#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MYSM1	114803	hgsc.bcm.edu	37	1	59125680	59125680	+	Silent	SNP	A	A	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr1:59125680A>G	ENST00000472487.1	-	20	2515	c.2476T>C	c.(2476-2478)Ttg>Ctg	p.L826L	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	826					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					CACATTAACAATTCCTTTGTA	0.299																																					p.L826L		Atlas-SNP	.											.	MYSM1	50	.	0			c.T2476C						PASS	.						77.0	75.0	76.0					1																	59125680		1805	4073	5878	SO:0001819	synonymous_variant	114803	exon20			TTAACAATTCCTT	AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2476T>C	chr1.hg19:g.59125680A>G		84.0	0.0	.		88.0	4.0	.	NM_001085487	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Silent	SNP	ENST00000472487.1	hg19	CCDS41343.1																																																																																			.	.	.	none		0.299	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481	
TTN	7273	hgsc.bcm.edu	37	2	179611917	179611917	+	Intron	SNP	T	T	C	rs578160962		TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr2:179611917T>C	ENST00000591111.1	-	46	10585				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Silent_p.L5070L			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTATCTCTCTAGAGTCTCTC	0.522													T|||	1	0.000199681	0.0	0.0014	5008	,	,		15437	0.0		0.0	False		,,,				2504	0.0				p.L5070L		Atlas-SNP	.											TTN_ENST00000360870,NS,carcinoma,0,1	TTN	18412	.	0			c.A15210G						PASS	.						70.0	74.0	72.0					2																	179611917		2203	4300	6503	SO:0001627	intron_variant	7273	exon46			TCTCTCTAGAGTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5269A>G	chr2.hg19:g.179611917T>C		123.0	1.0	.		133.0	8.0	.	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.522	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PGAP1	80055	hgsc.bcm.edu	37	2	197767380	197767380	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr2:197767380C>T	ENST00000354764.4	-	5	850	c.736G>A	c.(736-738)Gat>Aat	p.D246N	PGAP1_ENST00000485830.1_5'UTR|PGAP1_ENST00000409475.1_Missense_Mutation_p.D246N|PGAP1_ENST00000409188.1_Missense_Mutation_p.D204N	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	246					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						ACTTGGTAATCCCGGAATCCT	0.353																																					p.D246N		Atlas-SNP	.											.	PGAP1	84	.	0			c.G736A						PASS	.						89.0	96.0	94.0					2																	197767380		2203	4300	6503	SO:0001583	missense	80055	exon5			GGTAATCCCGGAA		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.736G>A	chr2.hg19:g.197767380C>T	ENSP00000346809:p.Asp246Asn	98.0	0.0	.		90.0	32.0	.	NM_024989	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	hg19	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812990	0.90707	.	.	ENSG00000197121	ENST00000354764;ENST00000409475;ENST00000409188	D;D;D	0.96491	-4.03;-4.03;-4.03	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.98585	0.9527	M	0.92122	3.275	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.99628	1.0985	10	0.87932	D	0	-16.6327	18.3788	0.90443	0.0:1.0:0.0:0.0	.	204;246;246	B4DYY6;Q75T13-3;Q75T13	.;.;PGAP1_HUMAN	N	246;246;204	ENSP00000346809:D246N;ENSP00000387028:D246N;ENSP00000386802:D204N	ENSP00000346809:D246N	D	-	1	0	PGAP1	197475625	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.144000	0.64832	2.568000	0.86640	0.650000	0.86243	GAT	.	.	.	none		0.353	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
LRRFIP1	9208	hgsc.bcm.edu	37	2	238636568	238636568	+	Intron	SNP	G	G	C			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr2:238636568G>C	ENST00000392000.4	+	4	366				LRRFIP1_ENST00000308482.9_Missense_Mutation_p.R145T|LRRFIP1_ENST00000244815.5_Intron|LRRFIP1_ENST00000289175.6_Intron	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1						innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CTGAATAGAAGATCTGGCAGG	0.318																																					p.R145T		Atlas-SNP	.											.	LRRFIP1	171	.	0			c.G434C						PASS	.						204.0	199.0	201.0					2																	238636568		1568	3582	5150	SO:0001627	intron_variant	9208	exon8			ATAGAAGATCTGG	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.249+7103G>C	chr2.hg19:g.238636568G>C		194.0	0.0	.		189.0	66.0	.	NM_001137550	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	ENST00000392000.4	hg19	CCDS46552.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945238	0.53079	.	.	ENSG00000124831	ENST00000308482;ENST00000391999;ENST00000420665	T	0.48201	0.82	5.3	4.2	0.49525	.	.	.	.	.	T	0.29288	0.0729	N	0.24115	0.695	0.80722	D	1	B	0.31318	0.319	B	0.32624	0.149	T	0.08207	-1.0733	9	0.23891	T	0.37	.	5.5337	0.16999	0.2308:0.0:0.7692:0.0	.	145	E9PGZ2	.	T	145;135;100	ENSP00000310109:R145T	ENSP00000310109:R145T	R	+	2	0	LRRFIP1	238301307	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.587000	0.53957	2.652000	0.90054	0.655000	0.94253	AGA	.	.	.	none		0.318	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317198.1	NM_004735	
PRRT3	285368	hgsc.bcm.edu	37	3	9990555	9990555	+	Missense_Mutation	SNP	C	C	A	rs187203537		TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr3:9990555C>A	ENST00000412055.1	-	3	1187	c.1058G>T	c.(1057-1059)cGg>cTg	p.R353L	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Missense_Mutation_p.R353L	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	353	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						TCCTCTCACCCGCTGGGGGGA	0.592																																					p.R353L		Atlas-SNP	.											.	PRRT3	35	.	0			c.G1058T						PASS	.						59.0	65.0	63.0					3																	9990555		1927	4137	6064	SO:0001583	missense	285368	exon3			CTCACCCGCTGGG	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1058G>T	chr3.hg19:g.9990555C>A	ENSP00000392511:p.Arg353Leu	131.0	0.0	.		146.0	6.0	.	NM_207351	Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	ENST00000412055.1	hg19	CCDS43049.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468603	0.84533	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.33654	1.66;1.4	5.17	5.17	0.71159	.	0.000000	0.50627	D	0.000103	T	0.48840	0.1522	L	0.36672	1.1	0.37495	D	0.916543	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.49204	-0.8964	9	.	.	.	-10.5905	14.1662	0.65477	0.0:1.0:0.0:0.0	.	353;353	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	L	353	ENSP00000392511:R353L;ENSP00000404512:R353L	.	R	-	2	0	PRRT3	9965555	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.604000	0.36804	2.403000	0.81681	0.655000	0.94253	CGG	.	C|0.999;T|0.001	.	alt		0.592	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
VPRBP	9730	hgsc.bcm.edu	37	3	51457622	51457622	+	Silent	SNP	C	C	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr3:51457622C>G	ENST00000335891.5	-	7	1464	c.1455G>C	c.(1453-1455)cgG>cgC	p.R485R				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	934	Protein kinase-like.				B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		CCTGGGGGGGCCGTGGCTGAG	0.592																																					p.R881R		Atlas-SNP	.											.	VPRBP	107	.	0			c.G2643C						PASS	.						44.0	47.0	46.0					3																	51457622		1981	4163	6144	SO:0001819	synonymous_variant	9730	exon14			GGGGGGCCGTGGC	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.1455G>C	chr3.hg19:g.51457622C>G		78.0	0.0	.		60.0	27.0	.	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Silent	SNP	ENST00000335891.5	hg19																																																																																				.	.	.	none		0.592	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
GMPS	8833	hgsc.bcm.edu	37	3	155654202	155654202	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr3:155654202A>T	ENST00000496455.2	+	15	2218	c.1883A>T	c.(1882-1884)cAg>cTg	p.Q628L	GMPS_ENST00000295920.7_Missense_Mutation_p.Q529L	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	628					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	CTTCAAAAGCAGCCTTCATGC	0.443			T	MLL	AML																																p.Q628L	Ovarian(153;896 1876 4149 15499 28134)	Atlas-SNP	.		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	.	GMPS	70	.	0			c.A1883T						PASS	.						128.0	120.0	122.0					3																	155654202		1870	4103	5973	SO:0001583	missense	8833	exon15			AAAAGCAGCCTTC	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1883A>T	chr3.hg19:g.155654202A>T	ENSP00000419851:p.Gln628Leu	169.0	0.0	.		165.0	49.0	.	NM_003875	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	hg19	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524899	0.44969	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.53	5.53	0.82687	GMP synthase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58308	0.2113	L	0.55990	1.75	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.53954	-0.8365	9	0.30854	T	0.27	-12.4699	15.6641	0.77213	1.0:0.0:0.0:0.0	.	529;628	F8W720;P49915	.;GUAA_HUMAN	L	628;529;577;628	.	ENSP00000295920:Q529L	Q	+	2	0	GMPS	157136896	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.800000	0.91900	2.086000	0.62901	0.459000	0.35465	CAG	.	.	.	none		0.443	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2		
MAP3K13	9175	hgsc.bcm.edu	37	3	185146747	185146747	+	Silent	SNP	C	C	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr3:185146747C>T	ENST00000265026.3	+	2	712	c.378C>T	c.(376-378)ggC>ggT	p.G126G	MAP3K13_ENST00000446828.1_Intron|MAP3K13_ENST00000424227.1_Silent_p.G126G|MAP3K13_ENST00000535426.1_Intron|MAP3K13_ENST00000443863.1_Intron	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CAGGCAGTGGCAGTGGTGGGT	0.493																																					p.G126G		Atlas-SNP	.											.	MAP3K13	209	.	0			c.C378T						PASS	.						93.0	94.0	94.0					3																	185146747		2203	4300	6503	SO:0001819	synonymous_variant	9175	exon2			CAGTGGCAGTGGT	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.378C>T	chr3.hg19:g.185146747C>T		80.0	0.0	.		94.0	27.0	.	NM_004721		Silent	SNP	ENST00000265026.3	hg19	CCDS3270.1																																																																																			.	.	.	none		0.493	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
WFS1	7466	hgsc.bcm.edu	37	4	6303094	6303094	+	Silent	SNP	C	C	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr4:6303094C>T	ENST00000226760.1	+	8	1742	c.1572C>T	c.(1570-1572)ttC>ttT	p.F524F	WFS1_ENST00000503569.1_Silent_p.F524F	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	524					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		TGAGGAATTTCAAGGGCACCT	0.597																																					p.F524F		Atlas-SNP	.											.	WFS1	71	.	0			c.C1572T						PASS	.						119.0	105.0	109.0					4																	6303094		2203	4300	6503	SO:0001819	synonymous_variant	7466	exon8			GAATTTCAAGGGC	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.1572C>T	chr4.hg19:g.6303094C>T		223.0	0.0	.		196.0	79.0	.	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Silent	SNP	ENST00000226760.1	hg19	CCDS3386.1																																																																																			.	.	.	none		0.597	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
LRBA	987	hgsc.bcm.edu	37	4	151935707	151935707	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr4:151935707C>A	ENST00000357115.3	-	2	331	c.88G>T	c.(88-90)Ggg>Tgg	p.G30W	LRBA_ENST00000535741.1_Missense_Mutation_p.G30W|LRBA_ENST00000507224.1_Missense_Mutation_p.G30W|LRBA_ENST00000510413.1_Missense_Mutation_p.G30W	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	30						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AATGCACCCCCTTCAGTAGGG	0.537																																					p.G30W		Atlas-SNP	.											.	LRBA	253	.	0			c.G88T						PASS	.						63.0	53.0	56.0					4																	151935707		2203	4300	6503	SO:0001583	missense	987	exon2			CACCCCCTTCAGT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.88G>T	chr4.hg19:g.151935707C>A	ENSP00000349629:p.Gly30Trp	47.0	0.0	.		60.0	23.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529711	0.64860	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.56444	0.88;1.03;0.88;0.46	5.33	5.33	0.75918	.	1.239200	0.06405	U	0.719521	T	0.52386	0.1731	L	0.47716	1.5	0.37618	D	0.921196	P;P;P	0.49447	0.876;0.924;0.924	B;B;B	0.43360	0.219;0.417;0.391	T	0.50432	-0.8829	10	0.48119	T	0.1	.	11.3073	0.49342	0.0:0.9149:0.0:0.0851	.	30;30;30	P50851;Q6P1X2;P50851-2	LRBA_HUMAN;.;.	W	30	ENSP00000446299:G30W;ENSP00000421552:G30W;ENSP00000349629:G30W;ENSP00000422180:G30W	ENSP00000349629:G30W	G	-	1	0	LRBA	152155157	0.031000	0.19500	0.961000	0.40146	0.587000	0.36485	1.159000	0.31749	2.514000	0.84764	0.555000	0.69702	GGG	.	.	.	none		0.537	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
EGFLAM	133584	hgsc.bcm.edu	37	5	38407020	38407020	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr5:38407020A>G	ENST00000354891.3	+	8	1265	c.919A>G	c.(919-921)Agg>Ggg	p.R307G	EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Missense_Mutation_p.R73G|EGFLAM_ENST00000322350.5_Missense_Mutation_p.R307G	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	307					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GACCATTTCTAGGCTCATCCC	0.483																																					p.R307G	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.A919G						PASS	.						155.0	147.0	149.0					5																	38407020		2203	4300	6503	SO:0001583	missense	133584	exon8			ATTTCTAGGCTCA	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.919A>G	chr5.hg19:g.38407020A>G	ENSP00000346964:p.Arg307Gly	101.0	0.0	.		99.0	4.0	.	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	hg19	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	A	11.67	1.706602	0.30232	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.80123	0.77;0.6;-1.34	5.69	1.96	0.26148	.	0.293605	0.35320	N	0.003289	T	0.70263	0.3204	M	0.72118	2.19	0.09310	N	1	B;P;P	0.40834	0.196;0.611;0.73	B;B;B	0.32980	0.067;0.075;0.156	T	0.64833	-0.6314	10	0.52906	T	0.07	-20.3281	2.0497	0.03568	0.416:0.32:0.1499:0.114	.	73;307;307	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	G	307;307;73;73	ENSP00000346964:R307G;ENSP00000313084:R307G;ENSP00000337607:R73G	ENSP00000313084:R307G	R	+	1	2	EGFLAM	38442777	0.487000	0.25988	0.030000	0.17652	0.190000	0.23558	1.133000	0.31430	0.102000	0.17638	-0.256000	0.11100	AGG	.	.	.	none		0.483	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
XRCC4	7518	hgsc.bcm.edu	37	5	82406899	82406899	+	Silent	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr5:82406899G>T	ENST00000511817.1	+	3	272	c.192G>T	c.(190-192)ggG>ggT	p.G64G	XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000396027.4_Silent_p.G64G|XRCC4_ENST00000282268.3_Silent_p.G64G|XRCC4_ENST00000338635.6_Silent_p.G64G			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	64					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TGGAAAAAGGGAAATATGTTG	0.338								Non-homologous end-joining																													p.G64G		Atlas-SNP	.											.	XRCC4	37	.	0			c.G192T						PASS	.						98.0	95.0	96.0					5																	82406899		2203	4300	6503	SO:0001819	synonymous_variant	7518	exon3			AAAAGGGAAATAT	AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.192G>T	chr5.hg19:g.82406899G>T		65.0	0.0	.		53.0	22.0	.	NM_003401	A8K3X4|Q9BS72|Q9UP94	Silent	SNP	ENST00000511817.1	hg19	CCDS4059.1																																																																																			.	.	.	none		0.338	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369624.1	NM_022550	
ERAP1	51752	hgsc.bcm.edu	37	5	96139212	96139212	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr5:96139212G>A	ENST00000443439.2	-	2	484	c.418C>T	c.(418-420)Ctt>Ttt	p.L140F	ERAP1_ENST00000296754.3_Missense_Mutation_p.L140F|CTD-2260A17.3_ENST00000606656.1_RNA|CTD-2260A17.3_ENST00000606346.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	140					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		AGCCCGACAAGGAGGGGCTCG	0.557																																					p.L140F		Atlas-SNP	.											.	ERAP1	59	.	0			c.C418T						PASS	.						63.0	70.0	68.0					5																	96139212		2203	4300	6503	SO:0001583	missense	51752	exon2			CGACAAGGAGGGG	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.418C>T	chr5.hg19:g.96139212G>A	ENSP00000406304:p.Leu140Phe	107.0	0.0	.		101.0	40.0	.	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	hg19	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	G	4.542	0.100606	0.08731	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.02763	4.17;4.17	5.51	2.68	0.31781	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.757856	0.12763	N	0.441158	T	0.03564	0.0102	L	0.52011	1.625	0.09310	N	1	B;B	0.15719	0.014;0.004	B;B	0.23852	0.049;0.019	T	0.48456	-0.9034	10	0.11182	T	0.66	.	9.253	0.37566	0.0:0.2989:0.4675:0.2337	.	140;140	Q9NZ08;Q9NZ08-2	ERAP1_HUMAN;.	F	140	ENSP00000296754:L140F;ENSP00000406304:L140F	ENSP00000296754:L140F	L	-	1	0	ERAP1	96164968	0.156000	0.22821	0.002000	0.10522	0.010000	0.07245	0.894000	0.28350	0.243000	0.21327	0.561000	0.74099	CTT	.	.	.	none		0.557	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
LY6G6F	259215	hgsc.bcm.edu	37	6	31677862	31677862	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr6:31677862A>T	ENST00000375832.4	+	4	728	c.706A>T	c.(706-708)Att>Ttt	p.I236F	LY6G6F_ENST00000556581.1_Missense_Mutation_p.I236F|MEGT1_ENST00000503322.1_Missense_Mutation_p.I236F|XXbac-BPG32J3.20_ENST00000461287.1_Intron	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						CATGCCTTGGATTCTGATGCT	0.617																																					p.I236F		Atlas-SNP	.											.	LY6G6F	23	.	0			c.A706T						PASS	.						93.0	67.0	76.0					6																	31677862		1511	2708	4219	SO:0001583	missense	259215	exon4			CCTTGGATTCTGA		CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.706A>T	chr6.hg19:g.31677862A>T	ENSP00000364992:p.Ile236Phe	71.0	0.0	.		54.0	17.0	.	NM_001003693	B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Missense_Mutation	SNP	ENST00000375832.4	hg19	CCDS34403.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.015117	0.35511	.	.	ENSG00000204424;ENSG00000204424;ENSG00000250641	ENST00000556581;ENST00000375832;ENST00000503322	T;T;T	0.26957	1.99;1.7;1.99	5.25	4.09	0.47781	.	0.098536	0.44688	D	0.000436	T	0.20981	0.0505	M	0.66939	2.045	0.32179	N	0.580661	D;P	0.54047	0.964;0.906	P;P	0.51101	0.659;0.546	T	0.12319	-1.0552	10	0.87932	D	0	-13.2059	7.687	0.28546	0.9038:0.0:0.0962:0.0	.	236;236	Q9NZJ1;Q5SQ64	.;LY66F_HUMAN	F	236	ENSP00000452432:I236F;ENSP00000364992:I236F;ENSP00000421232:I236F	ENSP00000364992:I236F	I	+	1	0	XXbac-BPG32J3.19;LY6G6F	31785841	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	1.214000	0.32419	0.844000	0.35094	0.477000	0.44152	ATT	.	.	.	none		0.617	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076532.2	NM_001003693	
GSTA2	2939	hgsc.bcm.edu	37	6	52617715	52617715	+	Missense_Mutation	SNP	T	T	A	rs200252041		TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr6:52617715T>A	ENST00000493422.1	-	5	506	c.351A>T	c.(349-351)caA>caT	p.Q117H		NM_000846.4	NP_000837.3	P09210	GSTA2_HUMAN	glutathione S-transferase alpha 2	117	GST C-terminal.				epithelial cell differentiation (GO:0030855)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(77;0.118)				Azathioprine(DB00993)|Busulfan(DB01008)|Chloroquine(DB00608)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Vitamin E(DB00163)	GCTTGGCATCTTGTTCCTCAG	0.393																																					p.Q117H		Atlas-SNP	.											.	GSTA2	33	.	0			c.A351T						PASS	.						240.0	229.0	233.0					6																	52617715		2203	4300	6503	SO:0001583	missense	2939	exon5			GGCATCTTGTTCC	AL109918	CCDS4944.1	6p12.2	2012-06-21	2008-11-26		ENSG00000244067	ENSG00000244067	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4627	protein-coding gene	gene with protein product		138360	"""glutathione S-transferase A2"""	GST2			Standard	NM_000846		Approved		uc003pay.3	P09210	OTTHUMG00000016263	ENST00000493422.1:c.351A>T	chr6.hg19:g.52617715T>A	ENSP00000420168:p.Gln117His	329.0	0.0	.		366.0	132.0	.	NM_000846	Q12759|Q16491|Q9NTY6	Missense_Mutation	SNP	ENST00000493422.1	hg19	CCDS4944.1	.	.	.	.	.	.	.	.	.	.	t	10.44	1.349542	0.24426	.	.	ENSG00000244067	ENST00000493422	T	0.02067	4.47	2.26	2.26	0.28386	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.539313	0.17882	N	0.158839	T	0.01092	0.0036	L	0.31926	0.97	0.09310	N	1	B	0.28233	0.204	B	0.38056	0.264	T	0.45775	-0.9238	10	0.87932	D	0	.	8.464	0.32944	0.0:0.0:0.0:1.0	.	117	P09210	GSTA2_HUMAN	H	117	ENSP00000420168:Q117H	ENSP00000420168:Q117H	Q	-	3	2	GSTA2	52725674	0.000000	0.05858	0.030000	0.17652	0.008000	0.06430	-0.493000	0.06459	1.310000	0.45006	0.254000	0.18369	CAA	.	T|1.000;C|0.000	.	alt		0.393	GSTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043589.1	NM_000846	
SOBP	55084	hgsc.bcm.edu	37	6	107955224	107955224	+	Silent	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr6:107955224G>T	ENST00000317357.5	+	6	1835	c.1176G>T	c.(1174-1176)ccG>ccT	p.P392P		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		ACCGCGGCCCGGTGCCGCTGC	0.672																																					p.P392P		Atlas-SNP	.											.	SOBP	53	.	0			c.G1176T						PASS	.						63.0	70.0	68.0					6																	107955224		2018	4170	6188	SO:0001819	synonymous_variant	55084	exon6			CGGCCCGGTGCCG	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.1176G>T	chr6.hg19:g.107955224G>T		148.0	0.0	.		141.0	6.0	.	NM_018013		Silent	SNP	ENST00000317357.5	hg19	CCDS43488.1																																																																																			.	.	.	none		0.672	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
CPVL	54504	hgsc.bcm.edu	37	7	29135764	29135764	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr7:29135764G>T	ENST00000409850.1	-	8	1004	c.358C>A	c.(358-360)Ctc>Atc	p.L120I	CPVL_ENST00000488891.2_5'UTR|CPVL_ENST00000396276.3_Missense_Mutation_p.L120I|CPVL_ENST00000265394.5_Missense_Mutation_p.L120I			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	120						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						TCCACAAAGAGTCCAAACATG	0.468																																					p.L120I		Atlas-SNP	.											.	CPVL	60	.	0			c.C358A						PASS	.						177.0	165.0	169.0					7																	29135764		2203	4300	6503	SO:0001583	missense	54504	exon4			CAAAGAGTCCAAA	AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.358C>A	chr7.hg19:g.29135764G>T	ENSP00000387164:p.Leu120Ile	216.0	0.0	.		218.0	71.0	.	NM_019029	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	ENST00000409850.1	hg19	CCDS5419.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911407	0.92178	.	.	ENSG00000106066	ENST00000265394;ENST00000396276;ENST00000409850;ENST00000542995;ENST00000448959;ENST00000458405;ENST00000447426	D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.93789	0.8014	M	0.85777	2.775	0.80722	D	1	D	0.69078	0.997	D	0.65573	0.936	D	0.93612	0.6940	10	0.46703	T	0.11	-0.6878	18.7662	0.91874	0.0:0.0:1.0:0.0	.	120	Q9H3G5	CPVL_HUMAN	I	120;120;120;4;50;4;50	ENSP00000265394:L120I;ENSP00000379572:L120I;ENSP00000387164:L120I;ENSP00000409036:L50I;ENSP00000417015:L4I;ENSP00000395690:L50I	ENSP00000265394:L120I	L	-	1	0	CPVL	29102289	1.000000	0.71417	0.998000	0.56505	0.918000	0.54935	6.732000	0.74790	2.519000	0.84933	0.491000	0.48974	CTC	.	.	.	none		0.468	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029	
EIF3E	3646	hgsc.bcm.edu	37	8	109215296	109215296	+	Silent	SNP	A	A	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr8:109215296A>T	ENST00000220849.5	-	12	1277	c.1215T>A	c.(1213-1215)atT>atA	p.I405I	EIF3E_ENST00000519517.1_5'Flank|EIF3E_ENST00000519030.1_Silent_p.I312I	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TGGTCTTTTCAATCACTTGCT	0.393																																					p.I405I	GBM(15;360 410 8460 34179 52246)	Atlas-SNP	.											.	EIF3E	73	.	0			c.T1215A						PASS	.						157.0	141.0	147.0					8																	109215296		2203	4297	6500	SO:0001819	synonymous_variant	3646	exon12			CTTTTCAATCACT	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.1215T>A	chr8.hg19:g.109215296A>T		88.0	0.0	.		112.0	41.0	.	NM_001568		Silent	SNP	ENST00000220849.5	hg19	CCDS6308.1	.	.	.	.	.	.	.	.	.	.	A	10.72	1.431022	0.25726	.	.	ENSG00000104408	ENST00000522352	.	.	.	5.7	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.5683	7.9818	0.30188	0.8114:0.0:0.0671:0.1214	.	.	.	.	R	116	.	.	X	-	1	0	EIF3E	109284472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.959000	0.40412	0.964000	0.38108	0.477000	0.44152	TGA	.	.	.	none		0.393	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39140600	39140600	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr9:39140600G>A	ENST00000297668.6	-	12	1865	c.1792C>T	c.(1792-1794)Cga>Tga	p.R598*	CNTNAP3_ENST00000377659.1_Nonsense_Mutation_p.R598*|CNTNAP3_ENST00000377656.2_Nonsense_Mutation_p.R598*|CNTNAP3_ENST00000358144.2_Nonsense_Mutation_p.R510*|CNTNAP3_ENST00000323947.7_Nonsense_Mutation_p.R505*	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	598	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GGGTTCCCTCGGTGCTTGTGG	0.468																																					p.R598X		Atlas-SNP	.											.	CNTNAP3	82	.	0			c.C1792T						PASS	.						38.0	44.0	42.0					9																	39140600		2203	4300	6503	SO:0001587	stop_gained	79937	exon12			TCCCTCGGTGCTT	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1792C>T	chr9.hg19:g.39140600G>A	ENSP00000297668:p.Arg598*	107.0	0.0	.		98.0	32.0	.	NM_033655	B1AMA0|Q9C0E9	Nonsense_Mutation	SNP	ENST00000297668.6	hg19	CCDS6616.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384365	0.82792	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000323947;ENST00000377659	.	.	.	2.85	1.69	0.24217	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	7.9696	0.30119	0.0:0.0:0.2419:0.7581	.	.	.	.	X	598;598;510;505;598	.	ENSP00000297668:R598X	R	-	1	2	CNTNAP3	39130600	0.593000	0.26840	0.377000	0.26055	0.034000	0.12701	0.720000	0.25896	0.328000	0.23435	0.440000	0.28878	CGA	.	.	.	none		0.468	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
INVS	27130	hgsc.bcm.edu	37	9	103059359	103059359	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr9:103059359C>A	ENST00000262457.2	+	15	3132	c.2947C>A	c.(2947-2949)Ccc>Acc	p.P983T	INVS_ENST00000541287.1_Missense_Mutation_p.P887T|INVS_ENST00000262456.2_Missense_Mutation_p.P813T	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	983					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				AAGCAAGGCCCCCAAGAGTCC	0.498																																					p.P983T		Atlas-SNP	.											.	INVS	81	.	0			c.C2947A						PASS	.						89.0	83.0	85.0					9																	103059359		2203	4300	6503	SO:0001583	missense	27130	exon15			AAGGCCCCCAAGA	AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2947C>A	chr9.hg19:g.103059359C>A	ENSP00000262457:p.Pro983Thr	50.0	0.0	.		53.0	31.0	.	NM_014425	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	ENST00000262457.2	hg19	CCDS6746.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.983872	0.00443	.	.	ENSG00000119509	ENST00000262457;ENST00000541287;ENST00000262456	T;T;T	0.38722	1.15;1.15;1.12	5.25	-0.716	0.11212	.	0.687064	0.14809	N	0.297151	T	0.16854	0.0405	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.0	T	0.13899	-1.0492	10	0.56958	D	0.05	.	3.4624	0.07537	0.1837:0.4859:0.231:0.0995	.	887;983;813	F5GZH2;Q9Y283;Q9Y283-2	.;INVS_HUMAN;.	T	983;887;813	ENSP00000262457:P983T;ENSP00000444454:P887T;ENSP00000262456:P813T	ENSP00000262456:P813T	P	+	1	0	INVS	102099180	0.023000	0.18921	0.222000	0.23844	0.317000	0.28152	0.424000	0.21330	0.160000	0.19432	0.650000	0.86243	CCC	.	.	.	none		0.498	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425	
PRKG1	5592	hgsc.bcm.edu	37	10	53227571	53227571	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr10:53227571C>G	ENST00000401604.2	+	3	716	c.522C>G	c.(520-522)aaC>aaG	p.N174K	PRKG1_ENST00000373985.1_Missense_Mutation_p.N162K|PRKG1_ENST00000373980.4_Missense_Mutation_p.N189K			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	174	cGMP-binding, high affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTCTTTACAACTGTACCCGGA	0.383																																					p.N189K		Atlas-SNP	.											.	PRKG1	167	.	0			c.C567G						PASS	.						154.0	141.0	145.0					10																	53227571		2203	4300	6503	SO:0001583	missense	5592	exon3			TTACAACTGTACC		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.522C>G	chr10.hg19:g.53227571C>G	ENSP00000384200:p.Asn174Lys	94.0	0.0	.		119.0	40.0	.	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	hg19	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475767	0.84640	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	D;D;D;D	0.96940	-4.18;-4.18;-1.92;-1.92	5.79	4.89	0.63831	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.115539	0.56097	D	0.000027	D	0.97983	0.9336	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	0.983;1.0;0.998	P;D;D	0.75484	0.82;0.985;0.986	D	0.98576	1.0648	10	0.87932	D	0	-19.8616	12.5809	0.56390	0.0:0.9197:0.0:0.0803	.	174;189;174	B4DT93;Q13976-2;Q13976	.;.;KGP1_HUMAN	K	174;162;189;47	ENSP00000384200:N174K;ENSP00000363097:N162K;ENSP00000363092:N189K;ENSP00000363087:N47K	ENSP00000363087:N47K	N	+	3	2	PRKG1	52897577	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.118000	0.31246	1.450000	0.47717	0.563000	0.77884	AAC	.	.	.	none		0.383	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CDH23	64072	hgsc.bcm.edu	37	10	73406335	73406335	+	Silent	SNP	C	C	T	rs549569431	byFrequency	TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr10:73406335C>T	ENST00000224721.6	+	13	1430	c.1425C>T	c.(1423-1425)taC>taT	p.Y475Y	CDH23_ENST00000299366.7_Silent_p.Y515Y|CDH23_ENST00000398809.4_Silent_p.Y470Y|CDH23_ENST00000398842.3_Silent_p.Y470Y|CDH23_ENST00000461841.3_Silent_p.Y515Y	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	470	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						TCAGCCTGTACGAGAACGTCA	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		19433	0.0		0.0	False		,,,				2504	0.002				p.Y470Y		Atlas-SNP	.											.	CDH23	365	.	0			c.C1410T						PASS	.						160.0	169.0	166.0					10																	73406335		2132	4248	6380	SO:0001819	synonymous_variant	64072	exon13			CCTGTACGAGAAC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.1425C>T	chr10.hg19:g.73406335C>T		235.0	0.0	.		219.0	64.0	.	NM_052836	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	hg19																																																																																				.	.	.	none		0.577	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
HNRNPUL2	221092	hgsc.bcm.edu	37	11	62491826	62491826	+	Missense_Mutation	SNP	C	C	A	rs577159200		TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr11:62491826C>A	ENST00000301785.5	-	2	803	c.611G>T	c.(610-612)cGg>cTg	p.R204L	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.R204L	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	204	Glu-rich. {ECO:0000255}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CTTCTCATCCCGCTGTCTCTT	0.512																																					p.R204L		Atlas-SNP	.											.	HNRNPUL2	41	.	0			c.G611T						PASS	.						132.0	133.0	133.0					11																	62491826		1970	4165	6135	SO:0001583	missense	221092	exon2			TCATCCCGCTGTC		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.611G>T	chr11.hg19:g.62491826C>A	ENSP00000301785:p.Arg204Leu	175.0	0.0	.		177.0	12.0	.	NM_001079559	Q8N3B3	Missense_Mutation	SNP	ENST00000301785.5	hg19	CCDS41659.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454369	0.84209	.	.	ENSG00000214753	ENST00000301785	T	0.65178	-0.14	4.9	4.9	0.64082	.	0.423150	0.24037	N	0.042138	T	0.68686	0.3028	L	0.36672	1.1	0.45284	D	0.998283	D	0.60160	0.987	D	0.65010	0.931	T	0.70974	-0.4726	10	0.72032	D	0.01	-11.7379	13.4322	0.61062	0.0:1.0:0.0:0.0	.	204	Q1KMD3	HNRL2_HUMAN	L	204	ENSP00000301785:R204L	ENSP00000301785:R204L	R	-	2	0	HNRNPUL2	62248402	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.879000	0.75572	2.547000	0.85894	0.655000	0.94253	CGG	.	.	.	none		0.512	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877	
PC	5091	hgsc.bcm.edu	37	11	66636376	66636376	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr11:66636376G>T	ENST00000393958.2	-	9	1056	c.963C>A	c.(961-963)taC>taA	p.Y321*	PC_ENST00000393955.2_Nonsense_Mutation_p.Y321*|PC_ENST00000524491.1_Nonsense_Mutation_p.Y281*|PC_ENST00000355677.3_Nonsense_Mutation_p.Y321*|PC_ENST00000393960.1_Nonsense_Mutation_p.Y321*	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	321	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CCTCGATGAAGTAGTGCTTGC	0.677																																					p.Y321X		Atlas-SNP	.											.	PC	116	.	0			c.C963A						PASS	.						90.0	79.0	83.0					11																	66636376		2200	4295	6495	SO:0001587	stop_gained	5091	exon9			GATGAAGTAGTGC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.963C>A	chr11.hg19:g.66636376G>T	ENSP00000377530:p.Tyr321*	94.0	0.0	.		123.0	38.0	.	NM_000920	B4DN00|Q16705	Nonsense_Mutation	SNP	ENST00000393958.2	hg19	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	G	36	5.754004	0.96890	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	.	.	.	4.65	2.37	0.29283	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0017	6.9367	0.24470	0.3253:0.0:0.6747:0.0	.	.	.	.	X	321;321;321;281;321	.	ENSP00000347900:Y321X	Y	-	3	2	PC	66392952	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.978000	0.49305	0.954000	0.37851	0.561000	0.74099	TAC	.	.	.	none		0.677	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
MMP27	64066	hgsc.bcm.edu	37	11	102573542	102573542	+	Silent	SNP	C	C	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr11:102573542C>A	ENST00000260229.4	-	4	652	c.561G>T	c.(559-561)ccG>ccT	p.P187P		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	187					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P187P(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CACCCAGACCCGGACCAGGAG	0.443																																					p.P187P		Atlas-SNP	.											MMP27,NS,carcinoma,0,2	MMP27	84	.	2	Substitution - coding silent(2)	lung(1)|central_nervous_system(1)	c.G561T						PASS	.						84.0	88.0	86.0					11																	102573542		2203	4299	6502	SO:0001819	synonymous_variant	64066	exon4			CAGACCCGGACCA	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.561G>T	chr11.hg19:g.102573542C>A		134.0	1.0	.		160.0	8.0	.	NM_022122	Q6UWK6	Silent	SNP	ENST00000260229.4	hg19	CCDS8319.1																																																																																			.	.	.	none		0.443	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	
GNPTAB	79158	hgsc.bcm.edu	37	12	102147162	102147162	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr12:102147162T>C	ENST00000299314.7	-	19	3852	c.3590A>G	c.(3589-3591)gAg>gGg	p.E1197G		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	1197					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						TTCCTGCAGCTCATGCATATG	0.383																																					p.E1197G		Atlas-SNP	.											.	GNPTAB	120	.	0			c.A3590G						PASS	.						126.0	114.0	118.0					12																	102147162		2203	4300	6503	SO:0001583	missense	79158	exon19			TGCAGCTCATGCA	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.3590A>G	chr12.hg19:g.102147162T>C	ENSP00000299314:p.Glu1197Gly	68.0	0.0	.		77.0	28.0	.	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	hg19	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490528	0.64074	.	.	ENSG00000111670	ENST00000299314	D	0.83163	-1.69	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.89196	0.6646	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88424	0.3030	10	0.39692	T	0.17	-26.24	15.9351	0.79698	0.0:0.0:0.0:1.0	.	1197	Q3T906	GNPTA_HUMAN	G	1197	ENSP00000299314:E1197G	ENSP00000299314:E1197G	E	-	2	0	GNPTAB	100671293	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.694000	0.84235	2.167000	0.68274	0.482000	0.46254	GAG	.	.	.	none		0.383	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
RASAL1	8437	hgsc.bcm.edu	37	12	113565934	113565934	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr12:113565934T>A	ENST00000261729.5	-	4	487	c.172A>T	c.(172-174)Acg>Tcg	p.T58S	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.T58S|RASAL1_ENST00000446861.3_Missense_Mutation_p.T58S|RASAL1_ENST00000546530.1_Missense_Mutation_p.T58S			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	58	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.		T -> M (in dbSNP:rs34598602). {ECO:0000269|PubMed:15489334}.		intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						AGGTGCACCGTGTACTCCTCC	0.617																																					p.T58S		Atlas-SNP	.											.	RASAL1	89	.	0			c.A172T						PASS	.						197.0	195.0	196.0					12																	113565934		2203	4300	6503	SO:0001583	missense	8437	exon4			GCACCGTGTACTC	AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.172A>T	chr12.hg19:g.113565934T>A	ENSP00000261729:p.Thr58Ser	327.0	0.0	.		349.0	118.0	.	NM_004658	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	ENST00000261729.5	hg19	CCDS9165.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.130000	0.77549	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.12	5.12	0.69794	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	L	0.45137	1.4	0.41650	D	0.98912	D;D;D;P;D;D	0.89917	1.0;1.0;1.0;0.698;0.994;1.0	D;D;D;P;D;D	0.91635	0.999;0.999;0.999;0.503;0.932;0.999	T	0.74191	-0.3745	10	0.36615	T	0.2	.	13.8909	0.63738	0.0:0.0:0.0:1.0	.	58;58;70;58;58;58	B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;RASL1_HUMAN;.	S	58	ENSP00000450244:T58S;ENSP00000261729:T58S;ENSP00000395920:T58S;ENSP00000448510:T58S	ENSP00000261729:T58S	T	-	1	0	RASAL1	112050317	1.000000	0.71417	0.993000	0.49108	0.930000	0.56654	7.259000	0.78381	1.939000	0.56221	0.402000	0.26972	ACG	.	.	.	none		0.617	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405522.2	NM_004658	
SACS	26278	hgsc.bcm.edu	37	13	23906994	23906994	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr13:23906994T>C	ENST00000382292.3	-	9	11294	c.11021A>G	c.(11020-11022)aAt>aGt	p.N3674S	SACS_ENST00000402364.1_Missense_Mutation_p.N2924S|SACS_ENST00000382298.3_Missense_Mutation_p.N3674S			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3674					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAGTGTTCCATTTACCTCTTG	0.393																																					p.N3674S		Atlas-SNP	.											.	SACS	871	.	0			c.A11021G						PASS	.						85.0	85.0	85.0					13																	23906994		2203	4300	6503	SO:0001583	missense	26278	exon10			GTTCCATTTACCT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11021A>G	chr13.hg19:g.23906994T>C	ENSP00000371729:p.Asn3674Ser	82.0	0.0	.		102.0	43.0	.	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	11.44	1.639656	0.29157	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87571	-2.12;-2.27;-2.12	5.8	5.8	0.92144	.	0.045544	0.85682	D	0.000000	T	0.79118	0.4392	N	0.17082	0.46	0.33015	D	0.528049	B	0.17465	0.022	B	0.14023	0.01	T	0.78450	-0.2199	10	0.33940	T	0.23	.	16.1429	0.81539	0.0:0.0:0.0:1.0	.	3674	Q9NZJ4	SACS_HUMAN	S	3674;2924;3674	ENSP00000371729:N3674S;ENSP00000385844:N2924S;ENSP00000371735:N3674S	ENSP00000371729:N3674S	N	-	2	0	SACS	22804994	1.000000	0.71417	0.981000	0.43875	0.722000	0.41435	4.970000	0.63742	2.209000	0.71365	0.460000	0.39030	AAT	.	.	.	none		0.393	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
IQGAP1	8826	hgsc.bcm.edu	37	15	91009552	91009552	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr15:91009552G>T	ENST00000268182.5	+	17	2043	c.1919G>T	c.(1918-1920)gGc>gTc	p.G640V	IQGAP1_ENST00000560738.1_Missense_Mutation_p.G68V	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	640					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGTGATGTTGGCAAAACACTG	0.443																																					p.G640V		Atlas-SNP	.											.	IQGAP1	140	.	0			c.G1919T						PASS	.						148.0	124.0	132.0					15																	91009552		2198	4298	6496	SO:0001583	missense	8826	exon17			ATGTTGGCAAAAC	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1919G>T	chr15.hg19:g.91009552G>T	ENSP00000268182:p.Gly640Val	147.0	0.0	.		123.0	33.0	.	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	hg19	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.470092	0.26423	.	.	ENSG00000140575	ENST00000268182	D	0.95171	-3.63	5.29	3.3	0.37823	.	0.339619	0.31268	N	0.007960	D	0.88444	0.6438	N	0.16478	0.41	0.33977	D	0.647533	B	0.02656	0.0	B	0.04013	0.001	D	0.87361	0.2344	10	0.35671	T	0.21	-7.5112	14.694	0.69107	0.0:0.4098:0.5901:0.0	.	640	P46940	IQGA1_HUMAN	V	640	ENSP00000268182:G640V	ENSP00000268182:G640V	G	+	2	0	IQGAP1	88810556	0.653000	0.27358	0.946000	0.38457	0.974000	0.67602	2.180000	0.42537	1.438000	0.47492	0.655000	0.94253	GGC	.	.	.	none		0.443	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
CNOT1	23019	hgsc.bcm.edu	37	16	58620607	58620607	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr16:58620607T>C	ENST00000317147.5	-	7	811	c.479A>G	c.(478-480)tAc>tGc	p.Y160C	CNOT1_ENST00000441024.2_Missense_Mutation_p.Y160C|CNOT1_ENST00000569240.1_Missense_Mutation_p.Y160C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	160					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TGCGTCAATGTAAGAACGCAG	0.458																																					p.Y160C		Atlas-SNP	.											.	CNOT1	359	.	0			c.A479G						PASS	.						218.0	225.0	223.0					16																	58620607		2198	4300	6498	SO:0001583	missense	23019	exon7			TCAATGTAAGAAC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.479A>G	chr16.hg19:g.58620607T>C	ENSP00000320949:p.Tyr160Cys	397.0	0.0	.		385.0	106.0	.	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.651332	0.88056	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.24350	1.86;1.86	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.49813	0.1579	M	0.71206	2.165	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.999	D;P;P	0.81914	0.995;0.808;0.871	T	0.49380	-0.8946	9	.	.	.	-13.1581	15.1793	0.72941	0.0:0.0:0.0:1.0	.	160;160;160	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	160	ENSP00000320949:Y160C;ENSP00000413113:Y160C	.	Y	-	2	0	CNOT1	57178108	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.041000	0.60428	0.454000	0.30748	TAC	.	.	.	none		0.458	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
BCO1	53630	hgsc.bcm.edu	37	16	81298288	81298288	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr16:81298288A>G	ENST00000258168.2	+	5	976	c.515A>G	c.(514-516)cAt>cGt	p.H172R	BCMO1_ENST00000425577.2_Missense_Mutation_p.H103R	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GCAACGTCACATCCCCATTAT	0.403																																					p.H172R		Atlas-SNP	.											.	BCMO1	53	.	0			c.A515G						PASS	.						160.0	135.0	143.0					16																	81298288		2202	4300	6502	SO:0001583	missense	53630	exon5			CGTCACATCCCCA																												ENST00000258168.2:c.515A>G	chr16.hg19:g.81298288A>G	ENSP00000258168:p.His172Arg	115.0	0.0	.		102.0	31.0	.	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	hg19	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125684	0.77436	.	.	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.99545	-6.13;-6.13	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.99715	0.9890	H	0.94658	3.565	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.971	D	0.97280	0.9917	10	0.87932	D	0	-25.987	14.8045	0.69942	1.0:0.0:0.0:0.0	.	103;172	E7EM88;Q9HAY6	.;BCDO1_HUMAN	R	172;103	ENSP00000258168:H172R;ENSP00000400586:H103R	ENSP00000258168:H172R	H	+	2	0	BCMO1	79855789	1.000000	0.71417	0.989000	0.46669	0.843000	0.47879	8.759000	0.91667	1.896000	0.54893	0.449000	0.29647	CAT	.	.	.	none		0.403	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
MED13	9969	hgsc.bcm.edu	37	17	60040331	60040331	+	Splice_Site	SNP	T	T	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr17:60040331T>G	ENST00000397786.2	-	21	4922	c.4846A>C	c.(4846-4848)Acg>Ccg	p.T1616P		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1616					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CGATCCATCGTGCTAAAATTT	0.398																																					p.T1616P		Atlas-SNP	.											.	MED13	181	.	0			c.A4846C						PASS	.						62.0	60.0	60.0					17																	60040331		1850	4094	5944	SO:0001630	splice_region_variant	9969	exon21			CCATCGTGCTAAA	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.4845-1A>C	chr17.hg19:g.60040331T>G		91.0	0.0	.		131.0	34.0	.	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199056	0.79015	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.76060	-0.99	5.44	4.34	0.51931	.	0.045205	0.85682	D	0.000000	T	0.76786	0.4036	M	0.64997	1.995	0.80722	D	1	D	0.57899	0.981	P	0.52109	0.69	T	0.73544	-0.3949	10	0.29301	T	0.29	-33.0615	11.6656	0.51372	0.1329:0.0:0.0:0.8671	.	1616	Q9UHV7	MED13_HUMAN	P	1616;1615	ENSP00000380888:T1616P	ENSP00000262436:T1615P	T	-	1	0	MED13	57395113	1.000000	0.71417	0.989000	0.46669	0.957000	0.61999	5.940000	0.70187	0.864000	0.35578	0.533000	0.62120	ACG	.	.	.	none		0.398	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	Missense_Mutation
ITGB4	3691	hgsc.bcm.edu	37	17	73746316	73746316	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr17:73746316G>A	ENST00000200181.3	+	28	3628	c.3441G>A	c.(3439-3441)tgG>tgA	p.W1147*	ITGB4_ENST00000449880.2_Nonsense_Mutation_p.W1147*|ITGB4_ENST00000450894.3_Nonsense_Mutation_p.W1147*|ITGB4_ENST00000579662.1_Nonsense_Mutation_p.W1147*|ITGB4_ENST00000339591.3_Nonsense_Mutation_p.W1147*	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1147	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			ATTTCAACTGGCTGCCCCCTT	0.632											OREG0024739	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W1147X		Atlas-SNP	.											.	ITGB4	165	.	0			c.G3441A						PASS	.						33.0	34.0	33.0					17																	73746316		2203	4300	6503	SO:0001587	stop_gained	3691	exon28			CAACTGGCTGCCC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.3441G>A	chr17.hg19:g.73746316G>A	ENSP00000200181:p.Trp1147*	58.0	0.0	.	1147	90.0	46.0	.	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Nonsense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	45	11.812557	0.99605	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	.	.	.	X	1147	.	ENSP00000200181:W1147X	W	+	3	0	ITGB4	71257911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.280000	0.89903	2.675000	0.91044	0.655000	0.94253	TGG	.	.	.	none		0.632	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
ABCA7	10347	hgsc.bcm.edu	37	19	1061844	1061844	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr19:1061844G>A	ENST00000263094.6	+	41	5758	c.5527G>A	c.(5527-5529)Gac>Aac	p.D1843N	ABCA7_ENST00000433129.1_Missense_Mutation_p.D1843N|ABCA7_ENST00000435683.2_Missense_Mutation_p.D1705N	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1843	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGACGGGGGACACATTGGC	0.642																																					p.D1843N		Atlas-SNP	.											.	ABCA7	174	.	0			c.G5527A						PASS	.						98.0	83.0	88.0					19																	1061844		2203	4299	6502	SO:0001583	missense	10347	exon41			ACGGGGGACACAT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5527G>A	chr19.hg19:g.1061844G>A	ENSP00000263094:p.Asp1843Asn	72.0	0.0	.		60.0	16.0	.	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.975956	0.53720	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.96200	-3.94;-3.94	3.57	2.52	0.30459	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.94837	0.8332	L	0.27053	0.805	0.43133	D	0.994875	D;D	0.76494	0.999;0.978	D;P	0.79784	0.993;0.906	D	0.93757	0.7063	9	0.87932	D	0	.	9.6422	0.39846	0.1075:0.0:0.8925:0.0	.	968;1843	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	N	1843	ENSP00000263094:D1843N;ENSP00000414062:D1843N	ENSP00000263094:D1843N	D	+	1	0	ABCA7	1012844	1.000000	0.71417	0.969000	0.41365	0.089000	0.18198	7.374000	0.79633	0.692000	0.31613	-0.258000	0.10820	GAC	.	.	.	none		0.642	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
SH2D3A	10045	hgsc.bcm.edu	37	19	6760836	6760836	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr19:6760836A>G	ENST00000245908.6	-	3	501	c.232T>C	c.(232-234)Ttt>Ctt	p.F78L	SH2D3A_ENST00000599563.1_5'UTR|SH2D3A_ENST00000437152.3_Intron	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	78	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						TCCAGTTGAAAGAGGGCTGTG	0.642																																					p.F78L		Atlas-SNP	.											.	SH2D3A	53	.	0			c.T232C						PASS	.						64.0	63.0	64.0					19																	6760836		2203	4300	6503	SO:0001583	missense	10045	exon3			GTTGAAAGAGGGC	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.232T>C	chr19.hg19:g.6760836A>G	ENSP00000245908:p.Phe78Leu	95.0	0.0	.		99.0	32.0	.	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	ENST00000245908.6	hg19	CCDS12173.1	.	.	.	.	.	.	.	.	.	.	A	17.60	3.431070	0.62844	.	.	ENSG00000125731	ENST00000245908	T	0.65178	-0.14	4.88	4.88	0.63580	SH2 motif (4);	0.000000	0.43747	D	0.000537	T	0.66366	0.2782	M	0.74546	2.27	0.80722	D	1	B	0.33883	0.43	B	0.39876	0.312	T	0.71310	-0.4631	10	0.87932	D	0	-15.1205	12.5273	0.56093	1.0:0.0:0.0:0.0	.	78	Q9BRG2	SH23A_HUMAN	L	78	ENSP00000245908:F78L	ENSP00000245908:F78L	F	-	1	0	SH2D3A	6711836	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	7.241000	0.78201	2.062000	0.61559	0.454000	0.30748	TTT	.	.	.	none		0.642	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
MAP2K7	5609	hgsc.bcm.edu	37	19	7976338	7976338	+	Silent	SNP	A	A	G			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr19:7976338A>G	ENST00000397979.3	+	9	1008	c.954A>G	c.(952-954)ggA>ggG	p.G318G	MAP2K7_ENST00000545011.1_Silent_p.G360G|MAP2K7_ENST00000397981.3_Silent_p.G325G|MAP2K7_ENST00000397983.3_Silent_p.G334G|CTD-3193O13.13_ENST00000595655.1_RNA	NM_145185.2	NP_660186.1	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of neuron apoptotic process (GO:0043525)|response to heat (GO:0009408)|response to osmotic stress (GO:0006970)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(3)|endometrium(1)|large_intestine(8)|lung(4)|ovary(1)	19						TGGCAACAGGACAGTTTCCCT	0.607																																					p.G318G		Atlas-SNP	.											.	MAP2K7	66	.	0			c.A954G						PASS	.						44.0	49.0	47.0					19																	7976338		1939	4121	6060	SO:0001819	synonymous_variant	5609	exon9			AACAGGACAGTTT	AF006689	CCDS42491.1, CCDS74277.1, CCDS74278.1	19p13.3-p13.2	2011-06-09			ENSG00000076984	ENSG00000076984	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6847	protein-coding gene	gene with protein product		603014		PRKMK7		9312068	Standard	XM_005272489		Approved	MKK7, Jnkk2	uc002mit.3	O14733	OTTHUMG00000137368	ENST00000397979.3:c.954A>G	chr19.hg19:g.7976338A>G		76.0	0.0	.		40.0	12.0	.	NM_145185	B2R9S5|D6W659|O14648|O14816|O60452|O60453|Q1PG43|Q8IY10	Silent	SNP	ENST00000397979.3	hg19	CCDS42491.1																																																																																			.	.	.	none		0.607	MAP2K7-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267980.1		
ZNF613	79898	hgsc.bcm.edu	37	19	52448014	52448014	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr19:52448014G>T	ENST00000293471.6	+	6	1557	c.878G>T	c.(877-879)tGt>tTt	p.C293F	ZNF613_ENST00000391794.4_Missense_Mutation_p.C257F	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TGCAGTGATTGTGGAAAAGGC	0.438																																					p.C293F		Atlas-SNP	.											.	ZNF613	62	.	0			c.G878T						PASS	.						67.0	73.0	71.0					19																	52448014		2203	4300	6503	SO:0001583	missense	79898	exon6			GTGATTGTGGAAA	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.878G>T	chr19.hg19:g.52448014G>T	ENSP00000293471:p.Cys293Phe	91.0	0.0	.		107.0	30.0	.	NM_001031721	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	hg19	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176698	0.57692	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	D;D	0.85861	-2.04;-2.04	3.1	3.1	0.35709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36034	N	0.002824	D	0.94673	0.8282	H	0.97415	4	0.43662	D	0.99608	D	0.89917	1.0	D	0.91635	0.999	D	0.96089	0.9060	10	0.87932	D	0	.	13.4498	0.61163	0.0:0.0:1.0:0.0	.	293	Q6PF04	ZN613_HUMAN	F	293;257	ENSP00000293471:C293F;ENSP00000375671:C257F	ENSP00000293471:C293F	C	+	2	0	ZNF613	57139826	1.000000	0.71417	0.876000	0.34364	0.804000	0.45430	8.406000	0.90216	1.730000	0.51580	0.655000	0.94253	TGT	.	.	.	none		0.438	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840	
MKL1	57591	hgsc.bcm.edu	37	22	40803806	40803806	+	IGR	SNP	A	A	C			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr22:40803806A>C	ENST00000355630.3	-	0	4496				SGSM3_ENST00000248929.9_Missense_Mutation_p.K513T|SGSM3_ENST00000454798.2_Missense_Mutation_p.K446T	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GTGTCTCAGAAGGACGAGCAC	0.622			T	RBM15	acute megakaryocytic leukemia																																p.K513T		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	SGSM3	48	.	0			c.A1538C						PASS	.						60.0	61.0	60.0					22																	40803806		2203	4300	6503	SO:0001628	intergenic_variant	27352	exon14			CTCAGAAGGACGA	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		chr22.hg19:g.40803806A>C		83.0	0.0	.		108.0	31.0	.	NM_015705	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	hg19	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.958990	0.92726	.	.	ENSG00000100359	ENST00000248929;ENST00000454798	T;T	0.49720	0.77;0.77	5.23	5.23	0.72850	Src homology-3 domain (4);	0.045898	0.85682	D	0.000000	T	0.47911	0.1471	N	0.04820	-0.15	0.80722	D	1	D;D;D;D	0.65815	0.985;0.958;0.981;0.995	P;P;P;D	0.69479	0.876;0.904;0.905;0.964	T	0.61222	-0.7106	10	0.87932	D	0	.	15.4205	0.75006	1.0:0.0:0.0:0.0	.	450;446;541;513	B4DVE3;B4DMS2;Q96HU1-2;Q96HU1	.;.;.;SGSM3_HUMAN	T	513;446	ENSP00000248929:K513T;ENSP00000390998:K446T	ENSP00000248929:K513T	K	+	2	0	SGSM3	39133752	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.528000	0.90598	2.109000	0.64355	0.459000	0.35465	AAG	.	.	.	none		0.622	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
TEX11	56159	hgsc.bcm.edu	37	X	69898664	69898664	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chrX:69898664C>T	ENST00000395889.2	-	16	1432	c.1277G>A	c.(1276-1278)aGt>aAt	p.S426N	TEX11_ENST00000374320.2_Missense_Mutation_p.S101N|TEX11_ENST00000344304.3_Missense_Mutation_p.S426N|TEX11_ENST00000374333.2_Missense_Mutation_p.S411N	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	426					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					CTCAAAACTACTGGCAGCTTG	0.338																																					p.S426N		Atlas-SNP	.											.	TEX11	132	.	0			c.G1277A						PASS	.						111.0	97.0	102.0					X																	69898664		2203	4300	6503	SO:0001583	missense	56159	exon16			AAACTACTGGCAG	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1277G>A	chrX.hg19:g.69898664C>T	ENSP00000379226:p.Ser426Asn	56.0	0.0	.		48.0	17.0	.	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	C	4.605	0.112373	0.08831	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	4.58	-1.09	0.09904	Tetratricopeptide-like helical (1);	0.437979	0.23803	N	0.044403	T	0.45875	0.1364	N	0.08118	0	0.09310	N	1	B;B	0.26195	0.119;0.144	B;B	0.30251	0.069;0.113	T	0.30416	-0.9979	9	.	.	.	0.0168	3.6866	0.08331	0.1899:0.282:0.0:0.5281	.	411;426	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	N	411;426;101;426	ENSP00000363453:S411N;ENSP00000379226:S426N;ENSP00000363440:S101N;ENSP00000340995:S426N	.	S	-	2	0	TEX11	69815389	0.996000	0.38824	0.062000	0.19696	0.495000	0.33615	0.274000	0.18680	-0.223000	0.09943	-0.371000	0.07208	AGT	.	.	.	none		0.338	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
TRIM2	23321	hgsc.bcm.edu	37	4	154237027	154237027	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr4:154237027delG	ENST00000437508.2	+	8	1778	c.1577delG	c.(1576-1578)cggfs	p.R526fs	TRIM2_ENST00000338700.5_Frame_Shift_Del_p.R553fs	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	526					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TTTGGCATACGGGGACGCTCT	0.463																																					p.R553fs		Atlas-INDEL	.											.	TRIM2	105	.	0			c.1657delC						PASS	.						80.0	90.0	87.0					4																	154237027		2203	4300	6503	SO:0001589	frameshift_variant	23321	exon8			.	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.1577delG	chr4.hg19:g.154237027delG	ENSP00000415812:p.Arg526fs	162.0	0.0	0		136.0	52.0	0.382353	NM_015271	D3DP09|O60272|Q9BSI9|Q9UFZ1	Frame_Shift_Del	DEL	ENST00000437508.2	hg19	CCDS47147.1																																																																																			.	.	.	none		0.463	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
CHRFAM7A	89832	hgsc.bcm.edu	37	15	30665308	30665308	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr15:30665308delA	ENST00000299847.2	-	6	654	c.201delT	c.(199-201)tttfs	p.F67fs	CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000397827.3_5'UTR|CHRFAM7A_ENST00000401522.3_5'UTR	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	67						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CATCAAAGGGAAACCAGCGTA	0.483																																					p.P68fs		Atlas-INDEL	.											.	CHRFAM7A	15	.	0			c.202delC						PASS	.						61.0	60.0	61.0					15																	30665308		2176	4256	6432	SO:0001589	frameshift_variant	89832	exon6			.	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.201delT	chr15.hg19:g.30665308delA	ENSP00000299847:p.Phe67fs	779.0	0.0	0		732.0	118.0	0.161202	NM_139320	A8KAB9	Frame_Shift_Del	DEL	ENST00000299847.2	hg19	CCDS32184.1																																																																																			.	.	.	none		0.483	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430700.1	NM_148911	
KCNJ15	3772	hgsc.bcm.edu	37	21	39672237	39672239	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr21:39672237_39672239delGAG	ENST00000328656.4	+	4	1357_1359	c.1054_1056delGAG	c.(1054-1056)gagdel	p.E353del	KCNJ15_ENST00000398930.1_In_Frame_Del_p.E353del|KCNJ15_ENST00000398932.1_In_Frame_Del_p.E353del|KCNJ15_ENST00000398938.2_In_Frame_Del_p.E353del|KCNJ15_ENST00000398934.1_In_Frame_Del_p.E353del	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	353					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	ACAGCAACTCGAGGAGAAGTACA	0.443																																					p.351_352del		Atlas-INDEL	.											.	KCNJ15	43	.	0			c.1053_1055del						PASS	.																																			SO:0001651	inframe_deletion	3772	exon3			.	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.1054_1056delGAG	chr21.hg19:g.39672240_39672242delGAG	ENSP00000331698:p.Glu353del	74.0	0.0	0		66.0	18.0	0.272727	NM_170736	D3DSH5|O00564|Q96L28|Q99446	In_Frame_Del	DEL	ENST00000328656.4	hg19	CCDS13656.1																																																																																			.	.	.	none		0.443	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
TMEM30A	55754	hgsc.bcm.edu	37	6	75975041	75975042	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BQ-7053-01A-11D-1961-08	TCGA-BQ-7053-11A-01D-1961-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95c43067-a2b1-4cdb-b018-47b3210fd396	d525dfc6-e5f2-40a6-b090-ecfc5e8c5f18	g.chr6:75975041_75975042delAT	ENST00000230461.6	-	3	687_688	c.358_359delAT	c.(358-360)atgfs	p.M120fs	TMEM30A_ENST00000370050.5_Start_Codon_Del|TMEM30A_ENST00000475111.2_Frame_Shift_Del_p.M84fs	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	120					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCCATAATACATAAACACGTTG	0.327																																					p.120_120del		Atlas-INDEL	.											.	TMEM30A	40	.	0			c.359_360del						PASS	.																																			SO:0001589	frameshift_variant	55754	exon3			.	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.358_359delAT	chr6.hg19:g.75975041_75975042delAT	ENSP00000230461:p.Met120fs	39.0	0.0	0		35.0	14.0	0.4	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Frame_Shift_Del	DEL	ENST00000230461.6	hg19	CCDS4983.1																																																																																			.	.	.	none		0.327	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
