C>T	c.(271-273)gtC>gtT	p.V91V		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					CATAGGTGATGACTCTGCTCT	0.468																																					p.V91V		Atlas-SNP	.											.	OR7A17	37	.	0			c.C273T						PASS	.						151.0	131.0	138.0					19																	14991895		2203	4300	6503	SO:0001819	synonymous_variant	26333	exon1			GGTGATGACTCTG	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.273C>T	chr19.hg19:g.14991895G>A		95.0	0.0	.		126.0	59.0	.	NM_030901	Q6IFQ6|Q96R98	Silent	SNP	ENST00000327462.2	hg19	CCDS12319.1																																																																																			.	.	.	none		0.468	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901	
USHBP1	83878	hgsc.bcm.edu	37	19	17362478	17362478	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:17362478C>G	ENST00000252597.3	-	12	2008	c.1835G>C	c.(1834-1836)cGc>cCc	p.R612P	AC010646.3_ENST00000594059.1_5'UTR|USHBP1_ENST00000431146.2_Missense_Mutation_p.R548P	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						CAGCTCCCTGCGCAGAGACTG	0.602																																					p.R612P		Atlas-SNP	.											.	USHBP1	85	.	0			c.G1835C						PASS	.						75.0	74.0	74.0					19																	17362478		2203	4300	6503	SO:0001583	missense	83878	exon12			TCCCTGCGCAGAG	AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1835G>C	chr19.hg19:g.17362478C>G	ENSP00000252597:p.Arg612Pro	96.0	0.0	.		104.0	48.0	.	NM_031941		Missense_Mutation	SNP	ENST00000252597.3	hg19	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	C	5.320	0.244414	0.10077	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.19250	2.17;2.16	4.28	1.98	0.26296	.	0.610995	0.13794	N	0.362329	T	0.19927	0.0479	L	0.57536	1.79	0.09310	N	1	P;P	0.45240	0.854;0.854	B;B	0.43301	0.415;0.415	T	0.13845	-1.0494	10	0.49607	T	0.09	-11.2307	4.0967	0.09995	0.234:0.6445:0.0:0.1215	.	548;612	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	P	612;548	ENSP00000252597:R612P;ENSP00000407902:R548P	ENSP00000252597:R612P	R	-	2	0	USHBP1	17223478	0.000000	0.05858	0.005000	0.12908	0.023000	0.10783	0.206000	0.17375	2.108000	0.64289	0.561000	0.74099	CGC	.	.	.	none		0.602	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	
CRTC1	23373	hgsc.bcm.edu	37	19	18876245	18876245	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:18876245C>G	ENST00000321949.8	+	9	944	c.918C>G	c.(916-918)caC>caG	p.H306Q	CRTC1_ENST00000338797.6_Missense_Mutation_p.H322Q|CRTC1_ENST00000594658.1_Missense_Mutation_p.H265Q|CRTC1_ENST00000601916.1_Missense_Mutation_p.H231Q	NM_015321.2	NP_056136.2			CREB regulated transcription coactivator 1										CRTC1/MAML2(516)	NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	19						CTCCACAGCACCGCCCAGCTG	0.622																																					p.H322Q		Atlas-SNP	.											.	CRTC1	88	.	0			c.C966G						PASS	.						131.0	128.0	129.0					19																	18876245		2203	4300	6503	SO:0001583	missense	23373	exon10			ACAGCACCGCCCA	AY040323	CCDS32963.1, CCDS42525.1	19p13	2012-07-31	2005-11-24	2005-11-24					16062	protein-coding gene	gene with protein product	"""transducer of regulated cAMP response element-binding protein"""	607536	"""mucoepidermoid carcinoma translocated 1"""	MECT1		12539049, 14536081, 14506290	Standard	NM_015321		Approved	KIAA0616, FLJ14027, TORC1	uc010ebv.3	Q6UUV9		ENST00000321949.8:c.918C>G	chr19.hg19:g.18876245C>G	ENSP00000323332:p.His306Gln	199.0	0.0	.		180.0	66.0	.	NM_001098482		Missense_Mutation	SNP	ENST00000321949.8	hg19	CCDS32963.1	.	.	.	.	.	.	.	.	.	.	C	4.850	0.158062	0.09236	.	.	ENSG00000105662	ENST00000262813;ENST00000338797;ENST00000321949	T;T	0.11495	2.77;2.77	4.23	3.18	0.36537	.	0.533386	0.19393	N	0.115375	T	0.07548	0.0190	L	0.46157	1.445	0.41761	D	0.989719	P;B;B	0.35348	0.496;0.284;0.112	B;B;B	0.27608	0.081;0.071;0.037	T	0.22208	-1.0223	10	0.17832	T	0.49	-19.0333	7.3343	0.26601	0.0:0.7971:0.0:0.2029	.	306;322;306	Q6UUV9-3;Q6UUV9-2;Q6UUV9	.;.;CRTC1_HUMAN	Q	306;322;306	ENSP00000345001:H322Q;ENSP00000323332:H306Q	ENSP00000262813:H306Q	H	+	3	2	CRTC1	18737245	0.713000	0.27926	0.992000	0.48379	0.498000	0.33706	0.107000	0.15375	2.077000	0.62373	0.561000	0.74099	CAC	.	.	.	none		0.622	CRTC1-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465151.3	NM_025021	
ZNF253	56242	hgsc.bcm.edu	37	19	20003291	20003291	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:20003291C>T	ENST00000589717.1	+	4	1327	c.1235C>T	c.(1234-1236)tCc>tTc	p.S412F	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.S336F|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	412				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCAATCCTCTCCAAACATAAA	0.388																																					p.S412F		Atlas-SNP	.											.	ZNF253	99	.	0			c.C1235T						PASS	.						39.0	43.0	42.0					19																	20003291		2087	4250	6337	SO:0001583	missense	56242	exon4			TCCTCTCCAAACA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1235C>T	chr19.hg19:g.20003291C>T	ENSP00000468720:p.Ser412Phe	37.0	0.0	.		38.0	19.0	.	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	hg19	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	c	3.372	-0.128115	0.06753	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25938	0.0632	L	0.35542	1.07	0.09310	N	1	P	0.34562	0.457	B	0.39299	0.296	T	0.21415	-1.0246	7	.	.	.	.	3.9875	0.09522	0.409:0.591:0.0:0.0	.	412	O75346	ZN253_HUMAN	F	412	.	.	S	+	2	0	ZNF253	19864291	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	0.021000	0.13489	0.293000	0.22520	0.298000	0.19748	TCC	.	.	.	none		0.388	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF471	57573	hgsc.bcm.edu	37	19	57037192	57037192	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr19:57037192T>C	ENST00000308031.5	+	5	1889	c.1756T>C	c.(1756-1758)Tgt>Cgt	p.C586R	ZNF471_ENST00000593197.1_3'UTR|ZNF471_ENST00000591537.1_3'UTR	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		TAGCTCATCCTGTGCTCAGCA	0.408																																					p.C586R	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	Atlas-SNP	.											.	ZNF471	99	.	0			c.T1756C						PASS	.						78.0	74.0	75.0					19																	57037192		2203	4300	6503	SO:0001583	missense	57573	exon5			TCATCCTGTGCTC	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1756T>C	chr19.hg19:g.57037192T>C	ENSP00000309161:p.Cys586Arg	62.0	0.0	.		76.0	33.0	.	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	hg19	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	T	4.114	0.019231	0.08006	.	.	ENSG00000196263	ENST00000308031	T	0.00949	5.51	3.68	-2.53	0.06326	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00724	0.0024	N	0.11789	0.175	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.45498	-0.9257	9	0.87932	D	0	.	9.1979	0.37240	0.0:0.4048:0.0:0.5952	.	586	Q9BX82	ZN471_HUMAN	R	586	ENSP00000309161:C586R	ENSP00000309161:C586R	C	+	1	0	ZNF471	61729004	0.000000	0.05858	0.017000	0.16124	0.514000	0.34195	-1.549000	0.02182	-0.322000	0.08615	-0.464000	0.05259	TGT	.	.	.	none		0.408	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
PTPRT	11122	hgsc.bcm.edu	37	20	41100970	41100970	+	Silent	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr20:41100970G>A	ENST00000373187.1	-	8	1385	c.1386C>T	c.(1384-1386)ctC>ctT	p.L462L	PTPRT_ENST00000356100.2_Silent_p.L462L|PTPRT_ENST00000373198.4_Silent_p.L462L|PTPRT_ENST00000373201.1_Silent_p.L462L|PTPRT_ENST00000373193.3_Silent_p.L462L|PTPRT_ENST00000373184.1_Silent_p.L462L|PTPRT_ENST00000373190.1_Silent_p.L462L			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	462	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGACAGCAAGAGTCGCAGCC	0.612																																					p.L462L		Atlas-SNP	.											.	PTPRT	372	.	0			c.C1386T						PASS	.						57.0	62.0	60.0					20																	41100970		2134	4245	6379	SO:0001819	synonymous_variant	11122	exon8			CAGCAAGAGTCGC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1386C>T	chr20.hg19:g.41100970G>A		103.0	0.0	.		147.0	51.0	.	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	hg19	CCDS42874.1																																																																																			.	.	.	none		0.612	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
ZGPAT	84619	hgsc.bcm.edu	37	20	62366823	62366823	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr20:62366823T>C	ENST00000328969.5	+	6	1491	c.1364T>C	c.(1363-1365)cTg>cCg	p.L455P	ZGPAT_ENST00000369967.3_Missense_Mutation_p.L435P|ZGPAT_ENST00000448100.2_Missense_Mutation_p.L435P|LIME1_ENST00000309546.3_5'Flank|RP4-583P15.14_ENST00000467211.1_5'Flank|ZGPAT_ENST00000357119.4_Missense_Mutation_p.L426P|ZGPAT_ENST00000355969.6_Missense_Mutation_p.L435P|RP4-583P15.15_ENST00000490623.2_Nonstop_Mutation_p.*341R	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	455					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					AAGCGGGCCCTGAGCCTGCGG	0.667																																					p.L455P		Atlas-SNP	.											.	ZGPAT	57	.	0			c.T1364C						PASS	.						23.0	27.0	26.0					20																	62366823		2200	4300	6500	SO:0001583	missense	84619	exon6			GGGCCCTGAGCCT	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.1364T>C	chr20.hg19:g.62366823T>C	ENSP00000332013:p.Leu455Pro	32.0	0.0	.		51.0	30.0	.	NM_032527	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	hg19	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234362	0.79800	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	T;T;T;T;T	0.32988	1.45;1.45;1.47;1.45;1.43	5.69	4.57	0.56435	.	0.072010	0.56097	D	0.000022	T	0.53738	0.1815	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.54490	-0.8286	10	0.52906	T	0.07	-25.847	11.8041	0.52143	0.1318:0.0:0.0:0.8682	.	426;455;435	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	P	435;435;426;435;455	ENSP00000391176:L435P;ENSP00000348242:L435P;ENSP00000349634:L426P;ENSP00000358984:L435P;ENSP00000332013:L455P	ENSP00000332013:L455P	L	+	2	0	ZGPAT	61837267	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.891000	0.69782	0.955000	0.37878	0.460000	0.39030	CTG	.	.	.	none		0.667	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
SFI1	9814	hgsc.bcm.edu	37	22	32002357	32002357	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:32002357G>C	ENST00000400288.2	+	21	2203	c.2098G>C	c.(2098-2100)Gat>Cat	p.D700H	SFI1_ENST00000414585.1_Missense_Mutation_p.D547H|SFI1_ENST00000432498.1_Missense_Mutation_p.D669H|SFI1_ENST00000400289.1_Missense_Mutation_p.D618H|SFI1_ENST00000443011.1_Missense_Mutation_p.D547H|SFI1_ENST00000443326.1_Missense_Mutation_p.D618H|SFI1_ENST00000540643.1_Missense_Mutation_p.D645H	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	700					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGCCCGAGTGGATGAAGCCAA	0.517																																					p.D700H		Atlas-SNP	.											.	SFI1	78	.	0			c.G2098C						PASS	.						88.0	88.0	88.0					22																	32002357		2023	4185	6208	SO:0001583	missense	9814	exon21			CGAGTGGATGAAG	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2098G>C	chr22.hg19:g.32002357G>C	ENSP00000383145:p.Asp700His	61.0	0.0	.		63.0	25.0	.	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	hg19	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	G	8.780	0.928003	0.18131	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.14266	3.1;3.1;2.94;2.93;2.93;2.94;3.1;2.52	5.06	0.509	0.16977	.	0.751926	0.13001	N	0.421651	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	P;P;P;P;P	0.42757	0.789;0.603;0.603;0.789;0.573	P;B;B;P;B	0.49922	0.626;0.366;0.277;0.626;0.366	T	0.28364	-1.0046	10	0.40728	T	0.16	.	6.8814	0.24174	0.4019:0.0:0.5981:0.0	.	645;618;618;669;700	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	H	669;645;618;547;547;618;700;283	ENSP00000402679:D669H;ENSP00000443025:D645H;ENSP00000416469:D618H;ENSP00000397148:D547H;ENSP00000401199:D547H;ENSP00000383146:D618H;ENSP00000383145:D700H;ENSP00000398871:D283H	ENSP00000383145:D700H	D	+	1	0	SFI1	30332357	0.001000	0.12720	0.033000	0.17914	0.025000	0.11179	0.187000	0.16998	0.237000	0.21200	-0.995000	0.02519	GAT	.	.	.	none		0.517	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
C1QTNF6	114904	hgsc.bcm.edu	37	22	37578251	37578251	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:37578251G>C	ENST00000337843.2	-	3	889	c.814C>G	c.(814-816)Ctc>Gtc	p.L272V	C1QTNF6_ENST00000397110.2_Missense_Mutation_p.L272V|RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000255836.6_Missense_Mutation_p.L148V|C1QTNF6_ENST00000470655.1_5'UTR	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	253					protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						GCCTTGATGAGGTGGCCGCTG	0.657																																					p.L272V		Atlas-SNP	.											.	C1QTNF6	32	.	0			c.C814G						PASS	.						61.0	57.0	58.0					22																	37578251		2203	4300	6503	SO:0001583	missense	114904	exon3			TGATGAGGTGGCC	AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.814C>G	chr22.hg19:g.37578251G>C	ENSP00000338812:p.Leu272Val	48.0	0.0	.		35.0	18.0	.	NM_182486	Q5H9G8|Q6ZRM7	Missense_Mutation	SNP	ENST00000337843.2	hg19	CCDS13943.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981527	0.74474	.	.	ENSG00000133466	ENST00000397110;ENST00000337843;ENST00000255836	T;T;T	0.51574	0.7;0.7;0.7	4.84	4.84	0.62591	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.64402	D	0.000001	T	0.78444	0.4284	H	0.97265	3.97	0.58432	D	0.999997	D;D	0.76494	0.999;0.998	D;D	0.72075	0.976;0.971	D	0.85842	0.1398	10	0.87932	D	0	.	13.3544	0.60619	0.0787:0.0:0.9213:0.0	.	272;253	Q9BXI9-2;Q9BXI9	.;C1QT6_HUMAN	V	272;272;148	ENSP00000380299:L272V;ENSP00000338812:L272V;ENSP00000255836:L148V	ENSP00000255836:L148V	L	-	1	0	C1QTNF6	35908197	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.704000	0.68347	2.238000	0.73509	0.491000	0.48974	CTC	.	.	.	none		0.657	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318807.1	NM_182486	
ARFGAP3	26286	hgsc.bcm.edu	37	22	43213794	43213794	+	Silent	SNP	A	A	G			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr22:43213794A>G	ENST00000263245.5	-	10	1101	c.882T>C	c.(880-882)atT>atC	p.I294I	ARFGAP3_ENST00000437119.2_Silent_p.I250I|ARFGAP3_ENST00000429508.2_Silent_p.I222I	NM_001142293.1|NM_014570.4	NP_001135765.1|NP_055385.3	Q9NP61	ARFG3_HUMAN	ADP-ribosylation factor GTPase activating protein 3	294					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|protein secretion (GO:0009306)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	11						TTTTGCCACtaatgttcatct	0.348																																					p.I294I	GBM(58;544 1030 21460 27159 48838)	Atlas-SNP	.											.	ARFGAP3	48	.	0			c.T882C						PASS	.						296.0	266.0	276.0					22																	43213794		2203	4300	6503	SO:0001819	synonymous_variant	26286	exon10			GCCACTAATGTTC	AK002083	CCDS14042.1, CCDS46722.1	22q13.2	2009-11-30	2002-08-20	2002-08-23	ENSG00000242247	ENSG00000242247		"""ADP-ribosylation factor GTPase activating proteins"""	661	protein-coding gene	gene with protein product		612439	"""ADP-ribosylation factor GTPase activating protein 1"""	ARFGAP1		10704287, 11172815	Standard	NM_014570		Approved		uc003bdd.2	Q9NP61	OTTHUMG00000150718	ENST00000263245.5:c.882T>C	chr22.hg19:g.43213794A>G		174.0	0.0	.		139.0	63.0	.	NM_014570	E9PB03|Q9BSC6|Q9H9J0|Q9NT10|Q9NUP5|Q9Y4V3|Q9Y4V4	Silent	SNP	ENST00000263245.5	hg19	CCDS14042.1	.	.	.	.	.	.	.	.	.	.	A	7.151	0.583739	0.13749	.	.	ENSG00000242247	ENST00000453516	.	.	.	5.35	-2.94	0.05581	.	.	.	.	.	.	.	.	.	.	.	0.32559	N	0.531383	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.1118	4.5685	0.12198	0.2139:0.5126:0.1904:0.0831	.	.	.	.	Q	141	.	.	X	-	1	0	ARFGAP3	41543738	0.000000	0.05858	0.062000	0.19696	0.849000	0.48306	-0.717000	0.04986	-0.307000	0.08804	-0.291000	0.09656	TAG	.	.	.	none		0.348	ARFGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319747.2	NM_014570	
SYN1	6853	hgsc.bcm.edu	37	X	47432308	47432308	+	Silent	SNP	G	G	C			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:47432308G>C	ENST00000295987.7	-	13	2197	c.2073C>G	c.(2071-2073)acC>acG	p.T691T	SYN1_ENST00000340666.4_3'UTR	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	691	E.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						GGCTGCGGATGGTCTCAGCTT	0.582																																					p.T691T		Atlas-SNP	.											.	SYN1	84	.	0			c.C2073G						PASS	.						108.0	91.0	97.0					X																	47432308		2203	4300	6503	SO:0001819	synonymous_variant	6853	exon13			GCGGATGGTCTCA		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.2073C>G	chrX.hg19:g.47432308G>C		74.0	0.0	.		58.0	56.0	.	NM_006950	B1AJQ1|O75825|Q5H9A9	Silent	SNP	ENST00000295987.7	hg19	CCDS14280.1																																																																																			.	.	.	none		0.582	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
HEPH	9843	hgsc.bcm.edu	37	X	65390505	65390505	+	Silent	SNP	C	C	T			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:65390505C>T	ENST00000343002.2	+	1	757	c.93C>T	c.(91-93)ggC>ggT	p.G31G	HEPH_ENST00000519389.1_Silent_p.G85G|HEPH_ENST00000419594.1_Silent_p.G34G|HEPH_ENST00000441993.2_Silent_p.G34G|HEPH_ENST00000374727.3_Silent_p.G34G|HEPH_ENST00000336279.5_Intron			Q9BQS7	HEPH_HUMAN	hephaestin	31	Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ACTACCTGGGCATCCGGGATG	0.527																																					p.G85G		Atlas-SNP	.											.	HEPH	224	.	0			c.C255T						PASS	.						94.0	64.0	74.0					X																	65390505		2203	4300	6503	SO:0001819	synonymous_variant	9843	exon2			CCTGGGCATCCGG	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.93C>T	chrX.hg19:g.65390505C>T		25.0	0.0	.		23.0	19.0	.	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	ENST00000343002.2	hg19																																																																																				.	.	.	none		0.527	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130215818	130215818	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chrX:130215818G>A	ENST00000276211.5	+	2	524	c.179G>A	c.(178-180)cGt>cAt	p.R60H	ARHGAP36_ENST00000370921.1_5'Flank|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R48H	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	60					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R60H(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAGCTGGAGCGTCTGAAGCTG	0.532																																					p.R60H		Atlas-SNP	.											.	ARHGAP36	171	.	1	Substitution - Missense(1)	large_intestine(1)	c.G179A						PASS	.						125.0	107.0	113.0					X																	130215818		2203	4300	6503	SO:0001583	missense	158763	exon2			TGGAGCGTCTGAA		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.179G>A	chrX.hg19:g.130215818G>A	ENSP00000276211:p.Arg60His	127.0	0.0	.		96.0	87.0	.	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	hg19	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358508	0.82243	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.28666	1.6;1.61;1.68	4.16	4.16	0.48862	.	0.000000	0.47455	D	0.000238	T	0.40886	0.1135	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.994	T	0.30387	-0.9980	10	0.87932	D	0	.	10.8111	0.46547	0.0:0.0:1.0:0.0	.	29;48;60	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	H	60;48;12;29	ENSP00000276211:R60H;ENSP00000359960:R48H;ENSP00000408515:R29H	ENSP00000276211:R60H	R	+	2	0	ARHGAP36	130043499	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.627000	0.67784	2.315000	0.78130	0.544000	0.68410	CGT	.	.	.	none		0.532	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
MFN2	9927	hgsc.bcm.edu	37	1	12061548	12061549	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr1:12061548_12061549delTT	ENST00000235329.5	+	9	1229_1230	c.907_908delTT	c.(907-909)tttfs	p.F303fs	MFN2_ENST00000444836.1_Frame_Shift_Del_p.F303fs	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	303	Dynamin-type G.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CCGCATCTTCTTTGTGTCTGCT	0.574																																					p.302_303del		Atlas-INDEL	.											.	MFN2	83	.	0			c.906_907del						PASS	.																																			SO:0001589	frameshift_variant	9927	exon9			.	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.907_908delTT	chr1.hg19:g.12061548_12061549delTT	ENSP00000235329:p.Phe303fs	48.0	0.0	0		47.0	26.0	0.553191	NM_014874	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Frame_Shift_Del	DEL	ENST00000235329.5	hg19	CCDS30587.1																																																																																			.	.	.	none		0.574	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
KMT2C	58508	hgsc.bcm.edu	37	7	151880116	151880116	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr7:151880116delA	ENST00000262189.6	-	35	5426	c.5208delT	c.(5206-5208)tttfs	p.F1736fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.F1736fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1736	Gln-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAGGATCTTTAAAAAGCTCCG	0.343																																					p.K1737fs		Atlas-INDEL	.											.	MLL3	1564	.	0			c.5209delA						PASS	.						216.0	218.0	217.0					7																	151880116		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon35			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5208delT	chr7.hg19:g.151880116delA	ENSP00000262189:p.Phe1736fs	340.0	0.0	0		463.0	289.0	0.62419	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	hg19	CCDS5931.1																																																																																			.	.	.	none		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
ADAMTS9	56999	hgsc.bcm.edu	37	3	64536694	64536703	+	Frame_Shift_Del	DEL	CACCACCTTG	CACCACCTTG	-	rs17071010|rs146412036|rs138988394	byFrequency	TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CACCACCTTG	CACCACCTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr3:64536694_64536703delCACCACCTTG	ENST00000498707.1	-	31	5076_5085	c.4734_4743delCAAGGTGGTG	c.(4732-4743)cgcaaggtggtgfs	p.RKVV1578fs	ADAMTS9_ENST00000295903.4_Frame_Shift_Del_p.RKVV1550fs	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1578	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1581M(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CATCCACACACACCACCTTGCGGTACCTGG	0.5																																					p.1579_1582del		Atlas-INDEL	.											.	ADAMTS9	206	.	1	Substitution - Missense(1)	large_intestine(1)	c.4735_4744del						PASS	.																																			SO:0001589	frameshift_variant	56999	exon31			.	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4734_4743delCAAGGTGGTG	chr3.hg19:g.64536694_64536703delCACCACCTTG	ENSP00000418735:p.Arg1578fs	237.0	0.0	0		135.0	26.0	0.192593	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Frame_Shift_Del	DEL	ENST00000498707.1	hg19	CCDS2903.1																																																																																			.	.	.	none		0.500	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
SLC46A1	113235	hgsc.bcm.edu	37	17	26731859	26731859	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr17:26731859delC	ENST00000440501.1	-	2	951	c.856delG	c.(856-858)gacfs	p.D286fs	SLC46A1_ENST00000321666.5_Frame_Shift_Del_p.D286fs|SLC46A1_ENST00000584729.1_5'UTR|CTD-2350C19.2_ENST00000580714.1_RNA|CTD-2350C19.1_ENST00000583956.1_RNA	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1	286					cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	GTTAAGATGTCCTGGGCCCCA	0.542																																					p.D286fs		Atlas-INDEL	.											.	SLC46A1	17	.	0			c.857delA						PASS	.						109.0	118.0	115.0					17																	26731859		2022	4180	6202	SO:0001589	frameshift_variant	113235	exon2			.	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.856delG	chr17.hg19:g.26731859delC	ENSP00000395653:p.Asp286fs	88.0	0.0	0		112.0	70.0	0.625	NM_001242366	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Frame_Shift_Del	DEL	ENST00000440501.1	hg19																																																																																				.	.	.	none		0.542	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
KMT2D	8085	hgsc.bcm.edu	37	12	49435198	49435199	+	Frame_Shift_Ins	INS	-	-	G	rs377392943	byFrequency	TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:49435198_49435199insG	ENST00000301067.7	-	31	6353_6354	c.6354_6355insC	c.(6352-6357)cccgctfs	p.A2119fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2119	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A2119fs*36(1)|p.A1849fs*36(1)									GGGGCAGCAGCGGGGGGCGGGC	0.688																																					p.A2119fs		Atlas-INDEL	.											.,2	MLL2	1173	.	2	Insertion - Frameshift(2)	central_nervous_system(2)	c.6355_6356insC						PASS	.																																			SO:0001589	frameshift_variant	8085	exon31			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6355dupC	chr12.hg19:g.49435204_49435204dupG	ENSP00000301067:p.Ala2119fs	42.0	0.0	0		38.0	19.0	0.5	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.	.	none		0.688	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MATN2	4147	hgsc.bcm.edu	37	8	98943606	98943609	+	Frame_Shift_Del	DEL	CTAA	CTAA	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CTAA	CTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr8:98943606_98943609delCTAA	ENST00000520016.1	+	2	692_695	c.568_571delCTAA	c.(568-573)ctaatcfs	p.LI190fs	MATN2_ENST00000521689.1_Frame_Shift_Del_p.LI190fs|MATN2_ENST00000524308.1_Frame_Shift_Del_p.LI190fs|MATN2_ENST00000522025.2_Intron|MATN2_ENST00000254898.5_Frame_Shift_Del_p.LI190fs			O00339	MATN2_HUMAN	matrilin 2	190	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CACGGGCATCCTAATCTTTGCCAT	0.559																																					p.189_190del		Atlas-INDEL	.											.	MATN2	165	.	0			c.567_570del						PASS	.																																			SO:0001589	frameshift_variant	4147	exon3			.	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.568_571delCTAA	chr8.hg19:g.98943606_98943609delCTAA	ENSP00000430487:p.Leu190fs	53.0	0.0	0		44.0	19.0	0.431818	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Frame_Shift_Del	DEL	ENST00000520016.1	hg19	CCDS55264.1																																																																																			.	.	.	none		0.559	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
ADAMTS20	80070	hgsc.bcm.edu	37	12	43823478	43823478	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr12:43823478delA	ENST00000389420.3	-	24	3430	c.3431delT	c.(3430-3432)ttafs	p.L1145fs	ADAMTS20_ENST00000395541.2_Intron|ADAMTS20_ENST00000553158.1_Frame_Shift_Del_p.L1145fs	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1145					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGTTGGTAATAAAGCGGTCTC	0.343																																					p.L1144fs		Atlas-INDEL	.											.	ADAMTS20	635	.	0			c.3432delA						PASS	.						60.0	56.0	57.0					12																	43823478		2203	4298	6501	SO:0001589	frameshift_variant	80070	exon24			.	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3431delT	chr12.hg19:g.43823478delA	ENSP00000374071:p.Leu1145fs	19.0	0.0	0		27.0	12.0	0.444444	NM_025003	A6NNC9|J3QT00	Frame_Shift_Del	DEL	ENST00000389420.3	hg19	CCDS31778.2																																																																																			.	.	.	none		0.343	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
KBTBD6	89890	hgsc.bcm.edu	37	13	41705610	41705612	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr13:41705610_41705612delCAC	ENST00000379485.1	-	1	1270_1272	c.1036_1038delGTG	c.(1036-1038)gtgdel	p.V346del	KBTBD6_ENST00000499385.2_In_Frame_Del_p.V280del	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	346										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		CAAAGAAGATCACCATCTCCTTG	0.527																																					p.346_347del		Atlas-INDEL	.											.	KBTBD6	83	.	0			c.1037_1039del						PASS	.																																			SO:0001651	inframe_deletion	89890	exon1			.	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1036_1038delGTG	chr13.hg19:g.41705610_41705612delCAC	ENSP00000368799:p.Val346del	152.0	0.0	0		94.0	29.0	0.308511	NM_152903	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	In_Frame_Del	DEL	ENST00000379485.1	hg19	CCDS9376.1																																																																																			.	.	.	none		0.527	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044657.1	NM_152903	
COX5A	9377	hgsc.bcm.edu	37	15	75221461	75221461	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr15:75221461delA	ENST00000322347.6	-	2	366	c.213delT	c.(211-213)cgtfs	p.R71fs	COX5A_ENST00000568783.1_Frame_Shift_Del_p.R71fs|COX5A_ENST00000567270.1_Intron|COX5A_ENST00000568517.1_5'UTR|COX5A_ENST00000562233.1_Frame_Shift_Del_p.R71fs|COX5A_ENST00000564811.1_Frame_Shift_Del_p.R71fs	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	71					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						AATTACCTTTACGCAATTCCC	0.413																																					p.K72fs		Atlas-INDEL	.											.	COX5A	9	.	0			c.214delA						PASS	.						140.0	129.0	133.0					15																	75221461		2197	4295	6492	SO:0001589	frameshift_variant	9377	exon2			.	M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.213delT	chr15.hg19:g.75221461delA	ENSP00000317780:p.Arg71fs	174.0	0.0	0		108.0	34.0	0.314815	NM_004255	P30045|Q8TB65	Frame_Shift_Del	DEL	ENST00000322347.6	hg19	CCDS10273.1																																																																																			.	.	.	none		0.413	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286417.1	NM_004255	
PAK1	5058	hgsc.bcm.edu	37	11	77047284	77047284	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7051-01A-12D-1961-08	TCGA-BQ-7051-11A-02D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b9c9f82-1e35-4ff6-94dc-0d2af8f0219b	d10a271b-6cf9-4623-a59e-f8cb7afcaca5	g.chr11:77047284delT	ENST00000356341.3	-	13	1791	c.1260delA	c.(1258-1260)aaafs	p.K420fs	PAK1_ENST00000530617.1_Frame_Shift_Del_p.K420fs|PAK1_ENST00000525542.1_5'UTR|PAK1_ENST00000528203.1_Frame_Shift_Del_p.K322fs|PAK1_ENST00000278568.4_Frame_Shift_Del_p.K420fs	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	420	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					TGGTGCTCCGTTTGCTCTGCT	0.473																																					p.R421fs		Atlas-INDEL	.											.	PAK1	89	.	0			c.1261delC						PASS	.						148.0	145.0	146.0					11																	77047284		2200	4292	6492	SO:0001589	frameshift_variant	5058	exon13			.	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.1260delA	chr11.hg19:g.77047284delT	ENSP00000348696:p.Lys420fs	121.0	0.0	0		104.0	43.0	0.413462	NM_001128620	O75561|Q13567|Q32M53|Q32M54|Q86W79	Frame_Shift_Del	DEL	ENST00000356341.3	hg19	CCDS8250.1																																																																																			.	.	.	none		0.473	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
