#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu	37	1	11307790	11307790	+	Splice_Site	SNP	C	C	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:11307790C>A	ENST00000361445.4	-	8	1193	c.1117G>T	c.(1117-1119)Gtg>Ttg	p.V373L		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	373	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CACTGGCACACCTGAGAGAGG	0.498																																					p.V373L		Atlas-SNP	.											.	MTOR	327	.	0			c.G1117T						PASS	.						95.0	94.0	94.0					1																	11307790		2203	4300	6503	SO:0001630	splice_region_variant	2475	exon8			GGCACACCTGAGA	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1117-1G>T	chr1.hg19:g.11307790C>A		114.0	0.0	.		90.0	18.0	.	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796328	0.50208	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.57273	0.41	5.74	5.74	0.90152	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.52075	0.1712	M	0.69823	2.125	0.80722	D	1	B	0.26744	0.158	B	0.19391	0.025	T	0.53092	-0.8487	10	0.56958	D	0.05	-0.496	13.1719	0.59604	0.0:0.9275:0.0:0.0725	.	373	P42345	MTOR_HUMAN	L	373	ENSP00000354558:V373L	ENSP00000354558:V373L	V	-	1	0	MTOR	11230377	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	5.752000	0.68728	2.712000	0.92718	0.650000	0.86243	GTG	.	.	.	none		0.498	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	Missense_Mutation
ZMYM6	9204	hgsc.bcm.edu	37	1	35476600	35476600	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:35476600G>A	ENST00000357182.4	-	9	1327	c.1100C>T	c.(1099-1101)gCg>gTg	p.A367V	ZMYM6_ENST00000373340.2_Missense_Mutation_p.A367V|ZMYM6_ENST00000487874.1_Missense_Mutation_p.A367V|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	367					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A367V(1)|p.A367E(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				CAGGGGCACCGCCGAAGAGTT	0.458																																					p.A367V		Atlas-SNP	.											ZMYM6,NS,carcinoma,0,2	ZMYM6	110	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1100T						PASS	.						53.0	53.0	53.0					1																	35476600		2203	4300	6503	SO:0001583	missense	9204	exon9			GGCACCGCCGAAG	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.1100C>T	chr1.hg19:g.35476600G>A	ENSP00000349708:p.Ala367Val	87.0	1.0	.		95.0	37.0	.	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	hg19	CCDS387.2	.	.	.	.	.	.	.	.	.	.	G	0.993	-0.693458	0.03303	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	T;T	0.21191	2.02;3.19	5.2	-0.779	0.10973	.	0.649416	0.15854	N	0.241338	T	0.05181	0.0138	N	0.00926	-1.1	0.19575	N	0.999966	B;B;B	0.16166	0.016;0.004;0.001	B;B;B	0.08055	0.002;0.001;0.003	T	0.42716	-0.9435	10	0.07644	T	0.81	-7.0E-4	10.0213	0.42044	0.749:0.0:0.251:0.0	.	270;367;367	B4DWC0;O95789;O95789-1	.;ZMYM6_HUMAN;.	V	367	ENSP00000362437:A367V;ENSP00000349708:A367V	ENSP00000349708:A367V	A	-	2	0	ZMYM6	35249187	0.006000	0.16342	0.025000	0.17156	0.615000	0.37417	0.331000	0.19733	-0.009000	0.14296	0.655000	0.94253	GCG	.	.	.	none		0.458	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
LCE2A	353139	hgsc.bcm.edu	37	1	152671691	152671691	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:152671691G>C	ENST00000368779.1	+	2	365	c.314G>C	c.(313-315)tGc>tCc	p.C105S		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	105	Cys-rich.				keratinization (GO:0031424)					breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGGGGACTGCTGCTGACCA	0.587																																					p.C105S		Atlas-SNP	.											.	LCE2A	22	.	0			c.G314C						PASS	.						41.0	46.0	45.0					1																	152671691		2203	4300	6503	SO:0001583	missense	353139	exon2			GGGACTGCTGCTG		CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.314G>C	chr1.hg19:g.152671691G>C	ENSP00000357768:p.Cys105Ser	121.0	0.0	.		127.0	32.0	.	NM_178428	A4QMZ9	Missense_Mutation	SNP	ENST00000368779.1	hg19	CCDS1021.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.291835	0.23564	.	.	ENSG00000187173	ENST00000368779	T	0.03496	3.91	4.41	4.41	0.53225	.	.	.	.	.	T	0.09069	0.0224	M	0.71206	2.165	0.27116	N	0.962263	D	0.76494	0.999	D	0.78314	0.991	T	0.02691	-1.1123	9	0.87932	D	0	.	12.3335	0.55054	0.0:0.0:1.0:0.0	.	105	Q5TA79	LCE2A_HUMAN	S	105	ENSP00000357768:C105S	ENSP00000357768:C105S	C	+	2	0	LCE2A	150938315	0.999000	0.42202	1.000000	0.80357	0.737000	0.42083	1.350000	0.34010	2.253000	0.74438	0.650000	0.86243	TGC	.	.	.	none		0.587	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034512.1	NM_178428	
TNN	63923	hgsc.bcm.edu	37	1	175086172	175086172	+	Silent	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:175086172G>C	ENST00000239462.4	+	10	2330	c.2217G>C	c.(2215-2217)gtG>gtC	p.V739V		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	739	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACAGGTATGTGGTGCGCTACA	0.622																																					p.V739V		Atlas-SNP	.											TNN,NS,carcinoma,0,1	TNN	297	.	0			c.G2217C						PASS	.						78.0	77.0	77.0					1																	175086172		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon10			GTATGTGGTGCGC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2217G>C	chr1.hg19:g.175086172G>C		91.0	1.0	.		120.0	5.0	.	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	.	.	none		0.622	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
DHX9	1660	hgsc.bcm.edu	37	1	182850707	182850707	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:182850707A>G	ENST00000367549.3	+	24	2949	c.2839A>G	c.(2839-2841)Atg>Gtg	p.M947V	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	947					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AAGACTTAATATGGCTACACT	0.363																																					p.M947V	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A2839G						PASS	.						111.0	103.0	105.0					1																	182850707		1829	4080	5909	SO:0001583	missense	1660	exon24			CTTAATATGGCTA	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2839A>G	chr1.hg19:g.182850707A>G	ENSP00000356520:p.Met947Val	144.0	0.0	.		105.0	76.0	.	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	9.958	1.221960	0.22457	.	.	ENSG00000135829	ENST00000367549	T	0.03468	3.92	5.94	5.94	0.96194	.	0.041899	0.85682	D	0.000000	T	0.05593	0.0147	L	0.52126	1.63	0.52501	D	0.999959	B;B	0.16396	0.002;0.017	B;B	0.10450	0.005;0.005	T	0.41197	-0.9522	10	0.17369	T	0.5	.	16.3945	0.83586	1.0:0.0:0.0:0.0	.	226;947	B3KU66;Q08211	.;DHX9_HUMAN	V	947	ENSP00000356520:M947V	ENSP00000356520:M947V	M	+	1	0	DHX9	181117330	1.000000	0.71417	0.999000	0.59377	0.825000	0.46686	6.735000	0.74806	2.265000	0.75225	0.482000	0.46254	ATG	.	.	.	none		0.363	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
USP34	9736	hgsc.bcm.edu	37	2	61450209	61450209	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:61450209G>C	ENST00000398571.2	-	64	7811	c.7735C>G	c.(7735-7737)Cga>Gga	p.R2579G	USP34_ENST00000472689.1_5'Flank	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2579					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCTGCAAGTCGATTATTGTAT	0.383																																					p.R2579G		Atlas-SNP	.											.	USP34	334	.	0			c.C7735G						PASS	.						76.0	66.0	69.0					2																	61450209		1841	4093	5934	SO:0001583	missense	9736	exon64			CAAGTCGATTATT	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.7735C>G	chr2.hg19:g.61450209G>C	ENSP00000381577:p.Arg2579Gly	46.0	0.0	.		38.0	10.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.151332|3.151332	0.57151|0.57151	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571|ENST00000411912	T|.	0.64803|.	-0.12|.	6.06|6.06	5.17|5.17	0.71159|0.71159	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67702|0.67702	0.2921|0.2921	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D|.	0.60160|.	0.987|.	D|.	0.67725|.	0.953|.	T|T	0.65598|0.65598	-0.6129|-0.6129	10|5	0.72032|.	D|.	0.01|.	.|.	15.4863|15.4863	0.75571|0.75571	0.0:0.0:0.6762:0.3238|0.0:0.0:0.6762:0.3238	.|.	2579|.	Q70CQ2|.	UBP34_HUMAN|.	G|W	2427;2427;2579|338	ENSP00000381577:R2579G|.	ENSP00000263989:R2427G|.	R|S	-|-	1|2	2|0	USP34|USP34	61303713|61303713	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.187000|5.187000	0.65087|0.65087	1.558000|1.558000	0.49541|0.49541	0.650000|0.650000	0.86243|0.86243	CGA|TCG	.	.	.	none		0.383	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
GCFC2	6936	hgsc.bcm.edu	37	2	75921529	75921529	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:75921529G>C	ENST00000321027.3	-	6	991	c.858C>G	c.(856-858)caC>caG	p.H286Q	GCFC2_ENST00000409857.3_Missense_Mutation_p.H248Q|GCFC2_ENST00000541687.1_Missense_Mutation_p.P248A	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	286					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										GGTGTGAGCGGTGAGTTTCCT	0.294																																					p.H286Q		Atlas-SNP	.											.	.	.	.	0			c.C858G						PASS	.						148.0	150.0	149.0					2																	75921529		2203	4300	6503	SO:0001583	missense	6936	exon6			TGAGCGGTGAGTT	AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.858C>G	chr2.hg19:g.75921529G>C	ENSP00000318690:p.His286Gln	125.0	0.0	.		98.0	40.0	.	NM_003203	A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	ENST00000321027.3	hg19	CCDS1961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.83|17.83	3.486559|3.486559	0.63962|0.63962	.|.	.|.	ENSG00000005436|ENSG00000005436	ENST00000321027;ENST00000409857|ENST00000541687	T;T|T	0.19105|0.39229	2.17;2.28|1.09	5.29|5.29	0.803|0.803	0.18691|0.18691	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.41282|0.41282	0.1152|0.1152	M|M	0.80982|0.80982	2.52|2.52	0.20926|0.20926	N|N	0.999823|0.999823	D|.	0.64830|.	0.994|.	P|.	0.59288|.	0.855|.	T|T	0.43877|0.43877	-0.9364|-0.9364	10|7	0.42905|0.02654	T|T	0.14|1	-15.9173|-15.9173	7.4758|7.4758	0.27376|0.27376	0.5377:0.0:0.4623:0.0|0.5377:0.0:0.4623:0.0	.|.	286|.	P16383|.	GCF_HUMAN|.	Q|A	286;248|248	ENSP00000318690:H286Q;ENSP00000386552:H248Q|ENSP00000437767:P248A	ENSP00000318690:H286Q|ENSP00000437767:P248A	H|P	-|-	3|1	2|0	C2orf3|C2orf3	75775037|75775037	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	1.338000|1.338000	0.33873|0.33873	0.152000|0.152000	0.19188|0.19188	-0.140000|-0.140000	0.14226|0.14226	CAC|CCG	.	.	.	none		0.294	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252255.2	NM_003203	
KIAA1211L	343990	hgsc.bcm.edu	37	2	99411105	99411105	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:99411105G>C	ENST00000397899.2	-	10	3110	c.2779C>G	c.(2779-2781)Ctg>Gtg	p.L927V		NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	927																	AGCTGATGCAGTTCCTTCTCC	0.478																																					p.L927V		Atlas-SNP	.											.	.	.	.	0			c.C2779G						PASS	.						109.0	107.0	108.0					2																	99411105		1996	4184	6180	SO:0001583	missense	343990	exon10			GATGCAGTTCCTT	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.2779C>G	chr2.hg19:g.99411105G>C	ENSP00000380996:p.Leu927Val	125.0	0.0	.		144.0	60.0	.	NM_207362		Missense_Mutation	SNP	ENST00000397899.2	hg19	CCDS42720.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057396	0.36277	.	.	ENSG00000196872	ENST00000397899	T	0.46819	0.86	5.27	0.764	0.18465	.	.	.	.	.	T	0.55449	0.1921	L	0.59436	1.845	0.24768	N	0.992884	D	0.76494	0.999	D	0.80764	0.994	T	0.49532	-0.8930	9	0.08599	T	0.76	-7.2777	8.2997	0.32006	0.3464:0.0:0.6536:0.0	.	927	Q6NV74	CB055_HUMAN	V	927	ENSP00000380996:L927V	ENSP00000380996:L927V	L	-	1	2	C2orf55	98777537	0.018000	0.18449	0.911000	0.35937	0.969000	0.65631	-0.303000	0.08210	-0.047000	0.13423	-0.255000	0.11280	CTG	.	.	.	none		0.478	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
XIRP2	129446	hgsc.bcm.edu	37	2	168103542	168103542	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:168103542T>A	ENST00000409195.1	+	9	5729	c.5640T>A	c.(5638-5640)caT>caA	p.H1880Q	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.H1880Q|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.H1658Q|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1705					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AATCAAGCCATCGATGGAAAG	0.383																																					p.H1880Q		Atlas-SNP	.											.	XIRP2	914	.	0			c.T5640A						PASS	.						83.0	75.0	77.0					2																	168103542		1885	4124	6009	SO:0001583	missense	129446	exon9			AAGCCATCGATGG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5640T>A	chr2.hg19:g.168103542T>A	ENSP00000386840:p.His1880Gln	73.0	0.0	.		72.0	18.0	.	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.991182	0.00439	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02280	4.36;4.36;4.36	5.46	-10.9	0.00192	.	1.270260	0.04947	N	0.459528	T	0.01254	0.0041	L	0.27053	0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.45279	-0.9272	10	0.20519	T	0.43	4.4394	1.0633	0.01605	0.3314:0.095:0.2197:0.3539	.	1705;1705;1658	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Q	1880;1880;1658	ENSP00000386840:H1880Q;ENSP00000295237:H1880Q;ENSP00000387255:H1658Q	ENSP00000295237:H1880Q	H	+	3	2	XIRP2	167811788	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.516000	0.00222	-2.709000	0.00395	-1.577000	0.00868	CAT	.	.	.	none		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
SPEG	10290	hgsc.bcm.edu	37	2	220309733	220309733	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:220309733C>G	ENST00000312358.7	+	3	797	c.665C>G	c.(664-666)cCa>cGa	p.P222R	SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396698.1_Missense_Mutation_p.P118R	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	222					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGGGCCGGGCCACGGCACCTG	0.716																																					p.P222R		Atlas-SNP	.											.	SPEG	272	.	0			c.C665G						PASS	.						10.0	14.0	13.0					2																	220309733		1928	4078	6006	SO:0001583	missense	10290	exon3			CCGGGCCACGGCA	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.665C>G	chr2.hg19:g.220309733C>G	ENSP00000311684:p.Pro222Arg	16.0	0.0	.		22.0	9.0	.	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587755	0.46110	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698	T;T	0.69175	-0.38;-0.11	4.86	4.86	0.63082	.	0.000000	0.36932	U	0.002335	T	0.61739	0.2371	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	P	0.58077	0.832	T	0.61058	-0.7139	10	0.31617	T	0.26	.	11.9491	0.52944	0.0:0.9075:0.0:0.0925	.	222	Q15772	SPEG_HUMAN	R	222;222;118	ENSP00000311684:P222R;ENSP00000379926:P118R	ENSP00000265327:P222R	P	+	2	0	SPEG	220017977	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.189000	0.42621	2.227000	0.72691	0.442000	0.29010	CCA	.	.	.	none		0.716	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
MRPL44	65080	hgsc.bcm.edu	37	2	224824513	224824513	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr2:224824513A>G	ENST00000258383.3	+	2	511	c.442A>G	c.(442-444)Atg>Gtg	p.M148V		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	148	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		GTACCCAGACATGCCCACTGA	0.428																																					p.M148V		Atlas-SNP	.											.	MRPL44	31	.	0			c.A442G						PASS	.						76.0	80.0	79.0					2																	224824513		2203	4300	6503	SO:0001583	missense	65080	exon2			CCAGACATGCCCA	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.442A>G	chr2.hg19:g.224824513A>G	ENSP00000258383:p.Met148Val	114.0	0.0	.		106.0	47.0	.	NM_022915	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	ENST00000258383.3	hg19	CCDS2459.1	.	.	.	.	.	.	.	.	.	.	A	3.222	-0.159303	0.06544	.	.	ENSG00000135900	ENST00000258383	T	0.39997	1.05	5.42	-3.5	0.04710	Ribonuclease III (3);	0.216533	0.40222	N	0.001151	T	0.15046	0.0363	N	0.04880	-0.145	0.21020	N	0.9998	B	0.02656	0.0	B	0.06405	0.002	T	0.07539	-1.0767	10	0.38643	T	0.18	-2.8434	4.3393	0.11101	0.5634:0.2199:0.0:0.2166	.	148	Q9H9J2	RM44_HUMAN	V	148	ENSP00000258383:M148V	ENSP00000258383:M148V	M	+	1	0	MRPL44	224532757	0.005000	0.15991	0.981000	0.43875	0.030000	0.12068	0.015000	0.13355	-0.206000	0.10203	-2.558000	0.00175	ATG	.	.	.	none		0.428	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256866.2	NM_022915	
GOLGA4	2803	hgsc.bcm.edu	37	3	37365472	37365472	+	Missense_Mutation	SNP	G	G	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:37365472G>A	ENST00000361924.2	+	14	2469	c.2095G>A	c.(2095-2097)Gcc>Acc	p.A699T	GOLGA4_ENST00000356847.4_Missense_Mutation_p.A721T|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	699	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGTATTAAAAGCCCGTCACAA	0.358																																					p.A721T		Atlas-SNP	.											.	GOLGA4	173	.	0			c.G2161A						PASS	.						32.0	35.0	34.0					3																	37365472		2195	4266	6461	SO:0001583	missense	2803	exon15			TTAAAAGCCCGTC	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.2095G>A	chr3.hg19:g.37365472G>A	ENSP00000354486:p.Ala699Thr	44.0	0.0	.		39.0	29.0	.	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	G	6.302	0.423898	0.11928	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000429018;ENST00000437131	T;T;T	0.22539	1.99;1.99;1.95	5.22	3.44	0.39384	.	0.449282	0.16613	N	0.206829	T	0.13329	0.0323	N	0.25890	0.77	0.09310	N	1	B;B;B;B	0.12013	0.005;0.001;0.001;0.002	B;B;B;B	0.09377	0.004;0.004;0.004;0.003	T	0.30563	-0.9974	10	0.15066	T	0.55	.	10.028	0.42083	0.2751:0.0:0.7249:0.0	.	699;699;721;699	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	T	699;721;260;570	ENSP00000354486:A699T;ENSP00000349305:A721T;ENSP00000405842:A570T	ENSP00000349305:A721T	A	+	1	0	GOLGA4	37340476	0.002000	0.14202	0.168000	0.22838	0.683000	0.39861	0.601000	0.24119	0.721000	0.32231	0.655000	0.94253	GCC	.	.	.	none		0.358	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
ACY1	95	hgsc.bcm.edu	37	3	52023049	52023049	+	Silent	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:52023049G>C	ENST00000404366.2	+	15	1331	c.1185G>C	c.(1183-1185)ctG>ctC	p.L395L	ACY1_ENST00000476351.1_Silent_p.L360L|ACY1_ENST00000476854.1_Silent_p.L330L|ACY1_ENST00000458031.2_Silent_p.L485L|ACY1_ENST00000494103.1_Silent_p.L323L|ABHD14A-ACY1_ENST00000463937.1_Silent_p.L496L	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1	395					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CACGCCTGCTGCCTGCCCTTG	0.607																																					p.L395L		Atlas-SNP	.											.	ACY1	35	.	0			c.G1185C						PASS	.						116.0	102.0	107.0					3																	52023049		2203	4300	6503	SO:0001819	synonymous_variant	95	exon15			CCTGCTGCCTGCC	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.1185G>C	chr3.hg19:g.52023049G>C		167.0	1.0	.		125.0	98.0	.	NM_001198895	C9J6I6|C9J9D8|C9JWD4	Silent	SNP	ENST00000404366.2	hg19	CCDS2844.1																																																																																			.	.	.	none		0.607	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349657.1	NM_000666	
PBRM1	55193	hgsc.bcm.edu	37	3	52651555	52651555	+	Splice_Site	SNP	C	C	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:52651555C>T	ENST00000296302.7	-	14	1543		c.e14-1		PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTTCTTTTTACTGTTGAGGGG	0.348			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																.		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.1542-1G>A						PASS	.						52.0	52.0	52.0					3																	52651555		2202	4300	6502	SO:0001630	splice_region_variant	55193	exon16			TTTTTACTGTTGA	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1542-1G>A	chr3.hg19:g.52651555C>T		38.0	0.0	.		35.0	23.0	.	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	C	21.4	4.147027	0.77888	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.139	0.98050	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52626595	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.810000	0.55613	2.764000	0.94973	0.655000	0.94253	.	.	.	.	none		0.348	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	Intron
KIAA2018	205717	hgsc.bcm.edu	37	3	113377559	113377559	+	Silent	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:113377559T>C	ENST00000478658.1	-	5	2987	c.2970A>G	c.(2968-2970)tcA>tcG	p.S990S	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.S990S			Q68DE3	K2018_HUMAN	KIAA2018	990						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GCATTGTATCTGATGAATCTT	0.393																																					p.S990S		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A2970G						PASS	.						113.0	106.0	108.0					3																	113377559		1870	4096	5966	SO:0001819	synonymous_variant	205717	exon7			TGTATCTGATGAA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.2970A>G	chr3.hg19:g.113377559T>C		152.0	0.0	.		134.0	104.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.	.	none		0.393	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
CD86	942	hgsc.bcm.edu	37	3	121822644	121822644	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:121822644C>G	ENST00000330540.2	+	3	466	c.350C>G	c.(349-351)cCc>cGc	p.P117R	CD86_ENST00000393627.2_Missense_Mutation_p.P111R|CD86_ENST00000469710.1_Missense_Mutation_p.P35R|CD86_ENST00000493101.1_Intron|CD86_ENST00000264468.5_Intron	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule	117	Ig-like V-type.				aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	CACAAAAAGCCCACAGGAATG	0.453																																					p.P117R	GBM(67;1379 1389 36064 39806)	Atlas-SNP	.											.	CD86	43	.	0			c.C350G						PASS	.						129.0	134.0	132.0					3																	121822644		2203	4300	6503	SO:0001583	missense	942	exon3			AAAAGCCCACAGG		CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.350C>G	chr3.hg19:g.121822644C>G	ENSP00000332049:p.Pro117Arg	125.0	0.0	.		77.0	64.0	.	NM_175862	A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	Missense_Mutation	SNP	ENST00000330540.2	hg19	CCDS3009.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769867	0.49680	.	.	ENSG00000114013	ENST00000469710;ENST00000330540;ENST00000482356;ENST00000393627	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.54	4.67	0.58626	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.828917	0.10874	N	0.624588	T	0.55768	0.1941	M	0.82630	2.6	0.25045	N	0.991176	D	0.64830	0.994	D	0.65987	0.94	T	0.44574	-0.9319	10	0.41790	T	0.15	-0.8312	10.1893	0.43017	0.0:0.9112:0.0:0.0888	.	117	P42081	CD86_HUMAN	R	35;117;111;111	ENSP00000418988:P35R;ENSP00000332049:P117R;ENSP00000419116:P111R;ENSP00000377248:P111R	ENSP00000332049:P117R	P	+	2	0	CD86	123305334	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.065000	0.14466	1.578000	0.49821	0.655000	0.94253	CCC	.	.	.	none		0.453	CD86-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000355671.1	NM_006889	
USP38	84640	hgsc.bcm.edu	37	4	144141548	144141548	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr4:144141548G>C	ENST00000307017.4	+	10	3574	c.3068G>C	c.(3067-3069)tGt>tCt	p.C1023S		NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	1023					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CCAGGAAGCTGTGGACCAACT	0.512																																					p.C1023S		Atlas-SNP	.											.	USP38	92	.	0			c.G3068C						PASS	.						92.0	94.0	93.0					4																	144141548		2203	4300	6503	SO:0001583	missense	84640	exon10			GAAGCTGTGGACC	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.3068G>C	chr4.hg19:g.144141548G>C	ENSP00000303434:p.Cys1023Ser	92.0	0.0	.		71.0	4.0	.	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	hg19	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312440	0.81358	.	.	ENSG00000170185	ENST00000307017	T	0.10477	2.87	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.01452	-1.1351	10	0.62326	D	0.03	-13.0776	20.1294	0.97995	0.0:0.0:1.0:0.0	.	1023	Q8NB14	UBP38_HUMAN	S	1023	ENSP00000303434:C1023S	ENSP00000303434:C1023S	C	+	2	0	USP38	144360998	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.758000	0.94735	0.591000	0.81541	TGT	.	.	.	none		0.512	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
SMAD1	4086	hgsc.bcm.edu	37	4	146475084	146475084	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr4:146475084T>G	ENST00000515385.1	+	6	1688	c.1146T>G	c.(1144-1146)atT>atG	p.I382M	SMAD1_ENST00000394092.2_Missense_Mutation_p.I382M|SMAD1_ENST00000302085.4_Missense_Mutation_p.I382M			Q15797	SMAD1_HUMAN	SMAD family member 1	382	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle cell proliferation (GO:0060038)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|embryonic pattern specification (GO:0009880)|gamete generation (GO:0007276)|hindbrain development (GO:0030902)|homeostatic process (GO:0042592)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|mesodermal cell fate commitment (GO:0001710)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|osteoblast fate commitment (GO:0002051)|positive regulation of cartilage development (GO:0061036)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of gene expression (GO:0010628)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|primary miRNA processing (GO:0031053)|protein phosphorylation (GO:0006468)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|signal transduction (GO:0007165)|SMAD protein complex assembly (GO:0007183)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	17	all_hematologic(180;0.151)					GTCTGAAAATTTTTAACAACC	0.398																																					p.I382M	Pancreas(182;1287 2092 10326 35158 50562)	Atlas-SNP	.											.	SMAD1	48	.	0			c.T1146G						PASS	.						165.0	158.0	160.0					4																	146475084		2203	4300	6503	SO:0001583	missense	4086	exon6			GAAAATTTTTAAC	U59423	CCDS3765.1	4q31.21	2013-10-22	2006-11-06	2004-05-26	ENSG00000170365	ENSG00000170365		"""SMADs"""	6767	protein-coding gene	gene with protein product		601595	"""MAD, mothers against decapentaplegic homolog 1 (Drosophila)"", ""SMAD, mothers against DPP homolog 1 (Drosophila)"""	MADH1		8653785, 8673135	Standard	NM_005900		Approved	MADR1, JV4-1	uc003ikc.3	Q15797	OTTHUMG00000161592	ENST00000515385.1:c.1146T>G	chr4.hg19:g.146475084T>G	ENSP00000426568:p.Ile382Met	141.0	0.0	.		101.0	36.0	.	NM_005900	A8KAJ0|D3DNZ9|Q16636|Q9UFT8	Missense_Mutation	SNP	ENST00000515385.1	hg19	CCDS3765.1	.	.	.	.	.	.	.	.	.	.	T	19.20	3.782414	0.70222	.	.	ENSG00000170365	ENST00000302085;ENST00000394092;ENST00000515385	D;D;D	0.97811	-4.55;-4.55;-4.55	5.73	2.08	0.27032	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	H	0.95712	3.71	0.80722	D	1	D	0.54397	0.966	D	0.73708	0.981	D	0.98389	1.0562	10	0.87932	D	0	.	9.1222	0.36795	0.0:0.1974:0.0:0.8026	.	382	Q15797	SMAD1_HUMAN	M	382	ENSP00000305769:I382M;ENSP00000377652:I382M;ENSP00000426568:I382M	ENSP00000305769:I382M	I	+	3	3	SMAD1	146694534	0.995000	0.38212	1.000000	0.80357	0.983000	0.72400	0.316000	0.19469	0.136000	0.18733	0.528000	0.53228	ATT	.	.	.	none		0.398	SMAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365467.1	NM_005900	
IRF2	3660	hgsc.bcm.edu	37	4	185339324	185339324	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr4:185339324G>C	ENST00000393593.3	-	5	615	c.408C>G	c.(406-408)atC>atG	p.I136M	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	136					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		AGATTACCTTGATGTGCTTAA	0.398																																					p.I136M		Atlas-SNP	.											.	IRF2	53	.	0			c.C408G						PASS	.						317.0	261.0	280.0					4																	185339324		2203	4300	6503	SO:0001583	missense	3660	exon5			TACCTTGATGTGC		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.408C>G	chr4.hg19:g.185339324G>C	ENSP00000377218:p.Ile136Met	187.0	0.0	.		186.0	64.0	.	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	hg19	CCDS3835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.31|11.31	1.601714|1.601714	0.28534|0.28534	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316|ENST00000505067	D;D;D;D|.	0.98090|.	-4.66;-4.65;-4.63;-4.71|.	6.17|6.17	5.17|5.17	0.71159|0.71159	.|.	0.584493|.	0.19685|.	N|.	0.108406|.	T|T	0.49047|0.49047	0.1534|0.1534	L|L	0.44542|0.44542	1.39|1.39	0.42544|0.42544	D|D	0.993085|0.993085	B|.	0.23854|.	0.092|.	B|.	0.18263|.	0.021|.	T|T	0.44205|0.44205	-0.9343|-0.9343	10|5	0.45353|.	T|.	0.12|.	-20.7082|-20.7082	5.7421|5.7421	0.18100|0.18100	0.129:0.0:0.6708:0.2002|0.129:0.0:0.6708:0.2002	.|.	136|.	P14316|.	IRF2_HUMAN|.	M|E	136|35	ENSP00000377218:I136M;ENSP00000427204:I136M;ENSP00000424552:I136M;ENSP00000422860:I136M|.	ENSP00000377218:I136M|.	I|Q	-|-	3|1	3|0	IRF2|IRF2	185576318|185576318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	0.647000|0.647000	0.24812|0.24812	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	ATC|CAA	.	.	.	none		0.398	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
UGT3A2	167127	hgsc.bcm.edu	37	5	36039694	36039694	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr5:36039694A>C	ENST00000282507.3	-	5	1061	c.960T>G	c.(958-960)ttT>ttG	p.F320L	UGT3A2_ENST00000513300.1_Missense_Mutation_p.F286L|UGT3A2_ENST00000504954.1_5'Flank|UGT3A2_ENST00000545528.1_Missense_Mutation_p.F18L	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	320					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GTAGGTGAGCAAAGGCATTGT	0.493																																					p.F320L		Atlas-SNP	.											.	UGT3A2	117	.	0			c.T960G						PASS	.						142.0	130.0	134.0					5																	36039694		2203	4300	6503	SO:0001583	missense	167127	exon5			GTGAGCAAAGGCA		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.960T>G	chr5.hg19:g.36039694A>C	ENSP00000282507:p.Phe320Leu	122.0	0.0	.		126.0	46.0	.	NM_174914	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	hg19	CCDS3914.1	.	.	.	.	.	.	.	.	.	.	A	8.718	0.913757	0.17907	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.50001	0.76;0.76;4.06	3.18	3.18	0.36537	.	0.000000	0.85682	D	0.000000	T	0.46210	0.1381	L	0.35414	1.06	0.36452	D	0.866122	D;D	0.89917	0.998;1.0	D;D	0.91635	0.986;0.999	T	0.54543	-0.8278	10	0.02654	T	1	.	6.7806	0.23643	0.8835:0.0:0.1165:0.0	.	286;320	E9PFK7;Q3SY77	.;UD3A2_HUMAN	L	320;286;18	ENSP00000282507:F320L;ENSP00000427404:F286L;ENSP00000445367:F18L	ENSP00000282507:F320L	F	-	3	2	UGT3A2	36075451	0.999000	0.42202	0.882000	0.34594	0.212000	0.24457	0.703000	0.25646	1.689000	0.51079	0.482000	0.46254	TTT	.	.	.	none		0.493	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
GFRA3	2676	hgsc.bcm.edu	37	5	137610073	137610073	+	Missense_Mutation	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr5:137610073A>G	ENST00000274721.3	-	1	287	c.41T>C	c.(40-42)gTc>gCc	p.V14A	GFRA3_ENST00000378362.3_Missense_Mutation_p.V14A	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	14					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			caacatcaggactacgggcgg	0.731																																					p.V14A		Atlas-SNP	.											.	GFRA3	36	.	0			c.T41C						PASS	.						6.0	10.0	8.0					5																	137610073		2055	4108	6163	SO:0001583	missense	2676	exon1			ATCAGGACTACGG	AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.41T>C	chr5.hg19:g.137610073A>G	ENSP00000274721:p.Val14Ala	8.0	0.0	.		9.0	6.0	.	NM_001496	B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Missense_Mutation	SNP	ENST00000274721.3	hg19	CCDS4201.1	.	.	.	.	.	.	.	.	.	.	A	10.66	1.413148	0.25465	.	.	ENSG00000146013	ENST00000274721;ENST00000378362	T;T	0.49139	1.38;0.79	3.8	2.63	0.31362	.	2.674420	0.01678	N	0.025995	T	0.31071	0.0785	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.017;0.01	B;B	0.18263	0.021;0.009	T	0.24261	-1.0165	10	0.51188	T	0.08	0.3298	5.8269	0.18558	0.879:0.0:0.121:0.0	.	14;14	O60609-2;O60609	.;GFRA3_HUMAN	A	14	ENSP00000274721:V14A;ENSP00000367613:V14A	ENSP00000274721:V14A	V	-	2	0	GFRA3	137637972	0.015000	0.18098	0.128000	0.21923	0.007000	0.05969	1.017000	0.29989	0.799000	0.34018	0.477000	0.44152	GTC	.	.	.	none		0.731	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251277.1	NM_001496	
SNRPC	6631	hgsc.bcm.edu	37	6	34730469	34730469	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:34730469T>C	ENST00000244520.5	+	3	287	c.149T>C	c.(148-150)aTt>aCt	p.I50T	SNRPC_ENST00000374017.3_Missense_Mutation_p.I71T|SNRPC_ENST00000374018.1_Missense_Mutation_p.I9T|SNRPC_ENST00000474635.1_3'UTR	NM_003093.2	NP_003084.1			small nuclear ribonucleoprotein polypeptide C											endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6						CAGAGCCTGATTGACAAAACA	0.413																																					p.I50T	NSCLC(131;576 1831 5287 11175 13324)	Atlas-SNP	.											.	SNRPC	16	.	0			c.T149C						PASS	.						81.0	72.0	75.0					6																	34730469		2203	4300	6503	SO:0001583	missense	6631	exon3			GCCTGATTGACAA		CCDS34436.1	6p21	2014-03-06			ENSG00000124562	ENSG00000124562			11157	protein-coding gene	gene with protein product		603522				2971157, 8532530	Standard	NR_029472		Approved	U1-C, Yhc1	uc003ojt.2	P09234	OTTHUMG00000014555	ENST00000244520.5:c.149T>C	chr6.hg19:g.34730469T>C	ENSP00000244520:p.Ile50Thr	25.0	0.0	.		22.0	6.0	.	NM_003093		Missense_Mutation	SNP	ENST00000244520.5	hg19	CCDS34436.1	.	.	.	.	.	.	.	.	.	.	T	17.21	3.330727	0.60853	.	.	ENSG00000124562	ENST00000244520;ENST00000374018;ENST00000374017	T;T;T	0.32988	1.43;1.43;1.43	6.17	4.99	0.66335	.	0.093403	0.64402	N	0.000001	T	0.20170	0.0485	M	0.80422	2.495	0.80722	D	1	P	0.36144	0.539	B	0.28709	0.093	T	0.05273	-1.0895	10	0.52906	T	0.07	.	12.5154	0.56030	0.1252:0.0:0.0:0.8748	.	50	P09234	RU1C_HUMAN	T	50;9;71	ENSP00000244520:I50T;ENSP00000363130:I9T;ENSP00000363129:I71T	ENSP00000244520:I50T	I	+	2	0	SNRPC	34838447	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.602000	0.82796	1.111000	0.41721	0.533000	0.62120	ATT	.	.	.	none		0.413	SNRPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040255.1	NM_003093	
PPARD	5467	hgsc.bcm.edu	37	6	35392132	35392132	+	Silent	SNP	A	A	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:35392132A>C	ENST00000311565.4	+	8	1003	c.654A>C	c.(652-654)acA>acC	p.T218T	PPARD_ENST00000540939.1_Silent_p.T115T|PPARD_ENST00000448077.2_Silent_p.T179T|PPARD_ENST00000444397.1_Silent_p.T218T|PPARD_ENST00000337400.2_Silent_p.T218T|PPARD_ENST00000418635.2_Silent_p.T120T|PPARD_ENST00000360694.3_Silent_p.T218T	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	218					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	ACATCGAGACATTGTGGCAGG	0.597																																					p.T218T		Atlas-SNP	.											.	PPARD	46	.	0			c.A654C						PASS	.						56.0	54.0	55.0					6																	35392132		2203	4300	6503	SO:0001819	synonymous_variant	5467	exon8			CGAGACATTGTGG	L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.654A>C	chr6.hg19:g.35392132A>C		67.0	0.0	.		62.0	22.0	.	NM_001171818	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Silent	SNP	ENST00000311565.4	hg19	CCDS4803.1																																																																																			.	.	.	none		0.597	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238	
TCTE1	202500	hgsc.bcm.edu	37	6	44254102	44254102	+	Missense_Mutation	SNP	C	C	T	rs149566851		TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:44254102C>T	ENST00000371505.4	-	3	567	c.445G>A	c.(445-447)Ggc>Agc	p.G149S	TCTE1_ENST00000371504.1_5'Flank|TCTE1_ENST00000371503.3_5'UTR|TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	149										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCCAGCTGCCGCCATGGTGG	0.612																																					p.G149S		Atlas-SNP	.											.	TCTE1	77	.	0			c.G445A						PASS	.						69.0	62.0	64.0					6																	44254102		2203	4300	6503	SO:0001583	missense	202500	exon3			AGCTGCCGCCATG	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.445G>A	chr6.hg19:g.44254102C>T	ENSP00000360560:p.Gly149Ser	91.0	0.0	.		108.0	22.0	.	NM_182539	B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	hg19	CCDS4910.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172677	0.38413	.	.	ENSG00000146221	ENST00000371505	T	0.53857	0.6	4.95	0.751	0.18392	.	0.494509	0.24332	N	0.039444	T	0.22666	0.0547	M	0.66939	2.045	0.31913	N	0.614463	B	0.29508	0.246	B	0.15484	0.013	T	0.02698	-1.1122	10	0.42905	T	0.14	-22.0618	3.2087	0.06675	0.1282:0.533:0.1253:0.2135	.	149	Q5JU00	TCTE1_HUMAN	S	149	ENSP00000360560:G149S	ENSP00000360560:G149S	G	-	1	0	TCTE1	44362080	0.194000	0.23325	0.977000	0.42913	0.826000	0.46750	1.144000	0.31565	1.073000	0.40885	0.563000	0.77884	GGC	.	C|1.000;A|0.000	.	alt		0.612	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
TDRD6	221400	hgsc.bcm.edu	37	6	46660547	46660547	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:46660547G>C	ENST00000316081.6	+	1	4682	c.4682G>C	c.(4681-4683)aGg>aCg	p.R1561T	TDRD6_ENST00000544460.1_Missense_Mutation_p.R1561T	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1561					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GTAGCAGACAGGAGAAATTGT	0.383																																					p.R1561T		Atlas-SNP	.											.	TDRD6	205	.	0			c.G4682C						PASS	.						143.0	136.0	139.0					6																	46660547		2203	4300	6503	SO:0001583	missense	221400	exon1			CAGACAGGAGAAA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.4682G>C	chr6.hg19:g.46660547G>C	ENSP00000346065:p.Arg1561Thr	86.0	0.0	.		70.0	30.0	.	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	hg19	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	4.125	0.021357	0.08006	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.14640	2.49;2.49	5.77	1.57	0.23409	Maternal tudor protein (1);	2.015520	0.01660	N	0.025077	T	0.01870	0.0059	N	0.17082	0.46	0.09310	N	1	B;B	0.20550	0.037;0.046	B;B	0.16289	0.009;0.015	T	0.36040	-0.9764	10	0.14252	T	0.57	-1.2406	1.4939	0.02462	0.3025:0.1233:0.4278:0.1465	.	1561;1561	F5H5M3;O60522	.;TDRD6_HUMAN	T	1561	ENSP00000443299:R1561T;ENSP00000346065:R1561T	ENSP00000346065:R1561T	R	+	2	0	TDRD6	46768506	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	0.037000	0.13840	-0.027000	0.13873	-0.345000	0.07892	AGG	.	.	.	none		0.383	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
FAM46A	55603	hgsc.bcm.edu	37	6	82461531	82461531	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:82461531C>T	ENST00000320172.6	-	2	642	c.328G>A	c.(328-330)Gag>Aag	p.E110K	FAM46A_ENST00000369754.3_Missense_Mutation_p.E129K|FAM46A_ENST00000369756.3_Missense_Mutation_p.E191K	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	110					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		ATGCGCTTCTCGGCCAGGCGC	0.672																																					p.E110K		Atlas-SNP	.											.	FAM46A	37	.	0			c.G328A						PASS	.						33.0	33.0	33.0					6																	82461531		2199	4296	6495	SO:0001583	missense	55603	exon2			GCTTCTCGGCCAG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.328G>A	chr6.hg19:g.82461531C>T	ENSP00000318298:p.Glu110Lys	71.0	0.0	.		67.0	31.0	.	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	ENST00000320172.6	hg19	CCDS34489.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133356	0.77662	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.24538	1.85;1.85;1.85	5.38	5.38	0.77491	Domain of unknown function DUF1693 (1);	0.093645	0.64402	D	0.000001	T	0.12902	0.0313	L	0.39514	1.22	0.80722	D	1	P;P	0.41748	0.524;0.761	B;B	0.35413	0.202;0.128	T	0.03268	-1.1054	9	.	.	.	-16.9061	18.9095	0.92477	0.0:1.0:0.0:0.0	.	110;129	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	K	129;110;191	ENSP00000358769:E129K;ENSP00000318298:E110K;ENSP00000358771:E191K	.	E	-	1	0	FAM46A	82518250	0.983000	0.35010	0.952000	0.39060	0.004000	0.04260	2.564000	0.45931	2.786000	0.95864	0.563000	0.77884	GAG	.	.	.	none		0.672	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
ROS1	6098	hgsc.bcm.edu	37	6	117706858	117706858	+	Silent	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:117706858T>A	ENST00000368508.3	-	15	2490	c.2292A>T	c.(2290-2292)ggA>ggT	p.G764G	ROS1_ENST00000368507.3_Silent_p.G759G|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	764					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CATATGTCTTTCCAGCCCAGT	0.423			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.G764G		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.A2292T						PASS	.						94.0	87.0	89.0					6																	117706858		2203	4300	6503	SO:0001819	synonymous_variant	6098	exon15			TGTCTTTCCAGCC	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.2292A>T	chr6.hg19:g.117706858T>A		143.0	0.0	.		118.0	53.0	.	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	hg19	CCDS5116.1																																																																																			.	.	.	none		0.423	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
RAET1G	353091	hgsc.bcm.edu	37	6	150240371	150240371	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:150240371T>C	ENST00000367360.2	-	3	506	c.439A>G	c.(439-441)Atc>Gtc	p.I147V	RAET1G_ENST00000479265.1_Missense_Mutation_p.I147V|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000605899.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		AGGAGGAAGATCTGTCCATCG	0.507																																					p.I147V		Atlas-SNP	.											.	RAET1G	31	.	0			c.A439G						PASS	.						210.0	194.0	200.0					6																	150240371		2203	4300	6503	SO:0001583	missense	353091	exon3			GGAAGATCTGTCC	AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.439A>G	chr6.hg19:g.150240371T>C	ENSP00000356329:p.Ile147Val	142.0	0.0	.		130.0	59.0	.	NM_001001788		Missense_Mutation	SNP	ENST00000367360.2	hg19	CCDS43514.1	.	.	.	.	.	.	.	.	.	.	T	2.316	-0.356879	0.05138	.	.	ENSG00000203722	ENST00000367360;ENST00000479265	T;T	0.00695	5.83;5.83	2.4	-0.116	0.13555	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00356	0.0011	L	0.39898	1.24	0.09310	N	1	B	0.24043	0.096	B	0.37091	0.241	T	0.33650	-0.9860	9	0.22706	T	0.39	.	6.0143	0.19594	0.0:0.1591:0.0:0.8409	.	147	Q6H3X3	RET1G_HUMAN	V	147	ENSP00000356329:I147V;ENSP00000417503:I147V	ENSP00000356329:I147V	I	-	1	0	RAET1G	150282064	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-1.019000	0.03622	-0.018000	0.14079	-1.493000	0.00968	ATC	.	.	.	none		0.507	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042668.2		
GNAI1	2770	hgsc.bcm.edu	37	7	79842142	79842142	+	Silent	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr7:79842142A>G	ENST00000351004.3	+	7	1204	c.831A>G	c.(829-831)aaA>aaG	p.K277K	GNAI1_ENST00000457358.2_Silent_p.K225K	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	277					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						TTGAAGAAAAAATCAAAAAGA	0.323																																					p.K277K		Atlas-SNP	.											.	GNAI1	44	.	0			c.A831G						PASS	.						67.0	74.0	71.0					7																	79842142		2203	4294	6497	SO:0001819	synonymous_variant	2770	exon7			AGAAAAAATCAAA	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.831A>G	chr7.hg19:g.79842142A>G		198.0	0.0	.		263.0	74.0	.	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Silent	SNP	ENST00000351004.3	hg19	CCDS5595.1																																																																																			.	.	.	none		0.323	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
SAMD9	54809	hgsc.bcm.edu	37	7	92734539	92734539	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr7:92734539T>G	ENST00000379958.2	-	3	1141	c.872A>C	c.(871-873)gAa>gCa	p.E291A		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	291						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CAGTAAAACTTCCACAAATCT	0.353																																					p.E291A		Atlas-SNP	.											.	SAMD9	239	.	0			c.A872C						PASS	.						122.0	121.0	121.0					7																	92734539		2203	4300	6503	SO:0001583	missense	54809	exon2			AAAACTTCCACAA	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.872A>C	chr7.hg19:g.92734539T>G	ENSP00000369292:p.Glu291Ala	88.0	0.0	.		95.0	52.0	.	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	hg19	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372223	0.61624	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.16324	2.35;2.35	4.34	4.34	0.51931	.	0.190136	0.33127	U	0.005253	T	0.20700	0.0498	M	0.73598	2.24	0.30798	N	0.740149	P	0.40970	0.734	B	0.35114	0.196	T	0.33111	-0.9881	10	0.72032	D	0.01	-8.454	12.7423	0.57259	0.0:0.0:0.0:1.0	.	291	Q5K651	SAMD9_HUMAN	A	291	ENSP00000369292:E291A;ENSP00000414529:E291A	ENSP00000369292:E291A	E	-	2	0	SAMD9	92572475	1.000000	0.71417	0.998000	0.56505	0.879000	0.50718	2.498000	0.45363	1.948000	0.56530	0.491000	0.48974	GAA	.	.	.	none		0.353	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
SLC26A5	375611	hgsc.bcm.edu	37	7	103029511	103029511	+	Silent	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr7:103029511A>G	ENST00000306312.3	-	14	1719	c.1458T>C	c.(1456-1458)taT>taC	p.Y486Y	SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000393730.1_Silent_p.Y454Y|SLC26A5_ENST00000393735.2_Silent_p.Y486Y|SLC26A5_ENST00000393729.1_Silent_p.Y449Y|SLC26A5_ENST00000432958.2_Silent_p.Y454Y|SLC26A5_ENST00000339444.6_Silent_p.Y486Y|SLC26A5_ENST00000393727.1_Silent_p.Y486Y|SLC26A5_ENST00000393723.1_Silent_p.Y454Y|SLC26A5_ENST00000354356.4_5'UTR	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	486					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						TGATCAAACCATAGTCCAATC	0.458																																					p.Y486Y		Atlas-SNP	.											.	SLC26A5	231	.	0			c.T1458C						PASS	.						141.0	108.0	119.0					7																	103029511		2203	4300	6503	SO:0001819	synonymous_variant	375611	exon14			CAAACCATAGTCC	AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1458T>C	chr7.hg19:g.103029511A>G		54.0	0.0	.		78.0	17.0	.	NM_206883	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Silent	SNP	ENST00000306312.3	hg19	CCDS5733.1																																																																																			.	.	.	none		0.458	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313860.1	NM_198999	
KIAA1549	57670	hgsc.bcm.edu	37	7	138602963	138602963	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr7:138602963T>C	ENST00000422774.1	-	2	1457	c.1409A>G	c.(1408-1410)gAc>gGc	p.D470G	KIAA1549_ENST00000440172.1_Missense_Mutation_p.D470G|KIAA1549_ENST00000242365.4_Missense_Mutation_p.D420G			Q9HCM3	K1549_HUMAN	KIAA1549	470						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TTCAGAGAAGTCTGCTACGAC	0.483			O	BRAF	pilocytic astrocytoma																																p.D470G	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.A1409G						PASS	.						39.0	40.0	40.0					7																	138602963		2029	4193	6222	SO:0001583	missense	57670	exon2			GAGAAGTCTGCTA		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1409A>G	chr7.hg19:g.138602963T>C	ENSP00000416040:p.Asp470Gly	66.0	0.0	.		77.0	23.0	.	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	hg19	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	T	11.54	1.669378	0.29693	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.41065	1.01;1.03;1.03	4.75	3.59	0.41128	.	0.100076	0.43579	N	0.000548	T	0.26448	0.0646	N	0.20986	0.625	0.20703	N	0.999861	B;B	0.23540	0.053;0.087	B;B	0.23018	0.019;0.043	T	0.14476	-1.0471	10	0.33141	T	0.24	.	8.3927	0.32537	0.0:0.089:0.0:0.911	.	470;470	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	G	470;420;470	ENSP00000406661:D470G;ENSP00000242365:D420G;ENSP00000416040:D470G	ENSP00000242365:D420G	D	-	2	0	KIAA1549	138253503	0.991000	0.36638	0.195000	0.23364	0.070000	0.16714	1.352000	0.34033	0.846000	0.35142	0.533000	0.62120	GAC	.	.	.	none		0.483	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
TMEM176B	28959	hgsc.bcm.edu	37	7	150493608	150493608	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr7:150493608G>C	ENST00000447204.2	-	2	422	c.50C>G	c.(49-51)cCa>cGa	p.P17R	TMEM176B_ENST00000450753.2_Missense_Mutation_p.P17R|TMEM176B_ENST00000492607.1_Missense_Mutation_p.P17R|TMEM176B_ENST00000429904.2_Missense_Mutation_p.P17R|TMEM176B_ENST00000326442.5_Missense_Mutation_p.P17R|TMEM176B_ENST00000434545.1_Missense_Mutation_p.P17R	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	17				PS -> HA (in Ref. 1; AAD23440). {ECO:0000305}.	cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGGCTGGGATGGCCTAGAGGC	0.522																																					p.P17R		Atlas-SNP	.											.	TMEM176B	36	.	0			c.C50G						PASS	.						91.0	82.0	85.0					7																	150493608		2203	4300	6503	SO:0001583	missense	28959	exon2			TGGGATGGCCTAG	AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.50C>G	chr7.hg19:g.150493608G>C	ENSP00000410269:p.Pro17Arg	72.0	0.0	.		129.0	6.0	.	NM_014020	B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Missense_Mutation	SNP	ENST00000447204.2	hg19	CCDS5908.1	.	.	.	.	.	.	.	.	.	.	G	4.944	0.175328	0.09391	.	.	ENSG00000106565	ENST00000492607;ENST00000326442;ENST00000447204;ENST00000434545;ENST00000429904;ENST00000450753;ENST00000528038	T;T;T;T;T;T	0.07327	3.35;3.35;3.35;3.35;3.35;3.2	4.92	-6.03	0.02185	.	2.014350	0.02708	N	0.112490	T	0.03564	0.0102	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.0	T	0.37197	-0.9716	10	0.14252	T	0.57	2.0728	0.9199	0.01312	0.193:0.1221:0.2552:0.4297	.	17;17	E9PAV4;Q3YBM2	.;T176B_HUMAN	R	17	ENSP00000419258:P17R;ENSP00000318409:P17R;ENSP00000410269:P17R;ENSP00000413531:P17R;ENSP00000397810:P17R;ENSP00000404831:P17R	ENSP00000318409:P17R	P	-	2	0	TMEM176B	150124541	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.663000	0.05299	-0.721000	0.04929	0.467000	0.42956	CCA	.	.	.	none		0.522	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349204.1	NM_014020	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617295	77617296	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr8:77617295_77617296GA>TT	ENST00000521891.2	+	2	1420_1421	c.972_973GA>TT	c.(970-975)ggGAtt>ggTTtt	p.I325F	ZFHX4_ENST00000050961.6_Missense_Mutation_p.I325F|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Missense_Mutation_p.I325F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.I325F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G324G(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAATACAGGGGATTGGCAAAGA	0.441										HNSCC(33;0.089)																											p.G324G|p.I325F		Atlas-SNP	.											ZFHX4,NS,carcinoma,0,1|.	ZFHX4	878	.	1	Substitution - coding silent(1)	lung(1)	c.G972T|c.A973T						PASS	.																																			SO:0001583	missense	79776	exon2			ACAGGGGATTGGC|CAGGGGATTGGCA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	Exception_encountered	chr8.hg19:g.77617295_77617296delinsTT	ENSP00000430497:p.Ile325Phe	143.0|142.0	0.0	.		158.0|161.0	61.0|63.0	.	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent|Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.	.	none		0.441	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
SLC6A13	6540	hgsc.bcm.edu	37	12	346409	346409	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:346409A>T	ENST00000343164.4	-	6	663	c.611T>A	c.(610-612)cTg>cAg	p.L204Q	SLC6A13_ENST00000445055.2_Missense_Mutation_p.L112Q	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	204					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CTCCCAGCGCAGGGCCCCCAG	0.602																																					p.L204Q		Atlas-SNP	.											.	SLC6A13	62	.	0			c.T611A						PASS	.						66.0	69.0	68.0					12																	346409		2203	4300	6503	SO:0001583	missense	6540	exon6			CAGCGCAGGGCCC	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.611T>A	chr12.hg19:g.346409A>T	ENSP00000339260:p.Leu204Gln	133.0	0.0	.		164.0	41.0	.	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	hg19	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.892851	0.91889	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164;ENST00000546319	T;T;T	0.78003	-1.14;-1.14;-1.14	5.5	5.5	0.81552	.	0.070471	0.64402	D	0.000018	D	0.90428	0.7003	M	0.92317	3.295	0.80722	D	1	D;D;D	0.76494	0.976;0.999;0.996	D;D;D	0.71414	0.964;0.973;0.964	D	0.92683	0.6160	10	0.87932	D	0	.	15.8304	0.78745	1.0:0.0:0.0:0.0	.	112;183;204	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	Q	112;183;204;112	ENSP00000407104:L112Q;ENSP00000339260:L204Q;ENSP00000444606:L112Q	ENSP00000318097:L183Q	L	-	2	0	SLC6A13	216670	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.127000	0.94417	2.322000	0.78497	0.529000	0.55759	CTG	.	.	.	none		0.602	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
ATN1	1822	hgsc.bcm.edu	37	12	7046365	7046365	+	Silent	SNP	C	C	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:7046365C>G	ENST00000356654.4	+	5	2172	c.1935C>G	c.(1933-1935)tcC>tcG	p.S645S	ATN1_ENST00000396684.2_Silent_p.S645S	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	645					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GAGCCCCGTCCCCGGGGGCCT	0.672																																					p.S645S		Atlas-SNP	.											.	ATN1	95	.	0			c.C1935G						PASS	.						22.0	27.0	25.0					12																	7046365		2201	4291	6492	SO:0001819	synonymous_variant	1822	exon5			CCCGTCCCCGGGG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1935C>G	chr12.hg19:g.7046365C>G		76.0	0.0	.		95.0	54.0	.	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	hg19	CCDS31734.1																																																																																			.	.	.	none		0.672	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
TAS2R13	50838	hgsc.bcm.edu	37	12	11061866	11061866	+	Missense_Mutation	SNP	A	A	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:11061866A>C	ENST00000390677.2	-	1	295	c.32T>G	c.(31-33)cTt>cGt	p.L11R	PRR4_ENST00000536668.1_Intron	NM_023920.2	NP_076409.1	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	11					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						AATTATTACAAGAGTGAAGAT	0.388																																					p.L11R		Atlas-SNP	.											.	TAS2R13	29	.	0			c.T32G						PASS	.						39.0	38.0	39.0					12																	11061866		2202	4298	6500	SO:0001583	missense	50838	exon1			ATTACAAGAGTGA	AF227137	CCDS8635.1	12p13	2012-08-22			ENSG00000212128	ENSG00000212128		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14919	protein-coding gene	gene with protein product		604792				10761934, 10766242	Standard	NM_023920		Approved	T2R13, TRB3	uc001qzg.1	Q9NYV9		ENST00000390677.2:c.32T>G	chr12.hg19:g.11061866A>C	ENSP00000375095:p.Leu11Arg	41.0	0.0	.		54.0	31.0	.	NM_023920	Q4G0I5|Q502V8|Q645X2	Missense_Mutation	SNP	ENST00000390677.2	hg19	CCDS8635.1	.	.	.	.	.	.	.	.	.	.	A	12.87	2.068962	0.36470	.	.	ENSG00000212128	ENST00000390677	T	0.00922	5.54	3.3	2.14	0.27477	.	0.745999	0.10446	U	0.673619	T	0.02888	0.0086	M	0.76328	2.33	0.09310	N	1	P	0.48834	0.916	P	0.54026	0.74	T	0.42582	-0.9443	10	0.87932	D	0	.	5.1506	0.15007	0.8598:0.0:0.1402:0.0	.	11	Q9NYV9	T2R13_HUMAN	R	11	ENSP00000375095:L11R	ENSP00000375095:L11R	L	-	2	0	TAS2R13	10953133	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.614000	0.24314	0.456000	0.26937	0.533000	0.62120	CTT	.	.	.	none		0.388	TAS2R13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400229.1		
DPY19L2	283417	hgsc.bcm.edu	37	12	64041138	64041138	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:64041138A>T	ENST00000324472.4	-	5	779	c.596T>A	c.(595-597)aTa>aAa	p.I199K	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	199					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CCAGGAGGCTATGATTACCTT	0.299																																					p.I199K		Atlas-SNP	.											.	DPY19L2	97	.	0			c.T596A						PASS	.						60.0	65.0	63.0					12																	64041138		2203	4297	6500	SO:0001583	missense	283417	exon5			GAGGCTATGATTA		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.596T>A	chr12.hg19:g.64041138A>T	ENSP00000315988:p.Ile199Lys	148.0	0.0	.		189.0	40.0	.	NM_173812	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	hg19	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	A	10.54	1.378802	0.24944	.	.	ENSG00000177990	ENST00000324472	T	0.56275	0.47	2.35	2.35	0.29111	.	0.184092	0.34828	U	0.003648	T	0.59046	0.2165	M	0.66939	2.045	0.58432	D	0.999995	D	0.53619	0.961	P	0.57009	0.811	T	0.57808	-0.7747	9	.	.	.	.	6.5488	0.22420	1.0:0.0:0.0:0.0	.	199	Q6NUT2	D19L2_HUMAN	K	199	ENSP00000315988:I199K	.	I	-	2	0	DPY19L2	62327405	0.987000	0.35691	0.069000	0.20011	0.326000	0.28443	5.607000	0.67648	1.080000	0.41073	0.155000	0.16302	ATA	.	.	.	none		0.299	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
RFX4	5992	hgsc.bcm.edu	37	12	107154995	107154995	+	Silent	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:107154995T>A	ENST00000392842.1	+	18	2370	c.1956T>A	c.(1954-1956)acT>acA	p.T652T	RFX4_ENST00000357881.4_Silent_p.T661T|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000229387.5_Silent_p.T558T	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	652					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						ATAGCCCCACTTCCCGGATGG	0.468																																					p.T661T		Atlas-SNP	.											.	RFX4	218	.	0			c.T1983A						PASS	.						190.0	205.0	200.0					12																	107154995		2203	4300	6503	SO:0001819	synonymous_variant	5992	exon18			CCCCACTTCCCGG	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.1956T>A	chr12.hg19:g.107154995T>A		430.0	1.0	.		528.0	282.0	.	NM_001206691	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Silent	SNP	ENST00000392842.1	hg19	CCDS9106.1																																																																																			.	.	.	none		0.468	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402707.1	NM_032491	
NOS1	4842	hgsc.bcm.edu	37	12	117655909	117655909	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:117655909T>C	ENST00000338101.4	-	28	4337	c.4333A>G	c.(4333-4335)Aac>Gac	p.N1445D	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.N1411D			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTAAGGCGGTTGGTCACTTCG	0.498																																					p.N1445D	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.A4333G						PASS	.						312.0	309.0	310.0					12																	117655909		1986	4167	6153	SO:0001583	missense	4842	exon29			GGCGGTTGGTCAC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.4333A>G	chr12.hg19:g.117655909T>C	ENSP00000337459:p.Asn1445Asp	458.0	0.0	.		603.0	135.0	.	NM_001204218		Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379742	0.61845	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	T;T	0.01397	4.94;4.99	4.57	4.57	0.56435	.	0.093612	0.85682	D	0.000000	T	0.02342	0.0072	L	0.59436	1.845	0.80722	D	1	P	0.36412	0.552	B	0.35039	0.194	T	0.60393	-0.7272	10	0.38643	T	0.18	-42.2525	14.0843	0.64944	0.0:0.0:0.0:1.0	.	1411	P29475	NOS1_HUMAN	D	1306;1411;1445	ENSP00000320758:N1411D;ENSP00000337459:N1445D	ENSP00000320758:N1411D	N	-	1	0	NOS1	116140292	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.501000	0.81600	1.914000	0.55421	0.459000	0.35465	AAC	.	.	.	none		0.498	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
RIMBP2	23504	hgsc.bcm.edu	37	12	130919339	130919339	+	Silent	SNP	G	G	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr12:130919339G>A	ENST00000261655.4	-	11	2305	c.2142C>T	c.(2140-2142)gaC>gaT	p.D714D	RIMBP2_ENST00000536002.1_Silent_p.D622D|RIMBP2_ENST00000535703.1_Silent_p.D622D	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	714					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCCTCTTGAAGTCTGGAGAGT	0.597																																					p.D714D		Atlas-SNP	.											.	RIMBP2	220	.	0			c.C2142T						PASS	.						74.0	81.0	79.0					12																	130919339		2203	4300	6503	SO:0001819	synonymous_variant	23504	exon11			CTTGAAGTCTGGA	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2142C>T	chr12.hg19:g.130919339G>A		167.0	0.0	.		206.0	30.0	.	NM_015347	Q96ID2	Silent	SNP	ENST00000261655.4	hg19	CCDS31925.1																																																																																			.	.	.	none		0.597	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
TP53BP1	7158	hgsc.bcm.edu	37	15	43749140	43749140	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr15:43749140T>A	ENST00000263801.3	-	12	1903	c.1651A>T	c.(1651-1653)Atg>Ttg	p.M551L	TP53BP1_ENST00000382044.4_Missense_Mutation_p.M556L|TP53BP1_ENST00000450115.2_Missense_Mutation_p.M556L|TP53BP1_ENST00000382039.3_Missense_Mutation_p.M556L|TP53BP1_ENST00000605155.1_5'Flank	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	551					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ACTGGAGACATGGGTTCCGTA	0.403								Other conserved DNA damage response genes																													p.M556L		Atlas-SNP	.											.	TP53BP1	157	.	0			c.A1666T						PASS	.						152.0	135.0	141.0					15																	43749140		2201	4298	6499	SO:0001583	missense	7158	exon12			GAGACATGGGTTC	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1651A>T	chr15.hg19:g.43749140T>A	ENSP00000263801:p.Met551Leu	108.0	0.0	.		66.0	27.0	.	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	hg19	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	T	4.082	0.013103	0.07912	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46	5.04	1.11	0.20524	.	0.534882	0.20646	N	0.088301	T	0.09730	0.0239	L	0.36672	1.1	0.19775	N	0.999951	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.37361	-0.9709	10	0.10377	T	0.69	-0.7027	5.1031	0.14770	0.3274:0.0823:0.0:0.5903	.	556;551;556;556	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	L	551;556;556;556;556	ENSP00000263801:M551L;ENSP00000371475:M556L;ENSP00000371470:M556L;ENSP00000393497:M556L;ENSP00000388028:M556L	ENSP00000263801:M551L	M	-	1	0	TP53BP1	41536432	0.005000	0.15991	0.993000	0.49108	0.768000	0.43524	0.173000	0.16724	0.321000	0.23259	-0.371000	0.07208	ATG	.	.	.	none		0.403	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
MYO1E	4643	hgsc.bcm.edu	37	15	59501015	59501015	+	Silent	SNP	G	G	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr15:59501015G>A	ENST00000288235.4	-	14	1794	c.1395C>T	c.(1393-1395)gaC>gaT	p.D465D		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	465	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGGCGCACACGTCATCCAGGA	0.542																																					p.D465D		Atlas-SNP	.											.	MYO1E	99	.	0			c.C1395T						PASS	.						118.0	99.0	105.0					15																	59501015		2191	4290	6481	SO:0001819	synonymous_variant	4643	exon14			GCACACGTCATCC	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1395C>T	chr15.hg19:g.59501015G>A		73.0	0.0	.		71.0	16.0	.	NM_004998	Q14778	Silent	SNP	ENST00000288235.4	hg19	CCDS32254.1																																																																																			.	.	.	none		0.542	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
TLN2	83660	hgsc.bcm.edu	37	15	63011987	63011987	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr15:63011987C>G	ENST00000561311.1	+	24	3129	c.2899C>G	c.(2899-2901)Cag>Gag	p.Q967E	TLN2_ENST00000306829.6_Missense_Mutation_p.Q967E			Q9Y4G6	TLN2_HUMAN	talin 2	967	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TCACATCCCTCAGCTGGTCCA	0.547																																					p.Q967E		Atlas-SNP	.											.	TLN2	253	.	0			c.C2899G						PASS	.						65.0	51.0	56.0					15																	63011987		2203	4300	6503	SO:0001583	missense	83660	exon22			ATCCCTCAGCTGG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2899C>G	chr15.hg19:g.63011987C>G	ENSP00000453508:p.Gln967Glu	52.0	0.0	.		36.0	13.0	.	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	hg19	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050280	0.55218	.	.	ENSG00000171914	ENST00000306829	T	0.67865	-0.29	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	L	0.47716	1.5	0.80722	D	1	B	0.24882	0.113	B	0.25987	0.065	T	0.56745	-0.7928	10	0.22706	T	0.39	-16.8653	19.9103	0.97024	0.0:1.0:0.0:0.0	.	967	Q9Y4G6	TLN2_HUMAN	E	967	ENSP00000303476:Q967E	ENSP00000303476:Q967E	Q	+	1	0	TLN2	60799279	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.887000	0.63156	2.765000	0.95021	0.650000	0.86243	CAG	.	.	.	none		0.547	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
RASGRF1	5923	hgsc.bcm.edu	37	15	79264261	79264261	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr15:79264261G>A	ENST00000419573.3	-	27	3950	c.3676C>T	c.(3676-3678)Cga>Tga	p.R1226*	RASGRF1_ENST00000558480.2_Nonsense_Mutation_p.R1210*|RASGRF1_ENST00000394745.3_Nonsense_Mutation_p.R442*	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1226	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGAATCTCTCGGATAATATGG	0.473																																					p.R1226X		Atlas-SNP	.											.	RASGRF1	168	.	0			c.C3676T						PASS	.						268.0	228.0	242.0					15																	79264261		2196	4293	6489	SO:0001587	stop_gained	5923	exon27			TCTCTCGGATAAT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3676C>T	chr15.hg19:g.79264261G>A	ENSP00000405963:p.Arg1226*	233.0	0.0	.		216.0	75.0	.	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Nonsense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	42	9.264118	0.99118	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	.	.	.	4.23	3.23	0.37069	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9463	0.47301	0.0:0.0:0.8013:0.1987	.	.	.	.	X	1226;1210;442	.	ENSP00000378224:R1210X	R	-	1	2	RASGRF1	77051316	1.000000	0.71417	0.999000	0.59377	0.806000	0.45545	1.206000	0.32321	2.169000	0.68431	0.561000	0.74099	CGA	.	.	.	none		0.473	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
ZP2	7783	hgsc.bcm.edu	37	16	21215430	21215430	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr16:21215430T>A	ENST00000574002.1	-	10	1375	c.893A>T	c.(892-894)cAg>cTg	p.Q298L	ZP2_ENST00000219593.4_Missense_Mutation_p.Q298L|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.Q298L			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	298					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		GTCATGCAGCTGGCTCACATC	0.428																																					p.Q298L		Atlas-SNP	.											.	ZP2	92	.	0			c.A893T						PASS	.						161.0	137.0	145.0					16																	21215430		2200	4300	6500	SO:0001583	missense	7783	exon9			TGCAGCTGGCTCA	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.893A>T	chr16.hg19:g.21215430T>A	ENSP00000460971:p.Gln298Leu	102.0	0.0	.		88.0	33.0	.	NM_003460	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	hg19	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.233434	0.39498	.	.	ENSG00000103310	ENST00000219593	T	0.78816	-1.21	6.08	3.74	0.42951	.	0.574315	0.17910	N	0.157889	D	0.84938	0.5583	M	0.73962	2.25	0.09310	N	1	D;B;B	0.89917	1.0;0.223;0.223	D;B;B	0.91635	0.999;0.143;0.053	T	0.73563	-0.3943	10	0.28530	T	0.3	-5.929	9.6718	0.40017	0.1165:0.0:0.1209:0.7626	.	298;298;298	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	L	298	ENSP00000219593:Q298L	ENSP00000219593:Q298L	Q	-	2	0	ZP2	21122931	0.975000	0.34042	0.255000	0.24374	0.042000	0.13812	2.912000	0.48782	2.330000	0.79161	0.533000	0.62120	CAG	.	.	.	none		0.428	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2		
FOXC2	2303	hgsc.bcm.edu	37	16	86601010	86601010	+	Missense_Mutation	SNP	T	T	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr16:86601010T>G	ENST00000320354.4	+	1	154	c.69T>G	c.(67-69)aaT>aaG	p.N23K	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	23					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						GCGAGCAGAATTACTACCGGG	0.701									Late-onset Hereditary Lymphedema																												p.N23K		Atlas-SNP	.											.	FOXC2	46	.	0			c.T69G						PASS	.						34.0	38.0	37.0					16																	86601010		2196	4296	6492	SO:0001583	missense	2303	exon1	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	GCAGAATTACTAC	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.69T>G	chr16.hg19:g.86601010T>G	ENSP00000326371:p.Asn23Lys	93.0	0.0	.		85.0	32.0	.	NM_005251	C6KMR9|Q14DA6	Missense_Mutation	SNP	ENST00000320354.4	hg19	CCDS10958.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618182	0.66787	.	.	ENSG00000176692	ENST00000320354	D	0.94862	-3.54	3.49	-4.32	0.03688	.	0.351583	0.22692	U	0.056809	D	0.91768	0.7396	L	0.46157	1.445	0.37017	D	0.896014	P	0.47409	0.895	P	0.47573	0.55	D	0.88376	0.2998	10	0.39692	T	0.17	.	14.3409	0.66624	0.0:0.8175:0.0:0.1825	.	23	Q99958	FOXC2_HUMAN	K	23	ENSP00000326371:N23K	ENSP00000326371:N23K	N	+	3	2	FOXC2	85158511	0.974000	0.33945	0.948000	0.38648	0.973000	0.67179	0.371000	0.20450	-1.237000	0.02539	-0.689000	0.03729	AAT	.	.	.	none		0.701	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251	
TSR1	55720	hgsc.bcm.edu	37	17	2232753	2232753	+	Missense_Mutation	SNP	A	A	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr17:2232753A>T	ENST00000301364.5	-	11	2866	c.1787T>A	c.(1786-1788)aTg>aAg	p.M596K	SNORD91A_ENST00000390861.1_RNA|SNORD91B_ENST00000391250.1_RNA	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	596					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						CCTCACCACCATATTCAATAC	0.438																																					p.M596K		Atlas-SNP	.											.	TSR1	57	.	0			c.T1787A						PASS	.						89.0	80.0	83.0					17																	2232753		2203	4300	6503	SO:0001583	missense	55720	exon11			ACCACCATATTCA	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.1787T>A	chr17.hg19:g.2232753A>T	ENSP00000301364:p.Met596Lys	68.0	0.0	.		75.0	26.0	.	NM_018128	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	ENST00000301364.5	hg19	CCDS32525.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.337499	0.60963	.	.	ENSG00000167721	ENST00000301364	T	0.18016	2.24	5.34	5.34	0.76211	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.225116	0.52532	D	0.000063	T	0.23649	0.0572	M	0.69185	2.1	0.53688	D	0.999979	B	0.25667	0.131	B	0.29440	0.102	T	0.02533	-1.1145	10	0.54805	T	0.06	-17.0729	14.4964	0.67691	1.0:0.0:0.0:0.0	.	596	Q2NL82	TSR1_HUMAN	K	596	ENSP00000301364:M596K	ENSP00000301364:M596K	M	-	2	0	TSR1	2179503	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.017000	0.93651	2.014000	0.59158	0.459000	0.35465	ATG	.	.	.	none		0.438	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438180.2	NM_018128	
PITPNM3	83394	hgsc.bcm.edu	37	17	6375990	6375990	+	Silent	SNP	C	C	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr17:6375990C>T	ENST00000262483.8	-	11	1503	c.1416G>A	c.(1414-1416)caG>caA	p.Q472Q	PITPNM3_ENST00000421306.3_Silent_p.Q436Q|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	472	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GGAGGAGGGACTGCCCATCGC	0.652																																					p.Q472Q		Atlas-SNP	.											.	PITPNM3	91	.	0			c.G1416A						PASS	.						57.0	57.0	57.0					17																	6375990		2202	4300	6502	SO:0001819	synonymous_variant	83394	exon11			GAGGGACTGCCCA	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1416G>A	chr17.hg19:g.6375990C>T		33.0	0.0	.		28.0	15.0	.	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	hg19	CCDS11076.1																																																																																			.	.	.	none		0.652	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
ST6GALNAC2	10610	hgsc.bcm.edu	37	17	74570497	74570497	+	Missense_Mutation	SNP	C	C	T			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr17:74570497C>T	ENST00000225276.5	-	3	630	c.311G>A	c.(310-312)cGc>cAc	p.R104H	ST6GALNAC2_ENST00000586520.1_5'UTR	NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	104					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						TTGGCTCAGGCGGTCCCAGAG	0.637																																					p.R104H		Atlas-SNP	.											ST6GALNAC2,colon,carcinoma,0,1	ST6GALNAC2	29	.	0			c.G311A						PASS	.						38.0	35.0	36.0					17																	74570497		2203	4300	6503	SO:0001583	missense	10610	exon3			CTCAGGCGGTCCC	U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.311G>A	chr17.hg19:g.74570497C>T	ENSP00000225276:p.Arg104His	40.0	0.0	.		44.0	16.0	.	NM_006456	Q12971	Missense_Mutation	SNP	ENST00000225276.5	hg19	CCDS11747.1	.	.	.	.	.	.	.	.	.	.	c	14.90	2.674158	0.47781	.	.	ENSG00000070731	ENST00000225276	T	0.32272	1.46	4.47	-0.561	0.11785	.	0.749066	0.12928	N	0.427572	T	0.24392	0.0591	L	0.55017	1.72	0.18873	N	0.999984	B	0.29301	0.241	B	0.25884	0.064	T	0.19353	-1.0308	10	0.56958	D	0.05	-1.9719	6.7032	0.23236	0.0:0.3692:0.0:0.6308	.	104	Q9UJ37	SIA7B_HUMAN	H	104	ENSP00000225276:R104H	ENSP00000225276:R104H	R	-	2	0	ST6GALNAC2	72082092	0.001000	0.12720	0.960000	0.40013	0.859000	0.49053	0.361000	0.20267	0.093000	0.17368	-0.258000	0.10820	CGC	.	.	.	none		0.637	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450650.1	NM_006456	
TRMT1	55621	hgsc.bcm.edu	37	19	13226494	13226494	+	Missense_Mutation	SNP	T	T	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr19:13226494T>A	ENST00000592062.1	-	5	969	c.399A>T	c.(397-399)gaA>gaT	p.E133D	TRMT1_ENST00000592892.1_5'UTR|TRMT1_ENST00000221504.8_Missense_Mutation_p.E133D|NACC1_ENST00000292431.4_5'Flank|TRMT1_ENST00000357720.4_Missense_Mutation_p.E133D|TRMT1_ENST00000437766.1_Missense_Mutation_p.E133D			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	133	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		AGGCCAGGTTTTCACTCTCTT	0.572																																					p.E133D		Atlas-SNP	.											.	TRMT1	31	.	0			c.A399T						PASS	.						166.0	168.0	168.0					19																	13226494		2203	4300	6503	SO:0001583	missense	55621	exon4			CAGGTTTTCACTC	AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.399A>T	chr19.hg19:g.13226494T>A	ENSP00000466967:p.Glu133Asp	280.0	0.0	.		299.0	114.0	.	NM_001136035	O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	ENST00000592062.1	hg19	CCDS12293.1	.	.	.	.	.	.	.	.	.	.	T	9.755	1.168481	0.21621	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	.	.	.	3.89	2.82	0.32997	.	0.227351	0.35677	N	0.003045	T	0.31979	0.0814	N	0.19112	0.55	0.36296	D	0.856722	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.18650	-1.0330	9	0.17369	T	0.5	-2.7274	8.7051	0.34349	0.0:0.0:0.1926:0.8074	.	133;133	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	D	133	.	ENSP00000221504:E133D	E	-	3	2	TRMT1	13087494	0.311000	0.24536	0.324000	0.25361	0.593000	0.36681	1.442000	0.35046	0.797000	0.33971	0.460000	0.39030	GAA	.	.	.	none		0.572	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452780.2	NM_017722	
SIN3B	23309	hgsc.bcm.edu	37	19	16964967	16964967	+	Missense_Mutation	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr19:16964967T>C	ENST00000248054.5	+	8	974	c.953T>C	c.(952-954)cTg>cCg	p.L318P	SIN3B_ENST00000596802.1_Missense_Mutation_p.L318P|SIN3B_ENST00000379803.1_Missense_Mutation_p.L318P					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						CGCCGGGTGCTGAAGAGCCAG	0.597																																					p.L318P		Atlas-SNP	.											.	SIN3B	90	.	0			c.T953C						PASS	.						56.0	53.0	54.0					19																	16964967		2203	4300	6503	SO:0001583	missense	23309	exon8			GGGTGCTGAAGAG	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.953T>C	chr19.hg19:g.16964967T>C	ENSP00000248054:p.Leu318Pro	64.0	0.0	.		65.0	28.0	.	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	hg19		.	.	.	.	.	.	.	.	.	.	T	21.4	4.138166	0.77775	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.63580	-0.05;0.13	5.19	5.19	0.71726	.	0.064314	0.64402	D	0.000004	D	0.83275	0.5219	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.987;0.988	D	0.87560	0.2471	10	0.87932	D	0	-38.9141	14.2256	0.65858	0.0:0.0:0.0:1.0	.	318;318;318	O75182-2;O75182;O75182-3	.;SIN3B_HUMAN;.	P	318	ENSP00000369131:L318P;ENSP00000248054:L318P	ENSP00000248054:L318P	L	+	2	0	SIN3B	16825967	1.000000	0.71417	0.993000	0.49108	0.870000	0.49936	7.837000	0.86796	1.958000	0.56883	0.459000	0.35465	CTG	.	.	.	none		0.597	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
LSR	51599	hgsc.bcm.edu	37	19	35757260	35757260	+	Splice_Site	SNP	A	A	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr19:35757260A>G	ENST00000361790.3	+	6	1081		c.e6-1		USF2_ENST00000594064.1_5'Flank|LSR_ENST00000427250.1_Splice_Site|LSR_ENST00000354900.3_Splice_Site|LSR_ENST00000347609.4_Splice_Site|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000602122.1_Splice_Site|USF2_ENST00000222305.3_5'Flank|USF2_ENST00000379134.3_5'Flank|LSR_ENST00000360798.3_Splice_Site|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000595068.1_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor						embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GTGTCCTCACAGTGTATGCCG	0.627																																					.		Atlas-SNP	.											.	LSR	60	.	0			c.866-2A>G						PASS	.						76.0	78.0	77.0					19																	35757260		2203	4300	6503	SO:0001630	splice_region_variant	51599	exon5			CCTCACAGTGTAT	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.923-1A>G	chr19.hg19:g.35757260A>G		175.0	0.0	.		140.0	39.0	.	NM_015925	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Splice_Site	SNP	ENST00000361790.3	hg19	CCDS12450.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029984	0.35797	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	.	.	.	3.99	2.94	0.34122	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7508	0.28896	0.8124:0.0:0.0:0.1876	.	.	.	.	.	-1	.	.	.	+	.	.	LSR	40449100	1.000000	0.71417	0.489000	0.27452	0.523000	0.34469	7.126000	0.77201	0.540000	0.28808	0.379000	0.24179	.	.	.	.	none		0.627	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	Intron
ZSCAN4	201516	hgsc.bcm.edu	37	19	58187881	58187881	+	Missense_Mutation	SNP	C	C	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr19:58187881C>G	ENST00000318203.5	+	3	1065	c.368C>G	c.(367-369)aCt>aGt	p.T123S		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	123	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GAAGACCTGACTGATGACAGC	0.418																																					p.T123S		Atlas-SNP	.											.	ZSCAN4	72	.	0			c.C368G						PASS	.						83.0	81.0	81.0					19																	58187881		2203	4300	6503	SO:0001583	missense	201516	exon3			ACCTGACTGATGA	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.368C>G	chr19.hg19:g.58187881C>G	ENSP00000321963:p.Thr123Ser	73.0	0.0	.		73.0	26.0	.	NM_152677	Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	hg19	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	C	9.547	1.114797	0.20795	.	.	ENSG00000180532	ENST00000318203	T	0.04317	3.65	4.42	-8.83	0.00806	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (1);	1.418230	0.04476	N	0.376945	T	0.04363	0.0120	L	0.53671	1.685	0.09310	N	1	B	0.14805	0.011	B	0.22386	0.039	T	0.40021	-0.9585	10	0.11794	T	0.64	0.036	5.2622	0.15580	0.3993:0.1301:0.3976:0.073	.	123	Q8NAM6	ZSCA4_HUMAN	S	123	ENSP00000321963:T123S	ENSP00000321963:T123S	T	+	2	0	ZSCAN4	62879693	0.006000	0.16342	0.000000	0.03702	0.016000	0.09150	-0.007000	0.12810	-2.018000	0.00943	-0.140000	0.14226	ACT	.	.	.	none		0.418	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677	
ENTPD6	955	hgsc.bcm.edu	37	20	25198149	25198149	+	Missense_Mutation	SNP	G	G	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr20:25198149G>C	ENST00000376652.4	+	9	973	c.810G>C	c.(808-810)caG>caC	p.Q270H	ENTPD6_ENST00000433259.2_Missense_Mutation_p.Q270H|Y_RNA_ENST00000365544.1_RNA|ENTPD6_ENST00000360031.2_Missense_Mutation_p.Q269H|ENTPD6_ENST00000354989.5_Missense_Mutation_p.Q253H			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	270					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						GCACCCTGCAGGCCTCCCCAC	0.537																																					p.Q270H		Atlas-SNP	.											ENTPD6,right_upper_lobe,carcinoma,0,1	ENTPD6	57	.	0			c.G810C						PASS	.						93.0	91.0	92.0					20																	25198149		2203	4300	6503	SO:0001583	missense	955	exon9			CCTGCAGGCCTCC	AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.810G>C	chr20.hg19:g.25198149G>C	ENSP00000365840:p.Gln270His	132.0	0.0	.		131.0	32.0	.	NM_001247	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Missense_Mutation	SNP	ENST00000376652.4	hg19	CCDS13170.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	7.510|7.510|7.510	0.654527|0.654527|0.654527	0.14580|0.14580|0.14580	.|.|.	.|.|.	ENSG00000197586|ENSG00000197586|ENSG00000197586	ENST00000376666|ENST00000354989;ENST00000360031;ENST00000525986;ENST00000376641;ENST00000376652;ENST00000439162;ENST00000417467;ENST00000433259;ENST00000425813|ENST00000433417;ENST00000427553;ENST00000447877	.|T;T;T;T;T;T;T|.	.|0.11495|.	.|2.77;2.77;2.77;2.77;2.77;2.77;2.77|.	5.71|5.71|5.71	2.69|2.69|2.69	0.31865|0.31865|0.31865	.|.|.	.|0.866486|.	.|0.10745|.	.|N|.	.|0.638962|.	T|T|T	0.51686|0.51686|0.51686	0.1689|0.1689|0.1689	L|L|L	0.58925|0.58925|0.58925	1.835|1.835|1.835	0.33639|0.33639|0.33639	D|D|D	0.607014|0.607014|0.607014	.|B;B;B;B;B;B;B;B;B|.	.|0.20459|.	.|0.004;0.045;0.045;0.027;0.045;0.004;0.006;0.022;0.012|.	.|B;B;B;B;B;B;B;B;B|.	.|0.30105|.	.|0.021;0.076;0.076;0.049;0.111;0.029;0.033;0.037;0.037|.	T|T|T	0.58047|0.58047|0.58047	-0.7705|-0.7705|-0.7705	5|10|5	.|0.46703|.	.|T|.	.|0.11|.	-8.1099|-8.1099|-8.1099	5.5882|5.5882|5.5882	0.17287|0.17287|0.17287	0.1474:0.0:0.5745:0.2781|0.1474:0.0:0.5745:0.2781|0.1474:0.0:0.5745:0.2781	.|.|.	.|52;252;270;270;270;253;269;269;270|.	.|B4DHS2;B4DDM7;B4DNK6;E7EP89;Q5QPI9;O75354-2;D3DW49;Q5QPJ2;O75354|.	.|.;.;.;.;.;.;.;.;ENTP6_HUMAN|.	R|H|T	94|253;269;190;166;270;252;204;270;222|191;128;163	.|ENSP00000347084:Q253H;ENSP00000353131:Q269H;ENSP00000365840:Q270H;ENSP00000408098:Q252H;ENSP00000395064:Q204H;ENSP00000401895:Q270H;ENSP00000390646:Q222H|.	.|ENSP00000347084:Q253H|.	G|Q|R	+|+|+	1|3|2	0|2|0	ENTPD6|ENTPD6|ENTPD6	25146149|25146149|25146149	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.038000|0.038000|0.038000	0.18304|0.18304|0.18304	0.058000|0.058000|0.058000	0.15608|0.15608|0.15608	1.836000|1.836000|1.836000	0.39191|0.39191|0.39191	0.346000|0.346000|0.346000	0.23899|0.23899|0.23899	0.462000|0.462000|0.462000	0.41574|0.41574|0.41574	GGC|CAG|AGG	.	.	.	none		0.537	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
GSPT2	23708	hgsc.bcm.edu	37	X	51486959	51486960	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chrX:51486959_51486960GC>TT	ENST00000340438.4	+	1	479_480	c.237_238GC>TT	c.(235-240)ccGCcc>ccTTcc	p.P80S		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	80					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					CGACTCAGCCGCCCACCCTCCC	0.658																																					p.P79P|p.P80S		Atlas-SNP	.											.	GSPT2	57	.	0			c.G237T|c.C238T						PASS	.																																			SO:0001583	missense	23708	exon1			TCAGCCGCCCACC|CAGCCGCCCACCC	AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	Exception_encountered	chrX.hg19:g.51486959_51486960delinsTT	ENSP00000341247:p.Pro80Ser	21.0|20.0	0.0	.		28.0	9.0	.	NM_018094	Q9H909|Q9NVY0|Q9NY44	Silent|Missense_Mutation	SNP	ENST00000340438.4	hg19	CCDS14336.1																																																																																			.	.	.	none		0.658	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1		
LAS1L	81887	hgsc.bcm.edu	37	X	64749564	64749564	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chrX:64749564C>A	ENST00000374811.3	-	5	749	c.709G>T	c.(709-711)Gag>Tag	p.E237*	LAS1L_ENST00000374807.5_Nonsense_Mutation_p.E237*|LAS1L_ENST00000374804.5_Nonsense_Mutation_p.E195*|LAS1L_ENST00000312391.8_Nonsense_Mutation_p.E237*	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	237					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						ACATCTGACTCCGTACTTTTC	0.453																																					p.E237X		Atlas-SNP	.											.	LAS1L	72	.	0			c.G709T						PASS	.						219.0	177.0	191.0					X																	64749564		2203	4300	6503	SO:0001587	stop_gained	81887	exon5			CTGACTCCGTACT	BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.709G>T	chrX.hg19:g.64749564C>A	ENSP00000363944:p.Glu237*	235.0	0.0	.		218.0	75.0	.	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Nonsense_Mutation	SNP	ENST00000374811.3	hg19	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371792	0.42003	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804;ENST00000312391	.	.	.	5.18	4.29	0.51040	.	0.478134	0.21197	N	0.078537	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	10.8918	0.47000	0.0:0.8136:0.1864:0.0	.	.	.	.	X	237;237;195;237	.	ENSP00000308649:E237X	E	-	1	0	LAS1L	64666289	0.369000	0.25039	0.062000	0.19696	0.007000	0.05969	1.842000	0.39250	1.194000	0.43101	0.600000	0.82982	GAG	.	.	.	none		0.453	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
KIF4A	24137	hgsc.bcm.edu	37	X	69637856	69637856	+	Splice_Site	SNP	T	T	C			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chrX:69637856T>C	ENST00000374403.3	+	29	3454		c.e29+2			NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A						anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CAAGGCAAGGTAGGATCAGGG	0.537																																					.		Atlas-SNP	.											.	KIF4A	118	.	0			c.3372+2T>C						PASS	.						139.0	96.0	111.0					X																	69637856		2203	4300	6503	SO:0001630	splice_region_variant	24137	exon29			GCAAGGTAGGATC	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3372+2T>C	chrX.hg19:g.69637856T>C		134.0	0.0	.		115.0	44.0	.	NM_012310	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Splice_Site	SNP	ENST00000374403.3	hg19	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	t	12.71	2.020554	0.35606	.	.	ENSG00000090889	ENST00000374403;ENST00000544650	.	.	.	5.3	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.5846	0.27985	0.0:0.0:0.2369:0.7631	.	.	.	.	.	-1	.	.	.	+	.	.	KIF4A	69554581	1.000000	0.71417	0.998000	0.56505	0.414000	0.31173	2.056000	0.41355	1.974000	0.57490	0.427000	0.28365	.	.	.	.	none		0.537	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	Intron
SLITRK2	84631	hgsc.bcm.edu	37	X	144904633	144904634	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chrX:144904633_144904634GC>CT	ENST00000370490.1	+	1	4945_4946	c.690_691GC>CT	c.(688-693)tgGCta>tgCTta	p.W230C	SLITRK2_ENST00000428560.2_Missense_Mutation_p.W230C|SLITRK2_ENST00000447897.2_Missense_Mutation_p.W230C|SLITRK2_ENST00000434188.2_Missense_Mutation_p.W230C|SLITRK2_ENST00000413937.2_Missense_Mutation_p.W230C			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	230	LRRCT 1.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCAAGGCCTGGCTAGACACCAT	0.49																																					p.W230C|p.L231L		Atlas-SNP	.											.	SLITRK2	221	.	0			c.G690C|c.C691T						PASS	.																																			SO:0001583	missense	84631	exon5			GGCCTGGCTAGAC|GCCTGGCTAGACA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	Exception_encountered	chrX.hg19:g.144904633_144904634delinsCT	ENSP00000359521:p.Trp230Cys	188.0|187.0	0.0	.		171.0	36.0|37.0	.	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation|Silent	SNP	ENST00000370490.1	hg19	CCDS14680.1																																																																																			.	.	.	none		0.490	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
C16orf62	57020	hgsc.bcm.edu	37	16	19711796	19711797	+	Stop_Codon_Ins	INS	-	-	G			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr16:19711796_19711797insG	ENST00000251143.5	+	0	2902_2903				C16orf62_ENST00000448695.1_Stop_Codon_Ins|C16orf62_ENST00000542263.1_Stop_Codon_Ins|C16orf62_ENST00000543152.1_Stop_Codon_Ins|C16orf62_ENST00000438132.3_Stop_Codon_Ins|C16orf62_ENST00000417362.2_Stop_Codon_Ins			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						AACAAGGACCTGACCCCCGGGC	0.51																																					p.X1053delinsW		Atlas-INDEL	.											.	C16orf62	164	.	0			c.3157_3158insG						PASS	.																																			SO:0001567	stop_retained_variant	57020	exon31			.		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2890dupG	chr16.hg19:g.19711797_19711797dupG	ENSP00000251143:p.*964Trpext*54	99.0	0.0	0		85.0	28.0	0.329412	NM_020314	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Frame_Shift_Ins	INS	ENST00000251143.5	hg19																																																																																				.	.	.	none		0.510	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_020314	
PDE7B	27115	hgsc.bcm.edu	37	6	136512787	136512788	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr6:136512787_136512788insA	ENST00000308191.6	+	13	1465_1466	c.1162_1163insA	c.(1162-1164)gaafs	p.E388fs	RP13-143G15.4_ENST00000417643.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	388	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.E388*(1)		breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	GCTCTTCCGGGAATGGGCCCAT	0.589																																					p.E388fs		Atlas-INDEL	.											PDE7B,NS,carcinoma,0,1	PDE7B	55	.	1	Substitution - Nonsense(1)	lung(1)	c.1162_1163insA						PASS	.																																			SO:0001589	frameshift_variant	27115	exon13			.	AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.1164dupA	chr6.hg19:g.136512789_136512789dupA	ENSP00000310661:p.Glu388fs	38.0	0.0	0		35.0	12.0	0.342857	NM_018945	Q5W154	Frame_Shift_Ins	INS	ENST00000308191.6	hg19	CCDS5175.1																																																																																			.	.	.	none		0.589	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042371.1		
ASPM	259266	hgsc.bcm.edu	37	1	197073973	197073974	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr1:197073973_197073974insA	ENST00000367409.4	-	18	4663_4664	c.4407_4408insT	c.(4405-4410)attatcfs	p.I1470fs	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1470					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATTGTATGATAATAGCAGAAT	0.292																																					p.I1470fs		Atlas-INDEL	.											.	ASPM	444	.	0			c.4408_4409insT						PASS	.																																			SO:0001589	frameshift_variant	259266	exon18			.	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.4408dupT	chr1.hg19:g.197073975_197073975dupA	ENSP00000356379:p.Ile1470fs	69.0	0.0	0		58.0	45.0	0.775862	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Frame_Shift_Ins	INS	ENST00000367409.4	hg19	CCDS1389.1																																																																																			.	.	.	none		0.292	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ANKRD26	22852	hgsc.bcm.edu	37	10	27349330	27349331	+	In_Frame_Ins	INS	-	-	TCA			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr10:27349330_27349331insTCA	ENST00000376087.4	-	15	1672_1673	c.1507_1508insTGA	c.(1507-1509)aaa>aTGAaa	p.502_503insM	ANKRD26_ENST00000436985.2_In_Frame_Ins_p.518_519insM	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	502					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						AACAGAATCTTTCATTTCAATG	0.277																																					p.K503delinsMK		Atlas-INDEL	.											.	ANKRD26	179	.	0			c.1508_1509insTGA						PASS	.																																			SO:0001652	inframe_insertion	22852	exon15			.	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1505_1507dupTGA	chr10.hg19:g.27349331_27349333dupTCA	ENSP00000365255:p.Met502_Met502dup	171.0	0.0	0		143.0	44.0	0.307692	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	In_Frame_Ins	INS	ENST00000376087.4	hg19	CCDS41499.1																																																																																			.	.	.	none		0.277	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
MGA	23269	hgsc.bcm.edu	37	15	42041819	42041837	+	Frame_Shift_Del	DEL	CTAATGTAATAAAACAAAA	CTAATGTAATAAAACAAAA	-	rs373448335		TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	CTAATGTAATAAAACAAAA	CTAATGTAATAAAACAAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr15:42041819_42041837delCTAATGTAATAAAACAAAA	ENST00000570161.1	+	16	6014_6032	c.6014_6032delCTAATGTAATAAAACAAAA	c.(6013-6033)gctaatgtaataaaacaaaacfs	p.ANVIKQN2005fs	MGA_ENST00000389936.4_Frame_Shift_Del_p.ANVIKQN1966fs|MGA_ENST00000545763.1_Frame_Shift_Del_p.ANVIKQN1796fs|MGA_ENST00000219905.7_Frame_Shift_Del_p.ANVIKQN2005fs|MGA_ENST00000566586.1_Frame_Shift_Del_p.ANVIKQN1796fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GACCCTGAGGCTAATGTAATAAAACAAAACTCAGGAGCT	0.416																																					p.2005_2011del		Atlas-INDEL	.											.	MGA	264	.	0			c.6013_6031del						PASS	.																																			SO:0001589	frameshift_variant	23269	exon17			.	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6014_6032delCTAATGTAATAAAACAAAA	chr15.hg19:g.42041819_42041837delCTAATGTAATAAAACAAAA	ENSP00000457035:p.Ala2005fs	153.0	0.0	0		111.0	24.0	0.216216	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.	.	none		0.416	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
SETD2	29072	hgsc.bcm.edu	37	3	47164114	47164114	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr3:47164114delA	ENST00000409792.3	-	3	2054	c.2012delT	c.(2011-2013)ttafs	p.L671fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	671					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTTATATTTAATTCTATGGG	0.328			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.L671fs		Atlas-INDEL	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.2013delA						PASS	.						58.0	63.0	61.0					3																	47164114		2203	4299	6502	SO:0001589	frameshift_variant	29072	exon3			.	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2012delT	chr3.hg19:g.47164114delA	ENSP00000386759:p.Leu671fs	102.0	0.0	0		85.0	70.0	0.823529	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.	.	none		0.328	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
NCAPD3	23310	hgsc.bcm.edu	37	11	134038822	134038822	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr11:134038822delG	ENST00000534548.2	-	25	3293	c.3229delC	c.(3229-3231)cagfs	p.Q1077fs		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1077					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CTCTCTGACTGGGGGAACTTG	0.443																																					p.Q1077fs		Atlas-INDEL	.											.	NCAPD3	141	.	0			c.3230delA						PASS	.						115.0	107.0	110.0					11																	134038822		2201	4297	6498	SO:0001589	frameshift_variant	23310	exon25			.	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.3229delC	chr11.hg19:g.134038822delG	ENSP00000433681:p.Gln1077fs	110.0	0.0	0		91.0	35.0	0.384615	NM_015261	A6NFS2|Q4KMQ9	Frame_Shift_Del	DEL	ENST00000534548.2	hg19	CCDS31723.1																																																																																			.	.	.	none		0.443	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
ZNF564	163050	hgsc.bcm.edu	37	19	12639496	12639497	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BQ-7061-01A-11D-1961-08	TCGA-BQ-7061-11A-01D-1961-08	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ae48a526-0daa-42b6-b98e-1453e9dc631a	4968c132-2d26-4a31-ab07-6d7c154551de	g.chr19:12639496_12639497delAG	ENST00000339282.7	-	2	213_214	c.17_18delCT	c.(16-18)tctfs	p.S6fs	CTD-2192J16.20_ENST00000593682.1_3'UTR|CTD-2192J16.21_ENST00000601420.1_RNA|ZNF709_ENST00000428311.1_Intron	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	6	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						CCACATCCTCAGAGGCCACTGA	0.45																																					p.6_7del		Atlas-INDEL	.											.	ZNF564	55	.	0			c.18_19del						PASS	.																																			SO:0001589	frameshift_variant	163050	exon2			.	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.17_18delCT	chr19.hg19:g.12639498_12639499delAG	ENSP00000340004:p.Ser6fs	140.0	0.0	0		146.0	54.0	0.369863	NM_144976	B9EGT4|Q6P1K6	Frame_Shift_Del	DEL	ENST00000339282.7	hg19	CCDS42505.1																																																																																			.	.	.	none		0.450	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2	NM_144976	
