#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
A2M	2	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	9230391	9230391	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr12:9230391G>A	ENST00000318602.7	-	26	3489	c.3182C>T	c.(3181-3183)gCa>gTa	p.A1061V	A2M_ENST00000542567.1_5'UTR	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1061					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.A1061V(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GGTAATGTGTGCTTCATCGAT	0.488																																																	1	Substitution - Missense(1)	kidney(1)											128.0	130.0	130.0					12																	9230391		2203	4300	6503	SO:0001583	missense	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3182C>T	12.37:g.9230391G>A	ENSP00000323929:p.Ala1061Val		Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001556	0.35320	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.37915	1.17	5.76	1.49	0.22878	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.864013	0.10196	N	0.704035	T	0.31857	0.0810	L	0.52364	1.645	0.09310	N	1	B	0.14012	0.009	B	0.18871	0.023	T	0.27872	-1.0061	10	0.38643	T	0.18	.	8.7941	0.34868	0.0751:0.0:0.3428:0.5821	.	1061	P01023	A2MG_HUMAN	V	1061;1076	ENSP00000323929:A1061V	ENSP00000323929:A1061V	A	-	2	0	A2M	9121658	0.000000	0.05858	0.969000	0.41365	0.862000	0.49288	0.003000	0.13083	0.297000	0.22615	0.585000	0.79938	GCA		0.488	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2		NM_000014	
A2M	2	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	9230405	9230405	+	Silent	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr12:9230405G>A	ENST00000318602.7	-	26	3475	c.3168C>T	c.(3166-3168)atC>atT	p.I1056I	A2M_ENST00000542567.1_5'UTR	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1056					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)	p.I1056I(1)		breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CATCGATGAAGATGTAGGCTC	0.473																																																	1	Substitution - coding silent(1)	kidney(1)											124.0	128.0	126.0					12																	9230405		2203	4300	6503	SO:0001819	synonymous_variant	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3168C>T	12.37:g.9230405G>A			Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	ENST00000318602.7	37	CCDS44827.1																																																																																				0.473	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2		NM_000014	
ABCC11	85320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	48244895	48244895	+	Silent	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr16:48244895G>A	ENST00000394747.1	-	10	1921	c.1572C>T	c.(1570-1572)ggC>ggT	p.G524G	ABCC11_ENST00000394748.1_Silent_p.G524G|ABCC11_ENST00000356608.2_Silent_p.G524G|ABCC11_ENST00000353782.5_Silent_p.G524G|ABCC11_ENST00000537808.1_Silent_p.G524G	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	524	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.G524G(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GCAACTCTGGGCCCAGGCTGT	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											102.0	86.0	91.0					16																	48244895		2201	4300	6501	SO:0001819	synonymous_variant	85320			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.1572C>T	16.37:g.48244895G>A			Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	ENST00000394747.1	37	CCDS10732.1																																																																																				0.617	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429984.1		NM_032583	
AGRN	375790	hgsc.bcm.edu;ucsc.edu	37	1	979247	979251	+	Frame_Shift_Del	DEL	GCAGG	GCAGG	-			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	GCAGG	GCAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:979247_979251delGCAGG	ENST00000379370.2	+	10	1893_1897	c.1843_1847delGCAGG	c.(1843-1848)gcagggfs	p.AG615fs		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	615	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		TGTGTGCTCCGCAGGGCAGTGTGTG	0.693																																																	0																																										SO:0001589	frameshift_variant	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1843_1847delGCAGG	1.37:g.979247_979251delGCAGG	ENSP00000368678:p.Ala615fs		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Frame_Shift_Del	DEL	ENST00000379370.2	37	CCDS30551.1																																																																																				0.693	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2		NM_198576	
AHNAK	79026	broad.mit.edu;hgsc.bcm.edu	37	11	62295513	62295513	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr11:62295513A>T	ENST00000378024.4	-	5	6650	c.6376T>A	c.(6376-6378)Ttg>Atg	p.L2126M	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2126					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.L2126M(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGGCCTTTCAAGTGTAAGTCC	0.517																																																	1	Substitution - Missense(1)	kidney(1)											191.0	205.0	200.0					11																	62295513		2202	4299	6501	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.6376T>A	11.37:g.62295513A>T	ENSP00000367263:p.Leu2126Met		A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	a	8.064	0.768833	0.15983	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.01998	4.51	3.51	-5.48	0.02592	.	.	.	.	.	T	0.10035	0.0246	M	0.77103	2.36	0.09310	N	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.00054	-1.2184	9	0.46703	T	0.11	.	13.5062	0.61485	0.3321:0.0:0.6679:0.0	.	2126	Q09666	AHNK_HUMAN	M	215;2126	ENSP00000367263:L2126M	ENSP00000244934:L215M	L	-	1	2	AHNAK	62052089	0.000000	0.05858	0.000000	0.03702	0.202000	0.24057	-2.187000	0.01250	-1.449000	0.01938	0.248000	0.18094	TTG		0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1		NM_024060	
AKAP13	11214	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	86123644	86123644	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:86123644A>G	ENST00000394518.2	+	7	2440	c.2345A>G	c.(2344-2346)gAc>gGc	p.D782G	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Missense_Mutation_p.D782G	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	782					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.D782G(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTAATATCAGACAGTACTTTC	0.443																																					Melanoma(94;603 1453 3280 32295 32951)												1	Substitution - Missense(1)	kidney(1)											113.0	116.0	115.0					15																	86123644		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.2345A>G	15.37:g.86123644A>G	ENSP00000378026:p.Asp782Gly		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	6.209	0.406789	0.11754	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.09073	3.02;3.03	5.88	-5.75	0.02384	.	.	.	.	.	T	0.03651	0.0104	N	0.17082	0.46	0.20074	N	0.999935	B;B	0.11235	0.002;0.004	B;B	0.08055	0.001;0.003	T	0.47071	-0.9145	9	0.02654	T	1	.	9.9106	0.41403	0.3309:0.1256:0.5434:0.0	.	782;782	Q12802;Q12802-2	AKP13_HUMAN;.	G	782;782;781;781	ENSP00000354718:D782G;ENSP00000378026:D782G	ENSP00000354718:D782G	D	+	2	0	AKAP13	83924648	0.219000	0.23619	0.037000	0.18230	0.893000	0.52053	-0.112000	0.10791	-1.482000	0.01860	0.533000	0.62120	GAC		0.443	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1		NM_007200	
ALPK2	115701	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	56205106	56205106	+	Silent	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr18:56205106A>T	ENST00000361673.3	-	5	2526	c.2313T>A	c.(2311-2313)ccT>ccA	p.P771P	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	771						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P137P(1)|p.P771P(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						AGACAGCCACAGGCTCCCTGA	0.527																																																	2	Substitution - coding silent(2)	kidney(2)											170.0	158.0	162.0					18																	56205106		2203	4300	6503	SO:0001819	synonymous_variant	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.2313T>A	18.37:g.56205106A>T			Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																				0.527	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1		NM_052947	
AMICA1	120425	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118074350	118074350	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr11:118074350G>T	ENST00000356289.5	-	6	738	c.565C>A	c.(565-567)Ctc>Atc	p.L189I	AMICA1_ENST00000292067.7_Missense_Mutation_p.L179I|AMICA1_ENST00000526620.1_Missense_Mutation_p.L150I|AMICA1_ENST00000533261.1_Missense_Mutation_p.L178I	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	189	Ig-like V-type 2.				blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)	p.L179I(1)		central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GACATCCTGAGTTTGTGGTAG	0.493																																																	1	Substitution - Missense(1)	kidney(1)											91.0	91.0	91.0					11																	118074350		2200	4296	6496	SO:0001583	missense	120425			AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.565C>A	11.37:g.118074350G>T	ENSP00000348635:p.Leu189Ile		B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Missense_Mutation	SNP	ENST00000356289.5	37	CCDS41723.1	.	.	.	.	.	.	.	.	.	.	G	8.191	0.795927	0.16327	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000533261;ENST00000526620;ENST00000537867	D;D;T;D	0.94457	-3.43;-3.43;-0.23;-3.43	3.96	3.04	0.35103	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.065980	0.07449	N	0.898700	D	0.92685	0.7675	L	0.48362	1.52	0.09310	N	1	B;B;B;B;B	0.33777	0.029;0.425;0.029;0.029;0.024	B;B;B;B;B	0.40659	0.124;0.336;0.124;0.124;0.076	D	0.83760	0.0214	10	0.33940	T	0.23	-1.1909	7.7445	0.28860	0.122:0.0:0.878:0.0	.	189;150;189;178;179	B4DVI6;E9PKK2;Q86YT9;E9PR26;Q86YT9-2	.;.;JAML1_HUMAN;.;.	I	189;179;178;150;150	ENSP00000348635:L189I;ENSP00000292067:L179I;ENSP00000436117:L178I;ENSP00000431218:L150I	ENSP00000292067:L179I	L	-	1	0	AMICA1	117579560	0.004000	0.15560	0.004000	0.12327	0.022000	0.10575	0.366000	0.20365	0.755000	0.32990	0.491000	0.48974	CTC		0.493	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2		NM_153206	
AP4E1	23431	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	51293254	51293254	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:51293254A>G	ENST00000261842.5	+	20	3233	c.3127A>G	c.(3127-3129)Aaa>Gaa	p.K1043E	AP4E1_ENST00000561397.1_3'UTR|AP4E1_ENST00000560508.1_Missense_Mutation_p.K968E	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	1043					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)		p.K1043E(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CGACTTTGGGAAACTCTGGTT	0.313																																																	1	Substitution - Missense(1)	kidney(1)											92.0	95.0	94.0					15																	51293254		2196	4294	6490	SO:0001583	missense	23431			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.3127A>G	15.37:g.51293254A>G	ENSP00000261842:p.Lys1043Glu		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	37	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097112	0.76870	.	.	ENSG00000081014	ENST00000261842	T	0.18502	2.21	5.06	3.92	0.45320	Coatomer, beta subunit, C-terminal (1);	0.255437	0.39210	N	0.001428	T	0.30448	0.0765	L	0.56769	1.78	0.42940	D	0.994345	D	0.57571	0.98	P	0.57324	0.818	T	0.02398	-1.1165	10	0.52906	T	0.07	-12.4087	11.4298	0.50034	0.8487:0.1513:0.0:0.0	.	1043	Q9UPM8	AP4E1_HUMAN	E	1043	ENSP00000261842:K1043E	ENSP00000261842:K1043E	K	+	1	0	AP4E1	49080546	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.859000	0.62954	0.930000	0.37217	0.533000	0.62120	AAA		0.313	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1			
ANPEP	290	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	90349608	90349608	+	Silent	SNP	T	T	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:90349608T>C	ENST00000300060.6	-	2	520	c.207A>G	c.(205-207)aaA>aaG	p.K69K		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	69	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.K69K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GATTCCACGCTTTACTTTGGT	0.617																																					NSCLC(30;827 977 2459 19669 26125)												1	Substitution - coding silent(1)	kidney(1)											128.0	118.0	122.0					15																	90349608		2200	4299	6499	SO:0001819	synonymous_variant	290			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.207A>G	15.37:g.90349608T>C			Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	37	CCDS10356.1																																																																																				0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1			
APOB	338	hgsc.bcm.edu;ucsc.edu	37	2	21229016	21229016	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:21229016delC	ENST00000233242.1	-	26	10851	c.10724delG	c.(10723-10725)ggcfs	p.G3575fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3575					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAAAAGAGGCCCTCTAGCTG	0.473																																																	0													77.0	73.0	75.0					2																	21229016		2203	4300	6503	SO:0001589	frameshift_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10724delG	2.37:g.21229016delC	ENSP00000233242:p.Gly3575fs		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																				0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1			
ARHGAP31	57514	broad.mit.edu;ucsc.edu	37	3	119132967	119132967	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr3:119132967T>A	ENST00000264245.4	+	12	2723	c.2191T>A	c.(2191-2193)Tcc>Acc	p.S731T		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	731	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.S731T(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						ACAGGGGGCTTCCACAGCAGC	0.612																																					Pancreas(7;176 297 5394 51128 51241)												1	Substitution - Missense(1)	kidney(1)											52.0	57.0	55.0					3																	119132967		1953	4144	6097	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2191T>A	3.37:g.119132967T>A	ENSP00000264245:p.Ser731Thr		Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	T	9.946	1.218768	0.22373	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.05996	3.36	5.08	-0.134	0.13481	.	0.806740	0.11114	N	0.598219	T	0.04092	0.0114	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.43686	-0.9376	10	0.54805	T	0.06	.	0.4947	0.00570	0.25:0.1766:0.3199:0.2535	.	731	Q2M1Z3	RHG31_HUMAN	T	731	ENSP00000264245:S731T	ENSP00000264245:S731T	S	+	1	0	ARHGAP31	120615657	0.000000	0.05858	0.005000	0.12908	0.450000	0.32258	-0.006000	0.12833	0.090000	0.17273	0.533000	0.62120	TCC		0.612	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2			
ARSD	414	hgsc.bcm.edu	37	X	2835999	2836007	+	In_Frame_Del	DEL	CCACGCCGG	CCACGCCGG	-	rs113556864|rs190767292		TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	CCACGCCGG	CCACGCCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chrX:2835999_2836007delCCACGCCGG	ENST00000381154.1	-	5	776_784	c.701_709delCCGGCGTGG	c.(700-711)gccggcgtgggc>ggc	p.AGV234del	ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	234					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AACAGGCAGCCCACGCCGGCCATGCCGGT	0.593																																																	0										451,3270		0,2,449,1590,88						-6.3	0.0		dbSNP_132	32	1416,5068		2,4,1408,2351,362	no	coding	ARSD	NM_001669.3		2,6,1857,3941,450	A1A1,A1R,A1,RR,R		21.8384,12.1204,18.295				1867,8338				SO:0001651	inframe_deletion	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.701_709delCCGGCGTGG	X.37:g.2835999_2836007delCCACGCCGG	ENSP00000370546:p.Ala234_Val236del		Q9UHJ8	In_Frame_Del	DEL	ENST00000381154.1	37	CCDS35196.1																																																																																				0.593	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			
ATP1A4	480	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	160144415	160144415	+	Missense_Mutation	SNP	C	C	T	rs377309643		TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:160144415C>T	ENST00000368081.4	+	15	2660	c.2189C>T	c.(2188-2190)gCg>gTg	p.A730V	ATP1A4_ENST00000470705.1_5'Flank|ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	730					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.A730V(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GACTCCCCTGCGCTGAAGAAG	0.547																																																	1	Substitution - Missense(1)	kidney(1)						C	VAL/ALA	0,4406		0,0,2203	138.0	104.0	116.0		2189	4.3	0.1	1		116	2,8598	2.2+/-6.3	0,2,4298	no	missense	ATP1A4	NM_144699.3	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	730/1030	160144415	2,13004	2203	4300	6503	SO:0001583	missense	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2189C>T	1.37:g.160144415C>T	ENSP00000357060:p.Ala730Val		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630147	0.87660	0.0	2.33E-4	ENSG00000132681	ENST00000368081	D	0.98090	-4.71	4.27	4.27	0.50696	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99281	0.9749	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.98440	1.0586	10	0.87932	D	0	.	14.5908	0.68362	0.0:1.0:0.0:0.0	.	730	Q13733	AT1A4_HUMAN	V	730	ENSP00000357060:A730V	ENSP00000357060:A730V	A	+	2	0	ATP1A4	158411039	1.000000	0.71417	0.125000	0.21846	0.787000	0.44495	7.623000	0.83113	2.371000	0.80710	0.655000	0.94253	GCG		0.547	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1		NM_144699	
CAPN12	147968	hgsc.bcm.edu;ucsc.edu	37	19	39229287	39229288	+	Splice_Site	DEL	CT	CT	-			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr19:39229287_39229288delCT	ENST00000328867.4	-	6	1038_1039	c.730_731delAG	c.(730-732)agt>t	p.S244fs	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Splice_Site_p.S95fs	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	244	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			ACCCCGATCACTCTGGGCAGGG	0.634																																																	0																																										SO:0001630	splice_region_variant	147968			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.730-1AG>-	19.37:g.39229289_39229290delCT				Frame_Shift_Del	DEL	ENST00000328867.4	37	CCDS12519.1																																																																																				0.634	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1			Frame_Shift_Del
EFCC1	79825	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	128758645	128758645	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr3:128758645C>T	ENST00000480450.1	+	8	1751	c.1751C>T	c.(1750-1752)gCc>gTc	p.A584V	EFCC1_ENST00000436022.2_Missense_Mutation_p.A147V			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	584	Poly-Ala.						calcium ion binding (GO:0005509)	p.A147V(1)|p.A584V(1)									TCGGCACCAGCCTCTGCAGCA	0.662																																																	2	Substitution - Missense(2)	kidney(2)											53.0	51.0	52.0					3																	128758645		2203	4300	6503	SO:0001583	missense	0			AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1751C>T	3.37:g.128758645C>T	ENSP00000420075:p.Ala584Val		A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839316	0.32513	.	.	ENSG00000114654	ENST00000480450;ENST00000436022	T;T	0.52754	0.66;0.65	3.94	3.06	0.35304	.	0.464062	0.20711	N	0.087081	T	0.39200	0.1069	M	0.63843	1.955	0.09310	N	1	B	0.32573	0.376	B	0.25140	0.058	T	0.37150	-0.9718	10	0.59425	D	0.04	.	7.1202	0.25440	0.0:0.8746:0.0:0.1254	.	584	Q9HA90	CCD48_HUMAN	V	584;147	ENSP00000420075:A584V;ENSP00000414597:A147V	ENSP00000414597:A147V	A	+	2	0	CCDC48	130241335	0.000000	0.05858	0.009000	0.14445	0.013000	0.08279	0.297000	0.19101	0.853000	0.35312	0.491000	0.48974	GCC		0.662	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1		NM_024768	
DHX9	1660	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	182841497	182841497	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:182841497G>A	ENST00000367549.3	+	15	1693	c.1583G>A	c.(1582-1584)cGt>cAt	p.R528H		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	528	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)	p.R528H(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GTAGTACTGCGTGATGTTGTT	0.323																																					Colon(69;210 1162 3697 13559 39565)												1	Substitution - Missense(1)	kidney(1)											200.0	173.0	181.0					1																	182841497		1861	4089	5950	SO:0001583	missense	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1583G>A	1.37:g.182841497G>A	ENSP00000356520:p.Arg528His		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	34	5.334717	0.95758	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.09255	3.0	5.97	5.97	0.96955	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41419	0.1158	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.27157	-1.0082	10	0.72032	D	0.01	.	20.0239	0.97514	0.0:0.0:1.0:0.0	.	528	Q08211	DHX9_HUMAN	H	528	ENSP00000356520:R528H	ENSP00000356520:R528H	R	+	2	0	DHX9	181108120	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.901000	0.92560	2.835000	0.97688	0.591000	0.81541	CGT		0.323	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2		NM_030588	
FADS6	283985	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	72888762	72888762	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr17:72888762A>T	ENST00000310226.6	-	2	259	c.245T>A	c.(244-246)aTc>aAc	p.I82N		NM_178128.3	NP_835229.2	Q8N9I5	FADS6_HUMAN	fatty acid desaturase 6	88					fatty acid biosynthetic process (GO:0006633)	integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)	p.I82N(1)|p.I87N(1)		endometrium(3)|kidney(1)|lung(4)	8	all_lung(278;0.172)|Lung NSC(278;0.207)					CACACCCAAGATGGTGATGCC	0.597																																																	2	Substitution - Missense(2)	kidney(2)											48.0	52.0	50.0					17																	72888762		2070	4203	6273	SO:0001583	missense	283985			AK094411	CCDS54163.1	17q25.1	2014-07-17	2013-01-25			ENSG00000172782		"""Fatty acid desaturases"""	30459	protein-coding gene	gene with protein product			"""fatty acid desaturase domain family, member 6"""				Standard	XM_005257224		Approved		uc002jmd.1	Q8N9I5		ENST00000310226.6:c.245T>A	17.37:g.72888762A>T	ENSP00000307821:p.Ile82Asn		Q17RQ7|Q6XYE1	Missense_Mutation	SNP	ENST00000310226.6	37	CCDS54163.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.712007	0.48517	.	.	ENSG00000172782	ENST00000310226	T	0.18810	2.19	5.32	5.32	0.75619	Fatty acid desaturase, type 1 (1);	0.288406	0.38326	N	0.001731	T	0.28962	0.0719	M	0.62723	1.935	0.39047	D	0.960253	B	0.31274	0.317	B	0.42030	0.373	T	0.12734	-1.0536	10	0.34782	T	0.22	-0.3632	10.1893	0.43017	0.9154:0.0:0.0846:0.0	.	88	Q8N9I5	FADS6_HUMAN	N	82	ENSP00000307821:I82N	ENSP00000307821:I82N	I	-	2	0	FADS6	70400357	1.000000	0.71417	0.082000	0.20525	0.185000	0.23345	3.308000	0.51896	2.047000	0.60756	0.524000	0.50904	ATC		0.597	FADS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445219.1			
PCED1A	64773	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	2819279	2819279	+	Missense_Mutation	SNP	A	A	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr20:2819279A>G	ENST00000360652.2	-	5	1059	c.557T>C	c.(556-558)cTc>cCc	p.L186P	PCED1A_ENST00000356872.3_Missense_Mutation_p.L135P|VPS16_ENST00000380469.3_5'Flank|VPS16_ENST00000380445.3_5'Flank	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	186								p.L186P(1)									ACGTTCCCCGAGGGGCATCGC	0.577																																																	1	Substitution - Missense(1)	kidney(1)											124.0	108.0	113.0					20																	2819279		2203	4300	6503	SO:0001583	missense	0			AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.557T>C	20.37:g.2819279A>G	ENSP00000353868:p.Leu186Pro		Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	ENST00000360652.2	37	CCDS13035.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.411689	0.42817	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	3.7	3.7	0.42460	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.350251	0.23273	N	0.049985	T	0.33673	0.0871	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.99;0.999	D;D	0.71870	0.918;0.975	T	0.06534	-1.0821	10	0.87932	D	0	-7.7576	8.9489	0.35776	1.0:0.0:0.0:0.0	.	135;186	Q9H1Q7-2;Q9H1Q7	.;F113A_HUMAN	P	135;186;135;186	ENSP00000349334:L135P;ENSP00000353868:L186P;ENSP00000388935:L135P;ENSP00000401711:L186P	ENSP00000349334:L135P	L	-	2	0	FAM113A	2767279	1.000000	0.71417	0.966000	0.40874	0.862000	0.49288	7.035000	0.76517	1.707000	0.51288	0.379000	0.24179	CTC		0.577	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2		NM_022760	
CCSER2	54462	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	86130886	86130886	+	Silent	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr10:86130886A>T	ENST00000224756.8	+	2	263	c.78A>T	c.(76-78)acA>acT	p.T26T	CCSER2_ENST00000372088.2_Silent_p.T26T|CCSER2_ENST00000359979.4_Silent_p.T26T	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	26					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.T26T(1)									TAAGAAGTACATTGCAGCCAA	0.348																																																	1	Substitution - coding silent(1)	kidney(1)											52.0	52.0	52.0					10																	86130886		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.78A>T	10.37:g.86130886A>T			B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Silent	SNP	ENST00000224756.8	37	CCDS31235.1																																																																																				0.348	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2		NM_018999	
BRINP3	339479	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	190068181	190068181	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:190068181G>A	ENST00000367462.3	-	8	1499	c.1268C>T	c.(1267-1269)aCg>aTg	p.T423M	BRINP3_ENST00000534846.1_Missense_Mutation_p.T321M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	423					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.T423M(1)									GCACGAGTGCGTCTCTTCTGA	0.547																																																	1	Substitution - Missense(1)	kidney(1)											50.0	40.0	43.0					1																	190068181		2203	4300	6503	SO:0001583	missense	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1268C>T	1.37:g.190068181G>A	ENSP00000356432:p.Thr423Met		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027250	0.54683	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.42900	0.96;0.96	5.65	5.65	0.86999	.	0.114994	0.64402	D	0.000011	T	0.38692	0.1050	L	0.34521	1.04	0.40578	D	0.981363	D;P	0.53619	0.961;0.935	B;B	0.43701	0.428;0.187	T	0.34976	-0.9807	10	0.62326	D	0.03	.	17.2216	0.86959	0.0:0.0:1.0:0.0	.	321;423	B7Z260;Q76B58	.;FAM5C_HUMAN	M	423;321	ENSP00000356432:T423M;ENSP00000438022:T321M	ENSP00000356432:T423M	T	-	2	0	FAM5C	188334804	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	3.178000	0.50879	2.656000	0.90262	0.591000	0.81541	ACG		0.547	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1		NM_199051	
FBN2	2201	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	127685089	127685089	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr5:127685089C>T	ENST00000508053.1	-	29	3913	c.2939G>A	c.(2938-2940)tGc>tAc	p.C980Y	FBN2_ENST00000508989.1_Missense_Mutation_p.C947Y|FBN2_ENST00000262464.4_Missense_Mutation_p.C980Y			P35556	FBN2_HUMAN	fibrillin 2	980	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.C980Y(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGGGCACTCGCAATGAAAAGA	0.463																																																	2	Substitution - Missense(2)	kidney(2)											119.0	98.0	105.0					5																	127685089		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2939G>A	5.37:g.127685089C>T	ENSP00000424571:p.Cys980Tyr		B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949816	0.73787	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.99445	-5.91;-5.91;-5.91	4.04	3.17	0.36434	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000005	D	0.99736	0.9896	H	0.98818	4.34	0.80722	D	1	D;D	0.76494	0.999;0.983	D;P	0.79784	0.993;0.857	D	0.97050	0.9763	10	0.87932	D	0	.	14.8009	0.69916	0.0:0.8546:0.1454:0.0	.	947;980	D6RJI3;P35556	.;FBN2_HUMAN	Y	980;980;947	ENSP00000262464:C980Y;ENSP00000424571:C980Y;ENSP00000425596:C947Y	ENSP00000262464:C980Y	C	-	2	0	FBN2	127712988	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	7.548000	0.82154	1.299000	0.44798	0.655000	0.94253	TGC		0.463	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2		NM_001999	
FOXD4L1	200350	broad.mit.edu	37	2	114257620	114257620	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:114257620C>T	ENST00000306507.5	+	1	960	c.787C>T	c.(787-789)Cac>Tac	p.H263Y		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	263	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H263Y(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						CGCTCTGCTGCACCCGCATCC	0.736																																																	1	Substitution - Missense(1)	kidney(1)											16.0	21.0	19.0					2																	114257620		1641	3196	4837	SO:0001583	missense	200350			AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.787C>T	2.37:g.114257620C>T	ENSP00000302756:p.His263Tyr		B3KWN1|B9EGF3	Missense_Mutation	SNP	ENST00000306507.5	37	CCDS2117.1	.	.	.	.	.	.	.	.	.	.	.	9.436	1.086867	0.20390	.	.	ENSG00000184492	ENST00000306507	D	0.94897	-3.55	2.57	2.57	0.30868	.	0.219300	0.22365	U	0.061035	D	0.86577	0.5966	L	0.34521	1.04	0.24373	N	0.99482	B	0.14438	0.01	B	0.09377	0.004	T	0.69833	-0.5038	10	0.02654	T	1	.	7.4563	0.27268	0.0:0.7284:0.2716:0.0	.	263	Q9NU39	FX4L1_HUMAN	Y	263	ENSP00000302756:H263Y	ENSP00000302756:H263Y	H	+	1	0	FOXD4L1	113974090	0.001000	0.12720	0.998000	0.56505	0.080000	0.17528	0.828000	0.27435	1.452000	0.47756	0.184000	0.17185	CAC		0.736	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254148.1		NM_012184	
FRAS1	80144	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	79458343	79458343	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr4:79458343T>G	ENST00000264895.6	+	72	11727	c.11287T>G	c.(11287-11289)Ttc>Gtc	p.F3763V		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3759					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.F3764V(1)|p.F3763V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AAAACACAGATTCCTGCTGTT	0.438																																																	2	Substitution - Missense(2)	kidney(2)											68.0	65.0	66.0					4																	79458343		1901	4112	6013	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11287T>G	4.37:g.79458343T>G	ENSP00000264895:p.Phe3763Val		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.3|26.3	4.724824|4.724824	0.89298|0.89298	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.66280|.	-0.2|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77644|0.77644	0.4161|0.4161	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	T|T	0.79097|0.79097	-0.1943|-0.1943	10|5	0.87932|.	D|.	0|.	.|.	16.1413|16.1413	0.81528|0.81528	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	3763|.	E9PHH6|.	.|.	V|S	3763|1991	ENSP00000264895:F3763V|.	ENSP00000264895:F3763V|.	F|I	+|+	1|2	0|0	FRAS1|FRAS1	79677367|79677367	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	7.848000|7.848000	0.86902|0.86902	2.270000|2.270000	0.75569|0.75569	0.482000|0.482000	0.46254|0.46254	TTC|ATT		0.438	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				
GCM1	8521	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	52993017	52993017	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr6:52993017C>T	ENST00000259803.7	-	6	1509	c.1298G>A	c.(1297-1299)tGt>tAt	p.C433Y	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	433					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.C433Y(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					TCTCAAAGGACACAGGTTCAG	0.403																																																	1	Substitution - Missense(1)	kidney(1)											145.0	148.0	147.0					6																	52993017		2203	4300	6503	SO:0001583	missense	8521			D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.1298G>A	6.37:g.52993017C>T	ENSP00000259803:p.Cys433Tyr		Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	37	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.343679	0.00222	.	.	ENSG00000137270	ENST00000259803	T	0.72394	-0.65	5.82	1.52	0.23074	.	0.183675	0.39146	N	0.001448	T	0.21921	0.0528	N	0.16656	0.425	0.32546	N	0.533049	B	0.02656	0.0	B	0.04013	0.001	T	0.03184	-1.1063	10	0.11485	T	0.65	-1.6718	2.5516	0.04750	0.3628:0.2909:0.0:0.3463	.	433	Q9NP62	GCM1_HUMAN	Y	433	ENSP00000259803:C433Y	ENSP00000259803:C433Y	C	-	2	0	GCM1	53100976	0.998000	0.40836	1.000000	0.80357	0.013000	0.08279	0.361000	0.20267	0.387000	0.25024	-0.136000	0.14681	TGT		0.403	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1			
GJA8	2703	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	147380712	147380712	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:147380712G>T	ENST00000369235.1	+	1	630	c.630G>T	c.(628-630)ttG>ttT	p.L210F	GJA8_ENST00000240986.4_Missense_Mutation_p.L210F			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	210					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)	p.L210F(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					TGTTCATGTTGTCTGTGGCCT	0.607																																					Melanoma(76;1255 1795 8195 52096)												1	Substitution - Missense(1)	kidney(1)											129.0	108.0	115.0					1																	147380712		2203	4300	6503	SO:0001583	missense	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.630G>T	1.37:g.147380712G>T	ENSP00000358238:p.Leu210Phe		A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	14.33	2.503817	0.44558	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.95724	-3.79;-3.79	4.92	0.0492	0.14288	Gap junction protein, cysteine-rich domain (1);	0.000000	0.64402	D	0.000003	D	0.93812	0.8021	L	0.52266	1.64	0.49687	D	0.999812	D	0.89917	1.0	D	0.97110	1.0	D	0.91422	0.5159	10	0.72032	D	0.01	.	4.7906	0.13247	0.1408:0.3354:0.4206:0.1032	.	210	P48165	CXA8_HUMAN	F	210	ENSP00000240986:L210F;ENSP00000358238:L210F	ENSP00000240986:L210F	L	+	3	2	GJA8	145847336	1.000000	0.71417	0.762000	0.31397	0.755000	0.42902	1.118000	0.31246	0.086000	0.17137	0.313000	0.20887	TTG		0.607	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1		NM_005267	
GRID1	2894	broad.mit.edu;hgsc.bcm.edu	37	10	87407096	87407096	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr10:87407096C>T	ENST00000327946.7	-	13	2141	c.2056G>A	c.(2056-2058)Gct>Act	p.A686T	GRID1_ENST00000536331.1_Missense_Mutation_p.A257T|RN7SKP238_ENST00000516483.1_RNA|RP11-93H12.4_ENST00000474115.2_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	686					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A686T(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCATATACAGCAGAATCCCGG	0.542										Multiple Myeloma(13;0.14)																																							1	Substitution - Missense(1)	kidney(1)											275.0	256.0	262.0					10																	87407096		2203	4300	6503	SO:0001583	missense	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2056G>A	10.37:g.87407096C>T	ENSP00000330148:p.Ala686Thr		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845538	0.71603	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.19394	2.15;2.15	5.7	5.7	0.88788	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.049674	0.85682	D	0.000000	T	0.22126	0.0533	L	0.56199	1.76	0.80722	D	1	P	0.35575	0.51	B	0.32342	0.144	T	0.02144	-1.1206	10	0.87932	D	0	.	13.7515	0.62910	0.1535:0.8465:0.0:0.0	.	686	Q9ULK0	GRID1_HUMAN	T	686;257	ENSP00000330148:A686T;ENSP00000444455:A257T	ENSP00000330148:A686T	A	-	1	0	GRID1	87397076	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	4.433000	0.59929	2.693000	0.91896	0.650000	0.86243	GCT		0.542	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3		XM_043613	
GRM1	2911	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	146720058	146720058	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr6:146720058G>A	ENST00000282753.1	+	7	2118	c.1883G>A	c.(1882-1884)cGg>cAg	p.R628Q	GRM1_ENST00000361719.2_Missense_Mutation_p.R628Q|GRM1_ENST00000492807.2_Missense_Mutation_p.R628Q|GRM1_ENST00000355289.4_Missense_Mutation_p.R628Q|GRM1_ENST00000507907.1_Missense_Mutation_p.R628Q|GRM1_ENST00000392299.2_Missense_Mutation_p.R628Q			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	628					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R628Q(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TCCTCCAGTCGGGAGCTCTGC	0.507																																																	2	Substitution - Missense(2)	kidney(2)											299.0	242.0	262.0					6																	146720058		2203	4300	6503	SO:0001583	missense	2911			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1883G>A	6.37:g.146720058G>A	ENSP00000282753:p.Arg628Gln		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	32	5.120440	0.94385	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	5.81	5.81	0.92471	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.93621	0.7963	M	0.73372	2.23	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.70716	0.97;0.924;0.95	D	0.93514	0.6855	10	0.87932	D	0	.	20.0694	0.97716	0.0:0.0:1.0:0.0	.	628;628;628	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	Q	628	ENSP00000354896:R628Q;ENSP00000376119:R628Q;ENSP00000424095:R628Q;ENSP00000282753:R628Q;ENSP00000347437:R628Q;ENSP00000425599:R628Q	ENSP00000282753:R628Q	R	+	2	0	GRM1	146761751	1.000000	0.71417	0.966000	0.40874	0.986000	0.74619	9.869000	0.99810	2.761000	0.94854	0.585000	0.79938	CGG		0.507	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1		NM_000838	
GUSB	2990	broad.mit.edu;ucsc.edu	37	7	65439618	65439618	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr7:65439618G>A	ENST00000304895.4	-	7	1269	c.1139C>T	c.(1138-1140)gCt>gTt	p.A380V	GUSB_ENST00000421103.1_Missense_Mutation_p.A234V|GUSB_ENST00000345660.6_Missense_Mutation_p.A329V|GUSB_ENST00000476486.1_5'Flank	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	380					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)	p.A380V(1)		breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GGTACGGAAAGCGTTGGCACC	0.592																																																	1	Substitution - Missense(1)	kidney(1)											92.0	85.0	87.0					7																	65439618		2203	4300	6503	SO:0001583	missense	2990			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1139C>T	7.37:g.65439618G>A	ENSP00000302728:p.Ala380Val		B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827063	0.90955	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.95656	-3.77;-3.77;-3.77	4.52	4.52	0.55395	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, family 2, conserved site (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.339317	0.35970	N	0.002875	D	0.97120	0.9059	M	0.75085	2.285	0.44976	D	0.997993	D;P	0.76494	0.999;0.945	P;P	0.62740	0.906;0.586	D	0.97717	1.0194	10	0.87932	D	0	.	16.7966	0.85603	0.0:0.0:1.0:0.0	.	234;380	E9PCV0;P08236	.;BGLR_HUMAN	V	380;234;329	ENSP00000302728:A380V;ENSP00000391390:A234V;ENSP00000340734:A329V	ENSP00000302728:A380V	A	-	2	0	GUSB	65077053	1.000000	0.71417	0.928000	0.36995	0.705000	0.40729	9.313000	0.96297	2.503000	0.84419	0.561000	0.74099	GCT		0.592	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3		NM_000181	
HGSNAT	138050	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	43002122	43002122	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr8:43002122G>T	ENST00000458501.2	+	2	234	c.234G>T	c.(232-234)aaG>aaT	p.K78N	HGSNAT_ENST00000379644.4_Missense_Mutation_p.K50N			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	78					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)	p.K78N(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			CAGAGCTGAAGATGGATCAGG	0.373																																																	1	Substitution - Missense(1)	kidney(1)											136.0	125.0	129.0					8																	43002122		1879	4104	5983	SO:0001583	missense	138050				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.234G>T	8.37:g.43002122G>T	ENSP00000389524:p.Lys78Asn		B4E2V0	Missense_Mutation	SNP	ENST00000458501.2	37		.	.	.	.	.	.	.	.	.	.	G	15.61	2.884175	0.51908	.	.	ENSG00000165102	ENST00000458501;ENST00000332689;ENST00000379644	D;D	0.91740	-2.9;-2.9	5.42	3.64	0.41730	.	0.064440	0.64402	D	0.000011	D	0.93058	0.7790	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	D	0.91706	0.5377	10	0.66056	D	0.02	-15.978	8.0566	0.30608	0.184:0.0:0.816:0.0	.	78	Q68CP4	HGNAT_HUMAN	N	78;50;50	ENSP00000389524:K78N;ENSP00000368965:K50N	ENSP00000327833:K50N	K	+	3	2	HGSNAT	43121279	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	2.225000	0.42954	0.677000	0.31305	0.456000	0.33151	AAG		0.373	HGSNAT-202	KNOWN	basic	protein_coding	protein_coding			XM_372038	
HMBS	3145	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	118963206	118963206	+	Silent	SNP	C	C	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr11:118963206C>A	ENST00000278715.3	+	11	895	c.744C>A	c.(742-744)atC>atA	p.I248I	HMBS_ENST00000543090.1_Silent_p.I217I|HMBS_ENST00000442944.2_Silent_p.I231I|HMBS_ENST00000544387.1_Intron|HMBS_ENST00000392841.1_Silent_p.I231I|HMBS_ENST00000537841.1_Silent_p.I231I|HMBS_ENST00000542729.1_Intron	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	248			I -> IETLLRCI (in AIP).		heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)	p.I248I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TTCGCTGCATCGCTGAAAGGG	0.607																																																	1	Substitution - coding silent(1)	kidney(1)											110.0	105.0	107.0					11																	118963206		2200	4295	6495	SO:0001819	synonymous_variant	3145			X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.744C>A	11.37:g.118963206C>A			A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Silent	SNP	ENST00000278715.3	37	CCDS8409.1																																																																																				0.607	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1		NM_000190	
KCNJ3	3760	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	155555522	155555522	+	Missense_Mutation	SNP	A	A	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:155555522A>C	ENST00000295101.2	+	1	712	c.235A>C	c.(235-237)Aag>Cag	p.K79Q	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Missense_Mutation_p.K79Q	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	79					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.K79Q(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	GGTGGACCTCAAGTGGCGCTG	0.597																																																	1	Substitution - Missense(1)	kidney(1)											141.0	133.0	136.0					2																	155555522		2203	4300	6503	SO:0001583	missense	3760			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.235A>C	2.37:g.155555522A>C	ENSP00000295101:p.Lys79Gln		B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.623906	0.46840	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.95069	-3.6;-3.6	5.16	5.16	0.70880	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.044578	0.85682	D	0.000000	D	0.91345	0.7270	L	0.31926	0.97	0.80722	D	1	B;B	0.28850	0.117;0.225	B;B	0.33295	0.053;0.161	D	0.90495	0.4470	10	0.87932	D	0	.	13.8034	0.63216	1.0:0.0:0.0:0.0	.	79;79	B4DEW7;P48549	.;IRK3_HUMAN	Q	79	ENSP00000295101:K79Q;ENSP00000438410:K79Q	ENSP00000295101:K79Q	K	+	1	0	KCNJ3	155263768	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.269000	0.95684	1.946000	0.56461	0.454000	0.30748	AAG		0.597	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2		NM_002239	
KCNK18	338567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	118957020	118957020	+	Silent	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr10:118957020C>T	ENST00000334549.1	+	1	21	c.21C>T	c.(19-21)ccC>ccT	p.P7P		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	7					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)	p.P7P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		CGGGGCACCCCCAGGCCAGGA	0.632																																																	1	Substitution - coding silent(1)	kidney(1)											62.0	61.0	61.0					10																	118957020		2203	4300	6503	SO:0001819	synonymous_variant	338567			AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.21C>T	10.37:g.118957020C>T			Q5SQQ8	Silent	SNP	ENST00000334549.1	37	CCDS7598.1																																																																																				0.632	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2		NM_181840	
KDELR3	11015	hgsc.bcm.edu;ucsc.edu	37	22	38877232	38877235	+	Frame_Shift_Del	DEL	TCTA	TCTA	-	rs139737165|rs573089298	byFrequency	TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	TCTA	TCTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr22:38877232_38877235delTCTA	ENST00000216014.4	+	4	539_542	c.367_370delTCTA	c.(367-372)tctatcfs	p.SI123fs	KDELR3_ENST00000409006.3_Frame_Shift_Del_p.SI123fs|KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3	123					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					CTGGACTTTCTCTATCTATCTGGA	0.446														3	0.000599042	0.0023	0.0	5008	,	,		17015	0.0		0.0	False		,,,				2504	0.0				Ovarian(11;103 529 24120 28493 32980)												0									,	5,4259		0,5,2127					,	5.0	1.0			175	3,8251		0,3,4124	no	frameshift,frameshift	KDELR3	NM_016657.1,NM_006855.2	,	0,8,6251	A1A1,A1R,RR		0.0363,0.1173,0.0639	,	,		8,12510				SO:0001589	frameshift_variant	11015			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	ENST00000216014.4:c.367_370delTCTA	22.37:g.38877236_38877239delTCTA	ENSP00000216014:p.Ser123fs		A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Frame_Shift_Del	DEL	ENST00000216014.4	37	CCDS13972.1																																																																																				0.446	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1			
KHK	3795	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	27322321	27322321	+	Silent	SNP	C	C	T	rs142428157	byFrequency	TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:27322321C>T	ENST00000260599.6	+	7	1200	c.687C>T	c.(685-687)ggC>ggT	p.G229G	KHK_ENST00000260598.5_Silent_p.G229G|CGREF1_ENST00000402550.1_3'UTR|KHK_ENST00000490823.1_3'UTR|CGREF1_ENST00000452318.2_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	229					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)	p.G229G(4)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAGGAGGGCGCCGACGCCC	0.652																																																	4	Substitution - coding silent(4)	large_intestine(2)|kidney(2)						T	,,,	1,4405	2.1+/-5.4	0,1,2202	63.0	66.0	65.0		687,,,687	-10.6	0.2	2	dbSNP_134	65	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,utr-3,utr-3,coding-synonymous	KHK,CGREF1	NM_000221.2,NM_001166240.1,NM_001166241.1,NM_006488.2	,,,	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	,,,	229/299,,,229/299	27322321	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.687C>T	2.37:g.27322321C>T			Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Silent	SNP	ENST00000260599.6	37	CCDS1734.1																																																																																				0.652	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1			
GSE1	23199	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	85696693	85696693	+	Silent	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr16:85696693C>T	ENST00000253458.7	+	10	2543	c.2367C>T	c.(2365-2367)tcC>tcT	p.S789S	GSE1_ENST00000405402.2_Silent_p.S685S|GSE1_ENST00000393243.1_Silent_p.S716S	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	789								p.S789S(1)									TGGACACGTCCTCTGAGGTAC	0.627																																																	1	Substitution - coding silent(1)	kidney(1)											68.0	54.0	59.0					16																	85696693		2198	4300	6498	SO:0001819	synonymous_variant	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.2367C>T	16.37:g.85696693C>T			D3DUM4|Q8IY61|Q96GA4|Q9BW09	Silent	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246584	0.22796	.	.	ENSG00000131149	ENST00000412692	.	.	.	5.48	3.51	0.40186	.	.	.	.	.	T	0.60248	0.2254	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57682	-0.7769	4	.	.	.	-27.6273	10.314	0.43725	0.0:0.7826:0.0:0.2174	.	.	.	.	L	596	.	.	P	+	2	0	KIAA0182	84254194	1.000000	0.71417	0.985000	0.45067	0.788000	0.44548	0.933000	0.28897	1.331000	0.45412	0.561000	0.74099	CCT		0.627	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1		NM_014615	
KIF20A	10112	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	137522869	137522869	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr5:137522869T>C	ENST00000394894.3	+	19	2666	c.2440T>C	c.(2440-2442)Tat>Cat	p.Y814H	KIF20A_ENST00000508792.1_Missense_Mutation_p.Y796H	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	814	Globular. {ECO:0000255}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.Y814H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGCTGAGCAGTATCATACTGT	0.473																																																	1	Substitution - Missense(1)	kidney(1)											89.0	83.0	85.0					5																	137522869		2203	4300	6503	SO:0001583	missense	10112			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.2440T>C	5.37:g.137522869T>C	ENSP00000378356:p.Tyr814His		B4DL79|D3DQB6	Missense_Mutation	SNP	ENST00000394894.3	37	CCDS4199.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.310724	0.60414	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	T;T	0.70516	-0.42;-0.49	5.01	5.01	0.66863	.	0.000000	0.39687	N	0.001281	T	0.78464	0.4287	L	0.54323	1.7	0.41086	D	0.98556	D;D	0.76494	0.998;0.999	P;D	0.66196	0.896;0.942	T	0.75277	-0.3374	10	0.22706	T	0.39	-10.9896	15.1825	0.72972	0.0:0.0:0.0:1.0	.	796;814	B4DL79;O95235	.;KI20A_HUMAN	H	814;796	ENSP00000378356:Y814H;ENSP00000420880:Y796H	ENSP00000378356:Y814H	Y	+	1	0	KIF20A	137550768	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.409000	0.59768	2.231000	0.72958	0.460000	0.39030	TAT		0.473	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251272.1		NM_005733	
KRT19	3880	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	39680198	39680198	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr17:39680198G>A	ENST00000361566.3	-	6	1060	c.1000C>T	c.(1000-1002)Cag>Tag	p.Q334*	KRT15_ENST00000393974.3_5'Flank|KRT15_ENST00000254043.3_5'Flank|KRT15_ENST00000393976.2_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	334	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.Q334*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				TGCGCCAGCTGGGCTCCAAAG	0.597																																																	1	Substitution - Nonsense(1)	kidney(1)											40.0	41.0	41.0					17																	39680198		2203	4299	6502	SO:0001587	stop_gained	3880				CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.1000C>T	17.37:g.39680198G>A	ENSP00000355124:p.Gln334*		B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Nonsense_Mutation	SNP	ENST00000361566.3	37	CCDS11399.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072829	0.76415	.	.	ENSG00000171345	ENST00000361566	.	.	.	5.17	4.2	0.49525	.	0.154508	0.30501	N	0.009483	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.0157	0.58754	0.0:0.0:0.7072:0.2928	.	.	.	.	X	334	.	ENSP00000355124:Q334X	Q	-	1	0	KRT19	36933724	0.334000	0.24739	0.854000	0.33618	0.575000	0.36095	1.709000	0.37909	1.179000	0.42884	0.556000	0.70494	CAG		0.597	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1		NM_002276	
Unknown	0	broad.mit.edu	37	13	19415641	19415641	+	IGR	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr13:19415641A>T								LINC00418 (121772 upstream) : RP11-38M15.11 (18325 downstream)																							aaaaaaaaaaaaacccaaaca	0.418																																																	0																																										SO:0001628	intergenic_variant	0																															13.37:g.19415641A>T				RNA	SNP		37																																																																																				0	0.418									
Unknown	0	broad.mit.edu	37	12	9458891	9458891	+	IGR	SNP	A	A	G	rs370295997		TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr12:9458891A>G								SNORA75 (19473 upstream) : RP13-735L24.1 (61168 downstream)														p.L565L(1)									CTTCCCCACTAATGCACATCG	0.612																																																	1	Substitution - coding silent(1)	kidney(1)																																								SO:0001628	intergenic_variant	642846																															12.37:g.9458891A>G				RNA	SNP		37																																																																																				0	0.612									
LRRC7	57554	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	70504369	70504369	+	Silent	SNP	G	G	A	rs370666609		TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:70504369G>A	ENST00000035383.5	+	19	2778	c.2748G>A	c.(2746-2748)ccG>ccA	p.P916P	LRRC7_ENST00000415775.2_Silent_p.P200P|LRRC7_ENST00000310961.5_Silent_p.P921P	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	916						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.P916P(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						ACTGCCGCCCGGAATCTTCTA	0.398																																																	1	Substitution - coding silent(1)	kidney(1)						G		0,4406		0,0,2203	52.0	53.0	53.0		2748	-2.4	0.9	1		53	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRRC7	NM_020794.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		916/1538	70504369	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57554				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2748G>A	1.37:g.70504369G>A			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	37	CCDS645.1																																																																																				0.398	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1		NM_020794	
MEIS1	4211	broad.mit.edu	37	2	66667009	66667009	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:66667009G>T	ENST00000272369.9	+	3	731	c.274G>T	c.(274-276)Gag>Tag	p.E92*	MEIS1_ENST00000488550.1_Nonsense_Mutation_p.E92*|MEIS1_ENST00000398506.2_Nonsense_Mutation_p.E90*|MEIS1_ENST00000495021.2_Nonsense_Mutation_p.E27*|MEIS1_ENST00000444274.2_Nonsense_Mutation_p.E60*|MEIS1_ENST00000560281.2_Nonsense_Mutation_p.E92*|MEIS1_ENST00000407092.2_Nonsense_Mutation_p.E92*|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1-AS1_ENST00000454595.1_RNA	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	92					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.E92*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						ACTGATTTTTGAGAAATGTGA	0.502																																																	1	Substitution - Nonsense(1)	kidney(1)											95.0	85.0	88.0					2																	66667009		1825	4077	5902	SO:0001587	stop_gained	4211				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.274G>T	2.37:g.66667009G>T	ENSP00000272369:p.Glu92*		A8MV50	Nonsense_Mutation	SNP	ENST00000272369.9	37	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	G	43	10.338579	0.99387	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274;ENST00000495021	.	.	.	5.38	5.38	0.77491	.	0.052845	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9412	0.92605	0.0:0.0:1.0:0.0	.	.	.	.	X	92;92;90;60;27	.	ENSP00000272369:E92X	E	+	1	0	MEIS1	66520513	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.620000	0.98373	2.793000	0.96121	0.655000	0.94253	GAG		0.502	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4		NM_002398	
MTMR10	54893	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	31266655	31266655	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:31266655G>T	ENST00000435680.1	-	5	433	c.336C>A	c.(334-336)aaC>aaA	p.N112K	MTMR10_ENST00000314404.8_5'Flank|MTMR10_ENST00000425768.1_Missense_Mutation_p.N112K|MTMR10_ENST00000563714.1_Missense_Mutation_p.N30K	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	112							phosphatase activity (GO:0016791)	p.N30K(1)|p.N112K(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		TCTTGTGGTCGTTTACTAAAA	0.303																																																	2	Substitution - Missense(2)	kidney(2)											45.0	43.0	44.0					15																	31266655		1796	4059	5855	SO:0001583	missense	54893			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.336C>A	15.37:g.31266655G>T	ENSP00000402537:p.Asn112Lys		Q6P4Q6	Missense_Mutation	SNP	ENST00000435680.1	37	CCDS45204.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.843233	0.51057	.	.	ENSG00000166912	ENST00000435680;ENST00000425768;ENST00000340566	D;T	0.94931	-3.56;0.87	5.49	3.18	0.36537	.	0.000000	0.85682	D	0.000000	D	0.94938	0.8363	L	0.53249	1.67	0.53688	D	0.999974	D;D	0.69078	0.989;0.997	P;D	0.64237	0.753;0.923	D	0.92675	0.6153	9	.	.	.	.	9.2248	0.37400	0.7934:0.0:0.2066:0.0	.	30;112	Q9NXD2-2;Q9NXD2	.;MTMRA_HUMAN	K	112;112;30	ENSP00000402537:N112K;ENSP00000412314:N112K	.	N	-	3	2	MTMR10	29053947	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.511000	0.53400	0.465000	0.27167	-0.254000	0.11334	AAC		0.303	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1		NM_017762	
MUC5B	727897	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	1264193	1264193	+	Missense_Mutation	SNP	C	C	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr11:1264193C>G	ENST00000529681.1	+	31	6141	c.6083C>G	c.(6082-6084)aCc>aGc	p.T2028S	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T2031S	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2028	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.T2028S(1)|p.T2031S(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCACGGCCACCACAACTGGG	0.632																																																	2	Substitution - Missense(2)	kidney(2)											128.0	155.0	146.0					11																	1264193		2095	4204	6299	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6083C>G	11.37:g.1264193C>G	ENSP00000436812:p.Thr2028Ser		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	6.839	0.524083	0.13066	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.20200	2.09;2.31	2.99	-1.02	0.10135	.	.	.	.	.	T	0.18635	0.0447	M	0.68317	2.08	0.09310	N	1	P;P	0.47762	0.9;0.9	B;B	0.41332	0.286;0.354	T	0.19063	-1.0317	9	0.87932	D	0	.	1.8362	0.03140	0.1579:0.4696:0.1557:0.2168	.	2721;2031	A7Y9J9;E9PBJ0	.;.	S	2028;2031;2029;2098	ENSP00000436812:T2028S;ENSP00000415793:T2031S	ENSP00000343037:T2029S	T	+	2	0	MUC5B	1220769	0.032000	0.19561	0.001000	0.08648	0.012000	0.07955	2.427000	0.44740	-0.077000	0.12752	0.305000	0.20034	ACC		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2		XM_001126093	
MYH11	4629	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	15841458	15841458	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr16:15841458G>C	ENST00000300036.5	-	19	2489	c.2380C>G	c.(2380-2382)Cag>Gag	p.Q794E	MYH11_ENST00000452625.2_Missense_Mutation_p.Q801E|MYH11_ENST00000396324.3_Missense_Mutation_p.Q801E|MYH11_ENST00000576790.2_Missense_Mutation_p.Q794E	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	794	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.Q801E(1)|p.Q794E(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CACATCGCCTGGAAGGCCATG	0.498			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(2)	kidney(2)											114.0	104.0	107.0					16																	15841458		2197	4300	6497	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2380C>G	16.37:g.15841458G>C	ENSP00000300036:p.Gln794Glu		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.981687	0.93044	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.93514	0.7930	H	0.96833	3.89	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.998	D	0.95353	0.8448	10	0.72032	D	0.01	.	18.3008	0.90163	0.0:0.0:1.0:0.0	.	801;794;801;794;801	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	E	794;794;801;801;801	ENSP00000300036:Q794E;ENSP00000345136:Q794E;ENSP00000379616:Q801E;ENSP00000407821:Q801E	ENSP00000300036:Q794E	Q	-	1	0	MYH11	15748959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.565000	0.86533	0.561000	0.74099	CAG		0.498	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2		NM_001040113	
NUP88	4927	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5322725	5322725	+	Silent	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr17:5322725G>T	ENST00000573584.1	-	1	755	c.246C>A	c.(244-246)cgC>cgA	p.R82R	RPAIN_ENST00000381209.3_5'Flank|RPAIN_ENST00000381208.5_5'Flank|RPAIN_ENST00000405578.4_5'Flank|RPAIN_ENST00000327154.6_5'Flank|RPAIN_ENST00000574003.1_5'Flank|RPAIN_ENST00000536255.2_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	82					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.R82R(1)		endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						GGCCCCGAAGGCGAACGACTA	0.647																																																	1	Substitution - coding silent(1)	kidney(1)											39.0	43.0	42.0					17																	5322725		2203	4300	6503	SO:0001819	synonymous_variant	4927			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.246C>A	17.37:g.5322725G>T			D3DTM2|Q9BWE5	Nonsense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1																																																																																				0.647	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3		NM_002532	
P2RX2	22953	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	133196058	133196058	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr12:133196058G>T	ENST00000389110.3	+	2	244	c.207G>T	c.(205-207)gaG>gaT	p.E69D	P2RX2_ENST00000449132.2_Missense_Mutation_p.E69D|P2RX2_ENST00000351222.4_Intron|P2RX2_ENST00000352418.4_Nonsense_Mutation_p.E47*|P2RX2_ENST00000343948.4_Missense_Mutation_p.E69D|P2RX2_ENST00000348800.5_Missense_Mutation_p.E69D|P2RX2_ENST00000350048.5_Missense_Mutation_p.E69D	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	69					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.E69D(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GCTACCAGGAGAGCGAGACGG	0.662																																																	1	Substitution - Missense(1)	kidney(1)											86.0	84.0	85.0					12																	133196058		2203	4300	6503	SO:0001583	missense	22953			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.207G>T	12.37:g.133196058G>T	ENSP00000373762:p.Glu69Asp		A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Nonsense_Mutation	SNP	ENST00000389110.3	37	CCDS31931.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	26.8|26.8|26.8	4.777016|4.777016|4.777016	0.90195|0.90195|0.90195	.|.|.	.|.|.	ENSG00000187848|ENSG00000187848|ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000350048;ENST00000348800|ENST00000352418|ENST00000542301;ENST00000536121;ENST00000535910	T;T;T;T;T|.|.	0.04551|.|.	3.6;3.6;3.6;3.6;3.6|.|.	4.44|4.44|4.44	1.41|1.41|1.41	0.22369|0.22369|0.22369	.|.|.	0.295951|0.295951|.	0.36200|0.36200|.	N|N|.	0.002735|0.002735|.	T|.|T	0.32734|.|0.32734	0.0839|.|0.0839	.|.|.	.|.|.	.|.|.	0.31050|0.31050|0.31050	N|N|N	0.71534|0.71534|0.71534	B;B;B;B;B;B|.|.	0.13594|.|.	0.003;0.008;0.004;0.004;0.003;0.001|.|.	B;B;B;B;B;B|.|.	0.21360|.|.	0.007;0.034;0.006;0.004;0.007;0.002|.|.	T|.|T	0.34378|.|0.34378	-0.9831|.|-0.9831	9|.|4	0.11182|0.72032|.	T|D|.	0.66|0.01|.	-20.4988|-20.4988|-20.4988	5.7002|5.7002|5.7002	0.17877|0.17877|0.17877	0.1208:0.3445:0.4516:0.0831|0.1208:0.3445:0.4516:0.0831|0.1208:0.3445:0.4516:0.0831	.|.|.	69;69;69;69;69;69|.|.	Q32MC3;Q9UBL9-7;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2|.|.	.;.;.;.;P2RX2_HUMAN;.|.|.	D|X|I	69|47|80;55;25	ENSP00000373762:E69D;ENSP00000405531:E69D;ENSP00000343339:E69D;ENSP00000343904:E69D;ENSP00000345095:E69D|.|.	ENSP00000343339:E69D|ENSP00000341419:E47X|.	E|E|R	+|+|+	3|1|2	2|0|0	P2RX2|P2RX2|P2RX2	131706131|131706131|131706131	0.376000|0.376000|0.376000	0.25098|0.25098|0.25098	0.996000|0.996000|0.996000	0.52242|0.52242|0.52242	0.924000|0.924000|0.924000	0.55760|0.55760|0.55760	0.388000|0.388000|0.388000	0.20735|0.20735|0.20735	-0.029000|-0.029000|-0.029000	0.13827|0.13827|0.13827	-0.430000|-0.430000|-0.430000	0.05897|0.05897|0.05897	GAG|GAG|AGA		0.662	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1			
PCK1	5105	broad.mit.edu;ucsc.edu	37	20	56138156	56138156	+	Missense_Mutation	SNP	T	T	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr20:56138156T>G	ENST00000319441.4	+	5	847	c.683T>G	c.(682-684)aTc>aGc	p.I228S	PCK1_ENST00000535860.1_Missense_Mutation_p.I96S|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	228					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)	p.I228S(1)		endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CGCAGAGAGATCATCTCCTTT	0.617																																																	1	Substitution - Missense(1)	kidney(1)											77.0	79.0	78.0					20																	56138156		2203	4300	6503	SO:0001583	missense	5105				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.683T>G	20.37:g.56138156T>G	ENSP00000319814:p.Ile228Ser		A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	37	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.676065	0.88445	.	.	ENSG00000124253	ENST00000319441;ENST00000535860	T;T	0.09073	3.02;3.02	5.06	5.06	0.68205	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67051	-0.5768	10	0.87932	D	0	-41.4685	15.1223	0.72453	0.0:0.0:0.0:1.0	.	228	P35558	PCKGC_HUMAN	S	228;96	ENSP00000319814:I228S;ENSP00000444342:I96S	ENSP00000319814:I228S	I	+	2	0	PCK1	55571562	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.539000	0.82063	2.040000	0.60383	0.533000	0.62120	ATC		0.617	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2			
PKN3	29941	broad.mit.edu	37	9	131469089	131469089	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr9:131469089G>A	ENST00000291906.4	+	4	902	c.509G>A	c.(508-510)gGg>gAg	p.G170E	RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	170					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)	p.G170E(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						GAGGCCAGTGGGTCCCCGGAG	0.672																																																	1	Substitution - Missense(1)	kidney(1)											23.0	27.0	25.0					9																	131469089		2203	4300	6503	SO:0001583	missense	29941			AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.509G>A	9.37:g.131469089G>A	ENSP00000291906:p.Gly170Glu		Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.703413	0.30232	.	.	ENSG00000160447	ENST00000291906	T	0.16597	2.33	5.08	0.188	0.15114	.	.	.	.	.	T	0.06917	0.0176	N	0.14661	0.345	0.50039	D	0.999844	B;B	0.16166	0.004;0.016	B;B	0.19946	0.013;0.027	T	0.34601	-0.9822	9	0.21014	T	0.42	.	0.3804	0.00394	0.3031:0.1904:0.314:0.1924	.	170;170	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	E	170	ENSP00000291906:G170E	ENSP00000291906:G170E	G	+	2	0	PKN3	130508910	1.000000	0.71417	0.842000	0.33263	0.886000	0.51366	2.206000	0.42779	0.113000	0.18004	0.561000	0.74099	GGG		0.672	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1		NM_013355	
POLR3A	11128	hgsc.bcm.edu;ucsc.edu	37	10	79764626	79764626	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr10:79764626C>A	ENST00000372371.3	-	16	2232	c.2095G>T	c.(2095-2097)Ggg>Tgg	p.G699W		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	699					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)	p.G699W(1)		breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TCACCGATCCCAATTGAGAAA	0.468																																																	1	Substitution - Missense(1)	kidney(1)											109.0	93.0	99.0					10																	79764626		2203	4300	6503	SO:0001583	missense	11128			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2095G>T	10.37:g.79764626C>A	ENSP00000361446:p.Gly699Trp		Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033399	0.93575	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	D	0.82893	-1.66	5.9	5.9	0.94986	RNA polymerase Rpb1, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.95153	0.8429	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96281	0.9206	9	.	.	.	-25.474	20.274	0.98482	0.0:1.0:0.0:0.0	.	699	O14802	RPC1_HUMAN	W	699	ENSP00000361446:G699W	.	G	-	1	0	POLR3A	79434632	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.487000	0.81328	2.797000	0.96272	0.650000	0.86243	GGG		0.468	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1		NM_007055	
POM121L9P	29774	broad.mit.edu	37	22	24659691	24659691	+	RNA	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr22:24659691G>A	ENST00000414583.2	+	0	3216					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		TCTCCTCCACGCACTGGCGCA	0.622																																																	0																																												29774			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659691G>A				RNA	SNP	ENST00000414583.2	37																																																																																					0.622	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319991.1		NM_014549	
PRSS21	10942	broad.mit.edu	37	16	2867459	2867459	+	Splice_Site	SNP	T	T	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr16:2867459T>G	ENST00000005995.3	+	2	133		c.e2+2		PRSS21_ENST00000450020.3_Splice_Site|PRSS21_ENST00000455114.1_Splice_Site			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)						spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.?(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						CGTTATCAGGTAGGGCGCCCA	0.721																																																	1	Unknown(1)	kidney(1)											8.0	8.0	8.0					16																	2867459		1927	3841	5768	SO:0001630	splice_region_variant	10942			AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.91+2T>G	16.37:g.2867459T>G			Q9NS34|Q9P2V6	Splice_Site	SNP	ENST00000005995.3	37	CCDS10478.1	.	.	.	.	.	.	.	.	.	.	t	8.127	0.782172	0.16189	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	.	.	.	3.39	0.146	0.14833	.	.	.	.	.	.	.	.	.	.	.	0.25438	N	0.988129	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.8506	0.03168	0.255:0.2367:0.0:0.5083	.	.	.	.	.	-1	.	.	.	+	.	.	PRSS21	2807460	0.007000	0.16637	0.037000	0.18230	0.061000	0.15899	0.193000	0.17116	0.269000	0.21961	0.330000	0.21533	.		0.721	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250910.1		NM_006799	Intron
RPS6KA1	6195	broad.mit.edu;hgsc.bcm.edu	37	1	26887302	26887302	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr1:26887302G>A	ENST00000374168.2	+	15	1455	c.1301G>A	c.(1300-1302)cGc>cAc	p.R434H	RPS6KA1_ENST00000530003.1_Missense_Mutation_p.R418H|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.R342H|RPS6KA1_ENST00000526792.1_Missense_Mutation_p.R342H|RPS6KA1_ENST00000531382.1_Missense_Mutation_p.R443H|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.R423H	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	434	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.R443H(1)		lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		GAGTGCAAGCGCTGTGTCCAC	0.572																																																	1	Substitution - Missense(1)	kidney(1)											123.0	115.0	118.0					1																	26887302		2203	4300	6503	SO:0001583	missense	6195			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1301G>A	1.37:g.26887302G>A	ENSP00000363283:p.Arg434His		A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	ENST00000374168.2	37	CCDS284.1	.	.	.	.	.	.	.	.	.	.	G	35	5.454774	0.96223	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000531382	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57592	0.2064	L	0.37897	1.145	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;P;D	0.77004	0.91;0.904;0.989	T	0.60005	-0.7347	10	0.87932	D	0	.	19.2983	0.94132	0.0:0.0:1.0:0.0	.	418;443;434	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	H	434;423;342;342;418;443	ENSP00000363283:R434H;ENSP00000363281:R423H;ENSP00000431651:R342H;ENSP00000363277:R342H;ENSP00000432281:R418H;ENSP00000435412:R443H	ENSP00000363277:R342H	R	+	2	0	RPS6KA1	26759889	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.921000	0.87530	2.567000	0.86603	0.462000	0.41574	CGC		0.572	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1		NM_002953	
RTL1	388015	broad.mit.edu;ucsc.edu	37	14	101347402	101347402	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr14:101347402G>A	ENST00000534062.1	-	1	3782	c.3724C>T	c.(3724-3726)Cgt>Tgt	p.R1242C	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1242					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)		p.R1242C(1)		breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGACGGTAACGTTGCAGGTCG	0.632																																																	1	Substitution - Missense(1)	kidney(1)											20.0	20.0	20.0					14																	101347402		1568	3580	5148	SO:0001583	missense	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3724C>T	14.37:g.101347402G>A	ENSP00000435342:p.Arg1242Cys		E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.319564	0.60524	.	.	ENSG00000254656	ENST00000534062	T	0.46063	0.88	3.48	2.55	0.30701	.	0.000000	0.35013	N	0.003510	T	0.43033	0.1229	L	0.29908	0.895	0.29790	N	0.833286	D	0.76494	0.999	P	0.59487	0.858	T	0.37056	-0.9722	10	0.87932	D	0	.	8.0406	0.30519	0.0:0.0:0.7579:0.2421	.	1242	E9PKS8	.	C	1242	ENSP00000435342:R1242C	ENSP00000435342:R1242C	R	-	1	0	RTL1	100417155	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.874000	0.39568	0.992000	0.38840	0.655000	0.94253	CGT		0.632	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1		NM_001134888	
RYR3	6263	broad.mit.edu;ucsc.edu	37	15	34118467	34118467	+	Missense_Mutation	SNP	C	C	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:34118467C>T	ENST00000389232.4	+	83	11231	c.11161C>T	c.(11161-11163)Cgt>Tgt	p.R3721C	RYR3_ENST00000415757.3_Missense_Mutation_p.R3716C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3721					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.R3720C(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGTTCGGGAACGTGGTAAGTT	0.378																																																	1	Substitution - Missense(1)	kidney(1)											223.0	194.0	203.0					15																	34118467		1862	4107	5969	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11161C>T	15.37:g.34118467C>T	ENSP00000373884:p.Arg3721Cys		O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812212	0.70797	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.96716	-4.1	5.35	4.43	0.53597	.	0.162693	0.39146	N	0.001452	D	0.91764	0.7395	N	0.22421	0.69	0.58432	D	0.999997	B;D	0.58620	0.022;0.983	B;B	0.41299	0.003;0.353	D	0.92007	0.5615	10	0.56958	D	0.05	.	12.5284	0.56100	0.0:0.9236:0.0:0.0764	.	3716;3721	Q15413-2;Q15413	.;RYR3_HUMAN	C	3721;3720;3717	ENSP00000373884:R3721C	ENSP00000354735:R3717C	R	+	1	0	RYR3	31905759	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	2.266000	0.43320	1.630000	0.50440	0.655000	0.94253	CGT		0.378	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1			
SLC38A10	124565	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	79257257	79257257	+	Silent	SNP	C	C	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr17:79257257C>A	ENST00000374759.3	-	4	692	c.309G>T	c.(307-309)gtG>gtT	p.V103V	SLC38A10_ENST00000288439.5_Silent_p.V103V|SLC38A10_ENST00000546352.1_5'Flank	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	103					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.V103V(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AGTCGCCGATCACGACGTAGA	0.587																																																	2	Substitution - coding silent(2)	kidney(2)											82.0	57.0	66.0					17																	79257257		2201	4298	6499	SO:0001819	synonymous_variant	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.309G>T	17.37:g.79257257C>A			Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	37	CCDS42397.1																																																																																				0.587	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1		NM_138570	
STYX	6815	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	53213187	53213187	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr14:53213187T>A	ENST00000354586.4	+	3	427	c.134T>A	c.(133-135)aTg>aAg	p.M45K	STYX_ENST00000556861.1_Intron|STYX_ENST00000442123.2_Missense_Mutation_p.M45K	NM_145251.3	NP_660294.1	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein	45					MAPK export from nucleus (GO:0045204)|protein dephosphorylation (GO:0006470)|regulation of ERK1 and ERK2 cascade (GO:0070372)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.M45K(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5	Breast(41;0.176)					TCATCTGCTATGAAAAGCAAG	0.289																																																	1	Substitution - Missense(1)	kidney(1)											62.0	64.0	63.0					14																	53213187		2202	4298	6500	SO:0001583	missense	6815				CCDS9711.1	14q22.1	2011-06-09	2001-11-29		ENSG00000198252	ENSG00000198252		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	11447	protein-coding gene	gene with protein product		615814	"""serine/threonine/tyrosine-interacting protein"""			7592916	Standard	NM_145251		Approved		uc010tqy.2	Q8WUJ0	OTTHUMG00000140306	ENST00000354586.4:c.134T>A	14.37:g.53213187T>A	ENSP00000346599:p.Met45Lys		B9EJG0|Q99850	Missense_Mutation	SNP	ENST00000354586.4	37	CCDS9711.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.360905	0.41801	.	.	ENSG00000198252	ENST00000442123;ENST00000354586	D;D	0.84800	-1.9;-1.9	5.38	5.38	0.77491	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.187173	0.64402	D	0.000003	T	0.75339	0.3836	L	0.31578	0.945	0.80722	D	1	P	0.35242	0.492	B	0.28139	0.086	T	0.73681	-0.3906	10	0.18710	T	0.47	.	15.6747	0.77307	0.0:0.0:0.0:1.0	.	45	Q8WUJ0	STYX_HUMAN	K	45	ENSP00000403214:M45K;ENSP00000346599:M45K	ENSP00000346599:M45K	M	+	2	0	STYX	52282937	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.801000	0.75170	2.166000	0.68216	0.533000	0.62120	ATG		0.289	STYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276902.1		NM_145251	
TPTE2P2	644623	broad.mit.edu	37	13	52803480	52803480	+	RNA	SNP	G	G	T	rs376784705		TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr13:52803480G>T	ENST00000451298.1	-	0	1024				TPTE2P2_ENST00000606973.1_RNA														p.F117L(1)									AATAAATAACGAATCTTTTTA	0.363																																																	1	Substitution - Missense(1)	kidney(1)																																										374500																															13.37:g.52803480G>T				RNA	SNP	ENST00000451298.1	37																																																																																					0.363	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000471093.1			
TP53I3	9540	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	24307098	24307100	+	Missense_Mutation	TNP	CTT	CTT	ACA			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C|T|T	C|T|T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:24307098_24307100CTT>ACA	ENST00000238721.4	-	1	951_953	c.97_99AAG>TGT	c.(97-99)AAG>TGT	p.K33C	FAM228B_ENST00000461972.1_Intron|TP53I3_ENST00000417886.1_5'UTR|TP53I3_ENST00000313482.4_Missense_Mutation_p.K33C|TP53I3_ENST00000407482.1_Missense_Mutation_p.K33C|TP53I3_ENST00000335934.4_Missense_Mutation_p.K33C	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	33					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.K33N(1)|p.K33R(1)|p.K33*(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCCGCCACCTTCAGGAGGACT	0.655											OREG0014492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					3	Substitution - Missense(2)|Substitution - Nonsense(1)	kidney(3)																																								SO:0001583	missense	9540			AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.97_99AAG>TGT	2.37:g.24307098CTT>ACA	ENSP00000238721:p.Lys33Cys	770	D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation|Missense_Mutation|Nonsense_Mutation	SNP	ENST00000238721.4	37	CCDS1708.1																																																																																				0.655	TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207618.2		NM_004881	
TRPM6	140803	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	77416960	77416960	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr9:77416960C>A	ENST00000360774.1	-	16	2100	c.1863G>T	c.(1861-1863)caG>caT	p.Q621H	TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.Q621H|TRPM6_ENST00000376872.3_Intron|RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000361255.3_Missense_Mutation_p.Q616H|TRPM6_ENST00000449912.2_Missense_Mutation_p.Q616H|TRPM6_ENST00000451710.3_Missense_Mutation_p.Q621H	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	621					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q621H(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TAGCCATCTTCTGCCTTTTCA	0.483																																																	1	Substitution - Missense(1)	kidney(1)											132.0	104.0	114.0					9																	77416960		2203	4300	6503	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1863G>T	9.37:g.77416960C>A	ENSP00000354006:p.Gln621His		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301313	0.81136	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.28	4.36	0.52297	.	0.050878	0.85682	N	0.000000	T	0.77471	0.4135	M	0.69463	2.115	0.53005	D	0.999961	D;D	0.89917	1.0;0.982	D;P	0.85130	0.997;0.885	T	0.80516	-0.1348	10	0.87932	D	0	.	15.7827	0.78272	0.0:0.8634:0.1366:0.0	.	621;616	Q9BX84;Q9BX84-3	TRPM6_HUMAN;.	H	621;621;616;616;621;284;284	ENSP00000354006:Q621H;ENSP00000407341:Q621H;ENSP00000396672:Q616H;ENSP00000354962:Q616H;ENSP00000366060:Q621H	ENSP00000309693:Q284H	Q	-	3	2	TRPM6	76606780	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.258000	0.51507	1.178000	0.42870	0.585000	0.79938	CAG		0.483	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1		NM_017662	
TTC30B	150737	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	178415573	178415573	+	Missense_Mutation	SNP	T	T	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:178415573T>C	ENST00000408939.3	-	1	2169	c.1919A>G	c.(1918-1920)cAt>cGt	p.H640R		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	640					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)		p.H640R(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			CTTTCCAACATGCATTCTTTC	0.358																																																	1	Substitution - Missense(1)	kidney(1)											146.0	150.0	148.0					2																	178415573		2201	4298	6499	SO:0001583	missense	150737			AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.1919A>G	2.37:g.178415573T>C	ENSP00000386181:p.His640Arg		Q63HQ1|Q96NE6	Missense_Mutation	SNP	ENST00000408939.3	37	CCDS42784.1	.	.	.	.	.	.	.	.	.	.	T	5.761	0.324738	0.10900	.	.	ENSG00000196659	ENST00000500357;ENST00000408939	T	0.16897	2.31	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	M	0.63428	1.95	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.05037	-1.0910	10	0.15952	T	0.53	.	15.0563	0.71915	0.0:0.0:0.0:1.0	.	640	Q8N4P2	TT30B_HUMAN	R	593;640	ENSP00000386181:H640R	ENSP00000386181:H640R	H	-	2	0	TTC30B	178123819	1.000000	0.71417	0.925000	0.36789	0.210000	0.24377	6.885000	0.75606	2.192000	0.70111	0.533000	0.62120	CAT		0.358	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334193.2		NM_152517	
TUBGCP5	114791	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	22846911	22846911	+	Missense_Mutation	SNP	G	G	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:22846911G>C	ENST00000283645.4	+	8	916	c.786G>C	c.(784-786)agG>agC	p.R262S	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R262S	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	262					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.R262S(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CAGATGACAGGGTTTTGGTTA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											145.0	125.0	132.0					15																	22846911		2203	4300	6503	SO:0001583	missense	114791			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.786G>C	15.37:g.22846911G>C	ENSP00000283645:p.Arg262Ser		E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	ENST00000283645.4	37	CCDS10008.1	.	.	.	.	.	.	.	.	.	.	.	11.75	1.731425	0.30684	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.23754	1.89;1.89	4.93	-6.3	0.02007	.	0.108809	0.64402	N	0.000009	T	0.09992	0.0245	L	0.27053	0.805	0.23361	N	0.997836	B;B	0.33583	0.418;0.418	B;B	0.21151	0.033;0.033	T	0.32508	-0.9904	10	0.14656	T	0.56	-14.6251	10.5009	0.44804	0.5496:0.087:0.3634:0.0	.	262;262	Q96RT8;E9PB12	GCP5_HUMAN;.	S	262	ENSP00000283645:R262S;ENSP00000409217:R262S	ENSP00000283645:R262S	R	+	3	2	TUBGCP5	20398352	0.994000	0.37717	0.052000	0.19188	0.967000	0.64934	0.506000	0.22658	-1.218000	0.02601	-0.880000	0.02959	AGG		0.353	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2		NM_052903	
TXNDC5	81567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	7904955	7904955	+	Splice_Site	SNP	A	A	G			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr6:7904955A>G	ENST00000379757.4	-	2	302	c.265T>C	c.(265-267)Tgt>Cgt	p.C89R	TXNDC5_ENST00000539054.1_Splice_Site_p.C17R|TXNDC5_ENST00000473453.1_5'UTR|BLOC1S5-TXNDC5_ENST00000439343.2_Splice_Site_p.V125A	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	89	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)	p.C89R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					CAGTGTCCACACCTGGAACAA	0.542																																					Ovarian(119;1430 1625 3928 26125 34589)												1	Substitution - Missense(1)	kidney(1)											101.0	81.0	88.0					6																	7904955		2203	4300	6503	SO:0001630	splice_region_variant	81567			AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.264-1T>C	6.37:g.7904955A>G			B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Missense_Mutation	SNP	ENST00000379757.4	37	CCDS4505.1	.	.	.	.	.	.	.	.	.	.	.	19.57	3.852139	0.71719	.	.	ENSG00000239264	ENST00000539054;ENST00000379757	T;T	0.35236	1.32;1.32	5.11	5.11	0.69529	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);	0.046236	0.85682	D	0.000000	T	0.69967	0.3170	H	0.99058	4.415	0.80722	D	1	D;D	0.71674	0.998;0.987	D;D	0.72075	0.976;0.924	T	0.83277	-0.0040	10	0.87932	D	0	.	13.8867	0.63712	1.0:0.0:0.0:0.0	.	17;89	Q86UY0;Q8NBS9	.;TXND5_HUMAN	R	17;89	ENSP00000442453:C17R;ENSP00000369081:C89R	ENSP00000442453:C17R	C	-	1	0	TXNDC5	7849954	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	8.434000	0.90294	1.907000	0.55213	0.416000	0.27883	TGT		0.542	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1		NM_030810	Missense_Mutation
GOLGA6L3	100133220	broad.mit.edu	37	15	85787980	85787980	+	IGR	SNP	T	T	G	rs201352385	byFrequency	TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:85787980T>G								RP11-561C5.4 (9964 upstream) : RP11-561C5.5 (81644 downstream)																							TACGTGAACATGAGGAGAGGC	0.562													g|||	1285	0.256589	0.4501	0.1744	5008	,	,		13696	0.248		0.1143	False		,,,				2504	0.2086																0																																										SO:0001628	intergenic_variant	0																															15.37:g.85787980T>G				Missense_Mutation	SNP		37																																																																																				0	0.562									
DNM1P47	100216544	broad.mit.edu	37	15	102292820	102292820	+	RNA	SNP	G	G	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr15:102292820G>C	ENST00000561463.1	+	0	866									DNM1 pseudogene 47									p.T136T(2)									GCGTGGGAACGAGAAGACACT	0.592																																																	2	Substitution - coding silent(2)	kidney(2)																																										0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102292820G>C				Silent	SNP	ENST00000561463.1	37																																																																																					0.592	DNM1P47-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417589.1		NG_009149	
MIR4477B	100616194	broad.mit.edu	37	9	68413570	68413570	+	RNA	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr9:68413570G>A	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		CCCCAGTGGCGCCGGATCTAG	0.602																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68413570G>A				RNA	SNP	ENST00000581659.1	37																																																																																					0.602	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
Unknown	0	broad.mit.edu	37	9	70182344	70182346	+	IGR	DEL	TTG	TTG	-	rs202095854|rs201125425|rs200827494	byFrequency	TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr9:70182344_70182346delTTG								FOXD4L5 (3529 upstream) : FOXD4L4 (244276 downstream)																							TTTCTGTGTATTGTTTTTTTTTT	0.236																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.70182344_70182346delTTG				RNA	DEL		37																																																																																				0	0.236									
USP35	57558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	77919916	77919916	+	Missense_Mutation	SNP	C	C	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr11:77919916C>A	ENST00000529308.1	+	9	1760	c.1499C>A	c.(1498-1500)tCc>tAc	p.S500Y	USP35_ENST00000530535.1_Intron|USP35_ENST00000441408.2_Missense_Mutation_p.S86Y|USP35_ENST00000530267.1_Missense_Mutation_p.S68Y|USP35_ENST00000526425.1_Missense_Mutation_p.S231Y	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	500	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.S256Y(1)|p.S500Y(1)		endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCTGCCATTTCCCCAGAGAAC	0.612																																																	2	Substitution - Missense(2)	kidney(2)											98.0	103.0	102.0					11																	77919916		2092	4208	6300	SO:0001583	missense	57558			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1499C>A	11.37:g.77919916C>A	ENSP00000431876:p.Ser500Tyr			Missense_Mutation	SNP	ENST00000529308.1	37	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861779	0.51482	.	.	ENSG00000118369	ENST00000530267;ENST00000528910;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37	4.5	4.5	0.54988	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.49305	D	0.000148	T	0.65238	0.2672	M	0.87971	2.92	0.41099	D	0.985657	D;D	0.71674	0.998;0.998	D;D	0.70016	0.967;0.967	T	0.73953	-0.3820	10	0.72032	D	0.01	-18.0586	17.3818	0.87407	0.0:1.0:0.0:0.0	.	500;86	Q9P2H5;E7EWV7	UBP35_HUMAN;.	Y	68;256;500;86;231	ENSP00000435468:S68Y;ENSP00000436001:S256Y;ENSP00000431876:S500Y;ENSP00000400825:S86Y;ENSP00000434942:S231Y	ENSP00000400825:S86Y	S	+	2	0	USP35	77597564	1.000000	0.71417	0.999000	0.59377	0.881000	0.50899	5.499000	0.66937	2.343000	0.79666	0.585000	0.79938	TCC		0.612	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1		XM_290527	
VPS54	51542	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	64161068	64161068	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr2:64161068G>A	ENST00000272322.4	-	12	1632	c.1478C>T	c.(1477-1479)tCa>tTa	p.S493L	VPS54_ENST00000354504.3_Missense_Mutation_p.S340L|VPS54_ENST00000409558.4_Missense_Mutation_p.S481L			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	493					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)		p.S493L(1)		endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						CTTCTGTTGTGAAATCTCTTC	0.383																																																	1	Substitution - Missense(1)	kidney(1)											150.0	122.0	132.0					2																	64161068		2203	4300	6503	SO:0001583	missense	51542			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.1478C>T	2.37:g.64161068G>A	ENSP00000272322:p.Ser493Leu		Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	ENST00000272322.4	37	CCDS33208.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578695	0.46006	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.33438	1.47;1.41;1.41	5.31	4.44	0.53790	.	0.852012	0.10676	N	0.646974	T	0.22244	0.0536	N	0.22421	0.69	0.29416	N	0.860904	B;B;B	0.22211	0.0;0.039;0.066	B;B;B	0.21708	0.001;0.016;0.036	T	0.16867	-1.0388	10	0.25106	T	0.35	.	11.1232	0.48302	0.1617:0.0:0.8383:0.0	.	340;493;481	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	L	340;493;481;481;493	ENSP00000346499:S340L;ENSP00000272322:S493L;ENSP00000386980:S481L	ENSP00000272322:S493L	S	-	2	0	VPS54	64014572	1.000000	0.71417	0.995000	0.50966	0.946000	0.59487	3.783000	0.55409	1.375000	0.46248	0.563000	0.77884	TCA		0.383	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2		NM_016516	
VWF	7450	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	6204730	6204730	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr12:6204730A>T	ENST00000261405.5	-	6	807	c.553T>A	c.(553-555)Tat>Aat	p.Y185N	VWF_ENST00000572068.1_Missense_Mutation_p.Y222N|RN7SL69P_ENST00000468423.2_RNA	NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	185	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.Y185N(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GCAAAGTCATAAGGGTCCGAG	0.512																																																	1	Substitution - Missense(1)	kidney(1)											125.0	114.0	118.0					12																	6204730		2203	4300	6503	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.553T>A	12.37:g.6204730A>T	ENSP00000261405:p.Tyr185Asn		Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	A	13.08	2.128996	0.37533	.	.	ENSG00000110799	ENST00000261405	T	0.35421	1.31	4.85	4.85	0.62838	von Willebrand factor, type D domain (1);	0.000000	0.36034	N	0.002826	T	0.52354	0.1729	L	0.51914	1.62	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.998;0.99;0.99	T	0.53143	-0.8480	10	0.56958	D	0.05	.	12.1053	0.53810	1.0:0.0:0.0:0.0	.	185;222;185	B4DNX0;Q8TCE8;P04275	.;.;VWF_HUMAN	N	185	ENSP00000261405:Y185N	ENSP00000261405:Y185N	Y	-	1	0	VWF	6074991	1.000000	0.71417	0.965000	0.40720	0.230000	0.25150	4.825000	0.62708	1.948000	0.56530	0.379000	0.24179	TAT		0.512	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1		NM_000552	
ZBTB38	253461	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	141161785	141161785	+	Missense_Mutation	SNP	G	G	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr3:141161785G>T	ENST00000514251.1	+	4	834	c.555G>T	c.(553-555)ttG>ttT	p.L185F	ZBTB38_ENST00000441582.2_Missense_Mutation_p.L185F|ZBTB38_ENST00000321464.5_Missense_Mutation_p.L186F					zinc finger and BTB domain containing 38									p.L185F(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CGCTGGACTTGAGGGCAAGTT	0.498																																																	1	Substitution - Missense(1)	kidney(1)											90.0	85.0	86.0					3																	141161785		1967	4150	6117	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.555G>T	3.37:g.141161785G>T	ENSP00000426387:p.Leu185Phe			Missense_Mutation	SNP	ENST00000514251.1	37	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932572	0.52866	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464;ENST00000510726	T;T;T;T;T	0.80304	3.2;2.78;2.78;2.78;-1.36	5.42	3.57	0.40892	.	0.176412	0.37437	N	0.002084	T	0.75034	0.3795	L	0.32530	0.975	0.38394	D	0.945497	D;D	0.53312	0.959;0.959	P;P	0.49085	0.6;0.6	T	0.74884	-0.3512	9	.	.	.	-13.6018	11.1471	0.48436	0.0688:0.2412:0.69:0.0	.	186;185	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	F	185;185;185;186;185	ENSP00000424254:L185F;ENSP00000426387:L185F;ENSP00000406955:L185F;ENSP00000372635:L186F;ENSP00000422081:L185F	.	L	+	3	2	ZBTB38	142644475	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.083000	0.41615	1.389000	0.46526	0.591000	0.81541	TTG		0.498	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2			
ZDHHC9	51114	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	128975882	128975882	+	Missense_Mutation	SNP	A	A	T			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chrX:128975882A>T	ENST00000357166.6	-	3	431	c.40T>A	c.(40-42)Tgg>Agg	p.W14R	ZDHHC9_ENST00000371064.3_Missense_Mutation_p.W14R	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	14					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)	p.W14R(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						AGTTTCTCCCATTTCCGTGTC	0.502																																																	1	Substitution - Missense(1)	kidney(1)											189.0	149.0	163.0					X																	128975882		2203	4300	6503	SO:0001583	missense	51114			AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.40T>A	X.37:g.128975882A>T	ENSP00000349689:p.Trp14Arg		B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	CCDS35395.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.473230	0.84640	.	.	ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492	T;T;T	0.65549	0.96;0.96;-0.16	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.78470	0.4288	M	0.79475	2.455	0.80722	D	1	D	0.62365	0.991	D	0.65987	0.94	T	0.81575	-0.0870	10	0.87932	D	0	-8.905	14.7898	0.69830	1.0:0.0:0.0:0.0	.	14	Q9Y397	ZDHC9_HUMAN	R	14	ENSP00000349689:W14R;ENSP00000360103:W14R;ENSP00000383991:W14R	ENSP00000349689:W14R	W	-	1	0	ZDHHC9	128803563	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	9.248000	0.95456	1.954000	0.56735	0.486000	0.48141	TGG		0.502	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1		NM_016032	
ZNF646	9726	broad.mit.edu;hgsc.bcm.edu	37	16	31089296	31089296	+	Missense_Mutation	SNP	G	G	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr16:31089296G>A	ENST00000394979.2	+	1	2074	c.1651G>A	c.(1651-1653)Gat>Aat	p.D551N	ZNF646_ENST00000300850.5_Missense_Mutation_p.D551N			O15015	ZN646_HUMAN	zinc finger protein 646	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D551N(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCCGCACACAGATCAGGACCA	0.597																																																	1	Substitution - Missense(1)	kidney(1)											49.0	50.0	50.0					16																	31089296		2197	4300	6497	SO:0001583	missense	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1651G>A	16.37:g.31089296G>A	ENSP00000378429:p.Asp551Asn		Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	G	14.25	2.478060	0.44044	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.09073	3.02;3.04	5.01	5.01	0.66863	.	.	.	.	.	T	0.15912	0.0383	L	0.29908	0.895	0.45621	D	0.998553	D	0.63046	0.992	P	0.59357	0.856	T	0.02358	-1.1171	9	0.34782	T	0.22	-7.6517	17.2369	0.87001	0.0:0.0:1.0:0.0	.	551	O15015-2	.	N	551	ENSP00000300850:D551N;ENSP00000378429:D551N	ENSP00000300850:D551N	D	+	1	0	ZNF646	30996797	0.002000	0.14202	0.362000	0.25862	0.728000	0.41692	0.727000	0.25999	2.616000	0.88540	0.655000	0.94253	GAT		0.597	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2		NM_014699	
MACROD2	140733	ucsc.edu	37	20	15948281	15948281	+	Intron	SNP	T	T	C			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	.	WXS	PGM	.		Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr20:15948281T>C	ENST00000310348.4	+	13	985				MACROD2_ENST00000378058.3_Intron|MACROD2_ENST00000402914.1_Intron|MACROD2_ENST00000217246.4_Intron			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CGATGGTAGGTTGTGAAATCC	0.333																																						.											0													111.0	111.0	111.0					20																	15948281		2203	4300	6503	SO:0001627	intron_variant	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.985+6T>C	20.37:g.15948281T>C			A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Intron	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																				0.333	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding			NM_080676	
ZNFX1	57169	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	47887117	47887117	+	Missense_Mutation	SNP	T	T	A			TCGA-CJ-4902-01A-01D-1429-08	TCGA-CJ-4902-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3ef9ea62-85c4-4261-af23-ecb86f192cdf	fc22c32f-f803-4803-b98d-bc1a2e693144	g.chr20:47887117T>A	ENST00000396105.1	-	3	1478	c.1232A>T	c.(1231-1233)tAc>tTc	p.Y411F	ZNFX1_ENST00000371752.1_Missense_Mutation_p.Y411F|ZNFX1_ENST00000371754.4_Missense_Mutation_p.Y411F	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	411							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.Y411F(2)|p.Y215F(1)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGTGTCAAAGTAGATTCGGAT	0.443																																																	3	Substitution - Missense(3)	kidney(3)											161.0	157.0	158.0					20																	47887117		2203	4300	6503	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1232A>T	20.37:g.47887117T>A	ENSP00000379412:p.Tyr411Phe		Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	T	19.72	3.879549	0.72294	.	.	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;D	0.89875	-2.41;-2.58;-2.58;-1.4;-2.04	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.94739	0.8302	M	0.85777	2.775	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.94777	0.7950	10	0.49607	T	0.09	-21.8294	15.0595	0.71942	0.0:0.0:0.0:1.0	.	411	Q9P2E3	ZNFX1_HUMAN	F	411;411;411;411;411;215	ENSP00000360819:Y411F;ENSP00000360817:Y411F;ENSP00000379412:Y411F;ENSP00000360809:Y411F;ENSP00000413800:Y215F	ENSP00000360809:Y411F	Y	-	2	0	ZNFX1	47320524	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.936000	0.87665	2.238000	0.73509	0.533000	0.62120	TAC		0.443	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2		NM_021035	
