#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEX10	5192	hgsc.bcm.edu	37	1	2340282	2340282	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:2340282C>G	ENST00000447513.2	-	3	277	c.209G>C	c.(208-210)gGg>gCg	p.G70A	PEX10_ENST00000507596.1_Missense_Mutation_p.G70A|PEX10_ENST00000288774.3_Missense_Mutation_p.G70A|PEX10_ENST00000515760.1_5'UTR	NM_002617.3	NP_002608.1	O60683	PEX10_HUMAN	peroxisomal biogenesis factor 10	70					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	integral component of peroxisomal membrane (GO:0005779)|intracellular (GO:0005622)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(2)	7	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		GTACTCCTCCCCCAGGGTCTG	0.677																																					p.G70A	GBM(12;9 508 1649 13619)	Atlas-SNP	.											.	PEX10	18	.	0			c.G209C						PASS	.						94.0	95.0	95.0					1																	2340282		2203	4300	6503	SO:0001583	missense	5192	exon3			TCCTCCCCCAGGG	AF060502	CCDS41.1, CCDS44045.1	1p36.32	2013-01-09	2008-08-26		ENSG00000157911	ENSG00000157911		"""RING-type (C3HC4) zinc fingers"""	8851	protein-coding gene	gene with protein product		602859	"""peroxisome biogenesis factor 10"""			9683594	Standard	NM_002617		Approved	RNF69	uc001ajg.3	O60683	OTTHUMG00000001637	ENST00000447513.2:c.209G>C	chr1.hg19:g.2340282C>G	ENSP00000407922:p.Gly70Ala	54.0	0.0	.		58.0	14.0	.	NM_002617	B3KWD8|Q5T095|Q9BW90	Missense_Mutation	SNP	ENST00000447513.2	hg19	CCDS44045.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210641	0.79240	.	.	ENSG00000157911	ENST00000288774;ENST00000447513;ENST00000507596	D;D;D	0.88201	-2.35;-2.35;-2.35	4.48	4.48	0.54585	Pex, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	M	0.92833	3.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96912	0.9668	10	0.87932	D	0	2.6652	16.1137	0.81283	0.0:1.0:0.0:0.0	.	70;70	O60683;O60683-2	PEX10_HUMAN;.	A	70	ENSP00000288774:G70A;ENSP00000407922:G70A;ENSP00000424291:G70A	ENSP00000288774:G70A	G	-	2	0	PEX10	2330142	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	5.505000	0.66981	2.035000	0.60131	0.462000	0.41574	GGG	.	.	.	none		0.677	PEX10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367454.1	NM_153818	
PER3	8863	hgsc.bcm.edu	37	1	7887456	7887456	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:7887456G>A	ENST00000361923.2	+	17	2618	c.2443G>A	c.(2443-2445)Gca>Aca	p.A815T	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.A823T	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	815	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		AAGAGAATACGCAGCCCCCGG	0.622																																					p.A815T		Atlas-SNP	.											.	PER3	95	.	0			c.G2443A						PASS	.						67.0	69.0	68.0					1																	7887456		2203	4300	6503	SO:0001583	missense	8863	exon17			GAATACGCAGCCC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2443G>A	chr1.hg19:g.7887456G>A	ENSP00000355031:p.Ala815Thr	162.0	0.0	.		112.0	28.0	.	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	hg19	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630557	0.14322	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.10192	2.9;2.9	3.68	-2.56	0.06268	.	2.865610	0.00841	N	0.001740	T	0.04003	0.0112	N	0.11427	0.14	0.09310	N	1	B;P;B;B	0.34662	0.07;0.462;0.41;0.07	B;B;B;B	0.24541	0.011;0.054;0.053;0.011	T	0.20009	-1.0288	10	0.17369	T	0.5	.	0.9429	0.01359	0.3343:0.3073:0.2098:0.1487	.	815;823;823;815	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	T	823;815;26	ENSP00000366755:A823T;ENSP00000355031:A815T	ENSP00000355031:A815T	A	+	1	0	PER3	7810043	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.918000	0.28678	-0.394000	0.07727	0.561000	0.74099	GCA	.	.	.	none		0.622	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
YARS	8565	hgsc.bcm.edu	37	1	33246690	33246690	+	Silent	SNP	G	G	T	rs376054085		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:33246690G>T	ENST00000373477.4	-	10	2007	c.1099C>A	c.(1099-1101)Cgg>Agg	p.R367R	YARS_ENST00000469100.1_5'UTR	NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	367	tRNA-binding. {ECO:0000255|PROSITE- ProRule:PRU00209}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)	p.R367W(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	ATATCCAGCCGGGATGGGATG	0.507																																					p.R367R		Atlas-SNP	.											YARS,caecum,carcinoma,0,1	YARS	34	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1099A						PASS	.						135.0	123.0	127.0					1																	33246690		2203	4300	6503	SO:0001819	synonymous_variant	8565	exon10			CCAGCCGGGATGG	U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.1099C>A	chr1.hg19:g.33246690G>T		194.0	0.0	.		185.0	8.0	.	NM_003680	B3KWK4|D3DPQ4|O43276|Q53EN1	Silent	SNP	ENST00000373477.4	hg19	CCDS368.1																																																																																			.	.	.	none		0.507	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011225.1	NM_003680	
ATXN7L2	127002	hgsc.bcm.edu	37	1	110034064	110034064	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:110034064C>A	ENST00000369870.3	+	10	1894	c.1879C>A	c.(1879-1881)Ctg>Atg	p.L627M	CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|CYB561D1_ENST00000533024.1_5'Flank|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|CYB561D1_ENST00000393709.3_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000310611.4_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	627										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GGCAGGGCCCCTGGACTGTCG	0.622																																					p.L627M		Atlas-SNP	.											.	ATXN7L2	60	.	0			c.C1879A						PASS	.						35.0	40.0	38.0					1																	110034064		2203	4300	6503	SO:0001583	missense	127002	exon10			GGGCCCCTGGACT	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1879C>A	chr1.hg19:g.110034064C>A	ENSP00000358886:p.Leu627Met	85.0	0.0	.		52.0	20.0	.	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514316	0.44763	.	.	ENSG00000162650	ENST00000369870;ENST00000369869	T	0.38560	1.13	5.36	3.26	0.37387	.	0.440276	0.19115	N	0.122331	T	0.23451	0.0567	N	0.24115	0.695	0.25930	N	0.983008	P;D	0.64830	0.946;0.994	P;P	0.55222	0.714;0.771	T	0.04678	-1.0934	10	0.72032	D	0.01	-0.0215	7.9316	0.29905	0.0:0.7788:0.0:0.2212	.	254;627	Q5T6C4;Q5T6C5	.;AT7L2_HUMAN	M	627;254	ENSP00000358886:L627M	ENSP00000358885:L254M	L	+	1	2	ATXN7L2	109835587	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.056000	0.41355	0.647000	0.30713	-0.258000	0.10820	CTG	.	.	.	none		0.622	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
INSRR	3645	hgsc.bcm.edu	37	1	156811976	156811976	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:156811976T>G	ENST00000368195.3	-	19	3721	c.3325A>C	c.(3325-3327)Aac>Cac	p.N1109H	NTRK1_ENST00000392302.2_Missense_Mutation_p.L38W	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACAAACTTGTTGGCAGCAAGG	0.572																																					p.N1109H		Atlas-SNP	.											.	INSRR	309	.	0			c.A3325C						PASS	.						104.0	95.0	98.0					1																	156811976		2203	4300	6503	SO:0001583	missense	3645	exon19			ACTTGTTGGCAGC	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.3325A>C	chr1.hg19:g.156811976T>G	ENSP00000357178:p.Asn1109His	58.0	0.0	.		41.0	12.0	.	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	hg19	CCDS1160.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.413045|4.413045	0.83449|0.83449	.|.	.|.	ENSG00000198400|ENSG00000027644	ENST00000392302|ENST00000368195	T|D	0.76839|0.82803	-1.05|-1.65	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.260110	.|0.27223	.|N	.|0.020345	T|T	0.67664|0.67664	0.2917|0.2917	N|N	0.17594|0.17594	0.5|0.5	0.37606|0.37606	D|D	0.920732|0.920732	D|P	0.76494|0.41102	0.999|0.738	D|P	0.64042|0.44623	0.921|0.455	T|T	0.76490|0.76490	-0.2940|-0.2940	9|10	0.87932|0.72032	D|D	0|0.01	.|.	13.364|13.364	0.60674|0.60674	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	38|1109	A6NF12|P14616	.|INSRR_HUMAN	W|H	38|1109	ENSP00000376120:L38W|ENSP00000357178:N1109H	ENSP00000376120:L38W|ENSP00000357178:N1109H	L|N	+|-	2|1	0|0	NTRK1|INSRR	155078600|155078600	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	7.868000|7.868000	0.87116|0.87116	2.041000|2.041000	0.60428|0.60428	0.459000|0.459000	0.35465|0.35465	TTG|AAC	.	.	.	none		0.572	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204198070	204198070	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:204198070T>C	ENST00000272203.3	-	19	3062	c.2746A>G	c.(2746-2748)Aag>Gag	p.K916E	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.K936E	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	916										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTCACCTCCTTATTGATGTCC	0.587																																					p.K916E		Atlas-SNP	.											.	PLEKHA6	115	.	0			c.A2746G						PASS	.						116.0	112.0	113.0					1																	204198070		2203	4300	6503	SO:0001583	missense	22874	exon19			CCTCCTTATTGAT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2746A>G	chr1.hg19:g.204198070T>C	ENSP00000272203:p.Lys916Glu	163.0	0.0	.		187.0	49.0	.	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	hg19	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.148801	0.57151	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.45276	0.9;0.9	5.3	5.3	0.74995	.	0.265846	0.36628	N	0.002497	T	0.59649	0.2209	M	0.72894	2.215	0.35019	D	0.757628	D	0.58268	0.982	D	0.67548	0.952	T	0.71002	-0.4718	10	0.49607	T	0.09	-32.3486	10.459	0.44567	0.0:0.0786:0.0:0.9214	.	916	Q9Y2H5	PKHA6_HUMAN	E	916;936	ENSP00000272203:K916E;ENSP00000402046:K936E	ENSP00000272203:K916E	K	-	1	0	PLEKHA6	202464693	1.000000	0.71417	0.875000	0.34327	0.332000	0.28634	5.520000	0.67080	1.995000	0.58328	0.460000	0.39030	AAG	.	.	.	none		0.587	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
TP53BP2	7159	hgsc.bcm.edu	37	1	223984099	223984099	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:223984099A>G	ENST00000343537.7	-	13	2433	c.2142T>C	c.(2140-2142)aaT>aaC	p.N714N	TP53BP2_ENST00000391879.2_5'UTR|TP53BP2_ENST00000391878.2_Silent_p.N585N|TP53BP2_ENST00000498843.1_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	708					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TTCGGTAAGGATTAGATAAGA	0.438																																					p.N714N		Atlas-SNP	.											.	TP53BP2	144	.	0			c.T2142C						PASS	.						143.0	139.0	140.0					1																	223984099		2203	4300	6503	SO:0001819	synonymous_variant	7159	exon13			GTAAGGATTAGAT	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2142T>C	chr1.hg19:g.223984099A>G		208.0	0.0	.		228.0	52.0	.	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Silent	SNP	ENST00000343537.7	hg19	CCDS44319.1																																																																																			.	.	.	none		0.438	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
DUSP11	8446	hgsc.bcm.edu	37	2	74007101	74007101	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:74007101T>C	ENST00000272444.3	-	1	183	c.142A>G	c.(142-144)Atg>Gtg	p.M48V	DUSP11_ENST00000377706.4_Start_Codon_SNP_p.M1V|DUSP11_ENST00000443070.1_Missense_Mutation_p.M48V|DUSP11_ENST00000480948.1_5'Flank	NM_003584.2	NP_003575.2	O75319	DUS11_HUMAN	dual specificity phosphatase 11 (RNA/RNP complex 1-interacting)	1					peptidyl-tyrosine dephosphorylation (GO:0035335)|polynucleotide 5' dephosphorylation (GO:0098507)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|phosphatase activity (GO:0016791)|poly(A) RNA binding (GO:0044822)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|skin(1)	12						CACTGGCTCATGTGGGTCCCA	0.607											OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M48V		Atlas-SNP	.											.	DUSP11	35	.	0			c.A142G						PASS	.						61.0	61.0	61.0					2																	74007101		2203	4300	6503	SO:0001583	missense	8446	exon1			GGCTCATGTGGGT	AF023917	CCDS1928.2	2p13.1	2011-06-09			ENSG00000144048	ENSG00000144048		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3066	protein-coding gene	gene with protein product		603092				9685386	Standard	NM_003584		Approved	PIR1	uc002sjp.3	O75319	OTTHUMG00000129816	ENST00000272444.3:c.142A>G	chr2.hg19:g.74007101T>C	ENSP00000272444:p.Met48Val	108.0	0.0	.	1149	82.0	24.0	.	NM_003584	B2RCT8|Q6AI47|Q9BWE3	Missense_Mutation	SNP	ENST00000272444.3	hg19	CCDS1928.2	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742276	0.49151	.	.	ENSG00000144048	ENST00000272444;ENST00000443070;ENST00000377706	T;T	0.32988	1.43;2.01	4.6	4.6	0.57074	.	0.059637	0.56097	D	0.000024	T	0.35008	0.0917	.	.	.	0.80722	D	1	P;D	0.55172	0.882;0.97	B;P	0.48627	0.428;0.584	T	0.10291	-1.0636	9	0.51188	T	0.08	-4.2088	10.6571	0.45682	0.0:0.0:0.0:1.0	.	48;1	C9JYA6;O75319	.;DUS11_HUMAN	V	48;48;1	ENSP00000413444:M48V;ENSP00000366935:M1V	ENSP00000272444:M48V	M	-	1	0	DUSP11	73860609	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	3.027000	0.49697	2.285000	0.76669	0.533000	0.62120	ATG	.	.	.	none		0.607	DUSP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252047.3		
RAPGEF4	11069	hgsc.bcm.edu	37	2	173885421	173885421	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr2:173885421C>A	ENST00000397081.3	+	23	2374	c.2231C>A	c.(2230-2232)cCg>cAg	p.P744Q	RAPGEF4_ENST00000538974.1_Missense_Mutation_p.P573Q|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.P600Q|RAPGEF4_ENST00000540783.1_Missense_Mutation_p.P591Q|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.P743Q|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.P744Q|RAPGEF4_ENST00000535187.1_Missense_Mutation_p.P524Q|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.P591Q	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	744					blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TTTGCTTGCCCGCGAGAGCAA	0.448																																					p.P744Q		Atlas-SNP	.											.	RAPGEF4	103	.	0			c.C2231A						PASS	.						179.0	166.0	170.0					2																	173885421		1902	4125	6027	SO:0001583	missense	11069	exon23			CTTGCCCGCGAGA	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.2231C>A	chr2.hg19:g.173885421C>A	ENSP00000380271:p.Pro744Gln	216.0	0.0	.		198.0	9.0	.	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	ENST00000397081.3	hg19	CCDS42775.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803308	0.70682	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000535187	T;T;T;T;T;T;T;T	0.63913	0.15;0.15;-0.07;0.04;0.04;0.16;0.16;-0.05	5.77	5.77	0.91146	Ras-association (1);Ras guanine nucleotide exchange factor, domain (1);	0.054509	0.85682	D	0.000000	T	0.71476	0.3344	M	0.62723	1.935	0.80722	D	1	P;B	0.52463	0.953;0.297	P;B	0.52646	0.705;0.239	T	0.67300	-0.5705	10	0.30854	T	0.27	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	600;744	Q8WZA2-3;Q8WZA2	.;RPGF4_HUMAN	Q	743;744;744;600;573;591;591;524	ENSP00000264111:P743Q;ENSP00000380271:P744Q;ENSP00000387104:P744Q;ENSP00000380276:P600Q;ENSP00000440135:P573Q;ENSP00000440250:P591Q;ENSP00000437384:P591Q;ENSP00000438011:P524Q	ENSP00000264111:P743Q	P	+	2	0	RAPGEF4	173593667	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	4.812000	0.62613	2.723000	0.93209	0.655000	0.94253	CCG	.	.	.	none		0.448	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
CNTN6	27255	hgsc.bcm.edu	37	3	1371578	1371578	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:1371578C>G	ENST00000446702.2	+	11	1950	c.1323C>G	c.(1321-1323)atC>atG	p.I441M	CNTN6_ENST00000539053.1_Missense_Mutation_p.I369M|CNTN6_ENST00000350110.2_Missense_Mutation_p.I441M			Q9UQ52	CNTN6_HUMAN	contactin 6	441	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGGCAGCTATCTCTTGGAAAA	0.333																																					p.I441M		Atlas-SNP	.											.	CNTN6	245	.	0			c.C1323G						PASS	.						57.0	59.0	58.0					3																	1371578		2202	4299	6501	SO:0001583	missense	27255	exon11			AGCTATCTCTTGG	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1323C>G	chr3.hg19:g.1371578C>G	ENSP00000407822:p.Ile441Met	50.0	0.0	.		59.0	14.0	.	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	hg19	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929637	0.52759	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.72282	-0.64;-0.64;-0.64	5.71	0.115	0.14643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.491996	0.18537	N	0.138338	T	0.81128	0.4758	M	0.92604	3.325	0.09310	N	1	P	0.48350	0.909	P	0.57371	0.819	T	0.70901	-0.4746	10	0.72032	D	0.01	.	4.4769	0.11748	0.0:0.2343:0.1888:0.5769	.	441	Q9UQ52	CNTN6_HUMAN	M	441;369;441	ENSP00000407822:I441M;ENSP00000442791:I369M;ENSP00000341882:I441M	ENSP00000341882:I441M	I	+	3	3	CNTN6	1346578	0.000000	0.05858	0.482000	0.27366	0.987000	0.75469	-0.078000	0.11375	0.093000	0.17368	0.563000	0.77884	ATC	.	.	.	none		0.333	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
CHDH	55349	hgsc.bcm.edu	37	3	53857341	53857341	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:53857341A>G	ENST00000315251.6	-	3	1132	c.695T>C	c.(694-696)aTc>aCc	p.I232T		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	232					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ACCTTCATGGATGGTCATGTC	0.612																																					p.I232T		Atlas-SNP	.											.	CHDH	34	.	0			c.T695C						PASS	.						46.0	48.0	47.0					3																	53857341		2203	4300	6503	SO:0001583	missense	55349	exon3			TCATGGATGGTCA	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.695T>C	chr3.hg19:g.53857341A>G	ENSP00000319851:p.Ile232Thr	18.0	0.0	.		17.0	5.0	.	NM_018397	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	hg19	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898970	0.52227	.	.	ENSG00000016391	ENST00000315251	T	0.39592	1.07	5.72	5.72	0.89469	Glucose-methanol-choline oxidoreductase, N-terminal (1);	0.161948	0.52532	D	0.000066	T	0.56046	0.1959	L	0.55103	1.725	0.53688	D	0.999973	D	0.63046	0.992	D	0.66084	0.941	T	0.57106	-0.7868	10	0.52906	T	0.07	-30.1407	11.1366	0.48378	0.8624:0.0:0.0:0.1376	.	232	Q8NE62	CHDH_HUMAN	T	232	ENSP00000319851:I232T	ENSP00000319851:I232T	I	-	2	0	CHDH	53832381	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.882000	0.92420	2.182000	0.69389	0.455000	0.32223	ATC	.	.	.	none		0.612	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
PDS5A	23244	hgsc.bcm.edu	37	4	39978137	39978137	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:39978137C>A	ENST00000303538.8	-	2	600	c.61G>T	c.(61-63)Ggg>Tgg	p.G21W	PDS5A_ENST00000503396.1_Missense_Mutation_p.G21W	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GCGATCTTCCCGTCGGCACTC	0.572											OREG0016159	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G21W		Atlas-SNP	.											PDS5A_ENST00000503396,NS,carcinoma,0,2	PDS5A	114	.	0			c.G61T						PASS	.						108.0	119.0	116.0					4																	39978137		1980	4154	6134	SO:0001583	missense	23244	exon2			TCTTCCCGTCGGC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.61G>T	chr4.hg19:g.39978137C>A	ENSP00000303427:p.Gly21Trp	161.0	1.0	.	890	140.0	8.0	.	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	hg19	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561627	0.86335	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	.	.	.	4.0	4.0	0.46444	.	0.249770	0.26453	U	0.024297	T	0.74935	0.3782	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.79784	0.98;0.993	T	0.75519	-0.3289	8	.	.	.	-4.2139	14.4859	0.67616	0.0:1.0:0.0:0.0	.	21;21	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	W	21	.	.	G	-	1	0	PDS5A	39654532	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.320000	0.79064	2.077000	0.62373	0.591000	0.81541	GGG	.	.	.	none		0.572	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
SLC30A9	10463	hgsc.bcm.edu	37	4	42072612	42072612	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:42072612T>A	ENST00000264451.7	+	15	1502	c.1322T>A	c.(1321-1323)cTc>cAc	p.L441H		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	441					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCAGCATTCCTCATCTACACT	0.458																																					p.L441H		Atlas-SNP	.											.	SLC30A9	58	.	0			c.T1322A						PASS	.						211.0	177.0	188.0					4																	42072612		2203	4300	6503	SO:0001583	missense	10463	exon15			CATTCCTCATCTA	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1322T>A	chr4.hg19:g.42072612T>A	ENSP00000264451:p.Leu441His	110.0	0.0	.		133.0	43.0	.	NM_006345	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	hg19	CCDS3465.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512256	0.85389	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.71817	-0.6	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90228	0.4277	10	0.87932	D	0	-6.7973	15.4439	0.75213	0.0:0.0:0.0:1.0	.	441	Q6PML9	ZNT9_HUMAN	H	441;269	ENSP00000264451:L441H	ENSP00000264451:L441H	L	+	2	0	SLC30A9	41767369	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.951000	0.87819	2.099000	0.63709	0.533000	0.62120	CTC	.	.	.	none		0.458	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
WDFY3	23001	hgsc.bcm.edu	37	4	85781624	85781624	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:85781624G>A	ENST00000295888.4	-	4	528	c.121C>T	c.(121-123)Cac>Tac	p.H41Y	WDFY3_ENST00000322366.6_Missense_Mutation_p.H41Y	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	41					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGAGTCATGTGCCGGGGAGGA	0.577																																					p.H41Y		Atlas-SNP	.											.	WDFY3	314	.	0			c.C121T						PASS	.						140.0	129.0	133.0					4																	85781624		2203	4300	6503	SO:0001583	missense	23001	exon4			TCATGTGCCGGGG	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.121C>T	chr4.hg19:g.85781624G>A	ENSP00000295888:p.His41Tyr	128.0	0.0	.		156.0	30.0	.	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238404	0.79800	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000509172	T;T	0.63744	-0.06;-0.06	5.72	5.72	0.89469	.	0.045076	0.85682	D	0.000000	T	0.43255	0.1239	N	0.08118	0	0.80722	D	1	D;D	0.52996	0.957;0.957	B;B	0.43575	0.402;0.424	T	0.48364	-0.9042	10	0.02654	T	1	.	19.8968	0.96969	0.0:0.0:1.0:0.0	.	41;41	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	Y	41	ENSP00000318466:H41Y;ENSP00000295888:H41Y	ENSP00000295888:H41Y	H	-	1	0	WDFY3	86000648	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.580000	0.98207	2.691000	0.91804	0.655000	0.94253	CAC	.	.	.	none		0.577	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
RAD50	10111	hgsc.bcm.edu	37	5	131976367	131976367	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:131976367T>C	ENST00000265335.6	+	24	4009	c.3622T>C	c.(3622-3624)Tta>Cta	p.L1208L	AC004041.2_ENST00000457489.1_RNA|AC004041.2_ENST00000435042.1_RNA|AC004041.2_ENST00000458509.1_RNA|AC004041.2_ENST00000417516.1_RNA|RAD50_ENST00000378823.3_Silent_p.L1069L			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1208	Ala/Asp-rich (DA-box).				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTCCAGGTATTAGCCTCACT	0.498								Homologous recombination																													p.L1208L		Atlas-SNP	.											.	RAD50	246	.	0			c.T3622C						PASS	.						168.0	156.0	160.0					5																	131976367		2203	4300	6503	SO:0001819	synonymous_variant	10111	exon24			CAGGTATTAGCCT	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3622T>C	chr5.hg19:g.131976367T>C		186.0	0.0	.		177.0	36.0	.	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Silent	SNP	ENST00000265335.6	hg19	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.963735	0.34659	.	.	ENSG00000113522	ENST00000455677	.	.	.	5.94	1.0	0.19881	.	.	.	.	.	T	0.55226	0.1907	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	T	0.46275	-0.9203	4	.	.	.	-7.5964	8.3809	0.32470	0.0:0.5216:0.0:0.4784	.	.	.	.	T	86	.	.	I	+	2	0	RAD50	132004266	0.068000	0.21057	0.032000	0.17829	0.920000	0.55202	0.417000	0.21214	0.177000	0.19895	0.528000	0.53228	ATT	.	.	.	none		0.498	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
TRIM38	10475	hgsc.bcm.edu	37	6	25967011	25967011	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:25967011G>C	ENST00000357085.3	+	3	737	c.261G>C	c.(259-261)acG>acC	p.T87T	TRIM38_ENST00000349458.3_Silent_p.T87T	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	87					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.T87T(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TCAAAGAGACGGATCAAGAAA	0.562																																					p.T87T		Atlas-SNP	.											TRIM38,NS,carcinoma,0,1	TRIM38	50	.	1	Substitution - coding silent(1)	lung(1)	c.G261C						PASS	.						61.0	58.0	59.0					6																	25967011		2203	4300	6503	SO:0001819	synonymous_variant	10475	exon3			AGAGACGGATCAA	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.261G>C	chr6.hg19:g.25967011G>C		54.0	0.0	.		54.0	17.0	.	NM_006355	B2R862	Silent	SNP	ENST00000357085.3	hg19	CCDS4568.1																																																																																			.	.	.	none		0.562	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2		
ITPR3	3710	hgsc.bcm.edu	37	6	33644599	33644599	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:33644599G>A	ENST00000374316.5	+	27	4397	c.3337G>A	c.(3337-3339)Gag>Aag	p.E1113K	ITPR3_ENST00000605930.1_Missense_Mutation_p.E1113K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1113					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GATCAAGTCGGAGCTGGACCG	0.622																																					p.E1113K		Atlas-SNP	.											.	ITPR3	409	.	0			c.G3337A						PASS	.						93.0	80.0	85.0					6																	33644599		2203	4300	6503	SO:0001583	missense	3710	exon26			AAGTCGGAGCTGG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.3337G>A	chr6.hg19:g.33644599G>A	ENSP00000363435:p.Glu1113Lys	94.0	0.0	.		67.0	19.0	.	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587672	0.86851	.	.	ENSG00000096433	ENST00000374316	D	0.91237	-2.81	5.22	5.22	0.72569	.	0.111019	0.64402	D	0.000010	D	0.85822	0.5786	L	0.44542	1.39	0.58432	D	0.999993	P	0.45594	0.862	B	0.41917	0.37	D	0.88575	0.3132	10	0.87932	D	0	-36.8399	18.8137	0.92070	0.0:0.0:1.0:0.0	.	1113	Q14573	ITPR3_HUMAN	K	1113	ENSP00000363435:E1113K	ENSP00000363435:E1113K	E	+	1	0	ITPR3	33752577	1.000000	0.71417	0.943000	0.38184	0.927000	0.56198	8.010000	0.88615	2.435000	0.82474	0.655000	0.94253	GAG	.	.	.	none		0.622	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
DOPEY1	23033	hgsc.bcm.edu	37	6	83839062	83839062	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:83839062C>A	ENST00000349129.2	+	16	2436	c.2176C>A	c.(2176-2178)Caa>Aaa	p.Q726K	DOPEY1_ENST00000237163.5_Missense_Mutation_p.Q707K|DOPEY1_ENST00000369739.3_Missense_Mutation_p.Q717K	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	726					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAGAAATTCACAAGGAGATGT	0.398																																					p.Q726K		Atlas-SNP	.											.	DOPEY1	190	.	0			c.C2176A						PASS	.						78.0	77.0	78.0					6																	83839062		2203	4300	6503	SO:0001583	missense	23033	exon16			AATTCACAAGGAG	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.2176C>A	chr6.hg19:g.83839062C>A	ENSP00000195654:p.Gln726Lys	56.0	0.0	.		85.0	16.0	.	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151734	0.38021	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.21734	1.99;1.99	5.68	5.68	0.88126	.	0.594531	0.18093	N	0.151930	T	0.15392	0.0371	L	0.57536	1.79	0.80722	D	1	B;B;B	0.15473	0.004;0.013;0.004	B;B;B	0.13407	0.006;0.009;0.006	T	0.02610	-1.1134	10	0.32370	T	0.25	.	19.7974	0.96491	0.0:1.0:0.0:0.0	.	617;717;726	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	K	726;707;707	ENSP00000195654:Q726K;ENSP00000237163:Q707K	ENSP00000237163:Q707K	Q	+	1	0	DOPEY1	83895781	0.879000	0.30193	0.997000	0.53966	0.964000	0.63967	3.092000	0.50207	2.673000	0.90976	0.650000	0.86243	CAA	.	.	.	none		0.398	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
FAM120B	84498	hgsc.bcm.edu	37	6	170700175	170700175	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr6:170700175C>G	ENST00000476287.1	+	8	2673	c.2565C>G	c.(2563-2565)atC>atG	p.I855M	FAM120B_ENST00000252510.9_Missense_Mutation_p.I187M|FAM120B_ENST00000540480.1_Missense_Mutation_p.I867M|FAM120B_ENST00000537664.1_Missense_Mutation_p.I878M	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	855					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ACAGACGCATCACTGGCCGAG	0.562																																					p.I855M		Atlas-SNP	.											.	FAM120B	108	.	0			c.C2565G						PASS	.						72.0	62.0	65.0					6																	170700175		2203	4300	6503	SO:0001583	missense	84498	exon8			ACGCATCACTGGC	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.2565C>G	chr6.hg19:g.170700175C>G	ENSP00000417970:p.Ile855Met	60.0	0.0	.		58.0	4.0	.	NM_032448	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	ENST00000476287.1	hg19	CCDS5314.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500782	0.26861	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287;ENST00000252510	T;T;T	0.09723	2.96;2.95;2.97	5.5	-3.03	0.05429	.	0.167917	0.40469	N	0.001099	T	0.06371	0.0164	L	0.27053	0.805	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.967;0.974	T	0.22382	-1.0218	10	0.56958	D	0.05	-19.2842	7.8011	0.29174	0.1064:0.3727:0.0:0.5209	.	855;855	Q96EK7;F2Z2E1	F120B_HUMAN;.	M	867;878;855;187	ENSP00000444125:I867M;ENSP00000440125:I878M;ENSP00000417970:I855M	ENSP00000252510:I187M	I	+	3	3	FAM120B	170542100	0.002000	0.14202	0.000000	0.03702	0.051000	0.14879	-0.226000	0.09139	-0.631000	0.05560	0.655000	0.94253	ATC	.	.	.	none		0.562	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
OGDH	4967	hgsc.bcm.edu	37	7	44685022	44685022	+	Missense_Mutation	SNP	G	G	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:44685022G>T	ENST00000222673.5	+	3	361	c.319G>T	c.(319-321)Gtg>Ttg	p.V107L	OGDH_ENST00000543843.1_Missense_Mutation_p.V47L|OGDH_ENST00000447398.1_Missense_Mutation_p.V107L|OGDH_ENST00000444676.1_Missense_Mutation_p.V107L|OGDH_ENST00000449767.1_Missense_Mutation_p.V107L|OGDH_ENST00000443864.2_Missense_Mutation_p.V107L|OGDH_ENST00000439616.2_Intron	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	107					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CCTGGCTGCTGTGGCCCATGC	0.597																																					p.V107L		Atlas-SNP	.											.	OGDH	145	.	0			c.G319T						PASS	.						85.0	83.0	83.0					7																	44685022		2203	4300	6503	SO:0001583	missense	4967	exon3			GCTGCTGTGGCCC	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.319G>T	chr7.hg19:g.44685022G>T	ENSP00000222673:p.Val107Leu	159.0	0.0	.		169.0	35.0	.	NM_001165036	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	hg19	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775197	0.31411	.	.	ENSG00000105953	ENST00000443864;ENST00000449767;ENST00000447398;ENST00000419661;ENST00000444676;ENST00000222673;ENST00000543843	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.81	-4.96	0.03038	.	1.033080	0.07585	N	0.921017	T	0.10680	0.0261	N	0.02181	-0.65	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.27054	-1.0085	10	0.05620	T	0.96	-2.8184	1.8649	0.03196	0.4868:0.1815:0.1602:0.1715	.	107;107;107;107	E9PBM1;E9PDF2;Q02218;Q96DD3	.;.;ODO1_HUMAN;.	L	107;107;107;107;107;107;47	ENSP00000388084:V107L;ENSP00000392878:V107L;ENSP00000388183:V107L;ENSP00000411830:V107L;ENSP00000414662:V107L;ENSP00000222673:V107L;ENSP00000443821:V47L	ENSP00000222673:V107L	V	+	1	0	OGDH	44651547	0.003000	0.15002	0.000000	0.03702	0.974000	0.67602	0.473000	0.22132	-0.618000	0.05656	0.655000	0.94253	GTG	.	.	.	none		0.597	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
MET	4233	hgsc.bcm.edu	37	7	116423407	116423407	+	Missense_Mutation	SNP	G	G	C	rs121913671		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:116423407G>C	ENST00000318493.6	+	19	3923	c.3736G>C	c.(3736-3738)Gac>Cac	p.D1246H	MET_ENST00000539704.1_Missense_Mutation_p.D98H|MET_ENST00000397752.3_Missense_Mutation_p.D1228H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D1246H(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TCTTGCCAGAGACATGTATGA	0.378			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.D1246H		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,colon,carcinoma,-2,1	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.G3736C	GRCh37	CM970946	MET	M	rs121913671	PASS	.						106.0	99.0	102.0					7																	116423407		1841	4093	5934	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GCCAGAGACATGT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3736G>C	chr7.hg19:g.116423407G>C	ENSP00000317272:p.Asp1246His	67.0	1.0	.		101.0	30.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285616	0.80803	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83837	-1.77;-1.77;-1.77	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91327	0.7265	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91745	0.5407	10	0.87932	D	0	.	19.6667	0.95895	0.0:0.0:1.0:0.0	.	1246;1228	P08581-2;P08581	.;MET_HUMAN	H	1228;1246;98	ENSP00000380860:D1228H;ENSP00000317272:D1246H;ENSP00000445020:D98H	ENSP00000317272:D1246H	D	+	1	0	MET	116210643	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.813000	0.99286	2.721000	0.93114	0.563000	0.77884	GAC	.	.	.	alt		0.378	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
ADAM32	203102	hgsc.bcm.edu	37	8	39044454	39044454	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:39044454A>G	ENST00000379907.4	+	11	1069	c.942A>G	c.(940-942)gcA>gcG	p.A314A	ADAM32_ENST00000519315.1_Intron|ADAM32_ENST00000437682.2_Intron	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	314	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CTCTGGAGGCATTTGCAGTTA	0.358																																					p.A314A		Atlas-SNP	.											.	ADAM32	70	.	0			c.A942G						PASS	.						79.0	76.0	77.0					8																	39044454		1814	4076	5890	SO:0001819	synonymous_variant	203102	exon11			GGAGGCATTTGCA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.942A>G	chr8.hg19:g.39044454A>G		83.0	0.0	.		139.0	34.0	.	NM_145004	Q8TC42	Silent	SNP	ENST00000379907.4	hg19	CCDS47846.1																																																																																			.	.	.	none		0.358	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
OSGIN2	734	hgsc.bcm.edu	37	8	90936955	90936955	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:90936955G>C	ENST00000297438.2	+	6	1068	c.713G>C	c.(712-714)aGg>aCg	p.R238T	OSGIN2_ENST00000451899.2_Missense_Mutation_p.R282T	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	238					meiotic nuclear division (GO:0007126)					breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TGGGAAATTAGGGGTTATCAG	0.418																																					p.R282T		Atlas-SNP	.											.	OSGIN2	73	.	0			c.G845C						PASS	.						75.0	77.0	76.0					8																	90936955		2203	4300	6503	SO:0001583	missense	734	exon6			AAATTAGGGGTTA	AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.713G>C	chr8.hg19:g.90936955G>C	ENSP00000297438:p.Arg238Thr	84.0	0.0	.		95.0	30.0	.	NM_001126111		Missense_Mutation	SNP	ENST00000297438.2	hg19	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436313	0.25813	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.22539	1.95;1.95	5.25	5.25	0.73442	.	0.041552	0.85682	D	0.000000	T	0.16769	0.0403	L	0.43152	1.355	0.80722	D	1	B;B	0.31077	0.307;0.163	B;B	0.26416	0.069;0.068	T	0.05209	-1.0899	10	0.17832	T	0.49	-3.8246	12.2313	0.54490	0.0783:0.0:0.9217:0.0	.	282;238	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	T	238;282	ENSP00000297438:R238T;ENSP00000396445:R282T	ENSP00000297438:R238T	R	+	2	0	OSGIN2	91006130	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.061000	0.89467	2.461000	0.83175	0.555000	0.69702	AGG	.	.	.	none		0.418	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
TMEM133	83935	hgsc.bcm.edu	37	11	100863392	100863392	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:100863392T>A	ENST00000303130.2	+	1	582	c.353T>A	c.(352-354)cTt>cAt	p.L118H		NM_032021.2	NP_114410.1	Q9H2Q1	TM133_HUMAN	transmembrane protein 133	118						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)|lung(1)|prostate(1)	5		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)		BRCA - Breast invasive adenocarcinoma(274;0.0675)		CCAGTTCCACTTGGTAATAAC	0.388																																					p.L118H		Atlas-SNP	.											.	TMEM133	9	.	0			c.T353A						PASS	.						142.0	137.0	138.0					11																	100863392		2203	4299	6502	SO:0001583	missense	83935	exon1			TTCCACTTGGTAA	AF247167	CCDS8309.1	11q22.1	2006-03-09				ENSG00000170647			24033	protein-coding gene	gene with protein product						12477932	Standard	NM_032021		Approved	AD031	uc001pgf.3	Q9H2Q1		ENST00000303130.2:c.353T>A	chr11.hg19:g.100863392T>A	ENSP00000303999:p.Leu118His	177.0	0.0	.		153.0	28.0	.	NM_032021		Missense_Mutation	SNP	ENST00000303130.2	hg19	CCDS8309.1	.	.	.	.	.	.	.	.	.	.	T	8.089	0.774082	0.16051	.	.	ENSG00000170647	ENST00000303130	.	.	.	2.67	-1.16	0.09678	.	.	.	.	.	T	0.22704	0.0548	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	P	0.56398	0.797	T	0.14448	-1.0472	8	0.87932	D	0	.	4.3705	0.11246	0.1931:0.0:0.4529:0.3539	.	118	Q9H2Q1	TM133_HUMAN	H	118	.	ENSP00000303999:L118H	L	+	2	0	TMEM133	100368602	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.318000	0.08050	-0.257000	0.09459	-0.329000	0.08387	CTT	.	.	.	none		0.388	TMEM133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395137.1	NM_032021	
PHLDB1	23187	hgsc.bcm.edu	37	11	118516166	118516166	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:118516166G>C	ENST00000361417.2	+	17	3625	c.3214G>C	c.(3214-3216)Ggg>Cgg	p.G1072R	PHLDB1_ENST00000356063.5_Missense_Mutation_p.G1025R|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000524713.1_Missense_Mutation_p.G215R|PHLDB1_ENST00000527898.1_Missense_Mutation_p.G123R	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1072										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TGCCCTTCACGGGGCAGCACC	0.657																																					p.G1072R		Atlas-SNP	.											.	PHLDB1	103	.	0			c.G3214C						PASS	.						43.0	52.0	49.0					11																	118516166		2200	4295	6495	SO:0001583	missense	23187	exon16			CTTCACGGGGCAG		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3214G>C	chr11.hg19:g.118516166G>C	ENSP00000354498:p.Gly1072Arg	152.0	0.0	.		90.0	26.0	.	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	hg19	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268966	0.80469	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063;ENST00000527898;ENST00000524713	T;T;T;T	0.50277	1.41;1.48;0.75;0.76	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.65883	0.2734	L	0.59436	1.845	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.997;0.999;0.995;0.991	D;D;D;D;D	0.97110	1.0;0.966;0.989;0.976;0.922	T	0.57124	-0.7865	10	0.21014	T	0.42	-37.8382	19.9036	0.96999	0.0:0.0:1.0:0.0	.	215;436;831;1025;1072	B4DK17;B0YJ65;Q5W9G0;Q86UU1-2;Q86UU1	.;.;.;.;PHLB1_HUMAN	R	1072;846;436;1025;123;215	ENSP00000354498:G1072R;ENSP00000348359:G1025R;ENSP00000435388:G123R;ENSP00000434905:G215R	ENSP00000348359:G1025R	G	+	1	0	PHLDB1	118021376	1.000000	0.71417	0.821000	0.32701	0.728000	0.41692	5.896000	0.69822	2.706000	0.92434	0.655000	0.94253	GGG	.	.	.	none		0.657	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
GRIK4	2900	hgsc.bcm.edu	37	11	120745883	120745883	+	Silent	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:120745883C>T	ENST00000527524.2	+	11	1382	c.1095C>T	c.(1093-1095)ttC>ttT	p.F365F	GRIK4_ENST00000438375.2_Silent_p.F365F|RP11-640N11.2_ENST00000505153.2_RNA	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	365					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		ACATTGAATTCAACAGCAAAG	0.502																																					p.F365F		Atlas-SNP	.											.	GRIK4	149	.	0			c.C1095T						PASS	.						130.0	112.0	118.0					11																	120745883		2203	4299	6502	SO:0001819	synonymous_variant	2900	exon9			TGAATTCAACAGC	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1095C>T	chr11.hg19:g.120745883C>T		111.0	0.0	.		136.0	24.0	.	NM_014619	A8K9L1	Silent	SNP	ENST00000527524.2	hg19	CCDS8433.1																																																																																			.	.	.	none		0.502	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
CDON	50937	hgsc.bcm.edu	37	11	125880565	125880565	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:125880565A>T	ENST00000392693.3	-	8	1350	c.1223T>A	c.(1222-1224)aTt>aAt	p.I408N	CDON_ENST00000263577.7_Missense_Mutation_p.I408N	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	408	Ig-like C2-type 5.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TGGTGCCGTAATTATAACTGG	0.428																																					p.I408N		Atlas-SNP	.											.	CDON	137	.	0			c.T1223A						PASS	.						63.0	61.0	62.0					11																	125880565		2201	4299	6500	SO:0001583	missense	50937	exon8			GCCGTAATTATAA	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1223T>A	chr11.hg19:g.125880565A>T	ENSP00000376458:p.Ile408Asn	87.0	0.0	.		75.0	18.0	.	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	hg19	CCDS58192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.259|7.259	0.604826|0.604826	0.14002|0.14002	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000392693;ENST00000263577|ENST00000534661	T;T|.	0.29142|.	1.58;1.58|.	5.01|5.01	2.7|2.7	0.31948|0.31948	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.421653|.	0.19358|.	N|.	0.116221|.	T|T	0.38612|0.38612	0.1047|0.1047	L|L	0.43923|0.43923	1.385|1.385	0.09310|0.09310	N|N	0.999999|0.999999	P;P|.	0.36392|.	0.551;0.496|.	B;B|.	0.39738|.	0.308;0.205|.	T|T	0.21965|0.21965	-1.0230|-1.0230	10|5	0.66056|.	D|.	0.02|.	-2.7576|-2.7576	8.6995|8.6995	0.34316|0.34316	0.7929:0.0:0.2071:0.0|0.7929:0.0:0.2071:0.0	.|.	408;408|.	Q4KMG0;Q4KMG0-2|.	CDON_HUMAN;.|.	N|K	408|383	ENSP00000376458:I408N;ENSP00000263577:I408N|.	ENSP00000263577:I408N|.	I|N	-|-	2|3	0|2	CDON|CDON	125385775|125385775	0.210000|0.210000	0.23517|0.23517	0.307000|0.307000	0.25127|0.25127	0.339000|0.339000	0.28857|0.28857	1.941000|1.941000	0.40233|0.40233	0.272000|0.272000	0.22027|0.22027	0.482000|0.482000	0.46254|0.46254	ATT|AAT	.	.	.	none		0.428	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
SLC2A14	144195	hgsc.bcm.edu	37	12	7982586	7982586	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:7982586T>A	ENST00000543909.1	-	10	1117	c.358A>T	c.(358-360)Att>Ttt	p.I120F	SLC2A14_ENST00000431042.2_Missense_Mutation_p.I97F|SLC2A14_ENST00000396589.2_Missense_Mutation_p.I120F|SLC2A14_ENST00000340749.5_Missense_Mutation_p.I97F|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000542546.1_Missense_Mutation_p.I11F|SLC2A14_ENST00000539924.1_Missense_Mutation_p.I135F|SLC2A14_ENST00000535295.1_Missense_Mutation_p.I11F			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	120					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGGTTGACAATCAGCATTGAA	0.458																																					p.I120F		Atlas-SNP	.											.	SLC2A14	78	.	0			c.A358T						PASS	.						62.0	61.0	61.0					12																	7982586		2203	4300	6503	SO:0001583	missense	144195	exon6			TGACAATCAGCAT	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.358A>T	chr12.hg19:g.7982586T>A	ENSP00000440480:p.Ile120Phe	63.0	0.0	.		81.0	16.0	.	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	hg19	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	t	10.42	1.346517	0.24426	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924;ENST00000546234;ENST00000542782;ENST00000535344;ENST00000537557;ENST00000535266	T;T;T;T;T;T;T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	3.11	1.89	0.25635	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.451473	0.22797	N	0.055529	T	0.63094	0.2482	L	0.49455	1.56	0.09310	N	1	B;B;B;B	0.17852	0.02;0.006;0.002;0.024	B;B;B;B	0.24394	0.049;0.049;0.013;0.053	T	0.46076	-0.9217	10	0.15499	T	0.54	.	7.3787	0.26843	0.0:0.0:0.4716:0.5284	.	135;11;97;120	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	F	97;120;97;120;11;11;135;97;97;97;120;120	ENSP00000340450:I97F;ENSP00000440480:I120F;ENSP00000407287:I97F;ENSP00000379834:I120F;ENSP00000440492:I11F;ENSP00000443903:I11F;ENSP00000445929:I135F;ENSP00000440043:I97F;ENSP00000438312:I97F;ENSP00000443217:I97F;ENSP00000440044:I120F;ENSP00000437653:I120F	ENSP00000340450:I97F	I	-	1	0	SLC2A14	7873853	0.000000	0.05858	0.522000	0.27862	0.249000	0.25844	-0.458000	0.06737	0.201000	0.20466	0.377000	0.23210	ATT	.	.	.	none		0.458	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
ANO6	196527	hgsc.bcm.edu	37	12	45695869	45695869	+	Missense_Mutation	SNP	C	C	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:45695869C>A	ENST00000320560.8	+	2	345	c.143C>A	c.(142-144)cCg>cAg	p.P48Q	ANO6_ENST00000441606.2_Missense_Mutation_p.P30Q|ANO6_ENST00000426898.2_Intron|ANO6_ENST00000435642.1_Missense_Mutation_p.P48Q|ANO6_ENST00000425752.2_Missense_Mutation_p.P48Q|ANO6_ENST00000423947.3_Missense_Mutation_p.P69Q	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	48					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTTCGAACCCCGGAGTTTGTG	0.328																																					p.P69Q		Atlas-SNP	.											.	ANO6	163	.	0			c.C206A						PASS	.						140.0	138.0	138.0					12																	45695869		2203	4300	6503	SO:0001583	missense	196527	exon3			GAACCCCGGAGTT	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.143C>A	chr12.hg19:g.45695869C>A	ENSP00000320087:p.Pro48Gln	102.0	0.0	.		152.0	7.0	.	NM_001204803	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	hg19	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805266	0.50315	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.70516	-0.49;-0.36;-0.49;-0.34;-0.33	4.83	4.83	0.62350	.	0.193850	0.31450	N	0.007636	T	0.81054	0.4743	L	0.61218	1.895	0.34896	D	0.745981	B;P;D;B	0.89917	0.089;0.622;1.0;0.171	B;B;D;B	0.85130	0.057;0.222;0.997;0.14	D	0.84674	0.0713	10	0.42905	T	0.14	.	14.1386	0.65303	0.0:1.0:0.0:0.0	.	30;69;48;48	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	Q	48;69;48;48;30	ENSP00000391417:P48Q;ENSP00000409126:P69Q;ENSP00000413840:P48Q;ENSP00000320087:P48Q;ENSP00000413137:P30Q	ENSP00000320087:P48Q	P	+	2	0	ANO6	43982136	0.223000	0.23663	0.737000	0.30932	0.994000	0.84299	3.434000	0.52841	2.611000	0.88343	0.643000	0.83706	CCG	.	.	.	none		0.328	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743	
SLC38A1	81539	hgsc.bcm.edu	37	12	46633478	46633478	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:46633478T>A	ENST00000398637.5	-	3	800	c.106A>T	c.(106-108)Aat>Tat	p.N36Y	SLC38A1_ENST00000439706.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000546893.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000552197.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000549049.1_Missense_Mutation_p.N36Y|SLC38A1_ENST00000549633.1_Intron	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	36					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			ATCTGACCATTTTCTACTTCG	0.413																																					p.N36Y		Atlas-SNP	.											.	SLC38A1	58	.	0			c.A106T						PASS	.						159.0	147.0	151.0					12																	46633478		1872	4125	5997	SO:0001583	missense	81539	exon3			GACCATTTTCTAC	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.106A>T	chr12.hg19:g.46633478T>A	ENSP00000381634:p.Asn36Tyr	88.0	0.0	.		171.0	33.0	.	NM_030674	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	hg19	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.844471	0.71488	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197;ENST00000550173	T;T;T;T;T	0.07688	3.33;3.33;3.33;3.33;3.17	4.93	4.93	0.64822	.	0.000000	0.56097	D	0.000026	T	0.13457	0.0326	N	0.08118	0	0.46437	D	0.999046	D;P	0.89917	1.0;0.871	D;B	0.87578	0.998;0.327	T	0.35076	-0.9803	10	0.66056	D	0.02	-24.0257	14.896	0.70644	0.0:0.0:0.0:1.0	.	36;36	F8VX04;Q9H2H9	.;S38A1_HUMAN	Y	36	ENSP00000449607:N36Y;ENSP00000398142:N36Y;ENSP00000381634:N36Y;ENSP00000447853:N36Y;ENSP00000449756:N36Y	ENSP00000381634:N36Y	N	-	1	0	SLC38A1	44919745	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.732000	0.62029	1.975000	0.57531	0.477000	0.44152	AAT	.	.	.	none		0.413	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
TCTN1	79600	hgsc.bcm.edu	37	12	111070319	111070319	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:111070319C>T	ENST00000551590.1	+	5	823	c.667C>T	c.(667-669)Cct>Tct	p.P223S	TCTN1_ENST00000397655.3_Missense_Mutation_p.P223S|TCTN1_ENST00000397659.4_Missense_Mutation_p.P223S|AC144522.1_ENST00000408319.1_RNA|HVCN1_ENST00000548312.1_Intron|TCTN1_ENST00000551555.2_3'UTR|TCTN1_ENST00000377654.3_Missense_Mutation_p.P45S			Q2MV58	TECT1_HUMAN	tectonic family member 1	223					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						TCTGAGATTTCCTTCGTCCCT	0.398																																					p.P223S		Atlas-SNP	.											TCTN1,NS,lymphoid_neoplasm,0,1	TCTN1	37	.	0			c.C667T						PASS	.						197.0	184.0	188.0					12																	111070319		1898	4131	6029	SO:0001583	missense	79600	exon5			AGATTTCCTTCGT	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.667C>T	chr12.hg19:g.111070319C>T	ENSP00000448735:p.Pro223Ser	182.0	1.0	.		244.0	52.0	.	NM_024549	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Missense_Mutation	SNP	ENST00000551590.1	hg19	CCDS41835.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656513	0.88154	.	.	ENSG00000204852	ENST00000397650;ENST00000551590;ENST00000397655;ENST00000377654;ENST00000547868;ENST00000548095;ENST00000397657;ENST00000397659;ENST00000397652	D;D;D;D	0.98313	-4.86;-4.86;-4.86;-4.86	5.97	5.97	0.96955	Domain of unknown function DUF1619 (1);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	M	0.87180	2.865	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99716	1.1008	10	0.87932	D	0	-15.0486	18.9916	0.92794	0.0:1.0:0.0:0.0	.	223;223;223;163;167	Q2MV58;Q2MV58-3;Q2MV58-2;C9J1H5;C9J1H4	TECT1_HUMAN;.;.;.;.	S	163;223;223;45;45;223;45;223;167	ENSP00000448735:P223S;ENSP00000380775:P223S;ENSP00000366882:P45S;ENSP00000380779:P223S	ENSP00000366882:P45S	P	+	1	0	TCTN1	109554702	1.000000	0.71417	0.767000	0.31495	0.782000	0.44232	4.913000	0.63341	2.835000	0.97688	0.591000	0.81541	CCT	.	.	.	none		0.398	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316016.2	NM_024549	
ATXN2	6311	hgsc.bcm.edu	37	12	111908459	111908459	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:111908459G>C	ENST00000377617.3	-	19	3247	c.3086C>G	c.(3085-3087)gCc>gGc	p.A1029G	ATXN2_ENST00000608853.1_Missense_Mutation_p.A869G|ATXN2_ENST00000389153.4_Missense_Mutation_p.A766G|ATXN2_ENST00000542287.2_Missense_Mutation_p.A764G|ATXN2_ENST00000535949.1_Missense_Mutation_p.A740G|ATXN2_ENST00000550104.1_3'UTR	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1029	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TGGTGGGGTGGCTGCAATCGG	0.532																																					p.A1029G		Atlas-SNP	.											.	ATXN2	99	.	0			c.C3086G						PASS	.						139.0	128.0	132.0					12																	111908459		2203	4300	6503	SO:0001583	missense	6311	exon19			GGGGTGGCTGCAA	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3086C>G	chr12.hg19:g.111908459G>C	ENSP00000366843:p.Ala1029Gly	149.0	0.0	.		179.0	63.0	.	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	hg19	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351916	0.95830	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000482777;ENST00000542287;ENST00000535949	T	0.77620	-1.11	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.85444	0.5698	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.997;0.993;0.999;0.998	D;D;D;D;D	0.85130	0.994;0.985;0.978;0.997;0.994	T	0.81564	-0.0875	10	0.27082	T	0.32	-9.4636	19.888	0.96917	0.0:0.0:1.0:0.0	.	48;1029;740;764;766	Q99700-3;Q99700;Q24JQ7;F8VQP2;F8WB06	.;ATX2_HUMAN;.;.;.	G	84;766;1029;48;764;740	ENSP00000366843:A1029G	ENSP00000366843:A1029G	A	-	2	0	ATXN2	110392842	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.720000	0.93068	0.591000	0.81541	GCC	.	.	.	none		0.532	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
SBNO1	55206	hgsc.bcm.edu	37	12	123806180	123806180	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:123806180T>C	ENST00000602398.1	-	17	2352	c.2225A>G	c.(2224-2226)aAt>aGt	p.N742S	SBNO1_ENST00000267176.4_Missense_Mutation_p.N741S|SBNO1_ENST00000602750.1_Missense_Mutation_p.N741S|SBNO1_ENST00000420886.2_Missense_Mutation_p.N742S			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	742					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ACTTTCTTCATTATCAGAGGC	0.403																																					p.N742S		Atlas-SNP	.											.	SBNO1	138	.	0			c.A2225G						PASS	.						193.0	173.0	180.0					12																	123806180		2203	4300	6503	SO:0001583	missense	55206	exon16			TCTTCATTATCAG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2225A>G	chr12.hg19:g.123806180T>C	ENSP00000473665:p.Asn742Ser	132.0	0.0	.		218.0	90.0	.	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	hg19	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	3.761	-0.049616	0.07407	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.28666	1.6;1.6	5.33	4.15	0.48705	.	0.449012	0.24209	N	0.040557	T	0.09949	0.0244	N	0.00926	-1.1	0.35755	D	0.819721	B;B;B	0.19200	0.0;0.001;0.034	B;B;B	0.21917	0.001;0.001;0.037	T	0.20538	-1.0272	10	0.06365	T	0.9	-14.1214	12.2297	0.54480	0.0:0.0:0.1426:0.8574	.	742;741;740	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	S	742;741	ENSP00000387361:N742S;ENSP00000267176:N741S	ENSP00000267176:N741S	N	-	2	0	SBNO1	122372133	0.996000	0.38824	0.986000	0.45419	0.996000	0.88848	1.100000	0.31025	0.819000	0.34492	0.460000	0.39030	AAT	.	.	.	none		0.403	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
MTHFD1	4522	hgsc.bcm.edu	37	14	64915025	64915025	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:64915025A>C	ENST00000545908.1	+	23	2666	c.2437A>C	c.(2437-2439)Aat>Cat	p.N813H	MTHFD1_ENST00000216605.8_Missense_Mutation_p.N757H|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	757	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	AGTGGCCGTGAATGCATTCAA	0.383																																					p.N757H	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	Atlas-SNP	.											.	MTHFD1	61	.	0			c.A2269C						PASS	.						79.0	78.0	78.0					14																	64915025		2203	4300	6503	SO:0001583	missense	4522	exon23			GCCGTGAATGCAT	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2437A>C	chr14.hg19:g.64915025A>C	ENSP00000438588:p.Asn813His	43.0	0.0	.		59.0	12.0	.	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	hg19		.	.	.	.	.	.	.	.	.	.	A	21.0	4.077868	0.76528	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605	T;T;T	0.47177	0.85;0.85;0.85	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.82898	0.5137	H	0.99573	4.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90598	0.4542	10	0.87932	D	0	-21.8056	16.1926	0.82004	1.0:0.0:0.0:0.0	.	813;757	F5H2F4;G3V2B8	.;.	H	813;757;813	ENSP00000438588:N813H;ENSP00000450560:N757H;ENSP00000216605:N813H	ENSP00000216605:N757H	N	+	1	0	MTHFD1	63984778	1.000000	0.71417	0.914000	0.36105	0.594000	0.36715	9.339000	0.96797	2.219000	0.72066	0.533000	0.62120	AAT	.	.	.	none		0.383	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
ATG2B	55102	hgsc.bcm.edu	37	14	96784101	96784101	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr14:96784101C>G	ENST00000359933.4	-	19	3864	c.2971G>C	c.(2971-2973)Gcc>Ccc	p.A991P		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	991					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGCTGACTGGCTACTGAAAGC	0.343																																					p.A991P		Atlas-SNP	.											.	ATG2B	169	.	0			c.G2971C						PASS	.						101.0	96.0	98.0					14																	96784101		1833	4104	5937	SO:0001583	missense	55102	exon19			GACTGGCTACTGA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2971G>C	chr14.hg19:g.96784101C>G	ENSP00000353010:p.Ala991Pro	134.0	0.0	.		189.0	35.0	.	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998612	0.74818	.	.	ENSG00000066739	ENST00000359933	T	0.39997	1.05	5.54	5.54	0.83059	.	0.164574	0.39759	U	0.001274	T	0.63034	0.2477	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.54576	-0.8273	10	0.25751	T	0.34	.	19.8585	0.96775	0.0:1.0:0.0:0.0	.	991	Q96BY7	ATG2B_HUMAN	P	991	ENSP00000353010:A991P	ENSP00000353010:A991P	A	-	1	0	ATG2B	95853854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.496000	0.81526	2.760000	0.94817	0.655000	0.94253	GCC	.	.	.	none		0.343	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
TMED3	23423	hgsc.bcm.edu	37	15	79606106	79606106	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr15:79606106C>G	ENST00000299705.5	+	2	364	c.176C>G	c.(175-177)aCt>aGt	p.T59S	TMED3_ENST00000424155.2_Missense_Mutation_p.T59S|TMED3_ENST00000536821.1_Missense_Mutation_p.T59S	NM_007364.2	NP_031390.1	Q9Y3Q3	TMED3_HUMAN	transmembrane emp24 protein transport domain containing 3	59	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				protein transport (GO:0015031)	COPI vesicle coat (GO:0030126)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)|ovary(1)|skin(1)	9						CAGGTCATCACTGGAGGCCAC	0.478																																					p.T59S		Atlas-SNP	.											.	TMED3	19	.	0			c.C176G						PASS	.						94.0	82.0	86.0					15																	79606106		2196	4293	6489	SO:0001583	missense	23423	exon2			TCATCACTGGAGG	BC022232	CCDS10310.1, CCDS73768.1	15q24-q25	2011-02-09	2005-08-26	2005-01-07	ENSG00000166557	ENSG00000166557			28889	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 22"", ""transmembrane emp24 domain containing 3"""	C15orf22		12975309	Standard	XM_005254263		Approved	p24B	uc002beu.3	Q9Y3Q3	OTTHUMG00000144170	ENST00000299705.5:c.176C>G	chr15.hg19:g.79606106C>G	ENSP00000299705:p.Thr59Ser	42.0	0.0	.		51.0	8.0	.	NM_007364	A8K069|B4DN05|Q2T9F8	Missense_Mutation	SNP	ENST00000299705.5	hg19	CCDS10310.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220785	0.58560	.	.	ENSG00000166557	ENST00000299705;ENST00000424155;ENST00000536821;ENST00000543455	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	4.88	4.88	0.63580	GOLD (3);	0.258714	0.39407	N	0.001373	T	0.12220	0.0297	L	0.28694	0.88	0.47698	D	0.999498	B;B	0.29085	0.232;0.004	B;B	0.35607	0.206;0.01	T	0.06954	-1.0798	10	0.08599	T	0.76	-25.4826	15.9067	0.79436	0.0:1.0:0.0:0.0	.	59;59	B4DN05;Q9Y3Q3	.;TMED3_HUMAN	S	59	ENSP00000299705:T59S;ENSP00000414983:T59S;ENSP00000446062:T59S;ENSP00000440228:T59S	ENSP00000299705:T59S	T	+	2	0	TMED3	77393161	0.995000	0.38212	0.976000	0.42696	0.985000	0.73830	3.616000	0.54174	2.680000	0.91292	0.655000	0.94253	ACT	.	.	.	none		0.478	TMED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291369.1	NM_007364	
SRRM2	23524	hgsc.bcm.edu	37	16	2808492	2808492	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:2808492T>A	ENST00000301740.8	+	5	1086	c.537T>A	c.(535-537)agT>agA	p.S179R		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	179	Ser-rich.			SS -> NN (in Ref. 2; AAF21439). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGTCTAGCAGTTCTCGCTCAC	0.423																																					p.S179R		Atlas-SNP	.											.	SRRM2	263	.	0			c.T537A						PASS	.						161.0	166.0	165.0					16																	2808492		2198	4300	6498	SO:0001583	missense	23524	exon5			TAGCAGTTCTCGC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.537T>A	chr16.hg19:g.2808492T>A	ENSP00000301740:p.Ser179Arg	268.0	0.0	.		274.0	50.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195477	0.58126	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000396975;ENST00000426305	T	0.25250	1.81	5.15	2.81	0.32909	.	0.000000	0.64402	D	0.000006	T	0.29749	0.0743	N	0.19112	0.55	0.32407	N	0.551109	D	0.71674	0.998	D	0.76071	0.987	T	0.32955	-0.9887	10	0.87932	D	0	-4.3082	6.3143	0.21182	0.0:0.2621:0.0:0.7379	.	179	Q9UQ35	SRRM2_HUMAN	R	179;179;83;144	ENSP00000301740:S179R	ENSP00000301740:S179R	S	+	3	2	SRRM2	2748493	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.382000	0.20635	0.797000	0.33971	0.528000	0.53228	AGT	.	.	.	none		0.423	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ZNF23	7571	hgsc.bcm.edu	37	16	71483580	71483580	+	Silent	SNP	G	G	T	rs376275643		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:71483580G>T	ENST00000393539.2	-	6	1161	c.348C>A	c.(346-348)ccC>ccA	p.P116P	ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000428724.2_Silent_p.P58P|ZNF23_ENST00000417828.1_Silent_p.P116P|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000357254.4_Silent_p.P116P|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000564528.1_Silent_p.P58P	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P116P(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		ACTCCTCCACGGGGCTTGTCT	0.448																																					p.P116P		Atlas-SNP	.											.	ZNF23	65	.	1	Substitution - coding silent(1)	lung(1)	c.C348A						PASS	.						167.0	173.0	171.0					16																	71483580		2198	4300	6498	SO:0001819	synonymous_variant	7571	exon6			CTCCACGGGGCTT	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.348C>A	chr16.hg19:g.71483580G>T		232.0	0.0	.		242.0	10.0	.	NM_145911	Q8NDP5|Q96IT3|Q9UG42	Silent	SNP	ENST00000393539.2	hg19	CCDS10900.1																																																																																			.	.	.	alt		0.448	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911	
DHX38	9785	hgsc.bcm.edu	37	16	72138441	72138441	+	Silent	SNP	G	G	T	rs199994362	byFrequency	TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr16:72138441G>T	ENST00000268482.3	+	15	2576	c.2067G>T	c.(2065-2067)gcG>gcT	p.A689A	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	689	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.A689A(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CGATGGATGCGGAGAAGTTTG	0.572																																					p.A689A	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											DHX38,rectum,carcinoma,0,1	DHX38	91	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2067T						PASS	.						242.0	177.0	199.0					16																	72138441		2198	4300	6498	SO:0001819	synonymous_variant	9785	exon15			GGATGCGGAGAAG	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2067G>T	chr16.hg19:g.72138441G>T		114.0	0.0	.		128.0	7.0	.	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	hg19	CCDS10907.1																																																																																			.	G|0.999;A|0.001	.	alt		0.572	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
WSCD1	23302	hgsc.bcm.edu	37	17	6012935	6012935	+	Silent	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:6012935C>G	ENST00000574946.1	+	6	1248	c.858C>G	c.(856-858)ccC>ccG	p.P286P	WSCD1_ENST00000539421.1_Silent_p.P286P|WSCD1_ENST00000574232.1_Silent_p.P286P|WSCD1_ENST00000317744.5_Silent_p.P286P|WSCD1_ENST00000573634.1_Silent_p.P170P			Q658N2	WSCD1_HUMAN	WSC domain containing 1	286	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.P286P(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						AGGAGTTCCCCTTGGCCATTC	0.557																																					p.P286P		Atlas-SNP	.											WSCD1,NS,carcinoma,0,1	WSCD1	84	.	1	Substitution - coding silent(1)	endometrium(1)	c.C858G						PASS	.						260.0	245.0	250.0					17																	6012935		2203	4300	6503	SO:0001819	synonymous_variant	23302	exon6			GTTCCCCTTGGCC		CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.858C>G	chr17.hg19:g.6012935C>G		483.0	1.0	.		392.0	87.0	.	NM_015253	A8K0N8|D3DTM3|O60276|Q96G45	Silent	SNP	ENST00000574946.1	hg19	CCDS32538.1																																																																																			.	.	.	none		0.557	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438965.4	NM_015253	
ZNF830	91603	hgsc.bcm.edu	37	17	33289281	33289281	+	Silent	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:33289281T>C	ENST00000361952.3	+	1	733	c.696T>C	c.(694-696)caT>caC	p.H232H	CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000436961.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	232					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				CAGAAATACATGAAAAAGTGG	0.448																																					p.H232H		Atlas-SNP	.											.	ZNF830	26	.	0			c.T696C						PASS	.						49.0	48.0	48.0					17																	33289281		2203	4300	6503	SO:0001819	synonymous_variant	91603	exon1			AATACATGAAAAA	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.696T>C	chr17.hg19:g.33289281T>C		63.0	0.0	.		59.0	16.0	.	NM_052857	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	ENST00000361952.3	hg19	CCDS32618.1																																																																																			.	.	.	none		0.448	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
NR1D1	9572	hgsc.bcm.edu	37	17	38253601	38253601	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:38253601A>G	ENST00000246672.3	-	2	717	c.87T>C	c.(85-87)ccT>ccC	p.P29P		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	29	Modulating.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					AGAGGGATTCAGGGCTGGTGC	0.592																																					p.P29P		Atlas-SNP	.											.	NR1D1	45	.	0			c.T87C						PASS	.						57.0	62.0	60.0					17																	38253601		2203	4300	6503	SO:0001819	synonymous_variant	9572	exon2			GGATTCAGGGCTG	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.87T>C	chr17.hg19:g.38253601A>G		47.0	0.0	.		30.0	12.0	.	NM_021724	Q0P5Z4|Q15304	Silent	SNP	ENST00000246672.3	hg19	CCDS11361.1																																																																																			.	.	.	none		0.592	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
NAGS	162417	hgsc.bcm.edu	37	17	42083544	42083544	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr17:42083544T>C	ENST00000293404.3	+	3	972	c.854T>C	c.(853-855)cTg>cCg	p.L285P	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	285	Amino-acid kinase domain (AAK).				arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GCCAAGGCGCTGCGGCCCACC	0.662																																					p.L285P		Atlas-SNP	.											.	NAGS	25	.	0			c.T854C						PASS	.						29.0	29.0	29.0					17																	42083544		2200	4297	6497	SO:0001583	missense	162417	exon3			AGGCGCTGCGGCC	AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.854T>C	chr17.hg19:g.42083544T>C	ENSP00000293404:p.Leu285Pro	82.0	0.0	.		60.0	14.0	.	NM_153006	B2RAZ9|Q8IWR4	Missense_Mutation	SNP	ENST00000293404.3	hg19	CCDS11473.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478496	0.84747	.	.	ENSG00000161653	ENST00000541745;ENST00000293404	D	0.94576	-3.46	4.49	4.49	0.54785	Aspartate/glutamate/uridylate kinase (2);	0.000000	0.64402	D	0.000014	D	0.96815	0.8960	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.98	D	0.97143	0.9826	10	0.87932	D	0	-18.0769	11.7799	0.52008	0.0:0.0:0.0:1.0	.	119;285	Q2NKP2;Q8N159	.;NAGS_HUMAN	P	119;285	ENSP00000293404:L285P	ENSP00000293404:L285P	L	+	2	0	NAGS	39439070	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.544000	0.73878	1.883000	0.54544	0.374000	0.22700	CTG	.	.	.	none		0.662	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457660.1	NM_153006	
CATSPERD	257062	hgsc.bcm.edu	37	19	5744442	5744442	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:5744442A>G	ENST00000381624.3	+	8	639	c.578A>G	c.(577-579)gAa>gGa	p.E193G	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	193					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TCATAGGCAGAAATCATTGGG	0.368																																					p.E193G		Atlas-SNP	.											.	.	.	.	0			c.A578G						PASS	.						177.0	156.0	162.0					19																	5744442		1821	4093	5914	SO:0001583	missense	257062	exon8			AGGCAGAAATCAT	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.578A>G	chr19.hg19:g.5744442A>G	ENSP00000371037:p.Glu193Gly	112.0	0.0	.		125.0	16.0	.	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	hg19	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	A	11.28	1.590905	0.28357	.	.	ENSG00000174898	ENST00000394548;ENST00000381624	T	0.16597	2.33	2.61	-0.961	0.10337	.	1.018470	0.07916	U	0.975045	T	0.14227	0.0344	L	0.60455	1.87	0.09310	N	0.999999	P	0.46512	0.879	B	0.40009	0.316	T	0.20974	-1.0259	10	0.66056	D	0.02	.	0.3749	0.00385	0.3898:0.2527:0.1457:0.2118	.	193	Q86XM0	TM146_HUMAN	G	119;193	ENSP00000371037:E193G	ENSP00000371037:E193G	E	+	2	0	TMEM146	5695442	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	0.059000	0.14322	-0.283000	0.09115	0.260000	0.18958	GAA	.	.	.	none		0.368	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
C3	718	hgsc.bcm.edu	37	19	6711075	6711075	+	Missense_Mutation	SNP	C	C	A	rs148820222		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:6711075C>A	ENST00000245907.6	-	12	1494	c.1402G>T	c.(1402-1404)Ggg>Tgg	p.G468W		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	468					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGGGTCTCCCCGGGTCTGAGC	0.597																																					p.G468W		Atlas-SNP	.											.	C3	192	.	0			c.G1402T						PASS	.						232.0	206.0	215.0					19																	6711075		2203	4300	6503	SO:0001583	missense	718	exon12			TCTCCCCGGGTCT	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1402G>T	chr19.hg19:g.6711075C>A	ENSP00000245907:p.Gly468Trp	234.0	0.0	.		176.0	8.0	.	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399751	0.42512	.	.	ENSG00000125730	ENST00000245907	T	0.78707	-1.2	5.03	5.03	0.67393	Alpha-2-macroglobulin, N-terminal 2 (1);	0.273635	0.41194	D	0.000922	D	0.91126	0.7206	M	0.94021	3.485	0.41715	D	0.989475	D	0.89917	1.0	D	0.91635	0.999	D	0.93675	0.6993	10	0.87932	D	0	.	17.1311	0.86726	0.0:1.0:0.0:0.0	.	468	P01024	CO3_HUMAN	W	468	ENSP00000245907:G468W	ENSP00000245907:G468W	G	-	1	0	C3	6662075	0.672000	0.27530	0.279000	0.24732	0.004000	0.04260	3.025000	0.49681	2.344000	0.79699	0.557000	0.71058	GGG	.	C|1.000;T|0.000	.	alt		0.597	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
QTRT1	81890	hgsc.bcm.edu	37	19	10823458	10823458	+	Missense_Mutation	SNP	A	A	G	rs568561273		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:10823458A>G	ENST00000250237.5	+	8	896	c.886A>G	c.(886-888)Act>Gct	p.T296A		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	296					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CCTGGTGCCCACTGGGAACCT	0.622																																					p.T296A		Atlas-SNP	.											.	QTRT1	25	.	0			c.A886G						PASS	.						118.0	111.0	113.0					19																	10823458		2203	4300	6503	SO:0001583	missense	81890	exon8			GTGCCCACTGGGA	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.886A>G	chr19.hg19:g.10823458A>G	ENSP00000250237:p.Thr296Ala	249.0	0.0	.		228.0	44.0	.	NM_031209	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	hg19	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	A	0.571	-0.841326	0.02692	.	.	ENSG00000213339	ENST00000250237	.	.	.	3.87	3.87	0.44632	.	0.163748	0.42821	U	0.000652	T	0.28067	0.0692	L	0.43923	1.385	0.26123	N	0.980526	B	0.14805	0.011	B	0.17433	0.018	T	0.21143	-1.0254	9	0.07990	T	0.79	-8.686	6.4838	0.22077	0.7837:0.0:0.0:0.2163	.	296	Q9BXR0	TGT_HUMAN	A	296	.	ENSP00000250237:T296A	T	+	1	0	QTRT1	10684458	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	5.570000	0.67398	1.631000	0.50456	0.379000	0.24179	ACT	.	.	.	none		0.622	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
NOTCH3	4854	hgsc.bcm.edu	37	19	15289675	15289675	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:15289675C>G	ENST00000263388.2	-	23	3871	c.3796G>C	c.(3796-3798)Ggt>Cgt	p.G1266R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1266	EGF-like 32. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCCCCAGGACCCGGGCTAGGA	0.652																																					p.G1266R		Atlas-SNP	.											.	NOTCH3	340	.	0			c.G3796C						PASS	.						36.0	32.0	33.0					19																	15289675		2198	4296	6494	SO:0001583	missense	4854	exon23			CAGGACCCGGGCT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3796G>C	chr19.hg19:g.15289675C>G	ENSP00000263388:p.Gly1266Arg	25.0	0.0	.		17.0	5.0	.	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333583	0.41297	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.92099	-2.97	3.54	2.41	0.29592	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.94016	0.8083	M	0.72894	2.215	0.09310	N	1	P;D	0.89917	0.566;1.0	B;D	0.87578	0.131;0.998	D	0.84646	0.0698	9	0.54805	T	0.06	.	4.1418	0.10196	0.0:0.7058:0.0:0.2942	.	1217;1266	Q59FL3;Q9UM47	.;NOTC3_HUMAN	R	1266;1216	ENSP00000263388:G1266R	ENSP00000263388:G1266R	G	-	1	0	NOTCH3	15150675	0.011000	0.17503	0.110000	0.21437	0.729000	0.41735	0.970000	0.29383	1.813000	0.52934	0.561000	0.74099	GGT	.	.	.	none		0.652	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
GPR32	2854	hgsc.bcm.edu	37	19	51273914	51273914	+	Silent	SNP	G	G	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:51273914G>C	ENST00000270590.4	+	1	194	c.57G>C	c.(55-57)ctG>ctC	p.L19L		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	19					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CTGGGGTCCTGACACGTGATC	0.512																																					p.L19L	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											.	GPR32	68	.	0			c.G57C						PASS	.						80.0	65.0	70.0					19																	51273914		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			GGTCCTGACACGT	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.57G>C	chr19.hg19:g.51273914G>C		51.0	0.0	.		45.0	8.0	.	NM_001506	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	hg19	CCDS12801.1																																																																																			.	.	.	none		0.512	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
ZNF416	55659	hgsc.bcm.edu	37	19	58084258	58084258	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr19:58084258A>G	ENST00000196489.3	-	4	1236	c.1014T>C	c.(1012-1014)agT>agC	p.S338S		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TAAGGTTGGAACTTTGGCTAA	0.428																																					p.S338S		Atlas-SNP	.											.	ZNF416	50	.	0			c.T1014C						PASS	.						96.0	93.0	94.0					19																	58084258		2203	4300	6503	SO:0001819	synonymous_variant	55659	exon4			GTTGGAACTTTGG	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1014T>C	chr19.hg19:g.58084258A>G		74.0	0.0	.		75.0	15.0	.	NM_017879	Q9NWW8	Silent	SNP	ENST00000196489.3	hg19	CCDS12954.1																																																																																			.	.	.	none		0.428	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
CSE1L	1434	hgsc.bcm.edu	37	20	47691344	47691344	+	Silent	SNP	A	A	G			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr20:47691344A>G	ENST00000262982.2	+	11	1212	c.1089A>G	c.(1087-1089)gaA>gaG	p.E363E	CSE1L_ENST00000542325.1_Silent_p.E146E|CSE1L_ENST00000396192.3_Silent_p.E307E	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	363					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AAGCATTTGAAGATAATTCTG	0.383																																					p.E363E		Atlas-SNP	.											.	CSE1L	83	.	0			c.A1089G						PASS	.						172.0	158.0	163.0					20																	47691344		2203	4300	6503	SO:0001819	synonymous_variant	1434	exon11			ATTTGAAGATAAT	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1089A>G	chr20.hg19:g.47691344A>G		48.0	0.0	.		58.0	12.0	.	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	hg19	CCDS13412.1																																																																																			.	.	.	none		0.383	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
TXN2	25828	hgsc.bcm.edu	37	22	36876727	36876727	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr22:36876727T>C	ENST00000216185.2	-	2	624	c.158A>G	c.(157-159)tAc>tGc	p.Y53C	TXN2_ENST00000487725.1_5'UTR|TXN2_ENST00000416967.1_De_novo_Start_OutOfFrame|TXN2_ENST00000403313.1_Missense_Mutation_p.Y53C			Q99757	THIOM_HUMAN	thioredoxin 2	53					cell redox homeostasis (GO:0045454)|cellular response to nutrient levels (GO:0031669)|glycerol ether metabolic process (GO:0006662)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)	dendrite (GO:0030425)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)	protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|lung(1)|prostate(1)	3						CCTCGTGGTGTATATTGTCCG	0.542																																					p.Y53C		Atlas-SNP	.											.	TXN2	15	.	0			c.A158G						PASS	.						162.0	137.0	145.0					22																	36876727		2203	4300	6503	SO:0001583	missense	25828	exon2			GTGGTGTATATTG	U78678	CCDS13928.1	22q13.1	2008-06-11			ENSG00000100348	ENSG00000100348			17772	protein-coding gene	gene with protein product		609063				9006939, 17220299	Standard	NM_012473		Approved	MT-TRX	uc003apk.1	Q99757	OTTHUMG00000150596	ENST00000216185.2:c.158A>G	chr22.hg19:g.36876727T>C	ENSP00000216185:p.Tyr53Cys	117.0	0.0	.		117.0	24.0	.	NM_012473	Q5JZA0|Q6FH60|Q9UH29	Missense_Mutation	SNP	ENST00000216185.2	hg19	CCDS13928.1	.	.	.	.	.	.	.	.	.	.	t	4.360	0.066374	0.08388	.	.	ENSG00000100348	ENST00000216185;ENST00000403313	T;T	0.11495	2.77;2.77	5.59	-4.59	0.03400	Thioredoxin-like fold (1);	1.054490	0.07330	N	0.879042	T	0.07413	0.0187	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44559	-0.9320	10	0.38643	T	0.18	.	0.2548	0.00210	0.3331:0.1924:0.2444:0.2301	.	53	Q99757	THIOM_HUMAN	C	53	ENSP00000216185:Y53C;ENSP00000385393:Y53C	ENSP00000216185:Y53C	Y	-	2	0	TXN2	35206673	0.001000	0.12720	0.004000	0.12327	0.028000	0.11728	-0.205000	0.09411	-0.499000	0.06623	-0.459000	0.05422	TAC	.	.	.	none		0.542	TXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319016.1	NM_012473	
GSN	2934	hgsc.bcm.edu	37	9	124089637	124089638	+	Frame_Shift_Ins	INS	-	-	C	rs376326631		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr9:124089637_124089638insC	ENST00000373818.4	+	13	1861_1862	c.1792_1793insC	c.(1792-1794)accfs	p.T598fs	GSN_ENST00000394353.2_Frame_Shift_Ins_p.T558fs|GSN_ENST00000341272.2_Frame_Shift_Ins_p.T547fs|GSN_ENST00000436847.1_Frame_Shift_Ins_p.T558fs|GSN_ENST00000373823.3_Frame_Shift_Ins_p.T547fs|GSN_ENST00000545652.1_Frame_Shift_Ins_p.T555fs|GSN_ENST00000373807.1_Frame_Shift_Ins_p.T329fs|GSN_ENST00000449733.1_Frame_Shift_Ins_p.T547fs|GSN_ENST00000373806.1_Frame_Shift_Ins_p.T23fs|GSN_ENST00000412819.1_Frame_Shift_Ins_p.T547fs|GSN_ENST00000373808.2_Frame_Shift_Ins_p.T547fs	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	598	Actin-binding, Ca-sensitive. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGTTCTGAAAACCCCCTCAGCC	0.594																																					p.T598fs		Atlas-INDEL	.											.	GSN	81	.	0			c.1792_1793insC						PASS	.																																			SO:0001589	frameshift_variant	2934	exon13			.	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.1797dupC	chr9.hg19:g.124089642_124089642dupC	ENSP00000362924:p.Thr598fs	83.0	0.0	0		85.0	16.0	0.188235	NM_000177	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Frame_Shift_Ins	INS	ENST00000373818.4	hg19	CCDS6828.1																																																																																			.	.	.	none		0.594	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053861.1	NM_000177	
KLHL7	55975	hgsc.bcm.edu	37	7	23163475	23163476	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr7:23163475_23163476insT	ENST00000339077.5	+	2	443_444	c.200_201insT	c.(199-204)cattttfs	p.HF67fs	KLHL7_ENST00000545771.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000322231.7_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000545443.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000409689.1_Frame_Shift_Ins_p.HF19fs|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000322275.5_Frame_Shift_Ins_p.HF67fs|KLHL7_ENST00000410047.1_Frame_Shift_Ins_p.HF45fs|KLHL7_ENST00000479288.1_Intron	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	67	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCAGCCAGTCATTTTTTTAACT	0.332																																					p.H67fs		Atlas-INDEL	.											.	KLHL7	102	.	0			c.200_201insT						PASS	.																																			SO:0001589	frameshift_variant	55975	exon2			.		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.207dupT	chr7.hg19:g.23163482_23163482dupT	ENSP00000343273:p.His67fs	49.0	0.0	0		94.0	30.0	0.319149	NM_001031710	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Frame_Shift_Ins	INS	ENST00000339077.5	hg19	CCDS34609.1																																																																																			.	.	.	none		0.332	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
TBC1D9B	23061	hgsc.bcm.edu	37	5	179318454	179318455	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:179318454_179318455insA	ENST00000356834.3	-	6	1005_1006	c.968_969insT	c.(967-969)atgfs	p.M323fs	TBC1D9B_ENST00000355235.3_Frame_Shift_Ins_p.M323fs	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	323	GRAM 2.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGAGATGAACATCTGGCCAGG	0.599																																					p.M323fs		Atlas-INDEL	.											.	TBC1D9B	157	.	0			c.969_970insT						PASS	.																																			SO:0001589	frameshift_variant	23061	exon6			.	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.969dupT	chr5.hg19:g.179318455_179318455dupA	ENSP00000349291:p.Met323fs	184.0	0.0	0		176.0	41.0	0.232955	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Frame_Shift_Ins	INS	ENST00000356834.3	hg19	CCDS43408.1																																																																																			.	.	.	none		0.599	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
PTCHD3	374308	hgsc.bcm.edu	37	10	27687672	27687673	+	In_Frame_Ins	INS	-	-	GTATAT			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr10:27687672_27687673insGTATAT	ENST00000438700.3	-	4	1971_1972	c.1854_1855insATATAC	c.(1852-1857)tatggg>tatATATACggg	p.617_618insYI		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	617					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TGGAAACACCCATATATACTGC	0.361																																					p.G619delinsIYG		Atlas-INDEL	.											.	PTCHD3	140	.	0			c.1855_1856insATATAC						PASS	.																																			SO:0001652	inframe_insertion	374308	exon4			.	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1854_1855insATATAC	chr10.hg19:g.27687672_27687673insGTATAT	ENSP00000417658:p.Ile617_Tyr618insTyrIle	130.0	0.0	0		107.0	13.0	0.121495	NM_001034842	I3L499|Q6ZU28	In_Frame_Ins	INS	ENST00000438700.3	hg19	CCDS31173.1																																																																																			.	.	.	none		0.361	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
MAML1	9794	hgsc.bcm.edu	37	5	179193559	179193560	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr5:179193559_179193560insC	ENST00000292599.3	+	2	1811_1812	c.1548_1549insC	c.(1549-1551)cccfs	p.P517fs	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCAATACAAAACCCCTTTCTCA	0.559																																					p.K516fs		Atlas-INDEL	.											.	MAML1	118	.	0			c.1548_1549insC						PASS	.																																			SO:0001589	frameshift_variant	9794	exon2			.	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1552dupC	chr5.hg19:g.179193563_179193563dupC	ENSP00000292599:p.Pro517fs	103.0	0.0	0		80.0	19.0	0.2375	NM_014757		Frame_Shift_Ins	INS	ENST00000292599.3	hg19	CCDS34315.1																																																																																			.	.	.	none		0.559	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
H2AFJ	55766	hgsc.bcm.edu	37	12	14927683	14927684	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr12:14927683_14927684insT	ENST00000544848.1	+	1	414_415	c.279_280insT	c.(280-282)ttafs	p.L94fs		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	94						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E93D(1)		NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						ACGACGAGGAGTTAAACAAGCT	0.614																																					p.E93fs		Atlas-INDEL	.											H2AFJ,caecum,carcinoma,+1,1	H2AFJ	14	.	1	Substitution - Missense(1)	ovary(1)	c.279_280insT						PASS	.																																			SO:0001589	frameshift_variant	55766	exon1			.	AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.281dupT	chr12.hg19:g.14927685_14927685dupT	ENSP00000438553:p.Leu94fs	131.0	0.0	0		159.0	58.0	0.36478	NM_177925	Q9NV63	Frame_Shift_Ins	INS	ENST00000544848.1	hg19	CCDS31752.1																																																																																			.	.	.	none		0.614	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400845.1	NM_177925	
DNAJC1	64215	hgsc.bcm.edu	37	10	22171214	22171214	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr10:22171214delT	ENST00000376980.3	-	8	1265	c.975delA	c.(973-975)aaafs	p.K325fs		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	325	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TATTTACCTGTTTTTTCTGTG	0.323																																					p.Q326fs		Atlas-INDEL	.											.	DNAJC1	42	.	0			c.976delC						PASS	.						142.0	132.0	135.0					10																	22171214		2202	4300	6502	SO:0001589	frameshift_variant	64215	exon8			.	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.975delA	chr10.hg19:g.22171214delT	ENSP00000366179:p.Lys325fs	66.0	0.0	0		77.0	16.0	0.207792	NM_022365	B0YIZ8|Q5VX89|Q9H6B8	Frame_Shift_Del	DEL	ENST00000376980.3	hg19	CCDS7136.1																																																																																			.	.	.	none		0.323	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
MCPH1	79648	hgsc.bcm.edu	37	8	6335132	6335133	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr8:6335132_6335133insA	ENST00000344683.5	+	10	2029_2030	c.1953_1954insA	c.(1954-1956)atgfs	p.M652fs		NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	652	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GAACATTAGTCATGACAAGCAT	0.317																																					p.V651fs	Colon(95;1448 1467 8277 34473 35819)	Atlas-INDEL	.											.	MCPH1	65	.	0			c.1953_1954insA						PASS	.																																			SO:0001589	frameshift_variant	79648	exon10			.	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1954dupA	chr8.hg19:g.6335133_6335133dupA	ENSP00000342924:p.Met652fs	159.0	0.0	0		281.0	77.0	0.274021	NM_024596	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Frame_Shift_Ins	INS	ENST00000344683.5	hg19	CCDS43689.1																																																																																			.	.	.	none		0.317	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
NR3C2	4306	hgsc.bcm.edu	37	4	149357285	149357285	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr4:149357285delT	ENST00000358102.3	-	2	1090	c.728delA	c.(727-729)aatfs	p.N243fs	NR3C2_ENST00000355292.3_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000512865.1_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000344721.4_Frame_Shift_Del_p.N243fs|NR3C2_ENST00000511528.1_Frame_Shift_Del_p.N243fs	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	243	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GGAGCCTCGATTTTCAACATT	0.527																																					p.N243fs	Melanoma(27;428 957 40335 51025 51111)	Atlas-INDEL	.											.	NR3C2	94	.	0			c.729delT						PASS	.						74.0	76.0	75.0					4																	149357285		2203	4300	6503	SO:0001589	frameshift_variant	4306	exon2			.	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.728delA	chr4.hg19:g.149357285delT	ENSP00000350815:p.Asn243fs	147.0	0.0	0		149.0	46.0	0.308725	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Frame_Shift_Del	DEL	ENST00000358102.3	hg19	CCDS3772.1																																																																																			.	.	.	none		0.527	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
THRAP3	9967	hgsc.bcm.edu	37	1	36767245	36767245	+	Frame_Shift_Del	DEL	G	G	-	rs566092059		TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr1:36767245delG	ENST00000354618.5	+	11	2818	c.2594delG	c.(2593-2595)cggfs	p.R865fs	THRAP3_ENST00000469141.2_Frame_Shift_Del_p.R865fs	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	865	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAAAGAAACCGGGAAGAGGAG	0.478			T	USP6	aneurysmal bone cysts																																p.R865fs	Pancreas(129;785 1795 20938 23278 32581)	Atlas-INDEL	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3	93	.	0			c.2593delC						PASS	.						66.0	68.0	67.0					1																	36767245		2203	4300	6503	SO:0001589	frameshift_variant	9967	exon11			.	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2594delG	chr1.hg19:g.36767245delG	ENSP00000346634:p.Arg865fs	75.0	0.0	0		78.0	21.0	0.269231	NM_005119	D3DPS5|Q5VTK6	Frame_Shift_Del	DEL	ENST00000354618.5	hg19	CCDS405.1																																																																																			.	.	.	none		0.478	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
CAMK1	8536	hgsc.bcm.edu	37	3	9800959	9800960	+	Intron	INS	-	-	T			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr3:9800959_9800960insT	ENST00000256460.3	-	10	1090				OGG1_ENST00000302008.8_Frame_Shift_Ins_p.R347fs|OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_3'UTR|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302036.7_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I						cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		ACTTCTTCCTCTAGACTTGGAG	0.46																																					p.S346fs		Atlas-INDEL	.											.	OGG1	57	.	0			c.1037_1038insT						PASS	.																																			SO:0001627	intron_variant	4968	exon7			.	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.912+211->A	chr3.hg19:g.9800960_9800960dupT		172.0	0.0	0		157.0	32.0	0.203822	NM_016828	Q3KPF6	Frame_Shift_Ins	INS	ENST00000256460.3	hg19	CCDS2582.1																																																																																			.	.	.	none		0.460	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
PHLDB1	23187	hgsc.bcm.edu	37	11	118516164	118516164	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7059-01A-11D-1961-08	TCGA-BQ-7059-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9beec2fe-169d-4c3d-b177-f0d7bd9e5e96	bdab2c62-1568-47e5-b8f6-99ada040a736	g.chr11:118516164delA	ENST00000361417.2	+	17	3623	c.3212delA	c.(3211-3213)cacfs	p.H1071fs	PHLDB1_ENST00000356063.5_Frame_Shift_Del_p.H1024fs|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000524713.1_Frame_Shift_Del_p.H214fs|PHLDB1_ENST00000527898.1_Frame_Shift_Del_p.H122fs	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1071										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GATGCCCTTCACGGGGCAGCA	0.652																																					p.H1071fs		Atlas-INDEL	.											.	PHLDB1	103	.	0			c.3211delC						PASS	.						42.0	51.0	48.0					11																	118516164		2200	4295	6495	SO:0001589	frameshift_variant	23187	exon16			.		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3212delA	chr11.hg19:g.118516164delA	ENSP00000354498:p.His1071fs	143.0	0.0	0		92.0	27.0	0.293478	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Frame_Shift_Del	DEL	ENST00000361417.2	hg19	CCDS8401.1																																																																																			.	.	.	none		0.652	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
