#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZYG11B	79699	hgsc.bcm.edu	37	1	53287196	53287196	+	Silent	SNP	T	T	C	rs368928161		TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr1:53287196T>C	ENST00000294353.6	+	14	2275	c.2130T>C	c.(2128-2130)caT>caC	p.H710H	ZYG11B_ENST00000443756.2_Silent_p.H640H	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	710										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						CTGATCCCCATGTCCAACAGA	0.433																																					p.H710H		Atlas-SNP	.											.	ZYG11B	61	.	0			c.T2130C						PASS	.	T		0,4406		0,0,2203	98.0	85.0	90.0		2130	-5.0	0.9	1		90	1,8599		0,1,4299	no	coding-synonymous	ZYG11B	NM_024646.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		710/745	53287196	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79699	exon14			TCCCCATGTCCAA	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.2130T>C	chr1.hg19:g.53287196T>C		71.0	0.0	.		75.0	35.0	.	NM_024646	Q8N2X3|Q9H8L8	Silent	SNP	ENST00000294353.6	hg19	CCDS30717.1																																																																																			.	.	.	none		0.433	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
PYCR2	29920	hgsc.bcm.edu	37	1	226109611	226109611	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr1:226109611C>G	ENST00000343818.6	-	4	635	c.487G>C	c.(487-489)Gaa>Caa	p.E163Q	PYCR2_ENST00000478402.1_5'UTR|RP4-559A3.7_ENST00000432920.2_Intron	NM_013328.2	NP_037460.2	Q96C36	P5CR2_HUMAN	pyrroline-5-carboxylate reductase family, member 2	163					L-proline biosynthetic process (GO:0055129)	cytoplasm (GO:0005737)	pyrroline-5-carboxylate reductase activity (GO:0004735)			kidney(1)|lung(3)	4	Breast(184;0.197)				L-Proline(DB00172)	AGGTCCTCTTCCACCTCAGTG	0.637																																					p.E163Q		Atlas-SNP	.											.	PYCR2	13	.	0			c.G487C						PASS	.						56.0	43.0	48.0					1																	226109611		2203	4300	6503	SO:0001583	missense	29920	exon4			CCTCTTCCACCTC	AF151351	CCDS31043.1, CCDS73039.1	1q42.13	2008-02-05			ENSG00000143811	ENSG00000143811			30262	protein-coding gene	gene with protein product						12477932	Standard	NM_013328		Approved	P5CR2	uc001hpq.4	Q96C36	OTTHUMG00000037506	ENST00000343818.6:c.487G>C	chr1.hg19:g.226109611C>G	ENSP00000342502:p.Glu163Gln	31.0	0.0	.		35.0	7.0	.	NM_013328	A8K798|Q7Z515|Q9Y5J4	Missense_Mutation	SNP	ENST00000343818.6	hg19	CCDS31043.1	.	.	.	.	.	.	.	.	.	.	c	15.98	2.994034	0.54041	.	.	ENSG00000143811	ENST00000343818;ENST00000316940;ENST00000316918	D	0.85088	-1.94	4.67	4.67	0.58626	6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	M	0.63169	1.94	0.52501	D	0.999958	P;D	0.59767	0.954;0.986	B;P	0.50825	0.442;0.651	D	0.85792	0.1368	10	0.34782	T	0.22	.	15.4503	0.75268	0.0:1.0:0.0:0.0	.	163;162	Q96C36;E7EUS9	P5CR2_HUMAN;.	Q	163;162;116	ENSP00000342502:E163Q	ENSP00000321499:E116Q	E	-	1	0	PYCR2	224176234	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.801000	0.69115	2.570000	0.86706	0.655000	0.94253	GAA	.	.	.	none		0.637	PYCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091314.1	NM_013328	
DLX1	1745	hgsc.bcm.edu	37	2	172950598	172950598	+	Silent	SNP	C	C	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr2:172950598C>A	ENST00000361725.4	+	1	645	c.193C>A	c.(193-195)Cga>Aga	p.R65R	DLX1_ENST00000341900.6_Silent_p.R65R	NM_178120.4	NP_835221.2	P56177	DLX1_HUMAN	distal-less homeobox 1	65					cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic skeletal system development (GO:0048706)|hippocampus development (GO:0021766)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|lung(4)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GTCCTTCTCCCGACCGCTGGG	0.652																																					p.R65R		Atlas-SNP	.											.	DLX1	23	.	0			c.C193A						PASS	.						90.0	89.0	89.0					2																	172950598		2203	4300	6503	SO:0001819	synonymous_variant	1745	exon1			TTCTCCCGACCGC	BC013010	CCDS2247.2, CCDS33328.1	2q31.1	2011-06-20	2005-12-22		ENSG00000144355	ENSG00000144355		"""Homeoboxes / ANTP class : NKL subclass"""	2914	protein-coding gene	gene with protein product		600029	"""distal-less homeo box 1"""			7907794	Standard	NM_001038493		Approved		uc002uhl.3	P56177	OTTHUMG00000073951	ENST00000361725.4:c.193C>A	chr2.hg19:g.172950598C>A		186.0	0.0	.		163.0	8.0	.	NM_178120	D3DPD7|Q53ZU4|Q7Z724|Q8IYB2	Silent	SNP	ENST00000361725.4	hg19	CCDS2247.2																																																																																			.	.	.	none		0.652	DLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405916.1	XM_087198	
TTN	7273	hgsc.bcm.edu	37	2	179443931	179443931	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr2:179443931A>G	ENST00000591111.1	-	270	63127	c.62903T>C	c.(62902-62904)aTa>aCa	p.I20968T	RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I13736T|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I22609T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I13544T|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I20041T|TTN_ENST00000359218.5_Missense_Mutation_p.I13669T|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20968	Ig-like 112.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCGTACACTATAAGAGTTGT	0.448																																					p.I22609T		Atlas-SNP	.											.	TTN	18412	.	0			c.T67826C						PASS	.						129.0	125.0	126.0					2																	179443931		1936	4122	6058	SO:0001583	missense	7273	exon320			TACACTATAAGAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62903T>C	chr2.hg19:g.179443931A>G	ENSP00000465570:p.Ile20968Thr	204.0	0.0	.		199.0	45.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.40	1.340192	0.24339	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.98	4.82	0.62117	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45196	0.1330	N	0.16166	0.38	0.22666	N	0.998875	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.001	T	0.40608	-0.9554	9	0.87932	D	0	.	9.2435	0.37511	0.8612:0.0:0.1388:0.0	.	13544;13669;13736;20968	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20041;13544;13736;13669;13542	ENSP00000343764:I20041T;ENSP00000434586:I13544T;ENSP00000340554:I13736T;ENSP00000352154:I13669T	ENSP00000340554:I13736T	I	-	2	0	TTN	179152177	0.996000	0.38824	0.972000	0.41901	0.977000	0.68977	5.187000	0.65087	1.075000	0.40932	0.533000	0.62120	ATA	.	.	.	none		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
COL7A1	1294	hgsc.bcm.edu	37	3	48602253	48602253	+	Silent	SNP	G	G	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr3:48602253G>A	ENST00000328333.8	-	117	8888	c.8781C>T	c.(8779-8781)cgC>cgT	p.R2927R	UCN2_ENST00000273610.3_5'Flank|COL7A1_ENST00000470076.1_5'UTR|COL7A1_ENST00000454817.1_Silent_p.R2895R	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2927	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.|Nonhelical region (NC2).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTGGGCAGCGGCGCTCGCAGG	0.662																																					p.R2927R		Atlas-SNP	.											.	COL7A1	320	.	0			c.C8781T						PASS	.						32.0	33.0	33.0					3																	48602253		2202	4299	6501	SO:0001819	synonymous_variant	1294	exon117			GCAGCGGCGCTCG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8781C>T	chr3.hg19:g.48602253G>A		55.0	0.0	.		56.0	26.0	.	NM_000094	Q14054|Q16507	Silent	SNP	ENST00000328333.8	hg19	CCDS2773.1																																																																																			.	.	.	none		0.662	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
RBM15B	29890	hgsc.bcm.edu	37	3	51431021	51431021	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr3:51431021A>T	ENST00000323686.4	+	1	2291	c.2191A>T	c.(2191-2193)Agc>Tgc	p.S731C		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	731	Interaction with Epstein-Barr virus BMLF1.|SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GTTGAAAAACAGCTGCTTCCC	0.512																																					p.S731C		Atlas-SNP	.											.	RBM15B	47	.	0			c.A2191T						PASS	.						88.0	89.0	88.0					3																	51431021		2203	4300	6503	SO:0001583	missense	29890	exon1			AAAAACAGCTGCT	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2191A>T	chr3.hg19:g.51431021A>T	ENSP00000313890:p.Ser731Cys	126.0	0.0	.		104.0	10.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Missense_Mutation	SNP	ENST00000323686.4	hg19	CCDS33764.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.394518	0.62066	.	.	ENSG00000179837	ENST00000323686;ENST00000540284;ENST00000541145;ENST00000536338	T	0.18338	2.22	5.75	5.75	0.90469	Spen Paralogue and Orthologue SPOC, C-terminal-like (2);Spen paralogue/orthologue C-terminal, metazoa (1);Spen paralogue and orthologue SPOC, C-terminal (1);	.	.	.	.	T	0.46718	0.1407	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.52034	-0.8629	9	0.87932	D	0	-23.1168	16.0623	0.80847	1.0:0.0:0.0:0.0	.	731	Q8NDT2	RB15B_HUMAN	C	731;52;404;150	ENSP00000313890:S731C	ENSP00000313890:S731C	S	+	1	0	RBM15B	51406061	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	9.307000	0.96226	2.195000	0.70347	0.533000	0.62120	AGC	.	.	.	none		0.512	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
CFAP44	55779	hgsc.bcm.edu	37	3	113128125	113128125	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr3:113128125C>A	ENST00000295868.2	-	7	880	c.718G>T	c.(718-720)Ggt>Tgt	p.G240C	WDR52-AS1_ENST00000473329.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.G240C|WDR52-AS1_ENST00000498480.1_RNA	NM_018338.3	NP_060808.2												p.G240C(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						AGCAAGTTACCGCTGTAGTTA	0.393																																					p.G240C		Atlas-SNP	.											.	WDR52	151	.	1	Substitution - Missense(1)	lung(1)	c.G718T						PASS	.						126.0	118.0	121.0					3																	113128125		2203	4300	6503	SO:0001583	missense	55779	exon7			AGTTACCGCTGTA																												ENST00000295868.2:c.718G>T	chr3.hg19:g.113128125C>A	ENSP00000295868:p.Gly240Cys	141.0	0.0	.		136.0	7.0	.	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	hg19	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675005	0.88445	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.73897	-0.79;2.77	6.04	6.04	0.98038	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	D	0.90614	0.7057	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91830	0.5474	9	0.87932	D	0	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	240	Q96MT7	WDR52_HUMAN	C	240	ENSP00000377428:G240C;ENSP00000295868:G240C	ENSP00000295868:G240C	G	-	1	0	WDR52	114610815	1.000000	0.71417	0.218000	0.23776	0.028000	0.11728	7.223000	0.78033	2.873000	0.98535	0.563000	0.77884	GGT	.	.	.	none		0.393	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
UGT2A1	10941	hgsc.bcm.edu	37	4	70513331	70513331	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr4:70513331T>C	ENST00000503640.1	-	1	87	c.32A>G	c.(31-33)cAg>cGg	p.Q11R	UGT2A1_ENST00000286604.4_Missense_Mutation_p.Q11R|UGT2A1_ENST00000514019.1_Missense_Mutation_p.Q11R|UGT2A1_ENST00000512704.1_Missense_Mutation_p.Q11R	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	11					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GAGACTTATCTGAAGGGAGAA	0.363																																					p.Q11R		Atlas-SNP	.											.	UGT2A1	131	.	0			c.A32G						PASS	.						43.0	41.0	42.0					4																	70513331		2202	4298	6500	SO:0001583	missense	10941	exon2			CTTATCTGAAGGG	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.32A>G	chr4.hg19:g.70513331T>C	ENSP00000424478:p.Gln11Arg	40.0	0.0	.		45.0	13.0	.	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	hg19	CCDS3529.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.251452	0.22880	.	.	ENSG00000173610	ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604;ENST00000505512	T;T;T;T;T	0.60424	0.2;0.27;0.21;0.19;1.99	5.93	4.69	0.59074	.	1.385230	0.04777	N	0.429078	T	0.50990	0.1648	L	0.34521	1.04	.	.	.	B;B;B;B	0.25772	0.047;0.134;0.047;0.047	B;B;B;B	0.28784	0.022;0.094;0.022;0.022	T	0.38929	-0.9638	9	0.25106	T	0.35	.	11.0455	0.47857	0.0:0.0:0.1554:0.8446	.	11;11;11;11	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1	.;.;.;UD2A1_HUMAN	R	11	ENSP00000424478:Q11R;ENSP00000421432:Q11R;ENSP00000425497:Q11R;ENSP00000286604:Q11R;ENSP00000427709:Q11R	ENSP00000286604:Q11R	Q	-	2	0	UGT2A1	70547920	0.908000	0.30866	1.000000	0.80357	0.292000	0.27327	1.859000	0.39418	2.281000	0.76405	0.533000	0.62120	CAG	.	.	.	none		0.363	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
SLC4A4	8671	hgsc.bcm.edu	37	4	72412140	72412140	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr4:72412140C>A	ENST00000264485.5	+	19	2633	c.2516C>A	c.(2515-2517)cCg>cAg	p.P839Q	SLC4A4_ENST00000425175.1_Missense_Mutation_p.P839Q|SLC4A4_ENST00000340595.3_Missense_Mutation_p.P795Q|SLC4A4_ENST00000351898.6_Intron	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	839					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ATGGCTCTTCCGTGGTATGTA	0.463																																					p.P839Q		Atlas-SNP	.											.	SLC4A4	269	.	0			c.C2516A						PASS	.						251.0	196.0	214.0					4																	72412140		2203	4299	6502	SO:0001583	missense	8671	exon19			CTCTTCCGTGGTA	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2516C>A	chr4.hg19:g.72412140C>A	ENSP00000264485:p.Pro839Gln	169.0	0.0	.		184.0	8.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	hg19	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417192	0.83449	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	D;D;D	0.89050	-2.46;-2.46;-2.46	5.75	5.75	0.90469	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96803	0.8956	H	0.96633	3.855	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97617	1.0133	10	0.87932	D	0	.	19.9564	0.97221	0.0:1.0:0.0:0.0	.	839;795;839	A5JJ20;Q9Y6R1-2;Q9Y6R1	.;.;S4A4_HUMAN	Q	839;839;795	ENSP00000264485:P839Q;ENSP00000393557:P839Q;ENSP00000344272:P795Q	ENSP00000264485:P839Q	P	+	2	0	SLC4A4	72631004	1.000000	0.71417	0.328000	0.25416	0.600000	0.36913	7.818000	0.86416	2.708000	0.92522	0.650000	0.86243	CCG	.	.	.	none		0.463	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
C4orf26	152816	hgsc.bcm.edu	37	4	76489342	76489342	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr4:76489342C>T	ENST00000311623.4	+	2	121	c.86C>T	c.(85-87)aCg>aTg	p.T29M	C4orf26_ENST00000435974.2_Missense_Mutation_p.R44C	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	29						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GAGGTATTTACGCCTCCTGGA	0.527																																					p.R44C		Atlas-SNP	.											C4orf26_ENST00000435974,rectum,carcinoma,-1,2	C4orf26	24	.	0			c.C130T						PASS	.						67.0	71.0	70.0					4																	76489342		2203	4300	6503	SO:0001583	missense	152816	exon3			TATTTACGCCTCC	AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.86C>T	chr4.hg19:g.76489342C>T	ENSP00000311307:p.Thr29Met	114.0	0.0	.		106.0	48.0	.	NM_001206981	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	hg19	CCDS3569.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.382|7.382	0.628915|0.628915	0.14257|0.14257	.|.	.|.	ENSG00000174792|ENSG00000174792	ENST00000435974|ENST00000311623	T|T	0.50813|0.39592	0.73|1.07	4.6|4.6	1.05|1.05	0.20165|0.20165	.|.	.|0.365474	.|0.21557	.|N	.|0.072634	T|T	0.39384|0.39384	0.1076|0.1076	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B|D	0.06786|0.89917	0.001|1.0	B|P	0.04013|0.58660	0.001|0.843	T|T	0.19418|0.19418	-1.0306|-1.0306	9|10	0.87932|0.87932	D|D	0|0	.|.	4.1083|4.1083	0.10047|0.10047	0.181:0.61:0.0:0.209|0.181:0.61:0.0:0.209	.|.	44|29	E7ETQ0|Q17RF5	.|CD026_HUMAN	C|M	44|29	ENSP00000406925:R44C|ENSP00000311307:T29M	ENSP00000406925:R44C|ENSP00000311307:T29M	R|T	+|+	1|2	0|0	C4orf26|C4orf26	76708366|76708366	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.212000|0.212000	0.24457|0.24457	-0.328000|-0.328000	0.07945|0.07945	0.054000|0.054000	0.16065|0.16065	0.551000|0.551000	0.68910|0.68910	CGC|ACG	.	.	.	none		0.527	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
UGT3A2	167127	hgsc.bcm.edu	37	5	36035804	36035804	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr5:36035804G>A	ENST00000282507.3	-	7	1669	c.1568C>T	c.(1567-1569)aCa>aTa	p.T523I	UGT3A2_ENST00000545528.1_Missense_Mutation_p.T221I|UGT3A2_ENST00000513300.1_Missense_Mutation_p.T489I	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	523					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGGCCTTATGTCTCCTTCAC	0.582																																					p.T523I		Atlas-SNP	.											.	UGT3A2	117	.	0			c.C1568T						PASS	.						53.0	48.0	50.0					5																	36035804		2203	4300	6503	SO:0001583	missense	167127	exon7			CCTTATGTCTCCT		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1568C>T	chr5.hg19:g.36035804G>A	ENSP00000282507:p.Thr523Ile	64.0	0.0	.		61.0	23.0	.	NM_174914	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	hg19	CCDS3914.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276110	0.23307	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;D	0.83992	0.02;-0.22;-1.79	2.74	-0.134	0.13481	.	2.665640	0.03471	U	0.213729	T	0.67636	0.2914	N	0.08118	0	0.09310	N	1	P;P	0.50272	0.933;0.933	B;B	0.42386	0.386;0.386	T	0.62120	-0.6921	10	0.87932	D	0	.	3.4564	0.07516	0.3405:0.0:0.479:0.1806	.	489;523	E9PFK7;Q3SY77	.;UD3A2_HUMAN	I	523;489;221	ENSP00000282507:T523I;ENSP00000427404:T489I;ENSP00000445367:T221I	ENSP00000282507:T523I	T	-	2	0	UGT3A2	36071561	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	0.200000	0.17257	-0.057000	0.13199	0.563000	0.77884	ACA	.	.	.	none		0.582	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
DDX4	54514	hgsc.bcm.edu	37	5	55088515	55088515	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr5:55088515G>T	ENST00000505374.1	+	17	1441	c.1349G>T	c.(1348-1350)cGc>cTc	p.R450L	DDX4_ENST00000511853.1_Missense_Mutation_p.R301L|DDX4_ENST00000354991.5_Missense_Mutation_p.R416L|DDX4_ENST00000514278.2_Missense_Mutation_p.R430L|DDX4_ENST00000353507.5_Missense_Mutation_p.R416L	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	450	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GAAGCTGATCGCATGTTGGAT	0.353																																					p.R450L		Atlas-SNP	.											DDX4_ENST00000511853,NS,carcinoma,0,3	DDX4	194	.	0			c.G1349T						PASS	.						75.0	74.0	74.0					5																	55088515		2203	4300	6503	SO:0001583	missense	54514	exon17			CTGATCGCATGTT	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1349G>T	chr5.hg19:g.55088515G>T	ENSP00000424838:p.Arg450Leu	78.0	0.0	.		63.0	27.0	.	NM_024415	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	hg19	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	G	33	5.250592	0.95305	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	D;D;D;T;D;D	0.93247	-3.19;-3.19;-3.19;0.92;-3.19;-3.19	5.39	5.39	0.77823	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.061968	0.64402	D	0.000017	D	0.96904	0.8989	M	0.81341	2.54	0.80722	D	1	D;D;D;D	0.89917	0.998;0.968;0.992;1.0	P;P;P;D	0.85130	0.901;0.717;0.842;0.997	D	0.97158	0.9836	10	0.87932	D	0	-27.4782	19.5193	0.95179	0.0:0.0:1.0:0.0	.	430;301;416;450	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	L	416;430;450;430;416;301	ENSP00000334167:R416L;ENSP00000425359:R430L;ENSP00000424838:R450L;ENSP00000427167:R430L;ENSP00000347087:R416L;ENSP00000423123:R301L	ENSP00000334167:R416L	R	+	2	0	DDX4	55124272	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.405000	0.97313	2.687000	0.91594	0.561000	0.74099	CGC	.	.	.	none		0.353	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
TNPO3	23534	hgsc.bcm.edu	37	7	128641219	128641219	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr7:128641219T>C	ENST00000265388.5	-	6	909	c.766A>G	c.(766-768)Att>Gtt	p.I256V	TNPO3_ENST00000471166.1_Missense_Mutation_p.I256V|TNPO3_ENST00000471234.1_Missense_Mutation_p.I256V|TNPO3_ENST00000482320.1_Missense_Mutation_p.I190V|TNPO3_ENST00000393245.1_Missense_Mutation_p.I256V			Q9Y5L0	TNPO3_HUMAN	transportin 3	256					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						ACATTCTCAATGGCATAGAGA	0.483																																					p.I256V	Pancreas(147;583 2585 39696 52331)	Atlas-SNP	.											.	TNPO3	148	.	0			c.A766G						PASS	.						264.0	229.0	241.0					7																	128641219		2203	4300	6503	SO:0001583	missense	23534	exon6			TCTCAATGGCATA	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.766A>G	chr7.hg19:g.128641219T>C	ENSP00000265388:p.Ile256Val	348.0	0.0	.		328.0	120.0	.	NM_012470	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	ENST00000265388.5	hg19	CCDS5809.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.346233	0.24426	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	.	.	.	5.57	5.57	0.84162	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41604	0.1166	N	0.22421	0.69	0.48511	D	0.999669	B;B;B	0.27450	0.039;0.179;0.063	B;B;B	0.22386	0.018;0.039;0.039	T	0.30592	-0.9973	9	0.17369	T	0.5	.	13.9666	0.64213	0.0:0.0:0.0:1.0	.	256;256;256	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	V	256;256;190;256;256	.	ENSP00000265388:I256V	I	-	1	0	TNPO3	128428455	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.088000	0.71371	2.247000	0.74100	0.528000	0.53228	ATT	.	.	.	none		0.483	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350929.1	NM_012470	
RBP3	5949	hgsc.bcm.edu	37	10	48390462	48390462	+	Missense_Mutation	SNP	G	G	T	rs147118201	byFrequency	TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr10:48390462G>T	ENST00000224600.4	-	1	529	c.416C>A	c.(415-417)cCg>cAg	p.P139Q	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	139	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CTCCTGGCCCGGGACGCTGTC	0.637																																					p.P139Q		Atlas-SNP	.											.	RBP3	152	.	0			c.C416A						PASS	.						69.0	76.0	74.0					10																	48390462		2203	4300	6503	SO:0001583	missense	5949	exon1			TGGCCCGGGACGC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.416C>A	chr10.hg19:g.48390462G>T	ENSP00000224600:p.Pro139Gln	167.0	0.0	.		149.0	8.0	.	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	hg19	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440090	0.43326	.	.	ENSG00000107618	ENST00000224600	T	0.63417	-0.04	5.7	5.7	0.88788	Interphotoreceptor retinol-binding (2);	0.268394	0.38272	N	0.001741	T	0.80460	0.4627	M	0.89601	3.045	0.35549	D	0.803682	D	0.89917	1.0	D	0.97110	1.0	D	0.86547	0.1832	10	0.72032	D	0.01	-37.5679	8.3623	0.32365	0.1656:0.0:0.8344:0.0	.	139	P10745	RET3_HUMAN	Q	139	ENSP00000224600:P139Q	ENSP00000224600:P139Q	P	-	2	0	RBP3	48010468	1.000000	0.71417	0.847000	0.33407	0.010000	0.07245	5.910000	0.69931	2.705000	0.92388	0.650000	0.86243	CCG	.	G|1.000;A|0.000	.	alt		0.637	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
SAMD8	142891	hgsc.bcm.edu	37	10	76868897	76868897	+	5'Flank	SNP	G	G	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr10:76868897G>A	ENST00000542569.1	+	0	0				SAMD8_ENST00000372687.4_5'Flank|DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000607009.1_5'UTR|SAMD8_ENST00000372690.3_5'Flank|DUSP13_ENST00000372700.3_Missense_Mutation_p.P7S|DUSP13_ENST00000607131.1_5'UTR|DUSP13_ENST00000372702.3_Missense_Mutation_p.P7S	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCCAGCTCTGGGAGAGAGGTC	0.627																																					p.P7S		Atlas-SNP	.											.	DUSP13	82	.	0			c.C19T						PASS	.						43.0	43.0	43.0					10																	76868897		2203	4300	6503	SO:0001631	upstream_gene_variant	51207	exon1			GCTCTGGGAGAGA	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515		chr10.hg19:g.76868897G>A	Exception_encountered	49.0	0.0	.		58.0	25.0	.	NM_001007272	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	hg19	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.302638	0.23736	.	.	ENSG00000079393	ENST00000372702;ENST00000372700	T;T	0.11495	3.76;2.77	5.91	-0.569	0.11756	.	.	.	.	.	T	0.06142	0.0159	N	0.22421	0.69	0.20703	N	0.999863	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.39014	-0.9634	9	0.87932	D	0	.	1.8802	0.03226	0.2904:0.1258:0.4545:0.1293	.	7;7	Q9UII6-4;Q6B8I1	.;MDSP_HUMAN	S	7	ENSP00000361787:P7S;ENSP00000361785:P7S	ENSP00000361785:P7S	P	-	1	0	DUSP13	76538903	0.461000	0.25783	0.168000	0.22838	0.265000	0.26407	0.801000	0.27055	0.117000	0.18138	-0.136000	0.14681	CCA	.	.	.	none		0.627	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
ATM	472	hgsc.bcm.edu	37	11	108206609	108206609	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr11:108206609A>C	ENST00000452508.2	+	57	8378	c.8189A>C	c.(8188-8190)cAg>cCg	p.Q2730P	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.Q2730P			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2730	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GTCATGCAACAGGTCTTCCAG	0.348			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.Q2730P		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.A8189C						PASS	.						114.0	106.0	108.0					11																	108206609		2201	4298	6499	SO:0001583	missense	472	exon56	Familial Cancer Database	AT, Louis-Bar syndrome	TGCAACAGGTCTT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8189A>C	chr11.hg19:g.108206609A>C	ENSP00000388058:p.Gln2730Pro	73.0	0.0	.		57.0	20.0	.	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.787127	0.90367	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.88896	-2.44;-2.44	5.56	5.56	0.83823	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.96605	0.8892	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98083	1.0405	10	0.87932	D	0	.	15.7045	0.77565	1.0:0.0:0.0:0.0	.	2730	Q13315	ATM_HUMAN	P	2730	ENSP00000278616:Q2730P;ENSP00000388058:Q2730P	ENSP00000278616:Q2730P	Q	+	2	0	ATM	107711819	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.809000	0.91944	2.125000	0.65367	0.533000	0.62120	CAG	.	.	.	none		0.348	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
C11orf1	64776	hgsc.bcm.edu	37	11	111753250	111753250	+	Silent	SNP	C	C	T			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr11:111753250C>T	ENST00000260276.3	+	2	541	c.204C>T	c.(202-204)acC>acT	p.T68T	C11orf1_ENST00000528125.1_Silent_p.T22T|C11orf1_ENST00000530214.1_Silent_p.T68T|C11orf1_ENST00000529270.1_Silent_p.T108T	NM_022761.2	NP_073598.1	Q9H5F2	CK001_HUMAN	chromosome 11 open reading frame 1	68						nucleus (GO:0005634)				kidney(2)|lung(3)	5		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		CAAACCGTACCCTGATGGGCA	0.438																																					p.T68T		Atlas-SNP	.											.	C11orf1	15	.	0			c.C204T						PASS	.						129.0	117.0	121.0					11																	111753250		2201	4297	6498	SO:0001819	synonymous_variant	64776	exon2			CCGTACCCTGATG	AJ250229	CCDS8350.1	11q23.1	2012-05-30			ENSG00000137720	ENSG00000137720			1163	protein-coding gene	gene with protein product						10873569	Standard	NM_022761		Approved	FLJ23499	uc001pmd.3	Q9H5F2	OTTHUMG00000166884	ENST00000260276.3:c.204C>T	chr11.hg19:g.111753250C>T		61.0	0.0	.		83.0	30.0	.	NM_022761	Q6I9X7|Q9NQC6	Silent	SNP	ENST00000260276.3	hg19	CCDS8350.1																																																																																			.	.	.	none		0.438	C11orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391650.1	NM_022761	
FKBP11	51303	hgsc.bcm.edu	37	12	49319118	49319118	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr12:49319118C>G	ENST00000550765.1	-	1	492	c.94G>C	c.(94-96)Gaa>Caa	p.E32Q	FKBP11_ENST00000444214.2_5'Flank|RP11-302B13.5_ENST00000398092.4_Intron|FKBP11_ENST00000552878.1_Missense_Mutation_p.E32Q|FKBP11_ENST00000453172.2_Missense_Mutation_p.E32Q|CCDC65_ENST00000266984.5_Intron|AC073610.5_ENST00000537495.1_Intron|Y_RNA_ENST00000364808.1_RNA	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	32					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(3)|lung(1)	5						ACGGGACTTTCGGTTTCGAGC	0.662																																					p.E32Q		Atlas-SNP	.											.	FKBP11	12	.	0			c.G94C						PASS	.						31.0	32.0	32.0					12																	49319118		2203	4298	6501	SO:0001583	missense	51303	exon1			GACTTTCGGTTTC	AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.94G>C	chr12.hg19:g.49319118C>G	ENSP00000449751:p.Glu32Gln	51.0	0.0	.		40.0	14.0	.	NM_016594	B4DWB7	Missense_Mutation	SNP	ENST00000550765.1	hg19	CCDS8773.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.568652	0.28003	.	.	ENSG00000134285	ENST00000550765;ENST00000552878;ENST00000453172	T;T;T	0.56611	0.46;1.2;0.45	4.58	3.69	0.42338	.	0.561459	0.16287	N	0.221075	T	0.43277	0.1240	L	0.29908	0.895	0.38062	D	0.9361	P;P	0.44690	0.841;0.746	B;B	0.43155	0.218;0.41	T	0.50792	-0.8786	10	0.87932	D	0	-14.2492	10.3341	0.43839	0.0:0.9065:0.0:0.0935	.	32;32	B4DWB7;Q9NYL4	.;FKB11_HUMAN	Q	32	ENSP00000449751:E32Q;ENSP00000447911:E32Q;ENSP00000396874:E32Q	ENSP00000256680:E32Q	E	-	1	0	FKBP11	47605385	1.000000	0.71417	1.000000	0.80357	0.472000	0.32918	4.451000	0.60047	1.299000	0.44798	0.561000	0.74099	GAA	.	.	.	none		0.662	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1	NM_016594	
OTOGL	283310	hgsc.bcm.edu	37	12	80626779	80626779	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr12:80626779G>A	ENST00000547103.1	+	8	698	c.692G>A	c.(691-693)gGg>gAg	p.G231E	OTOGL_ENST00000458043.2_Missense_Mutation_p.G231E			Q3ZCN5	OTOGL_HUMAN	otogelin-like	231	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GGGATATCTGGGATCTACCTC	0.413																																					p.G231E		Atlas-SNP	.											.	OTOGL	235	.	0			c.G692A						PASS	.						92.0	89.0	90.0					12																	80626779		1872	4109	5981	SO:0001583	missense	283310	exon8			TATCTGGGATCTA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.692G>A	chr12.hg19:g.80626779G>A	ENSP00000447211:p.Gly231Glu	90.0	0.0	.		80.0	34.0	.	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	G	23.5	4.419978	0.83559	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.58506	0.33;0.33	5.92	5.02	0.67125	.	.	.	.	.	T	0.67429	0.2892	L	0.52905	1.665	0.58432	D	0.999999	.	.	.	.	.	.	T	0.68720	-0.5334	7	0.51188	T	0.08	.	17.0842	0.86606	0.0:0.1269:0.873:0.0	.	.	.	.	E	231	ENSP00000447211:G231E;ENSP00000400895:G231E	ENSP00000400895:G231E	G	+	2	0	OTOGL	79150910	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	6.419000	0.73345	1.480000	0.48289	0.650000	0.86243	GGG	.	.	.	none		0.413	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
TCL1B	9623	hgsc.bcm.edu	37	14	96152848	96152848	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr14:96152848G>A	ENST00000340722.7	+	1	95	c.44G>A	c.(43-45)cGt>cAt	p.R15H	RP11-1070N10.6_ENST00000461160.1_RNA	NM_004918.3	NP_004909.1	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	15										cervix(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		CCCCCTGGCCGTCTGTGGATC	0.627																																					p.R15H		Atlas-SNP	.											.	TCL1B	30	.	0			c.G44A						PASS	.						93.0	95.0	94.0					14																	96152848		2203	4300	6503	SO:0001583	missense	9623	exon1			CTGGCCGTCTGTG	AB018563	CCDS32151.1	14q32.1	2008-09-05			ENSG00000213231	ENSG00000213231			11649	protein-coding gene	gene with protein product		603769				10077617	Standard	NM_004918		Approved	TML1	uc001yez.3	O95988	OTTHUMG00000028912	ENST00000340722.7:c.44G>A	chr14.hg19:g.96152848G>A	ENSP00000343223:p.Arg15His	134.0	0.0	.		128.0	57.0	.	NM_004918	A6NEK7|Q6IAR7|Q9UBQ4	Missense_Mutation	SNP	ENST00000340722.7	hg19	CCDS32151.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705553	0.30232	.	.	ENSG00000213231	ENST00000340722;ENST00000538038	T	0.32272	1.46	2.78	-0.328	0.12690	.	.	.	.	.	T	0.27798	0.0684	L	0.31664	0.95	0.09310	N	1	D	0.64830	0.994	P	0.58520	0.84	T	0.18713	-1.0328	9	0.15499	T	0.54	.	3.386	0.07272	0.1377:0.0:0.411:0.4513	.	15	O95988	TCL1B_HUMAN	H	15	ENSP00000343223:R15H	ENSP00000343223:R15H	R	+	2	0	TCL1B	95222601	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.684000	0.05173	-0.071000	0.12886	0.455000	0.32223	CGT	.	.	.	none		0.627	TCL1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315123.2		
HERC1	8925	hgsc.bcm.edu	37	15	63978661	63978661	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr15:63978661T>C	ENST00000443617.2	-	34	6209	c.6122A>G	c.(6121-6123)cAg>cGg	p.Q2041R	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2041	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TAGGCAACACTGAGCTTTCTC	0.473																																					p.Q2041R		Atlas-SNP	.											.	HERC1	624	.	0			c.A6122G						PASS	.						177.0	178.0	178.0					15																	63978661		1955	4150	6105	SO:0001583	missense	8925	exon34			CAACACTGAGCTT	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6122A>G	chr15.hg19:g.63978661T>C	ENSP00000390158:p.Gln2041Arg	333.0	0.0	.		299.0	125.0	.	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733306	0.69189	.	.	ENSG00000103657	ENST00000443617	T	0.60040	0.22	5.63	5.63	0.86233	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000001	T	0.37320	0.0999	N	0.08118	0	0.47698	D	0.999492	P	0.38978	0.652	B	0.33295	0.161	T	0.42749	-0.9433	10	0.48119	T	0.1	.	15.8367	0.78805	0.0:0.0:0.0:1.0	.	2041	Q15751	HERC1_HUMAN	R	2041	ENSP00000390158:Q2041R	ENSP00000390158:Q2041R	Q	-	2	0	HERC1	61765714	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.268000	0.51585	2.142000	0.66516	0.533000	0.62120	CAG	.	.	.	none		0.473	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
NFAT5	10725	hgsc.bcm.edu	37	16	69718811	69718811	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr16:69718811T>C	ENST00000354436.2	+	10	1976	c.1658T>C	c.(1657-1659)gTa>gCa	p.V553A	NFAT5_ENST00000349945.1_Missense_Mutation_p.V477A|NFAT5_ENST00000567239.1_Missense_Mutation_p.V570A|NFAT5_ENST00000432919.1_Missense_Mutation_p.V571A|NFAT5_ENST00000393742.2_Missense_Mutation_p.V477A|NFAT5_ENST00000566899.1_Missense_Mutation_p.V477A	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	553					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GCTTTGAATGTAAATGTGAAG	0.323																																					p.V571A		Atlas-SNP	.											.	NFAT5	184	.	0			c.T1712C						PASS	.						67.0	72.0	70.0					16																	69718811		2197	4300	6497	SO:0001583	missense	10725	exon11			TGAATGTAAATGT	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1658T>C	chr16.hg19:g.69718811T>C	ENSP00000346420:p.Val553Ala	91.0	0.0	.		98.0	5.0	.	NM_138713	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	hg19	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.169644	0.57584	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.46451	0.88;0.88;0.87;0.88	5.31	5.31	0.75309	Immunoglobulin E-set (1);	0.122950	0.53938	D	0.000041	T	0.48484	0.1502	L	0.56769	1.78	0.58432	D	0.999999	B;P;B;P	0.49185	0.001;0.92;0.021;0.907	B;B;B;P	0.50490	0.003;0.439;0.013;0.642	T	0.39014	-0.9634	10	0.16896	T	0.51	.	15.2702	0.73696	0.0:0.0:0.0:1.0	.	570;553;571;477	A2RRB4;O94916;E9PHR7;O94916-2	.;NFAT5_HUMAN;.;.	A	571;570;477;553;477	ENSP00000396538:V571A;ENSP00000338806:V477A;ENSP00000346420:V553A;ENSP00000377343:V477A	ENSP00000338806:V477A	V	+	2	0	NFAT5	68276312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.036000	0.64164	2.011000	0.59026	0.528000	0.53228	GTA	.	.	.	none		0.323	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
DNAH9	1770	hgsc.bcm.edu	37	17	11520831	11520831	+	Silent	SNP	G	G	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr17:11520831G>C	ENST00000262442.4	+	5	1076	c.1008G>C	c.(1006-1008)cgG>cgC	p.R336R	DNAH9_ENST00000454412.2_Silent_p.R336R	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	336	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCCAGCTGCGGCCCCTGCTCC	0.592																																					p.R336R		Atlas-SNP	.											.	DNAH9	695	.	0			c.G1008C						PASS	.						57.0	53.0	54.0					17																	11520831		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon5			GCTGCGGCCCCTG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1008G>C	chr17.hg19:g.11520831G>C		73.0	0.0	.		60.0	17.0	.	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.	.	none		0.592	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DDX5	1655	hgsc.bcm.edu	37	17	62498660	62498660	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr17:62498660G>C	ENST00000225792.5	-	9	1392	c.991C>G	c.(991-993)Cgt>Ggt	p.R331G	DDX5_ENST00000450599.2_Missense_Mutation_p.R252G|DDX5_ENST00000580026.1_5'Flank|MIR3064_ENST00000581130.1_RNA|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.R331G	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	331	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCATTAGACGAATAAGTCTA	0.353			T	ETV4	prostate																																p.R331G	NSCLC(22;406 813 4871 19580 40307)	Atlas-SNP	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	101	.	0			c.C991G						PASS	.						86.0	82.0	83.0					17																	62498660		2203	4300	6503	SO:0001583	missense	1655	exon9			TTAGACGAATAAG	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.991C>G	chr17.hg19:g.62498660G>C	ENSP00000225792:p.Arg331Gly	81.0	0.0	.		85.0	4.0	.	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	hg19	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918794	0.52546	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.91	5.91	0.95273	Helicase, C-terminal (1);	0.096682	0.85682	D	0.000000	T	0.54078	0.1836	N	0.25060	0.705	0.80722	D	1	B;B;B;B	0.14012	0.001;0.009;0.009;0.009	B;B;B;B	0.17979	0.008;0.02;0.02;0.02	T	0.48681	-0.9014	9	0.62326	D	0.03	-11.1323	20.2985	0.98592	0.0:0.0:1.0:0.0	.	252;331;320;331	B4DLW8;B5BUE6;B4DN41;P17844	.;.;.;DDX5_HUMAN	G	331;261;320	.	ENSP00000225792:R320G	R	-	1	0	DDX5	59929122	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.292000	0.96076	2.793000	0.96121	0.655000	0.94253	CGT	.	.	.	none		0.353	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
RALBP1	10928	hgsc.bcm.edu	37	18	9535719	9535719	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr18:9535719C>G	ENST00000019317.4	+	10	1975	c.1752C>G	c.(1750-1752)atC>atG	p.I584M	RALBP1_ENST00000383432.3_Missense_Mutation_p.I584M			Q15311	RBP1_HUMAN	ralA binding protein 1	584					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	GCGAGGCCATCATCGAGCTGC	0.582																																					p.I584M		Atlas-SNP	.											.	RALBP1	48	.	0			c.C1752G						PASS	.						20.0	18.0	18.0					18																	9535719		2203	4299	6502	SO:0001583	missense	10928	exon10			GGCCATCATCGAG	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1752C>G	chr18.hg19:g.9535719C>G	ENSP00000019317:p.Ile584Met	29.0	0.0	.		18.0	10.0	.	NM_006788	D3DUI0	Missense_Mutation	SNP	ENST00000019317.4	hg19	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311613	0.60414	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.12879	2.64;2.64	5.01	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	L	0.59436	1.845	0.58432	D	0.999995	P	0.45474	0.859	B	0.42653	0.394	T	0.01935	-1.1244	10	0.66056	D	0.02	-13.417	13.4422	0.61119	0.0:0.9242:0.0:0.0758	.	584	Q15311	RBP1_HUMAN	M	584	ENSP00000019317:I584M;ENSP00000372924:I584M	ENSP00000019317:I584M	I	+	3	3	RALBP1	9525719	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	2.717000	0.47227	1.237000	0.43756	0.655000	0.94253	ATC	.	.	.	none		0.582	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8661946	8661946	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr19:8661946A>C	ENST00000597188.1	-	8	1235	c.965T>G	c.(964-966)gTg>gGg	p.V322G	ADAMTS10_ENST00000270328.4_Missense_Mutation_p.V322G|ADAMTS10_ENST00000596709.1_5'Flank	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	322	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GCTGTGGTTCACGATGGATTT	0.572																																					p.V322G		Atlas-SNP	.											.	ADAMTS10	132	.	0			c.T965G						PASS	.						102.0	89.0	93.0					19																	8661946		2203	4300	6503	SO:0001583	missense	81794	exon8			TGGTTCACGATGG	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.965T>G	chr19.hg19:g.8661946A>C	ENSP00000471851:p.Val322Gly	108.0	0.0	.		98.0	39.0	.	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	hg19	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.074561	0.55646	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.64438	-0.1	5.4	5.4	0.78164	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.175593	0.38663	U	0.001601	T	0.49236	0.1545	N	0.20685	0.6	0.80722	D	1	P	0.38729	0.644	B	0.39771	0.309	T	0.47837	-0.9086	10	0.26408	T	0.33	.	14.5981	0.68422	1.0:0.0:0.0:0.0	.	322	Q9H324	ATS10_HUMAN	G	322;76	ENSP00000270328:V322G	ENSP00000270328:V322G	V	-	2	0	ADAMTS10	8567946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.354000	0.66040	2.036000	0.60181	0.460000	0.39030	GTG	.	.	.	none		0.572	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
SIPA1L3	23094	hgsc.bcm.edu	37	19	38621327	38621327	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr19:38621327C>G	ENST00000222345.6	+	10	3567	c.3058C>G	c.(3058-3060)Cac>Gac	p.H1020D		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1020	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CACACTGACCCACGACCAGAT	0.642																																					p.H1020D		Atlas-SNP	.											.	SIPA1L3	150	.	0			c.C3058G						PASS	.						72.0	63.0	66.0					19																	38621327		2203	4300	6503	SO:0001583	missense	23094	exon10			CTGACCCACGACC	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3058C>G	chr19.hg19:g.38621327C>G	ENSP00000222345:p.His1020Asp	111.0	0.0	.		88.0	4.0	.	NM_015073	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	hg19	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.849035	0.91277	.	.	ENSG00000105738	ENST00000222345	T	0.64085	-0.08	5.21	5.21	0.72293	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	D	0.83635	0.5297	M	0.91663	3.23	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.87360	0.2343	10	0.87932	D	0	-32.8671	17.8767	0.88827	0.0:1.0:0.0:0.0	.	1020	O60292	SI1L3_HUMAN	D	1020	ENSP00000222345:H1020D	ENSP00000222345:H1020D	H	+	1	0	SIPA1L3	43313167	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.770000	0.85390	2.590000	0.87494	0.563000	0.77884	CAC	.	.	.	none		0.642	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
ZNF404	342908	hgsc.bcm.edu	37	19	44377748	44377748	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr19:44377748C>G	ENST00000587539.1	-	3	617	c.618G>C	c.(616-618)caG>caC	p.Q206H	ZNF404_ENST00000324394.6_Missense_Mutation_p.Q204H	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TATGAATTATCTGATGCTGAA	0.368																																					p.Q203H		Atlas-SNP	.											.	ZNF404	46	.	0			c.G609C						PASS	.						87.0	92.0	90.0					19																	44377748		2095	4252	6347	SO:0001583	missense	342908	exon2			AATTATCTGATGC	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.618G>C	chr19.hg19:g.44377748C>G	ENSP00000466051:p.Gln206His	174.0	0.0	.		151.0	60.0	.	NM_001033719	A4FU30|K7ELF2	Missense_Mutation	SNP	ENST00000587539.1	hg19	CCDS59394.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252356	0.39797	.	.	ENSG00000176222	ENST00000324394	T	0.18502	2.21	2.71	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31949	0.0813	M	0.77820	2.39	0.23351	N	0.997856	D	0.54207	0.965	P	0.58928	0.848	T	0.14254	-1.0479	9	0.52906	T	0.07	.	3.4705	0.07565	0.2546:0.6054:0.0:0.1399	.	206	Q494X3	ZN404_HUMAN	H	204	ENSP00000319479:Q204H	ENSP00000319479:Q204H	Q	-	3	2	ZNF404	49069588	0.564000	0.26602	1.000000	0.80357	0.979000	0.70002	1.602000	0.36783	1.519000	0.48950	0.404000	0.27445	CAG	.	.	.	none		0.368	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460019.1	NM_001033719	
ZNF578	147660	hgsc.bcm.edu	37	19	53014896	53014896	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr19:53014896A>C	ENST00000421239.2	+	6	1506	c.1262A>C	c.(1261-1263)cAt>cCt	p.H421P	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CATAGACTTCATACTGGAGAG	0.383																																					p.H421P		Atlas-SNP	.											.	.	.	.	0			c.A1262C						PASS	.						81.0	85.0	84.0					19																	53014896		2203	4300	6503	SO:0001583	missense	147660	exon6			GACTTCATACTGG	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1262A>C	chr19.hg19:g.53014896A>C	ENSP00000459216:p.His421Pro	149.0	0.0	.		153.0	10.0	.	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	hg19	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	14.26	2.481441	0.44147	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	1.48	0.22813	.	.	.	.	.	T	0.77685	0.4167	H	0.95950	3.745	0.30406	N	0.779575	D	0.57571	0.98	D	0.77004	0.989	T	0.72912	-0.4148	7	.	.	.	.	7.9426	0.29967	1.0:0.0:0.0:0.0	.	421	G3V4F6	.	P	421	.	.	H	+	2	0	ZNF578	57706708	0.998000	0.40836	0.005000	0.12908	0.050000	0.14768	6.983000	0.76180	0.696000	0.31696	0.246000	0.17985	CAT	.	.	.	none		0.383	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
CHD6	84181	hgsc.bcm.edu	37	20	40053940	40053940	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr20:40053940G>C	ENST00000373233.3	-	29	4401	c.4224C>G	c.(4222-4224)tgC>tgG	p.C1408W		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1408					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCTTGCGGTTGCAGCGCTGGT	0.552																																					p.C1408W		Atlas-SNP	.											.	CHD6	312	.	0			c.C4224G						PASS	.						85.0	76.0	79.0					20																	40053940		2203	4300	6503	SO:0001583	missense	84181	exon29			GCGGTTGCAGCGC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4224C>G	chr20.hg19:g.40053940G>C	ENSP00000362330:p.Cys1408Trp	88.0	0.0	.		77.0	4.0	.	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748438	0.69533	.	.	ENSG00000124177	ENST00000373233	T	0.79352	-1.26	5.66	-0.168	0.13343	.	0.000000	0.64402	D	0.000003	T	0.80742	0.4681	M	0.63428	1.95	0.80722	D	1	D	0.57257	0.979	P	0.57776	0.827	T	0.78790	-0.2066	10	0.51188	T	0.08	-12.621	10.7656	0.46292	0.3652:0.0:0.6348:0.0	.	1408	Q8TD26	CHD6_HUMAN	W	1408	ENSP00000362330:C1408W	ENSP00000362330:C1408W	C	-	3	2	CHD6	39487354	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	3.947000	0.56652	0.047000	0.15862	-0.136000	0.14681	TGC	.	.	.	none		0.552	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ALPK3	57538	hgsc.bcm.edu	37	15	85400008	85400009	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr15:85400008_85400009insA	ENST00000258888.5	+	6	2812_2813	c.2645_2646insA	c.(2644-2649)atacagfs	p.Q883fs		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	883					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGTGAGAAGATACAGGAAGACA	0.554																																					p.I882fs		Atlas-INDEL	.											.	ALPK3	289	.	0			c.2645_2646insA						PASS	.																																			SO:0001589	frameshift_variant	57538	exon6			.	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.2646dupA	chr15.hg19:g.85400009_85400009dupA	ENSP00000258888:p.Gln883fs	48.0	0.0	0		51.0	26.0	0.509804	NM_020778	Q9P2L6	Frame_Shift_Ins	INS	ENST00000258888.5	hg19	CCDS10333.1																																																																																			.	.	.	none		0.554	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
ABCA6	23460	hgsc.bcm.edu	37	17	67081860	67081863	+	Intron	DEL	GAAA	GAAA	-			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	GAAA	GAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr17:67081860_67081863delGAAA	ENST00000284425.2	-	31	4112				ABCA6_ENST00000446604.2_Intron	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6						transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AATTTCACCTGAAAGAAAGAATCA	0.392																																					.		Atlas-INDEL	.											.	ABCA6	210	.	0			.						PASS	.			2,4262		0,2,2130						4.6	1.0			68	2,8250		0,2,4124	no	intron	ABCA6	NM_080284.2		0,4,6254	A1A1,A1R,RR		0.0242,0.0469,0.032				4,12512				SO:0001627	intron_variant	23460	.			.	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3938-3TTTC>-	chr17.hg19:g.67081864_67081867delGAAA		50.0	0.0	0		52.0	15.0	0.288462	.	Q6NSH9|Q8N856|Q8WWZ6	Splice_Site	DEL	ENST00000284425.2	hg19	CCDS11683.1																																																																																			.	.	.	none		0.392	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
MAP3K12	7786	hgsc.bcm.edu	37	12	53895924	53895925	+	5'Flank	INS	-	-	T			TCGA-BQ-7056-01A-11D-1961-08	TCGA-BQ-7056-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8030657c-5a4c-49c4-a1c4-87344411c96f	5f202358-ec0a-45aa-b346-79d9e4f5b268	g.chr12:53895924_53895925insT	ENST00000267079.2	-	0	0				TARBP2_ENST00000456234.2_Frame_Shift_Ins_p.N40fs|TARBP2_ENST00000549028.1_3'UTR|MAP3K12_ENST00000547488.1_5'Flank|RP11-793H13.11_ENST00000602306.1_RNA|TARBP2_ENST00000394357.2_Frame_Shift_Ins_p.N40fs|MAP3K12_ENST00000547151.1_5'Flank|TARBP2_ENST00000552857.1_Intron|TARBP2_ENST00000266987.2_Frame_Shift_Ins_p.N61fs	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12						histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GCCCACCAGCCTAATTTCACCT	0.599																																					p.P60fs		Atlas-INDEL	.											.	TARBP2	35	.	0			c.179_180insT						PASS	.																																			SO:0001631	upstream_gene_variant	6895	exon2			.	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854		chr12.hg19:g.53895925_53895925dupT	Exception_encountered	67.0	0.0	0		67.0	25.0	0.373134	NM_134323	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Frame_Shift_Ins	INS	ENST00000267079.2	hg19	CCDS8860.1																																																																																			.	.	.	none		0.599	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
