#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	hgsc.bcm.edu	37	12	9016563	9016564	+	Frame_Shift_Del	DEL	GC	GC	-	rs144686314		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:9016563_9016564delGC	ENST00000299698.7	+	29	3856_3857	c.3676_3677delGC	c.(3676-3678)gccfs	p.A1226fs	A2ML1_ENST00000539547.1_Frame_Shift_Del_p.A735fs	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GGCTTGGTTGGCCAAGCAACAC	0.485														135	0.0269569	0.0023	0.0432	5008	,	,		15031	0.002		0.0447	False		,,,				2504	0.0562																0										39,3661		1,37,1812						1.6	0.3		dbSNP_134	52	418,7468		17,384,3542	no	frameshift	A2ML1	NM_144670.3		18,421,5354	A1A1,A1R,RR		5.3005,1.0541,3.9444				457,11129				SO:0001589	frameshift_variant	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.3676_3677delGC	12.37:g.9016563_9016564delGC	ENSP00000299698:p.Ala1226fs			Frame_Shift_Del	DEL	ENST00000299698.7	37	CCDS8596.2																																																																																				0.485	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3		NM_144670	
ALK	238	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	29462601	29462601	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:29462601delT	ENST00000389048.3	-	13	3206	c.2300delA	c.(2299-2301)aagfs	p.K767fs	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	767					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CATGTCATCCTTCTCCAGGTT	0.612			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													109.0	90.0	96.0					2																	29462601		2203	4300	6503	SO:0001589	frameshift_variant	238	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2300delA	2.37:g.29462601delT	ENSP00000373700:p.Lys767fs		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Frame_Shift_Del	DEL	ENST00000389048.3	37	CCDS33172.1																																																																																				0.612	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1		NM_004304	
APLF	200558	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	68740264	68740264	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:68740264C>A	ENST00000303795.4	+	4	565	c.394C>A	c.(394-396)Ccc>Acc	p.P132T		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	132					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.P132T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						ACCAAAATCCCCCGTGATTAA	0.368																																																	1	Substitution - Missense(1)	kidney(1)											66.0	69.0	68.0					2																	68740264		2203	4299	6502	SO:0001583	missense	200558			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.394C>A	2.37:g.68740264C>A	ENSP00000307004:p.Pro132Thr		A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	c	12.81	2.048999	0.36181	.	.	ENSG00000169621	ENST00000303795	T	0.24151	1.87	5.82	4.88	0.63580	.	0.739562	0.13506	N	0.382833	T	0.27313	0.0670	L	0.59436	1.845	0.09310	N	1	P;P	0.47302	0.893;0.666	P;B	0.47981	0.563;0.252	T	0.09773	-1.0659	10	0.10902	T	0.67	.	5.212	0.15322	0.0:0.8069:0.0:0.1931	.	132;132	F8WET0;Q8IW19	.;APLF_HUMAN	T	132	ENSP00000307004:P132T	ENSP00000307004:P132T	P	+	1	0	APLF	68593768	0.001000	0.12720	0.005000	0.12908	0.900000	0.52787	0.760000	0.26475	1.295000	0.44724	0.508000	0.49915	CCC		0.368	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1		NM_173545	
ANKRD36	375248	hgsc.bcm.edu	37	2	97817647	97817647	+	Missense_Mutation	SNP	A	A	G	rs79579412		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:97817647A>G	ENST00000461153.2	+	13	1377	c.1133A>G	c.(1132-1134)aAg>aGg	p.K378R	ANKRD36_ENST00000420699.2_Missense_Mutation_p.K378R			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	378										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						CCAAAGAGAAAGATTATTTCT	0.284																																																	0													126.0	101.0	108.0					2																	97817647		692	1591	2283	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.1133A>G	2.37:g.97817647A>G	ENSP00000419530:p.Lys378Arg		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	6.714	0.500361	0.12762	.	.	ENSG00000135976	ENST00000461153;ENST00000420699	T;T	0.19532	2.14;2.14	1.3	-2.61	0.06171	.	.	.	.	.	T	0.08179	0.0204	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.26326	-1.0106	8	0.36615	T	0.2	.	2.9988	0.06007	0.2324:0.0:0.4341:0.3334	.	378	A6QL64	AN36A_HUMAN	R	378	ENSP00000419530:K378R;ENSP00000391950:K378R	ENSP00000391950:K378R	K	+	2	0	ANKRD36	97181374	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.598000	0.05706	-1.256000	0.02478	-1.194000	0.01681	AAG		0.284	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5			
ARHGAP39	80728	broad.mit.edu;hgsc.bcm.edu	37	8	145759519	145759519	+	Silent	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr8:145759519G>A	ENST00000276826.5	-	6	2790	c.2589C>T	c.(2587-2589)gcC>gcT	p.A863A	ARHGAP39_ENST00000540274.1_Silent_p.A863A|ARHGAP39_ENST00000377307.2_Silent_p.A894A			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	863	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.A894A(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GTACCTTCTTGGCCCCGGTCA	0.637																																																	1	Substitution - coding silent(1)	kidney(1)											80.0	79.0	79.0					8																	145759519		2203	4300	6503	SO:0001819	synonymous_variant	80728				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2589C>T	8.37:g.145759519G>A			B4E1I1	Silent	SNP	ENST00000276826.5	37																																																																																					0.637	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1			
ARMCX3	51566	broad.mit.edu;hgsc.bcm.edu	37	X	100880895	100880895	+	Missense_Mutation	SNP	T	T	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chrX:100880895T>A	ENST00000341189.4	+	5	1792	c.926T>A	c.(925-927)tTt>tAt	p.F309Y	ARMCX3_ENST00000471229.2_Missense_Mutation_p.F309Y|ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000537169.1_Missense_Mutation_p.F309Y|RP4-545K15.5_ENST00000564612.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	309					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)		p.F309Y(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						CTGGTCATATTTGAGAACATA	0.353																																																	1	Substitution - Missense(1)	kidney(1)											41.0	42.0	42.0					X																	100880895		2198	4290	6488	SO:0001583	missense	51566			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.926T>A	X.37:g.100880895T>A	ENSP00000340672:p.Phe309Tyr		Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	37	CCDS14489.1	.	.	.	.	.	.	.	.	.	.	T	15.73	2.918895	0.52546	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.53206	0.63;0.63	4.43	4.43	0.53597	Armadillo-like helical (1);Armadillo-type fold (1);	0.276789	0.39274	N	0.001401	T	0.64125	0.2570	M	0.73962	2.25	0.25993	N	0.982229	D	0.76494	0.999	D	0.72982	0.979	T	0.57207	-0.7851	9	.	.	.	-10.5591	9.0529	0.36387	0.0:0.0:0.0:1.0	.	309	Q9UH62	ARMX3_HUMAN	Y	309	ENSP00000340672:F309Y;ENSP00000439032:F309Y	.	F	+	2	0	ARMCX3	100767551	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	2.479000	0.45197	1.960000	0.56953	0.486000	0.48141	TTT		0.353	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2		NM_016607	
ATR	545	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	142281209	142281209	+	Silent	SNP	A	A	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:142281209A>T	ENST00000350721.4	-	4	1156	c.1035T>A	c.(1033-1035)gcT>gcA	p.A345A	ATR_ENST00000383101.3_Silent_p.A345A	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	345					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A345A(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AATGGCACAAAGCTGCTTTTA	0.388								Other conserved DNA damage response genes																																									1	Substitution - coding silent(1)	kidney(1)											72.0	72.0	72.0					3																	142281209		2203	4300	6503	SO:0001819	synonymous_variant	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1035T>A	3.37:g.142281209A>T			Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																				0.388	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2		NM_001184	
BDP1	55814	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	70835434	70835434	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr5:70835434G>A	ENST00000358731.4	+	28	6243	c.5980G>A	c.(5980-5982)Gat>Aat	p.D1994N	BDP1_ENST00000380675.2_Missense_Mutation_p.D131N	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	1994					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D1994N(1)		NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TACAATGGGAGATCTAGTATT	0.343																																																	1	Substitution - Missense(1)	kidney(1)											83.0	80.0	81.0					5																	70835434		1864	4105	5969	SO:0001583	missense	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.5980G>A	5.37:g.70835434G>A	ENSP00000351575:p.Asp1994Asn		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	37	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603123	0.66445	.	.	ENSG00000145734	ENST00000358731;ENST00000380675;ENST00000545546	T;T	0.20598	2.06;2.06	5.29	4.39	0.52855	.	0.215408	0.32918	N	0.005489	T	0.32585	0.0834	M	0.62723	1.935	0.09310	N	0.999998	D;P	0.67145	0.996;0.877	P;B	0.52957	0.714;0.419	T	0.12993	-1.0526	10	0.62326	D	0.03	.	12.0767	0.53647	0.0:0.1718:0.8281:0.0	.	1994;1994	A6H8Y1;A6H8Y1-2	BDP1_HUMAN;.	N	1994;131;131	ENSP00000351575:D1994N;ENSP00000370050:D131N	ENSP00000351575:D1994N	D	+	1	0	BDP1	70871190	1.000000	0.71417	0.857000	0.33713	0.994000	0.84299	2.517000	0.45529	2.481000	0.83766	0.655000	0.94253	GAT		0.343	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2		NM_018429	
BLVRA	644	hgsc.bcm.edu;ucsc.edu	37	7	43827571	43827572	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr7:43827571_43827572delGC	ENST00000402924.1	+	4	244_245	c.81_82delGC	c.(79-84)ttgcggfs	p.R28fs	BLVRA_ENST00000265523.4_Frame_Shift_Del_p.R28fs	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	28					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						TGAGGGACTTGCGGAATCCACA	0.554																																																	0																																										SO:0001589	frameshift_variant	644			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.81_82delGC	7.37:g.43827571_43827572delGC	ENSP00000385757:p.Arg28fs		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Frame_Shift_Del	DEL	ENST00000402924.1	37	CCDS5472.1																																																																																				0.554	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339006.1		NM_000712	
BRWD1	54014	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	21	40568354	40568354	+	Intron	SNP	C	C	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr21:40568354C>A	ENST00000333229.2	-	41	6899				BRWD1_ENST00000380800.3_Intron|BRWD1_ENST00000342449.3_Missense_Mutation_p.S2214I	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1						cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S2214I(1)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATCATCCACACTTAACCTAGG	0.368																																					Melanoma(170;988 1986 4794 16843 39731)												1	Substitution - Missense(1)	kidney(1)											169.0	153.0	159.0					21																	40568354		2203	4300	6503	SO:0001627	intron_variant	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.6571+69G>T	21.37:g.40568354C>A			C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	C	9.753	1.167914	0.21621	.	.	ENSG00000185658	ENST00000342449	T	0.55588	0.51	5.53	-5.74	0.02391	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.09310	N	0.999996	B	0.32526	0.374	B	0.38616	0.277	T	0.45673	-0.9245	8	0.37606	T	0.19	.	11.1636	0.48531	0.0:0.5655:0.0959:0.3386	.	2214	Q9NSI6-2	.	I	2214	ENSP00000344333:S2214I	ENSP00000344333:S2214I	S	-	2	0	BRWD1	39490224	0.000000	0.05858	0.190000	0.23270	0.996000	0.88848	-0.837000	0.04377	-1.075000	0.03129	-0.136000	0.14681	AGT		0.368	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3		NM_033656	
SRP54-AS1	100506157	broad.mit.edu	37	14	35409214	35409214	+	RNA	SNP	T	T	C	rs1967723	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr14:35409214T>C	ENST00000556355.1	-	0	257				RP11-85K15.2_ENST00000555015.1_RNA																							CAACTTCTAATTCATCTCGCC	0.448													C|||	1527	0.304912	0.2837	0.2824	5008	,	,		21625	0.37		0.2704	False		,,,				2504	0.318																0																																												0																															14.37:g.35409214T>C				RNA	SNP	ENST00000556355.1	37																																																																																					0.448	RP11-85K15.2-004	KNOWN	basic	antisense	processed_transcript	OTTHUMT00000410682.2			
C20orf85	128602	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	56728656	56728656	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr20:56728656G>A	ENST00000371168.3	+	2	186	c.125G>A	c.(124-126)gGg>gAg	p.G42E		NM_178456.2	NP_848551.1	Q9H1P6	CT085_HUMAN	chromosome 20 open reading frame 85	42								p.G42E(1)		kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	13	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			CAGAACTGGGGGTTTTTAACA	0.423																																																	1	Substitution - Missense(1)	kidney(1)											70.0	75.0	73.0					20																	56728656		2203	4300	6503	SO:0001583	missense	128602			AL354776	CCDS13465.1	20q13.32	2012-10-29			ENSG00000124237	ENSG00000124237			16216	protein-coding gene	gene with protein product	"""Low in Lung Cancer 1"""						Standard	NM_178456		Approved	bA196N14.1, LLC1	uc002xyv.3	Q9H1P6	OTTHUMG00000032836	ENST00000371168.3:c.125G>A	20.37:g.56728656G>A	ENSP00000360210:p.Gly42Glu			Missense_Mutation	SNP	ENST00000371168.3	37	CCDS13465.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560392	0.86335	.	.	ENSG00000124237	ENST00000371168	T	0.34859	1.34	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.65302	0.2678	M	0.83483	2.645	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.68469	-0.5400	10	0.72032	D	0.01	-14.4909	17.8731	0.88816	0.0:0.0:1.0:0.0	.	42	Q9H1P6	CT085_HUMAN	E	42	ENSP00000360210:G42E	ENSP00000360210:G42E	G	+	2	0	C20orf85	56162062	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	5.456000	0.66665	2.760000	0.94817	0.655000	0.94253	GGG		0.423	C20orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079866.2		NM_178456	
CDC14A	8556	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	100961574	100961574	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:100961574G>C	ENST00000336454.3	+	13	1622	c.1267G>C	c.(1267-1269)Gga>Cga	p.G423R	CDC14A_ENST00000370125.2_3'UTR|CDC14A_ENST00000542213.1_Missense_Mutation_p.G365R|CDC14A_ENST00000361544.6_Missense_Mutation_p.G423R|CDC14A_ENST00000544534.1_Missense_Mutation_p.G423R	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	423					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G423R(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TGATACAAAAGGACATCCAAG	0.433																																																	1	Substitution - Missense(1)	kidney(1)											163.0	148.0	153.0					1																	100961574		2203	4300	6503	SO:0001583	missense	8556			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.1267G>C	1.37:g.100961574G>C	ENSP00000336739:p.Gly423Arg		A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	37	CCDS769.1	.	.	.	.	.	.	.	.	.	.	G	3.044	-0.196823	0.06259	.	.	ENSG00000079335	ENST00000542213;ENST00000361544;ENST00000336454;ENST00000544534	T;T;T;T	0.09538	2.97;2.97;3.16;2.98	5.05	1.97	0.26223	.	0.611281	0.16676	N	0.204155	T	0.01835	0.0058	L	0.28274	0.84	0.32717	N	0.510828	B;B;B;B	0.27229	0.065;0.172;0.101;0.162	B;B;B;B	0.29077	0.098;0.05;0.052;0.098	T	0.43605	-0.9381	10	0.16420	T	0.52	-5.6796	2.0978	0.03672	0.1855:0.3005:0.3872:0.1268	.	365;423;423;423	F5H7B3;A6MA65;Q9UNH5;Q9UNH5-2	.;.;CC14A_HUMAN;.	R	365;423;423;423	ENSP00000442640:G365R;ENSP00000354916:G423R;ENSP00000336739:G423R;ENSP00000442543:G423R	ENSP00000336739:G423R	G	+	1	0	CDC14A	100734162	0.997000	0.39634	0.904000	0.35570	0.019000	0.09904	0.790000	0.26900	1.239000	0.43787	0.655000	0.94253	GGA		0.433	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1		NM_033312	
CFHR1	3078	hgsc.bcm.edu	37	1	196797292	196797292	+	Missense_Mutation	SNP	G	G	C	rs388862		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:196797292G>C	ENST00000320493.5	+	4	611	c.523G>C	c.(523-525)Gaa>Caa	p.E175Q	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	175	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.		E -> Q (in dbSNP:rs388862). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:1711047, ECO:0000269|PubMed:1826708}.		complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						AGTACGTTATGAATGTAGGAG	0.403																																																	0													70.0	101.0	91.0					1																	196797292		1783	4089	5872	SO:0001583	missense	3078			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.523G>C	1.37:g.196797292G>C	ENSP00000314299:p.Glu175Gln		A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	ENST00000320493.5	37	CCDS1386.1	658	0.30128205128205127	144	0.2926829268292683	118	0.3259668508287293	181	0.31643356643356646	215	0.2836411609498681	.	5.396	0.258334	0.10239	.	.	ENSG00000244414	ENST00000320493	T	0.65364	-0.15	3.42	-3.67	0.04476	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.00012	0.0000	L	0.33189	0.99	0.80722	P	0.0	B	0.25235	0.121	B	0.25884	0.064	T	0.26849	-1.0091	8	0.12766	T	0.61	.	4.1668	0.10310	0.4179:0.3513:0.2309:0.0	rs388862;rs3174855;rs58276157	175	Q03591	FHR1_HUMAN	Q	175	ENSP00000314299:E175Q	ENSP00000314299:E175Q	E	+	1	0	CFHR1	195063915	0.916000	0.31088	0.005000	0.12908	0.001000	0.01503	0.066000	0.14489	-0.604000	0.05760	-1.536000	0.00914	GAA		0.403	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2		NM_002113	
CMYA5	202333	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	79031276	79031276	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr5:79031276G>C	ENST00000446378.2	+	2	6719	c.6688G>C	c.(6688-6690)Gct>Cct	p.A2230P		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2230					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.A2230P(2)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTTAATGTAGCTGAGAAACC	0.393																																																	2	Substitution - Missense(2)	kidney(2)											121.0	119.0	120.0					5																	79031276		1851	4094	5945	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6688G>C	5.37:g.79031276G>C	ENSP00000394770:p.Ala2230Pro		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	ENST00000446378.2	37	CCDS47238.1	.	.	.	.	.	.	.	.	.	.	G	5.682	0.310360	0.10733	.	.	ENSG00000164309	ENST00000446378	T	0.20069	2.1	5.9	-0.898	0.10550	.	0.794431	0.11313	N	0.576924	T	0.23330	0.0564	L	0.38175	1.15	0.09310	N	1	D	0.54397	0.966	P	0.50440	0.641	T	0.26292	-1.0107	10	0.66056	D	0.02	.	11.4446	0.50116	0.2772:0.0:0.7228:0.0	.	2230	Q8N3K9	CMYA5_HUMAN	P	2230	ENSP00000394770:A2230P	ENSP00000394770:A2230P	A	+	1	0	CMYA5	79067032	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.101000	0.10973	-0.110000	0.12022	-0.355000	0.07637	GCT		0.393	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1		NM_153610	
CRIP3	401262	hgsc.bcm.edu;ucsc.edu	37	6	43273854	43273855	+	Frame_Shift_Ins	INS	-	-	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:43273854_43273855insC	ENST00000274990.4	-	7	507_508	c.503_504insG	c.(502-504)ggafs	p.G168fs	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Frame_Shift_Ins_p.G168fs			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	168	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AGTAGGGGACTCCATCATGCTG	0.564																																																	0																																										SO:0001589	frameshift_variant	401262			AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.504dupG	6.37:g.43273856_43273856dupC	ENSP00000274990:p.Gly168fs		A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Frame_Shift_Ins	INS	ENST00000274990.4	37																																																																																					0.564	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1			
CUBN	8029	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	17110704	17110704	+	Silent	SNP	T	T	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr10:17110704T>G	ENST00000377833.4	-	20	2756	c.2691A>C	c.(2689-2691)tcA>tcC	p.S897S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	897	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.S897S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATGTTATAAATGAAGGTATGT	0.338																																																	1	Substitution - coding silent(1)	kidney(1)											121.0	127.0	125.0					10																	17110704		2203	4300	6503	SO:0001819	synonymous_variant	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2691A>C	10.37:g.17110704T>G			B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																				0.338	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1		NM_001081	
CYB5R3	1727	broad.mit.edu;hgsc.bcm.edu	37	22	43024289	43024289	+	Splice_Site	SNP	T	T	A	rs373889804		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr22:43024289T>A	ENST00000352397.5	-	5	586		c.e5-2		CYB5R3_ENST00000407623.3_Splice_Site|CYB5R3_ENST00000407332.1_Splice_Site|CYB5R3_ENST00000396303.3_Splice_Site|CYB5R3_ENST00000361740.4_Splice_Site|CYB5R3_ENST00000402438.1_Splice_Site	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3						blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)	p.?(2)		kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	GAAGTAAACCTGCAAGACACC	0.582																																																	2	Unknown(2)	kidney(2)	GRCh37	CS013087	CYB5R3	S							109.0	108.0	108.0					22																	43024289		2203	4300	6503	SO:0001630	splice_region_variant	1727			M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.334-2A>T	22.37:g.43024289T>A			B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Splice_Site	SNP	ENST00000352397.5	37	CCDS33658.1	.	.	.	.	.	.	.	.	.	.	T	19.24	3.790361	0.70337	.	.	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	.	.	.	3.56	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9571	0.52986	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYB5R3	41354233	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.462000	0.80851	1.866000	0.54105	0.454000	0.30748	.		0.582	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320439.1			Intron
DCLRE1A	9937	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	115609321	115609321	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr10:115609321C>T	ENST00000361384.2	-	2	2460	c.1543G>A	c.(1543-1545)Gtt>Att	p.V515I	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.V515I	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	515	Nuclear focus formation.				mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)		p.V515I(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		GCTTTACCAACTGGCACACCC	0.343								Other identified genes with known or suspected DNA repair function																																									1	Substitution - Missense(1)	kidney(1)											87.0	89.0	89.0					10																	115609321		2203	4300	6503	SO:0001583	missense	9937				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1543G>A	10.37:g.115609321C>T	ENSP00000355185:p.Val515Ile		D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970570	0.34754	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.63417	-0.04;-0.04	5.91	1.93	0.25924	.	1.574190	0.03039	N	0.153100	T	0.48429	0.1499	N	0.22421	0.69	0.09310	N	1	B	0.23490	0.086	B	0.23275	0.045	T	0.32268	-0.9913	10	0.37606	T	0.19	0.9567	5.2586	0.15561	0.1412:0.635:0.0:0.2238	.	515	Q6PJP8	DCR1A_HUMAN	I	515	ENSP00000355185:V515I;ENSP00000358311:V515I	ENSP00000355185:V515I	V	-	1	0	DCLRE1A	115599311	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.485000	0.06520	0.384000	0.24942	0.650000	0.86243	GTT		0.343	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1		NM_014881	
DEAF1	10522	broad.mit.edu;hgsc.bcm.edu	37	11	687971	687971	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:687971C>A	ENST00000382409.3	-	4	1088	c.604G>T	c.(604-606)Gag>Tag	p.E202*	DEAF1_ENST00000338675.6_Nonsense_Mutation_p.E202*	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	202	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.		E -> D (in a primary colorectal cancer). {ECO:0000269|PubMed:11705868}.|YDSE -> CDND (in a primary colorectal cancer).		anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E202*(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		ACGGGCAGCTCACTGTCGTAC	0.552																																																	1	Substitution - Nonsense(1)	kidney(1)											79.0	79.0	79.0					11																	687971		2203	4300	6503	SO:0001587	stop_gained	10522			AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.604G>T	11.37:g.687971C>A	ENSP00000371846:p.Glu202*		A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Nonsense_Mutation	SNP	ENST00000382409.3	37	CCDS31327.1	.	.	.	.	.	.	.	.	.	.	C	43	9.827621	0.99273	.	.	ENSG00000177030	ENST00000382409;ENST00000338675;ENST00000359958;ENST00000388804	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-37.0204	16.9509	0.86245	0.0:1.0:0.0:0.0	.	.	.	.	X	202;202;188;125	.	ENSP00000341902:E202X	E	-	1	0	DEAF1	677971	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	5.764000	0.68826	2.349000	0.79799	0.655000	0.94253	GAG		0.552	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383614.3		NM_021008	
DENND4A	10260	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	66044741	66044741	+	Silent	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr15:66044741G>A	ENST00000431932.2	-	4	745	c.537C>T	c.(535-537)gtC>gtT	p.V179V	DENND4A_ENST00000443035.3_Silent_p.V179V	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	179	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V179V(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GATTCTTGTCGACTTTGCAGA	0.363																																																	2	Substitution - coding silent(2)	kidney(2)											96.0	89.0	92.0					15																	66044741		1916	4128	6044	SO:0001819	synonymous_variant	10260			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.537C>T	15.37:g.66044741G>A			E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	37	CCDS45285.1																																																																																				0.363	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1		NM_005848	
DPCR1	135656	hgsc.bcm.edu	37	6	30918748	30918748	+	Missense_Mutation	SNP	A	A	C	rs538824498	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:30918748A>C	ENST00000462446.1	+	2	2535	c.2507A>C	c.(2506-2508)cAa>cCa	p.Q836P	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	280						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						AAGACCACACAATTCCCAGCA	0.478													-|||	25	0.00499201	0.0129	0.0029	5008	,	,		24278	0.001		0.0	False		,,,				2504	0.0051																0																																										SO:0001583	missense	135656			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.2507A>C	6.37:g.30918748A>C	ENSP00000417182:p.Gln836Pro		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	2.798	-0.249900	0.05867	.	.	ENSG00000168631	ENST00000462446	T	0.42513	0.97	1.15	0.181	0.15073	.	.	.	.	.	T	0.01976	0.0062	N	0.00237	-1.79	0.09310	N	0.999999	P	0.38148	0.62	B	0.25405	0.06	T	0.30238	-0.9985	9	0.16420	T	0.52	.	5.6695	0.17715	0.3503:0.0:0.6497:0.0	.	836	E9PEI6	.	P	836	ENSP00000417182:Q836P	ENSP00000417182:Q836P	Q	+	2	0	DPCR1	31026727	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.895000	0.00340	-0.310000	0.08766	0.000000	0.15137	CAA		0.478	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3		NM_080870	
DPF3	8110	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	73141008	73141008	+	Missense_Mutation	SNP	T	T	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr14:73141008T>C	ENST00000556509.1	-	8	810	c.811A>G	c.(811-813)Atg>Gtg	p.M271V	DPF3_ENST00000541685.1_Missense_Mutation_p.M271V|DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000546183.1_Missense_Mutation_p.M281V	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	271					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)	p.M270V(1)|p.M271V(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TTCTTGTTCATGTTGGAGCCC	0.547																																																	2	Substitution - Missense(2)	kidney(2)											56.0	63.0	61.0					14																	73141008		2058	4205	6263	SO:0001583	missense	8110			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.811A>G	14.37:g.73141008T>C	ENSP00000450518:p.Met271Val		A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	37		.	.	.	.	.	.	.	.	.	.	T	10.87	1.474095	0.26423	.	.	ENSG00000205683	ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.89746	-2.56;-0.03;-0.04	5.5	5.5	0.81552	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.	.	.	.	D	0.83266	0.5217	L	0.27053	0.805	0.32672	N	0.516669	B;B;B	0.19706	0.038;0.035;0.002	B;B;B	0.15870	0.014;0.01;0.005	T	0.82678	-0.0338	9	0.40728	T	0.16	.	15.7832	0.78281	0.0:0.0:0.0:1.0	.	281;271;271	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	V	271;270;271;281	ENSP00000450518:M271V;ENSP00000441640:M271V;ENSP00000444662:M281V	ENSP00000381791:M326V	M	-	1	0	DPF3	72210761	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	1.564000	0.36375	2.302000	0.77476	0.533000	0.62120	ATG		0.547	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2			
DTX1	1840	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	113531851	113531851	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:113531851C>G	ENST00000257600.3	+	5	1677	c.1174C>G	c.(1174-1176)Ccc>Gcc	p.P392A	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	392					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P392A(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						AGGTAAGAATCCCGAGGATGT	0.622																																																	1	Substitution - Missense(1)	kidney(1)											29.0	25.0	27.0					12																	113531851		2198	4293	6491	SO:0001583	missense	1840			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1174C>G	12.37:g.113531851C>G	ENSP00000257600:p.Pro392Ala		O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	37	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.389356	0.61956	.	.	ENSG00000135144	ENST00000257600	T	0.67865	-0.29	3.74	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.69931	0.3166	M	0.61703	1.905	0.58432	D	0.999997	P	0.36048	0.534	P	0.45377	0.478	T	0.68693	-0.5341	10	0.27785	T	0.31	-1.8241	15.1345	0.72552	0.0:1.0:0.0:0.0	.	392	Q86Y01	DTX1_HUMAN	A	392	ENSP00000257600:P392A	ENSP00000257600:P392A	P	+	1	0	DTX1	112016234	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.545000	0.82128	2.000000	0.58554	0.462000	0.41574	CCC		0.622	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2			
EBF3	253738	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	131638545	131638545	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr10:131638545G>A	ENST00000355311.5	-	15	1795	c.1723C>T	c.(1723-1725)Cct>Tct	p.P575S	EBF3_ENST00000368648.3_Missense_Mutation_p.P530S			Q9H4W6	COE3_HUMAN	early B-cell factor 3	575					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P575S(1)|p.P530S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GTGCAGGAAGGAGGAGGAGAG	0.642																																																	2	Substitution - Missense(2)	kidney(2)											36.0	34.0	35.0					10																	131638545		2197	4297	6494	SO:0001583	missense	253738				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.1723C>T	10.37:g.131638545G>A	ENSP00000347463:p.Pro575Ser		A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.52|17.52	3.411152|3.411152	0.62399|0.62399	.|.	.|.	ENSG00000108001|ENSG00000108001	ENST00000355311;ENST00000368648|ENST00000440978	T;T|.	0.57107|.	0.42;0.42|.	4.53|4.53	4.53|4.53	0.55603|0.55603	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79604|0.79604	0.4474|0.4474	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	B|.	0.17268|.	0.021|.	B|.	0.22880|.	0.042|.	T|T	0.82587|0.82587	-0.0383|-0.0383	10|5	0.48119|.	T|.	0.1|.	-5.3781|-5.3781	17.6452|17.6452	0.88146|0.88146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	530|.	Q9H4W6-2|.	.|.	S|F	575;530|136	ENSP00000347463:P575S;ENSP00000357637:P530S|.	ENSP00000347463:P575S|.	P|S	-|-	1|2	0|0	EBF3|EBF3	131528535|131528535	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.964000|0.964000	0.63967|0.63967	9.759000|9.759000	0.98931|0.98931	2.220000|2.220000	0.72140|0.72140	0.462000|0.462000	0.41574|0.41574	CCT|TCC		0.642	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2		NM_001005463	
EBLN2	55096	hgsc.bcm.edu	37	3	73111503	73111504	+	In_Frame_Ins	INS	-	-	TGG	rs143235716	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:73111503_73111504insTGG	ENST00000533473.1	+	1	694_695	c.271_272insTGG	c.(271-273)ttg>tTGGtg	p.91_92insV	PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000394284.3_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	91										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						ACTGGATGCATTGGAACCCCAA	0.49														125	0.0249601	0.0023	0.0231	5008	,	,		18981	0.0		0.0338	False		,,,				2504	0.0736																0									,	22,3698		1,20,1839					,	-0.9	0.0		dbSNP_134	37	274,7620		5,264,3678	no	intron,coding	EBLN2,PPP4R2	NM_174907.2,NM_018029.3	,	6,284,5517	A1A1,A1R,RR		3.471,0.5914,2.5486	,	,		296,11318				SO:0001652	inframe_insertion	55096				CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.272_274dupTGG	3.37:g.73111504_73111506dupTGG	ENSP00000432104:p.Leu91_Glu92insVal		Q8WWH3|Q9NW89	In_Frame_Ins	INS	ENST00000533473.1	37	CCDS54608.1																																																																																				0.490	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1		NM_018029	
F5	2153	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	169529926	169529926	+	Missense_Mutation	SNP	T	T	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:169529926T>A	ENST00000367797.3	-	4	653	c.452A>T	c.(451-453)gAa>gTa	p.E151V	F5_ENST00000546081.1_Missense_Mutation_p.E14V|F5_ENST00000367796.3_Missense_Mutation_p.E151V	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	151	F5/8 type A 1.|Plastocyanin-like 1.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.E151V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GATACTCCATTCATAGGTGTA	0.507																																																	1	Substitution - Missense(1)	kidney(1)											200.0	169.0	180.0					1																	169529926		2203	4300	6503	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.452A>T	1.37:g.169529926T>A	ENSP00000356771:p.Glu151Val		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	T	5.807	0.333197	0.11013	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.99032	-5.35;-5.35;-5.35	5.39	0.163	0.14986	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.996046	0.08151	N	0.990127	D	0.90293	0.6964	N	0.21545	0.675	0.28620	N	0.908239	B	0.14438	0.01	B	0.17433	0.018	T	0.82577	-0.0388	9	0.02654	T	1	-10.0363	5.797	0.18392	0.4232:0.0:0.3301:0.2467	.	151	P12259	FA5_HUMAN	V	151;151;14	ENSP00000356771:E151V;ENSP00000356770:E151V;ENSP00000439664:E14V	ENSP00000356770:E151V	E	-	2	0	F5	167796550	0.000000	0.05858	0.667000	0.29798	0.741000	0.42261	-0.030000	0.12308	0.300000	0.22699	0.477000	0.44152	GAA		0.507	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1		NM_000130	
FIG4	9896	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	110083350	110083350	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:110083350A>C	ENST00000230124.3	+	12	1452	c.1328A>C	c.(1327-1329)aAa>aCa	p.K443T	FIG4_ENST00000441478.2_Missense_Mutation_p.K166T	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	443	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)	p.K443T(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		GTGGTGAAGAAAACAGGTTTC	0.358																																																	1	Substitution - Missense(1)	kidney(1)											108.0	111.0	110.0					6																	110083350		2203	4299	6502	SO:0001583	missense	9896			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1328A>C	6.37:g.110083350A>C	ENSP00000230124:p.Lys443Thr		Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.775210	0.49786	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.52754	1.88;0.65	5.51	5.51	0.81932	Synaptojanin, N-terminal (1);	0.114914	0.56097	D	0.000030	T	0.37625	0.1010	L	0.41356	1.27	0.46798	D	0.999206	P;P	0.50272	0.933;0.856	P;B	0.51582	0.674;0.347	T	0.10660	-1.0620	10	0.23891	T	0.37	-25.8848	15.6402	0.76993	1.0:0.0:0.0:0.0	.	166;443	F5H8L9;Q92562	.;FIG4_HUMAN	T	166;443	ENSP00000399443:K166T;ENSP00000230124:K443T	ENSP00000230124:K443T	K	+	2	0	FIG4	110190043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.678000	0.74508	2.097000	0.63578	0.528000	0.53228	AAA		0.358	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1		NM_014845	
ANKRD36BP2	645784	broad.mit.edu	37	2	89100619	89100619	+	RNA	SNP	C	C	T	rs75347118		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:89100619C>T	ENST00000393525.3	+	0	1093									ankyrin repeat domain 36B pseudogene 2																		TCAACAGCAACTGGATGATGC	0.373																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89100619C>T				RNA	SNP	ENST00000393525.3	37																																																																																					0.373	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000323523.1			
FMNL2	114793	hgsc.bcm.edu	37	2	153476066	153476067	+	In_Frame_Ins	INS	-	-	CCA	rs35246864|rs5835439|rs3080632	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:153476066_153476067insCCA	ENST00000288670.9	+	15	2038_2039	c.1671_1672insCCA	c.(1672-1674)ccc>CCAccc	p.558_558P>PP	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	558	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CGCCGCCGCCGccccctcctcc	0.594														4998	0.998003	0.9932	1.0	5008	,	,		4428	1.0		1.0	False		,,,				2504	0.999																0																																										SO:0001652	inframe_insertion	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	Exception_encountered	2.37:g.153476066_153476067insCCA	ENSP00000288670:p.Pro573dup		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	In_Frame_Ins	INS	ENST00000288670.9	37	CCDS46429.1																																																																																				0.594	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2		NM_052905	
GOLGA6L3	100133220	broad.mit.edu	37	15	83014106	83014106	+	Silent	SNP	T	T	C	rs62009901		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr15:83014106T>C	ENST00000557886.1	-	6	576	c.477A>G	c.(475-477)gtA>gtG	p.V159V															p.V159V(12)		endometrium(6)|kidney(5)|prostate(1)	12						GTAGCTGCTCTACCTTAGATG	0.498																																																	12	Substitution - coding silent(12)	kidney(6)|endometrium(4)|prostate(2)																																								SO:0001819	synonymous_variant	647042																														ENST00000557886.1:c.477A>G	15.37:g.83014106T>C				Silent	SNP	ENST00000557886.1	37																																																																																					0.498	RP13-996F3.4-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419277.1			
GPRIN1	114787	hgsc.bcm.edu	37	5	176026122	176026122	+	Silent	SNP	C	C	T	rs142779818|rs550332435|rs3797464|rs371149640|rs386695335	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr5:176026122C>T	ENST00000303991.4	-	2	891	c.714G>A	c.(712-714)ttG>ttA	p.L238L		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	238				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCTTTCTCAAAGACCCAG	0.488																																																	0													90.0	94.0	93.0					5																	176026122		2171	4246	6417	SO:0001819	synonymous_variant	114787			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.714G>A	5.37:g.176026122C>T			C9JM70|Q8ND74|Q96PZ4	Silent	SNP	ENST00000303991.4	37	CCDS4405.1																																																																																				0.488	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1		NM_052899	
GTF2A1	2957	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	81682787	81682787	+	Silent	SNP	C	C	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr14:81682787C>T	ENST00000553612.1	-	2	505	c.102G>A	c.(100-102)gtG>gtA	p.V34V	GTF2A1_ENST00000434192.2_5'UTR	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	34					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.V34V(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		CTTGTTCATCCACTCCATCAT	0.323																																																	1	Substitution - coding silent(1)	kidney(1)											70.0	69.0	69.0					14																	81682787		2203	4300	6503	SO:0001819	synonymous_variant	2957			X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.102G>A	14.37:g.81682787C>T			Q3KNQ9	Silent	SNP	ENST00000553612.1	37	CCDS9873.1																																																																																				0.323	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1		NM_015859	
HIP1R	9026	broad.mit.edu	37	12	123345228	123345228	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:123345228A>G	ENST00000253083.4	+	28	2788	c.2663A>G	c.(2662-2664)gAg>gGg	p.E888G		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	888	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding.				receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)	p.E888G(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		ACCCGCAGGGAGGCAGCTGAC	0.662											OREG0022225	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	kidney(1)											53.0	53.0	53.0					12																	123345228		2203	4300	6503	SO:0001583	missense	9026			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2663A>G	12.37:g.123345228A>G	ENSP00000253083:p.Glu888Gly	1526	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	37	CCDS31922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.7|24.7	4.564392|4.564392	0.86335|0.86335	.|.	.|.	ENSG00000130787|ENSG00000130787	ENST00000253083|ENST00000535012	T|.	0.37235|.	1.21|.	5.31|5.31	5.31|5.31	0.75309|0.75309	I/LWEQ (4);|.	0.152411|.	0.56097|.	D|.	0.000021|.	T|T	0.76492|0.76492	0.3995|0.3995	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	D|.	0.53462|.	0.96|.	P|.	0.59703|.	0.862|.	T|T	0.78378|0.78378	-0.2227|-0.2227	10|5	0.72032|.	D|.	0.01|.	-41.0868|-41.0868	14.9361|14.9361	0.70957|0.70957	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	888|.	O75146|.	HIP1R_HUMAN|.	G|G	888|17	ENSP00000253083:E888G|.	ENSP00000253083:E888G|.	E|R	+|+	2|1	0|2	HIP1R|HIP1R	121911181|121911181	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.553000|0.553000	0.35397|0.35397	9.269000|9.269000	0.95684|0.95684	2.003000|2.003000	0.58678|0.58678	0.533000|0.533000	0.62120|0.62120	GAG|AGG		0.662	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1		NM_003959	
IGFN1	91156	hgsc.bcm.edu	37	1	201178849	201178849	+	Missense_Mutation	SNP	G	G	A	rs71524455		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:201178849G>A	ENST00000335211.4	+	12	4958	c.4828G>A	c.(4828-4830)Gag>Aag	p.E1610K	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGGGTTCCTGAGGGAATAGG	0.478																																																	0													43.0	38.0	39.0					1																	201178849		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.4828G>A	1.37:g.201178849G>A	ENSP00000334714:p.Glu1610Lys		F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	-	12.81	2.049452	0.36181	.	.	ENSG00000163395	ENST00000335211	D	0.87966	-2.32	1.72	-0.947	0.10382	.	.	.	.	.	T	0.68906	0.3052	N	0.08118	0	0.09310	N	0.999993	.	.	.	.	.	.	T	0.56733	-0.7930	6	.	.	.	.	5.0743	0.14622	0.72:0.0:0.28:0.0	rs12729404	.	.	.	K	1610	ENSP00000334714:E1610K	.	E	+	1	0	IGFN1	199445472	0.441000	0.25626	0.001000	0.08648	0.004000	0.04260	-0.017000	0.12590	-0.049000	0.13379	-1.024000	0.02432	GAG		0.478	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
IGFN1	91156	hgsc.bcm.edu	37	1	201179977	201179977	+	Missense_Mutation	SNP	G	G	A	rs202243048		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:201179977G>A	ENST00000335211.4	+	12	6086	c.5956G>A	c.(5956-5958)Ggt>Agt	p.G1986S	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGGTTTAGGGGGTTCTGAGGA	0.507																																																	0													47.0	41.0	43.0					1																	201179977		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.5956G>A	1.37:g.201179977G>A	ENSP00000334714:p.Gly1986Ser		F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734393	0.30774	.	.	ENSG00000163395	ENST00000335211	T	0.33438	1.41	2.89	-0.32	0.12721	.	.	.	.	.	T	0.13457	0.0326	N	0.08118	0	0.20403	N	0.9999	.	.	.	.	.	.	T	0.33574	-0.9863	6	.	.	.	.	6.9961	0.24782	0.339:0.0:0.661:0.0	.	.	.	.	S	1986	ENSP00000334714:G1986S	.	G	+	1	0	IGFN1	199446600	0.994000	0.37717	0.000000	0.03702	0.002000	0.02628	1.472000	0.35376	-0.192000	0.10432	-0.450000	0.05554	GGT		0.507	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
IGFN1	91156	hgsc.bcm.edu	37	1	201179984	201179984	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:201179984A>G	ENST00000335211.4	+	12	6093	c.5963A>G	c.(5962-5964)gAg>gGg	p.E1988G	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGGGTTCTGAGGAAATGGGG	0.512																																																	0													49.0	43.0	45.0					1																	201179984		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.5963A>G	1.37:g.201179984A>G	ENSP00000334714:p.Glu1988Gly		F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	8.747	0.920300	0.17982	.	.	ENSG00000163395	ENST00000335211	T	0.72282	-0.64	2.72	-1.08	0.09936	.	.	.	.	.	T	0.41050	0.1142	N	0.08118	0	0.09310	N	0.999998	.	.	.	.	.	.	T	0.15065	-1.0450	6	.	.	.	.	3.159	0.06514	0.3977:0.0:0.4184:0.1839	.	.	.	.	G	1988	ENSP00000334714:E1988G	.	E	+	2	0	IGFN1	199446607	0.906000	0.30813	0.000000	0.03702	0.000000	0.00434	-0.300000	0.08243	-1.050000	0.03230	-1.676000	0.00740	GAG		0.512	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
KAZN	23254	broad.mit.edu;hgsc.bcm.edu	37	1	15370643	15370643	+	Silent	SNP	C	C	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:15370643C>T	ENST00000376030.2	+	4	1008	c.714C>T	c.(712-714)gcC>gcT	p.A238A	KAZN_ENST00000361144.5_Silent_p.A232A|KAZN_ENST00000400798.2_Silent_p.A144A|KAZN_ENST00000503743.1_Silent_p.A238A|KAZN_ENST00000400797.3_Silent_p.A144A|KAZN_ENST00000422387.2_Silent_p.A238A	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	238	Interaction with PPL.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)		p.A232A(1)|p.A238A(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						AGCTGGAGGCCGAGCTGGCCA	0.672																																																	2	Substitution - coding silent(2)	kidney(2)											68.0	66.0	67.0					1																	15370643		2203	4300	6503	SO:0001819	synonymous_variant	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.714C>T	1.37:g.15370643C>T			B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	ENST00000376030.2	37	CCDS152.2																																																																																				0.672	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2		NM_001017999	
IGFN1	91156	hgsc.bcm.edu	37	1	201180361	201180361	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:201180361G>A	ENST00000335211.4	+	12	6470	c.6340G>A	c.(6340-6342)Gag>Aag	p.E2114K	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGGGCTCCTGAGGGAATAGG	0.483																																																	0													31.0	26.0	28.0					1																	201180361		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.6340G>A	1.37:g.201180361G>A	ENSP00000334714:p.Glu2114Lys		F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262844	0.23051	.	.	ENSG00000163395	ENST00000335211	T	0.41400	1.0	2.2	-4.39	0.03611	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.19647	-1.0299	6	.	.	.	.	0.0794	0.00030	0.3219:0.1691:0.1867:0.3223	.	.	.	.	K	2114	ENSP00000334714:E2114K	.	E	+	1	0	IGFN1	199446984	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.307000	0.08167	-0.644000	0.05465	0.184000	0.17185	GAG		0.483	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_178275	
LATS2	26524	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	13	21562131	21562131	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr13:21562131G>C	ENST00000382592.4	-	4	2193	c.1788C>G	c.(1786-1788)agC>agG	p.S596R	LATS2_ENST00000472754.1_5'Flank|LATS2_ENST00000542899.1_Missense_Mutation_p.S596R	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2									p.S596R(2)		breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		ATGGCGAGTAGCTCTTGATGC	0.512																																																	2	Substitution - Missense(2)	kidney(2)											260.0	263.0	262.0					13																	21562131		2203	4300	6503	SO:0001583	missense	26524			AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1788C>G	13.37:g.21562131G>C	ENSP00000372035:p.Ser596Arg			Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209403	0.58343	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.41758	0.99;0.99	5.12	3.2	0.36748	.	0.000000	0.85682	D	0.000000	T	0.37758	0.1015	L	0.49126	1.545	0.42017	D	0.99096	P	0.50943	0.94	P	0.45474	0.482	T	0.16012	-1.0417	10	0.33940	T	0.23	.	9.1378	0.36886	0.283:0.0:0.717:0.0	.	596	Q9NRM7	LATS2_HUMAN	R	596	ENSP00000372035:S596R;ENSP00000441817:S596R	ENSP00000372035:S596R	S	-	3	2	LATS2	20460131	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.446000	0.35090	1.385000	0.46445	0.549000	0.68633	AGC		0.512	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1			
LOC220729	220729	broad.mit.edu	37	3	197348668	197348668	+	RNA	SNP	C	C	G	rs79940815	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:197348668C>G	ENST00000418868.1	-	0	591					NR_003266.2																						ACTTGAGGCTCTGTCCACCAA	0.488													C|||	539	0.107628	0.0083	0.0692	5008	,	,		20710	0.1776		0.1074	False		,,,				2504	0.1973																0																																												220729																															3.37:g.197348668C>G				RNA	SNP	ENST00000418868.1	37																																																																																					0.488	AC024560.3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000340283.1			
LOC220729	220729	broad.mit.edu	37	3	197348674	197348674	+	RNA	SNP	A	A	G	rs376114863		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:197348674A>G	ENST00000418868.1	-	0	585					NR_003266.2																						GGCTCTGTCCACCAAATGCAC	0.478																																																	0																																												220729																															3.37:g.197348674A>G				RNA	SNP	ENST00000418868.1	37																																																																																					0.478	AC024560.3-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000340283.1			
KMT2E	55904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	7	104753209	104753209	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr7:104753209A>G	ENST00000311117.3	+	27	5551	c.5006A>G	c.(5005-5007)cAt>cGt	p.H1669R	SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000257745.4_Missense_Mutation_p.H1669R|KMT2E_ENST00000334877.4_Missense_Mutation_p.H1627R	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1669	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.H1669R(1)									TCGCATATTCATTCTCAAACT	0.577																																																	1	Substitution - Missense(1)	kidney(1)											80.0	78.0	79.0					7																	104753209		2203	4300	6503	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.5006A>G	7.37:g.104753209A>G	ENSP00000312379:p.His1669Arg		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	a	9.345	1.063934	0.20067	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.93604	-3.22;-3.25;-3.22	3.67	2.39	0.29439	.	0.157476	0.29451	N	0.012106	D	0.91486	0.7312	N	0.19112	0.55	0.80722	D	1	P;D	0.57899	0.642;0.981	B;D	0.67231	0.141;0.95	D	0.88918	0.3364	10	0.37606	T	0.19	.	8.3945	0.32548	0.8247:0.0:0.0:0.1753	.	1589;1669	F8W6H1;Q8IZD2	.;MLL5_HUMAN	R	1669;1627;1589;1669	ENSP00000312379:H1669R;ENSP00000335599:H1627R;ENSP00000257745:H1669R	ENSP00000257745:H1669R	H	+	2	0	MLL5	104540445	1.000000	0.71417	0.988000	0.46212	0.953000	0.61014	4.068000	0.57534	1.326000	0.45319	0.248000	0.18094	CAT		0.577	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1			
MUC2	4583	hgsc.bcm.edu	37	11	1092816	1092816	+	Silent	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:1092816G>C	ENST00000441003.2	+	30	4662	c.4635G>C	c.(4633-4635)acG>acC	p.T1545T	MUC2_ENST00000359061.5_Silent_p.T1546T|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccacGGTGACCCCAA	0.637																																																	0													38.0	55.0	49.0					11																	1092816		1771	3233	5004	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4635G>C	11.37:g.1092816G>C			Q14878	Silent	SNP	ENST00000441003.2	37																																																																																					0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1092841	1092841	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:1092841G>A	ENST00000441003.2	+	30	4687	c.4660G>A	c.(4660-4662)Ggc>Agc	p.G1554S	MUC2_ENST00000359061.5_Missense_Mutation_p.G1555S|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	AACACCCACCGGCACACAGAC	0.632																																																	0													79.0	103.0	94.0					11																	1092841		1868	3445	5313	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4660G>A	11.37:g.1092841G>A	ENSP00000415183:p.Gly1554Ser		Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	3.185	-0.167089	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11821	2.74;2.98	1.33	-2.66	0.06077	.	0.401141	0.15760	U	0.245987	T	0.03827	0.0108	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.01281	0.0	T	0.39921	-0.9590	9	0.07175	T	0.84	.	2.8157	0.05455	0.4548:0.0:0.3399:0.2053	.	1554	E7EUV1	.	S	1554;1555	ENSP00000415183:G1554S;ENSP00000351956:G1555S	ENSP00000351956:G1555S	G	+	1	0	MUC2	1082841	0.000000	0.05858	0.001000	0.08648	0.338000	0.28826	-2.797000	0.00763	-0.263000	0.09378	0.109000	0.15622	GGC		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2		NM_002457	
NBPF9	400818	broad.mit.edu	37	1	144813824	144813824	+	Silent	SNP	G	G	C	rs77446849	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:144813824G>C	ENST00000440491.2	+	2	297	c.297G>C	c.(295-297)ctG>ctC	p.L99L	NBPF9_ENST00000281815.8_5'UTR|NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000338347.4_Silent_p.L99L	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	357						cytoplasm (GO:0005737)		p.L99L(1)		NS(2)|prostate(1)	3						CAGAGCAGCTGAAGCAAGCTG	0.522													.|||	1679	0.335264	0.2269	0.3429	5008	,	,		21823	0.495		0.2763	False		,,,				2504	0.3722																1	Substitution - coding silent(1)	kidney(1)											2.0	2.0	2.0					1																	144813824		370	888	1258	SO:0001819	synonymous_variant	400818				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.297G>C	1.37:g.144813824G>C				Silent	SNP	ENST00000440491.2	37		.	.	.	.	.	.	.	.	.	.	.	0.186	-1.058093	0.01950	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.562	-1.12	0.09808	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	S	98	.	.	X	+	2	2	NBPF9	143525181	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.141000	0.03207	-3.442000	0.00162	-3.270000	0.00048	TGA		0.522	NBPF9-203	KNOWN	basic	protein_coding	protein_coding			NM_001037675	
NBPF9	400818	broad.mit.edu	37	1	144828610	144828610	+	Silent	SNP	T	T	G	rs12026633		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:144828610T>G	ENST00000281815.8	+	13	1196	c.450T>G	c.(448-450)tcT>tcG	p.S150S	NBPF9_ENST00000468645.1_3'UTR|NBPF9_ENST00000440491.2_3'UTR|NBPF9_ENST00000338347.4_Silent_p.S552S			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	810						cytoplasm (GO:0005737)		p.S552S(1)		NS(2)|prostate(1)	3						GATGTTATTCTACTCCGTCAA	0.468																																																	1	Substitution - coding silent(1)	kidney(1)											100.0	91.0	94.0					1																	144828610		692	1591	2283	SO:0001819	synonymous_variant	400818				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000281815.8:c.450T>G	1.37:g.144828610T>G				Silent	SNP	ENST00000281815.8	37		.	.	.	.	.	.	.	.	.	.	.	2.102	-0.405934	0.04832	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.618	0.618	0.17624	.	.	.	.	.	T	0.09730	0.0239	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35624	-0.9781	3	.	.	.	.	.	.	.	rs12026633	.	.	.	R	626	.	.	L	+	2	0	NBPF9	143539967	0.002000	0.14202	0.001000	0.08648	0.009000	0.06853	-0.254000	0.08781	-0.171000	0.10797	-1.044000	0.02363	CTA		0.468	NBPF9-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001037675	
NEK5	341676	broad.mit.edu;hgsc.bcm.edu	37	13	52661584	52661584	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr13:52661584G>C	ENST00000355568.4	-	15	1421	c.1282C>G	c.(1282-1284)Cgt>Ggt	p.R428G		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	428					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.R485G(1)|p.R428G(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GAAGATGGACGAAGACCCTAT	0.343																																																	2	Substitution - Missense(2)	kidney(2)											108.0	101.0	103.0					13																	52661584		2203	4300	6503	SO:0001583	missense	341676			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1282C>G	13.37:g.52661584G>C	ENSP00000347767:p.Arg428Gly		Q5TAP5	Missense_Mutation	SNP	ENST00000355568.4	37	CCDS31979.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703753	0.48412	.	.	ENSG00000197168	ENST00000355568	T	0.78924	-1.22	5.45	2.83	0.33086	.	0.000000	0.64402	D	0.000003	D	0.84005	0.5377	M	0.65498	2.005	0.23798	N	0.996816	D	0.89917	1.0	D	0.87578	0.998	T	0.74103	-0.3773	10	0.72032	D	0.01	.	7.7703	0.29004	0.2616:0.0:0.7384:0.0	.	428	Q6P3R8	NEK5_HUMAN	G	428	ENSP00000347767:R428G	ENSP00000347767:R428G	R	-	1	0	NEK5	51559585	1.000000	0.71417	0.992000	0.48379	0.707000	0.40811	1.885000	0.39678	0.286000	0.22352	-0.812000	0.03155	CGT		0.343	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3		NM_199289	
NIPBL	25836	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	37020560	37020560	+	Splice_Site	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr5:37020560G>T	ENST00000282516.8	+	26	5509		c.e26-1		NIPBL_ENST00000448238.2_Splice_Site	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.?(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTTCTTTCCAGTTTTCTCGTA	0.328																																																	2	Unknown(2)	kidney(2)											66.0	61.0	63.0					5																	37020560		2203	4297	6500	SO:0001630	splice_region_variant	25836			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.5011-1G>T	5.37:g.37020560G>T			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Splice_Site	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589670	0.86851	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5885	0.95498	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NIPBL	37056317	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.476000	0.97823	2.647000	0.89833	0.585000	0.79938	.		0.328	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1		NM_015384	Intron
NLGN2	57555	broad.mit.edu;hgsc.bcm.edu	37	17	7319145	7319145	+	Silent	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:7319145G>C	ENST00000302926.2	+	6	1426	c.1353G>C	c.(1351-1353)ctG>ctC	p.L451L	NLGN2_ENST00000575301.1_Silent_p.L451L	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	451					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.L451L(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GCAAAACCCTGCTGGCGCTCT	0.572																																																	1	Substitution - coding silent(1)	kidney(1)											65.0	63.0	64.0					17																	7319145		2203	4300	6503	SO:0001819	synonymous_variant	57555			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1353G>C	17.37:g.7319145G>C			Q9P2I1	Silent	SNP	ENST00000302926.2	37	CCDS11103.1																																																																																				0.572	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2		NM_020795	
NLRP9	338321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	56243618	56243618	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:56243618G>A	ENST00000332836.2	-	2	1606	c.1579C>T	c.(1579-1581)Ctt>Ttt	p.L527F		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	527						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.L527F(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		AAACTTTCAAGGCATTGGGTT	0.383																																																	1	Substitution - Missense(1)	kidney(1)											65.0	66.0	66.0					19																	56243618		2203	4300	6503	SO:0001583	missense	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1579C>T	19.37:g.56243618G>A	ENSP00000331857:p.Leu527Phe		B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	G	8.006	0.756490	0.15846	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.75367	-0.93	2.37	0.0363	0.14191	.	.	.	.	.	T	0.75982	0.3924	M	0.82716	2.605	0.09310	N	1	D	0.54964	0.969	P	0.46975	0.533	T	0.65965	-0.6040	9	0.46703	T	0.11	.	8.054	0.30593	0.0:0.5026:0.4974:0.0	.	527	Q7RTR0	NALP9_HUMAN	F	527	ENSP00000331857:L527F	ENSP00000331857:L527F	L	-	1	0	NLRP9	60935430	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.464000	0.06688	0.107000	0.17824	0.644000	0.83932	CTT		0.383	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1		NM_176820	
NUP85	79902	broad.mit.edu;ucsc.edu	37	17	73205917	73205918	+	Splice_Site	INS	-	-	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:73205917_73205918insA	ENST00000245544.4	+	3	198_199		c.e3-1		NUP85_ENST00000541827.1_Splice_Site|NUP85_ENST00000579324.1_Splice_Site|NUP85_ENST00000449421.2_Splice_Site|NUP85_ENST00000579298.1_Splice_Site|NUP85_ENST00000447371.2_Splice_Site	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TTTGGTTTCAGAAAAATCAGAG	0.351																																																	0																																										SO:0001630	splice_region_variant	79902			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.128-1->A	17.37:g.73205922_73205922dupA			B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Splice_Site	INS	ENST00000245544.4	37	CCDS32730.1																																																																																				0.351	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1		NM_024844	Intron
OR5AR1	219493	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	56431747	56431747	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:56431747G>T	ENST00000302969.2	+	1	610	c.586G>T	c.(586-588)Gag>Tag	p.E196*		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E196*(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						CTACATCAGTGAGATCTTGCT	0.448																																																	1	Substitution - Nonsense(1)	kidney(1)											197.0	169.0	179.0					11																	56431747		2201	4296	6497	SO:0001587	stop_gained	219493			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.586G>T	11.37:g.56431747G>T	ENSP00000302639:p.Glu196*		Q6IF61	Nonsense_Mutation	SNP	ENST00000302969.2	37	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894067	0.72639	.	.	ENSG00000172459	ENST00000302969	.	.	.	4.91	4.91	0.64330	.	0.000000	0.48286	D	0.000199	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	15.41	0.74911	0.0:0.0:1.0:0.0	.	.	.	.	X	196	.	ENSP00000302639:E196X	E	+	1	0	OR5AR1	56188323	0.824000	0.29247	0.996000	0.52242	0.983000	0.72400	3.225000	0.51246	2.554000	0.86153	0.573000	0.79308	GAG		0.448	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1		NM_001004730	
PBRM1	55193	broad.mit.edu;hgsc.bcm.edu	37	3	52663052	52663052	+	Splice_Site	SNP	C	C	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:52663052C>A	ENST00000296302.7	-	12	1303		c.e12-1		PBRM1_ENST00000409767.1_Splice_Site|PBRM1_ENST00000394830.3_Splice_Site|PBRM1_ENST00000410007.1_Splice_Site|PBRM1_ENST00000356770.4_Splice_Site|PBRM1_ENST00000409114.3_Splice_Site|PBRM1_ENST00000337303.4_Splice_Site|PBRM1_ENST00000409057.1_Splice_Site			Q86U86	PB1_HUMAN	polybromo 1						chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(3)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CAGTTTTGTTCTGTGAAAGAC	0.318			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	3	Unknown(3)	kidney(3)											51.0	48.0	49.0					3																	52663052		2203	4300	6503	SO:0001630	splice_region_variant	55193			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1302-1G>T	3.37:g.52663052C>A			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Splice_Site	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	18.22	3.575705	0.65878	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1293	0.93399	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PBRM1	52638092	1.000000	0.71417	1.000000	0.80357	0.639000	0.38242	7.487000	0.81328	2.532000	0.85374	0.467000	0.42956	.		0.318	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1		NM_018165	Intron
PCNX	22990	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	71524405	71524405	+	Missense_Mutation	SNP	C	C	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr14:71524405C>G	ENST00000304743.2	+	26	5262	c.4816C>G	c.(4816-4818)Ctg>Gtg	p.L1606V	PCNX_ENST00000238570.5_Intron|PCNX_ENST00000439984.3_Missense_Mutation_p.L1495V	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1606						integral component of membrane (GO:0016021)		p.L1606V(1)		NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGGCAATGGTCTGGTCACTTT	0.438																																																	1	Substitution - Missense(1)	kidney(1)											257.0	254.0	255.0					14																	71524405		2203	4300	6503	SO:0001583	missense	22990			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.4816C>G	14.37:g.71524405C>G	ENSP00000304192:p.Leu1606Val		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	37	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622748	0.66787	.	.	ENSG00000100731	ENST00000304743;ENST00000439984	T;T	0.11169	3.19;2.8	5.58	4.69	0.59074	.	0.000000	0.64402	D	0.000001	T	0.22627	0.0546	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.72625	0.956;0.978	T	0.00775	-1.1571	10	0.44086	T	0.13	.	9.3084	0.37889	0.0:0.7937:0.0:0.2063	.	1495;1606	B2RTR6;Q96RV3	.;PCX1_HUMAN	V	1606;1495	ENSP00000304192:L1606V;ENSP00000396617:L1495V	ENSP00000304192:L1606V	L	+	1	2	PCNX	70594158	0.980000	0.34600	0.987000	0.45799	0.968000	0.65278	1.949000	0.40313	1.354000	0.45846	0.591000	0.81541	CTG		0.438	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1		NM_014982	
PHRF1	57661	broad.mit.edu	37	11	608822	608822	+	Silent	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:608822G>A	ENST00000264555.5	+	14	3494	c.3366G>A	c.(3364-3366)gaG>gaA	p.E1122E	PHRF1_ENST00000533464.1_Silent_p.E1118E|PHRF1_ENST00000416188.2_Silent_p.E1121E|PHRF1_ENST00000413872.2_Silent_p.E1120E	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1122	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)	p.E1122E(1)|p.E1127E(1)		breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GGGGAAGGGAGTGCTCCCCCA	0.637																																																	2	Substitution - coding silent(2)	kidney(2)											24.0	30.0	28.0					11																	608822		2199	4295	6494	SO:0001819	synonymous_variant	57661			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3366G>A	11.37:g.608822G>A			A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	37																																																																																					0.637	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1		NM_020901	
PLIN4	729359	hgsc.bcm.edu	37	19	4511479	4511479	+	Silent	SNP	A	A	T	rs386806133|rs386806132|rs138464610	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:4511479A>T	ENST00000301286.3	-	3	2450	c.2451T>A	c.(2449-2451)acT>acA	p.T817T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	817	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CACTGCAGACAGTGTCCTTGG	0.597													a|||	397	0.0792732	0.1377	0.0735	5008	,	,		23517	0.0734		0.0586	False		,,,				2504	0.0317																0													86.0	109.0	102.0					19																	4511479		1995	4194	6189	SO:0001819	synonymous_variant	729359			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2451T>A	19.37:g.4511479A>T			A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																				0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1		XM_170901	
POLH	5429	hgsc.bcm.edu;ucsc.edu	37	6	43581424	43581425	+	In_Frame_Ins	INS	-	-	TGT			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:43581424_43581425insTGT	ENST00000372236.4	+	11	1567_1568	c.1272_1273insTGT	c.(1273-1275)tgt>TGTtgt	p.425_425C>CC	POLH_ENST00000535400.1_In_Frame_Ins_p.363_363C>CC|POLH_ENST00000372226.1_Intron	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			TGCTTTTCCTCTGTGCTACAAA	0.406								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																																								0																																										SO:0001652	inframe_insertion	5429	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.1273_1275dupTGT	6.37:g.43581425_43581427dupTGT	ENSP00000361310:p.Cys425dup		O95160|Q6VMB5	In_Frame_Ins	INS	ENST00000372236.4	37	CCDS4902.1																																																																																				0.406	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040666.1		NM_006502	
POTEA	340441	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	43152262	43152262	+	RNA	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr8:43152262G>A	ENST00000522175.2	+	0	401							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A									p.R133R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCAAAAAGAGGACAGCTCTGA	0.383																																																	1	Substitution - coding silent(1)	kidney(1)											92.0	90.0	91.0					8																	43152262		2175	4288	6463			340441			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152262G>A			A6ND17|A6ND71|Q6S8J6	Silent	SNP	ENST00000522175.2	37																																																																																					0.383	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1		NM_001002920	
POU3F4	5456	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	82763423	82763423	+	Missense_Mutation	SNP	T	T	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chrX:82763423T>C	ENST00000373200.2	+	1	155	c.91T>C	c.(91-93)Ttc>Ctc	p.F31L	RP3-326L13.2_ENST00000607095.1_RNA|RP3-326L13.3_ENST00000607789.1_lincRNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	31					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F31L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						GGGGAGTCCTTTCCGCAACCC	0.587																																																	1	Substitution - Missense(1)	kidney(1)											56.0	41.0	46.0					X																	82763423		2203	4300	6503	SO:0001583	missense	5456			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.91T>C	X.37:g.82763423T>C	ENSP00000362296:p.Phe31Leu		B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.438118	0.25900	.	.	ENSG00000196767	ENST00000373200	D	0.85702	-2.02	4.46	4.46	0.54185	.	0.066400	0.64402	D	0.000008	T	0.78679	0.4321	L	0.36672	1.1	0.39194	D	0.963012	B	0.18610	0.029	B	0.18263	0.021	T	0.77054	-0.2730	10	0.52906	T	0.07	.	12.0363	0.53427	0.0:0.0:0.0:1.0	.	31	P49335	PO3F4_HUMAN	L	31	ENSP00000362296:F31L	ENSP00000362296:F31L	F	+	1	0	POU3F4	82650079	1.000000	0.71417	0.998000	0.56505	0.291000	0.27294	5.131000	0.64751	1.753000	0.51906	0.483000	0.47432	TTC		0.587	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2		NM_000307	
PRAMEF12	390999	hgsc.bcm.edu	37	1	12837358	12837358	+	Silent	SNP	G	G	A	rs201553868	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:12837358G>A	ENST00000357726.4	+	3	1095	c.1068G>A	c.(1066-1068)gaG>gaA	p.E356E		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	356					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGGACTTAGAGGACTGTGGGA	0.597																																																	0													96.0	96.0	96.0					1																	12837358		2203	4300	6503	SO:0001819	synonymous_variant	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1068G>A	1.37:g.12837358G>A				Silent	SNP	ENST00000357726.4	37	CCDS41254.1																																																																																				0.597	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1		XM_372760	
PRB4	5545	hgsc.bcm.edu	37	12	11461580	11461580	+	Missense_Mutation	SNP	T	T	G	rs12303607	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:11461580T>G	ENST00000535904.1	-	3	370	c.337A>C	c.(337-339)Acc>Ccc	p.T113P	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.T113P			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	134	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).			extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGAGGTGGGGTACCTTGGGAC	0.617										HNSCC(22;0.051)			c|||	11	0.00219649	0.0045	0.0029	5008	,	,		17159	0.003		0.0	False		,,,				2504	0.0																0													142.0	153.0	149.0					12																	11461580		2202	4299	6501	SO:0001583	missense	5545				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.337A>C	12.37:g.11461580T>G	ENSP00000442834:p.Thr113Pro		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	543	0.24862637362637363	121	0.2459349593495935	120	0.3314917127071823	140	0.24475524475524477	162	0.21372031662269128	.	0.119	-1.127537	0.01770	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.03745	3.82;3.82	0.678	0.678	0.17969	.	.	.	.	.	T	0.00012	0.0000	N	0.00075	-2.25	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41627	-0.9498	7	0.02654	T	1	.	.	.	.	rs12303607;rs58158296	113	E9PAL0	.	P	113	ENSP00000279575:T113P;ENSP00000442834:T113P	ENSP00000279575:T113P	T	-	1	0	PRB4	11352847	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-5.077000	0.00153	-0.175000	0.10725	-1.039000	0.02377	ACC		0.617	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1		NM_002723	
PRB1	5542	broad.mit.edu;hgsc.bcm.edu	37	12	11506647	11506647	+	Intron	SNP	T	T	C	rs372620668		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:11506647T>C	ENST00000500254.2	-	3	351				PRB1_ENST00000546254.1_Intron|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1							extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GTGGGGGACCTTGAGGTCTGT	0.617																																																	0													16.0	13.0	14.0					12																	11506647		1287	2274	3561	SO:0001627	intron_variant	5542				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.313+76A>G	12.37:g.11506647T>C			Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Silent	SNP	ENST00000500254.2	37	CCDS8642.1																																																																																				0.617	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402312.1		NM_005039	
PRIM2	5558	broad.mit.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0																																										SO:0001624	3_prime_UTR_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	INS	ENST00000389488.2	37																																																																																					0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3		NM_000947	
PRIM2	5558	broad.mit.edu	37	6	57512788	57512789	+	3'UTR	INS	-	-	TA	rs376103961|rs386701662|rs79832250		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr6:57512788_57512789insTA	ENST00000389488.2	+	0	1703_1704				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgcactctgttgtgtaattgtg	0.436																																																	0																																										SO:0001624	3_prime_UTR_variant	5558				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1701->TA	6.37:g.57512788_57512789insTA			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	INS	ENST00000389488.2	37																																																																																					0.436	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3		NM_000947	
PSG9	5678	hgsc.bcm.edu;ucsc.edu	37	19	43772159	43772159	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:43772159delT	ENST00000270077.3	-	2	303	c.207delA	c.(205-207)aaafs	p.K69fs	PSG9_ENST00000596730.1_Frame_Shift_Del_p.K69fs|PSG9_ENST00000593948.1_Frame_Shift_Del_p.K69fs|PSG9_ENST00000418820.2_Frame_Shift_Del_p.K69fs|PSG9_ENST00000443718.3_Frame_Shift_Del_p.K69fs|PSG9_ENST00000244293.7_Frame_Shift_Del_p.K69fs|PSG9_ENST00000291752.5_Frame_Shift_Del_p.K69fs	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	69	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				TCATTTCCCCTTTGTACCAGA	0.413																																																	0													170.0	170.0	170.0					19																	43772159		2203	4300	6503	SO:0001589	frameshift_variant	5678			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.207delA	19.37:g.43772159delT	ENSP00000270077:p.Lys69fs		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Frame_Shift_Del	DEL	ENST00000270077.3	37	CCDS12618.1																																																																																				0.413	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1		NM_002784	
RAB3A	5864	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	18309636	18309636	+	Nonsense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:18309636G>C	ENST00000222256.4	-	4	549	c.371C>G	c.(370-372)tCa>tGa	p.S124*	RAB3A_ENST00000464076.3_Nonsense_Mutation_p.S29*	NM_002866.4	NP_002857.1	P20336	RAB3A_HUMAN	RAB3A, member RAS oncogene family	124					axonogenesis (GO:0007409)|constitutive secretory pathway (GO:0045054)|glutamate secretion (GO:0014047)|GTP catabolic process (GO:0006184)|lung development (GO:0030324)|maintenance of presynaptic active zone structure (GO:0048790)|mitochondrion organization (GO:0007005)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|positive regulation of exocytosis (GO:0045921)|post-embryonic development (GO:0009791)|protein transport (GO:0015031)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|respiratory system process (GO:0003016)|response to electrical stimulus (GO:0051602)|sensory perception of touch (GO:0050975)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle recycling (GO:0036465)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)	p.S124*(1)		NS(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	8						ATTGTCCCATGAGTAGGTCTT	0.592																																																	1	Substitution - Nonsense(1)	kidney(1)											125.0	95.0	105.0					19																	18309636		2203	4300	6503	SO:0001587	stop_gained	5864				CCDS12372.1	19p13.2	2008-07-17			ENSG00000105649	ENSG00000105649		"""RAB, member RAS oncogene"""	9777	protein-coding gene	gene with protein product	"""RAS-associated protein RAB3A"""	179490				2687157, 7532276	Standard	NM_002866		Approved		uc002nie.2	P20336	OTTHUMG00000137378	ENST00000222256.4:c.371C>G	19.37:g.18309636G>C	ENSP00000222256:p.Ser124*		A8K0J4|Q9NYE1	Nonsense_Mutation	SNP	ENST00000222256.4	37	CCDS12372.1	.	.	.	.	.	.	.	.	.	.	G	37	6.527871	0.97637	.	.	ENSG00000105649	ENST00000222256	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.6835	16.5307	0.84357	0.0:0.0:1.0:0.0	.	.	.	.	X	124	.	ENSP00000222256:S124X	S	-	2	0	RAB3A	18170636	1.000000	0.71417	0.937000	0.37676	0.982000	0.71751	9.630000	0.98420	2.492000	0.84095	0.561000	0.74099	TCA		0.592	RAB3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268056.2		NM_002866	
RAB8B	51762	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	63547744	63547744	+	Silent	SNP	C	C	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr15:63547744C>G	ENST00000321437.4	+	4	441	c.285C>G	c.(283-285)tcC>tcG	p.S95S	RAB8B_ENST00000448330.2_Silent_p.S95S	NM_016530.2	NP_057614.1	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	95					adherens junction organization (GO:0034332)|antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|positive regulation of cell projection organization (GO:0031346)|positive regulation of corticotropin secretion (GO:0051461)|protein import into peroxisome membrane (GO:0045046)|small GTPase mediated signal transduction (GO:0007264)	cell tip (GO:0051286)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)	p.S95S(1)		kidney(3)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9						ATGAAAAATCCTTTGACAATA	0.328																																																	1	Substitution - coding silent(1)	kidney(1)											56.0	60.0	59.0					15																	63547744		2203	4300	6503	SO:0001819	synonymous_variant	51762			AL833365	CCDS10183.1	15q22	2008-11-18			ENSG00000166128	ENSG00000166128		"""RAB, member RAS oncogene"""	30273	protein-coding gene	gene with protein product		613532				9030196, 18772196	Standard	XM_006720569		Approved		uc002alz.3	Q92930	OTTHUMG00000132862	ENST00000321437.4:c.285C>G	15.37:g.63547744C>G			Q5JPC4|Q9P293	Silent	SNP	ENST00000321437.4	37	CCDS10183.1																																																																																				0.328	RAB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256336.1		NM_016530	
RANBP2	5903	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	109379866	109379866	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:109379866G>C	ENST00000283195.6	+	20	2997	c.2871G>C	c.(2869-2871)agG>agC	p.R957S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	957					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R957S(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TATCGCCCAGGGGTGATGATT	0.458																																																	2	Substitution - Missense(2)	kidney(2)											109.0	106.0	107.0					2																	109379866		2203	4300	6503	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.2871G>C	2.37:g.109379866G>C	ENSP00000283195:p.Arg957Ser		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732624	0.30684	.	.	ENSG00000153201	ENST00000283195	T	0.23552	1.9	5.19	4.26	0.50523	.	.	.	.	.	T	0.15739	0.0379	L	0.27053	0.805	0.25346	N	0.988902	B	0.31581	0.329	B	0.25987	0.065	T	0.06789	-1.0807	9	0.30078	T	0.28	-18.3764	7.7707	0.29006	0.0846:0.0:0.6423:0.2731	.	957	P49792	RBP2_HUMAN	S	957	ENSP00000283195:R957S	ENSP00000283195:R957S	R	+	3	2	RANBP2	108746298	0.996000	0.38824	1.000000	0.80357	0.954000	0.61252	0.381000	0.20619	2.570000	0.86706	0.563000	0.77884	AGG		0.458	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1		NM_006267	
RARA	5914	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	38508596	38508596	+	Missense_Mutation	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:38508596A>G	ENST00000254066.5	+	6	1099	c.644A>G	c.(643-645)gAa>gGa	p.E215G	RARA_ENST00000394089.2_Missense_Mutation_p.E215G|RARA_ENST00000394081.3_Missense_Mutation_p.E210G|RARA_ENST00000425707.3_Missense_Mutation_p.E118G|RARA_ENST00000394086.3_Missense_Mutation_p.E231G|RARA_ENST00000420042.1_3'UTR	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	215	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)	p.E215G(1)		breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	AACAGCTCAGAACAACGTGTC	0.587			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																			Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	1	Substitution - Missense(1)	kidney(1)											166.0	144.0	152.0					17																	38508596		2203	4300	6503	SO:0001583	missense	5914			X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.644A>G	17.37:g.38508596A>G	ENSP00000254066:p.Glu215Gly		B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	SNP	ENST00000254066.5	37	CCDS11366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.251|8.251	0.808905|0.808905	0.16467|0.16467	.|.	.|.	ENSG00000131759|ENSG00000131759	ENST00000254066;ENST00000425707;ENST00000394089;ENST00000394086;ENST00000394081;ENST00000420042|ENST00000319149	T;D;T;T;T|.	0.93547|.	1.37;-3.24;1.37;1.37;1.37|.	4.34|4.34	4.34|4.34	0.51931|0.51931	Nuclear hormone receptor, ligand-binding (2);|.	.|2.442480	.|0.02920	.|N	.|0.137848	T|T	0.51907|0.51907	0.1702|0.1702	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999997|0.999997	P;B;P|.	0.52842|.	0.956;0.0;0.621|.	P;B;B|.	0.53490|.	0.727;0.002;0.178|.	T|T	0.12426|0.12426	-1.0548|-1.0548	9|7	0.41790|0.33940	T|T	0.15|0.23	.|.	12.6365|12.6365	0.56687|0.56687	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	118;210;215|.	B8Y636;F1D8N9;P10276|.	.;.;RARA_HUMAN|.	G|D	215;118;215;231;210;102|209	ENSP00000254066:E215G;ENSP00000389993:E118G;ENSP00000377649:E215G;ENSP00000377648:E231G;ENSP00000377643:E210G|.	ENSP00000254066:E215G|ENSP00000316769:N209D	E|N	+|+	2|1	0|0	RARA|RARA	35762122|35762122	1.000000|1.000000	0.71417|0.71417	0.896000|0.896000	0.35187|0.35187	0.043000|0.043000	0.13939|0.13939	9.139000|9.139000	0.94554|0.94554	1.801000|1.801000	0.52704|0.52704	0.377000|0.377000	0.23210|0.23210	GAA|AAC		0.587	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2			
SBSN	374897	hgsc.bcm.edu	37	19	36018413	36018413	+	Silent	SNP	T	T	A	rs368150998		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:36018413T>A	ENST00000452271.2	-	1	799	c.771A>T	c.(769-771)gcA>gcT	p.A257A	SBSN_ENST00000518157.1_Intron	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	257	Ala/Gly/His-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAAATCTCCCTGCCTCATTTC	0.627																																																	0													48.0	50.0	50.0					19																	36018413		692	1591	2283	SO:0001819	synonymous_variant	374897			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.771A>T	19.37:g.36018413T>A			A8K5J0|E9PBV3	Silent	SNP	ENST00000452271.2	37	CCDS54253.1																																																																																				0.627	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3		NM_198538	
SDHAP1	255812	broad.mit.edu	37	3	195698264	195698264	+	RNA	SNP	T	T	C	rs12485654	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:195698264T>C	ENST00000427841.1	-	0	1608					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTTGTCAACATTCGTGACAGA	0.413																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												255812			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195698264T>C				RNA	SNP	ENST00000427841.1	37																																																																																					0.413	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1			
SEMA4A	64218	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	156146590	156146590	+	Silent	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:156146590A>G	ENST00000368285.3	+	15	2355	c.2088A>G	c.(2086-2088)tcA>tcG	p.S696S	SEMA4A_ENST00000368286.2_Silent_p.S564S|SEMA4A_ENST00000368282.1_Silent_p.S696S|SEMA4A_ENST00000355014.2_Silent_p.S696S|SEMA4A_ENST00000368284.1_Silent_p.S564S	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	696					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.S696S(1)		breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					TAGTGCTTTCAGGAGCCCTCA	0.642																																																	1	Substitution - coding silent(1)	kidney(1)											100.0	87.0	92.0					1																	156146590		2203	4300	6503	SO:0001819	synonymous_variant	64218			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.2088A>G	1.37:g.156146590A>G			B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Silent	SNP	ENST00000368285.3	37	CCDS1132.1																																																																																				0.642	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2		NM_022367	
KIAA0100	9703	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	26939689	26939689	+	IGR	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:26939689G>T	ENST00000528896.2	-	0	7407				SGK494_ENST00000301037.5_Missense_Mutation_p.P165H|SGK494_ENST00000469832.3_5'UTR|SPAG5-AS1_ENST00000554154.1_RNA|SPAG5-AS1_ENST00000414744.1_RNA|RP11-192H23.4_ENST00000534850.1_Intron|RP11-192H23.4_ENST00000577790.1_Intron|RP11-192H23.6_ENST00000579019.2_RNA|SPAG5-AS1_ENST00000424210.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)		p.P165H(1)|p.P204H(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GTGTACAAAGGGATGGTTGAT	0.488																																																	2	Substitution - Missense(2)	kidney(2)											121.0	100.0	107.0					17																	26939689		2203	4300	6503	SO:0001628	intergenic_variant	124923			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26939689G>T			A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301780	0.81136	.	.	ENSG00000167524	ENST00000301037;ENST00000530121	T;T	0.12465	2.68;2.68	5.97	4.99	0.66335	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.87097	2.86	0.51767	D	0.999936	D	0.89917	1.0	D	0.97110	1.0	T	0.50508	-0.8820	10	0.87932	D	0	-10.4308	13.6111	0.62078	0.0:0.0:0.8446:0.1554	.	165	Q96LW2	SG494_HUMAN	H	165;161	ENSP00000301037:P165H;ENSP00000434603:P161H	ENSP00000301037:P165H	P	-	2	0	AC005726.6	23963816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.692000	0.74578	1.513000	0.48852	0.655000	0.94253	CCC		0.488	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3		NM_014680	
SH3GLB2	56904	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	131772971	131772971	+	Splice_Site	SNP	A	A	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr9:131772971A>C	ENST00000372564.3	-	7	771	c.626T>G	c.(625-627)cTc>cGc	p.L209R	SH3GLB2_ENST00000416629.1_Splice_Site_p.L188R|SH3GLB2_ENST00000372554.4_Splice_Site_p.L213R|SH3GLB2_ENST00000417224.1_Splice_Site_p.L209R|SH3GLB2_ENST00000372559.1_Splice_Site_p.L209R	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	209	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)		p.L209R(1)		NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						ATCATTCCAGAGCTGTGGAGA	0.642																																																	1	Substitution - Missense(1)	kidney(1)											63.0	57.0	59.0					9																	131772971		2203	4300	6503	SO:0001630	splice_region_variant	56904			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.625-1T>G	9.37:g.131772971A>C			A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	ENST00000372564.3	37	CCDS6916.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.397431	0.83120	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.25085	1.82;1.82;1.98;1.87;2.02	5.23	5.23	0.72850	BAR (3);	0.064015	0.64402	D	0.000004	T	0.44117	0.1278	M	0.68317	2.08	0.80722	D	1	D;D	0.58970	0.984;0.973	P;P	0.59012	0.85;0.777	T	0.43491	-0.9388	10	0.87932	D	0	2.5901	12.4894	0.55891	1.0:0.0:0.0:0.0	.	213;209	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	R	209;209;213;213;209;188	ENSP00000361645:L209R;ENSP00000361640:L209R;ENSP00000361634:L213R;ENSP00000402566:L209R;ENSP00000388282:L188R	ENSP00000361634:L213R	L	-	2	0	SH3GLB2	130812792	1.000000	0.71417	0.996000	0.52242	0.831000	0.47069	5.995000	0.70631	1.976000	0.57569	0.459000	0.35465	CTC		0.642	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054535.2			Missense_Mutation
SIRPA	140885	hgsc.bcm.edu;ucsc.edu	37	20	1896052	1896054	+	In_Frame_Del	DEL	CGA	CGA	-	rs139878822|rs202172737	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	CGA	CGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr20:1896052_1896054delCGA	ENST00000358771.4	+	2	539_541	c.387_389delCGA	c.(385-390)cccgat>cct	p.D131del	SIRPA_ENST00000356025.3_In_Frame_Del_p.D131del|SIRPA_ENST00000400068.3_In_Frame_Del_p.D131del	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	131	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.D131delD(2)|p.D130A(1)|p.P129P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		AAGGGAGCCCCGATGACGTGGAG	0.527														1950	0.389377	0.264	0.4063	5008	,	,		16040	0.5933		0.2932	False		,,,				2504	0.4356				GBM(155;1668 1920 5945 42733 48121)												4	Deletion - In frame(2)|Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)|upper_aerodigestive_tract(1)|large_intestine(1)							,,	1147,3105		167,813,1146					,,	2.0	0.0		dbSNP_134	106	2654,5494		452,1750,1872	no	coding,coding,coding	SIRPA	NM_080792.2,NM_001040023.1,NM_001040022.1	,,	619,2563,3018	A1A1,A1R,RR		32.5724,26.9755,30.6532	,,	,,		3801,8599				SO:0001651	inframe_deletion	140885			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.387_389delCGA	20.37:g.1896052_1896054delCGA	ENSP00000351621:p.Asp131del		A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	In_Frame_Del	DEL	ENST00000358771.4	37	CCDS13022.1																																																																																				0.527	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2		NM_080792	
SLC39A4	55630	broad.mit.edu	37	8	145642062	145642062	+	Missense_Mutation	SNP	C	C	T	rs374966929		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr8:145642062C>T	ENST00000301305.3	-	1	217	c.112G>A	c.(112-114)Gct>Act	p.A38T	SLC39A4_ENST00000276833.5_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	38					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.A38T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			TGATCCAGAGCGCCCTGGCCA	0.677																																																	1	Substitution - Missense(1)	kidney(1)						C	THR/ALA	0,4404		0,0,2202	31.0	32.0	32.0		112	-0.2	0.1	8		32	1,8595	1.2+/-3.3	0,1,4297	no	missense	SLC39A4	NM_130849.2	58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	38/648	145642062	1,12999	2202	4298	6500	SO:0001583	missense	55630			AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.112G>A	8.37:g.145642062C>T	ENSP00000301305:p.Ala38Thr		Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	37	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607703	0.46527	0.0	1.16E-4	ENSG00000147804	ENST00000301305;ENST00000526658	T;T	0.58652	0.33;0.32	4.23	-0.164	0.13359	.	1.576910	0.04196	N	0.329087	T	0.36441	0.0967	N	0.19112	0.55	0.09310	N	0.999999	B	0.24533	0.105	B	0.10450	0.005	T	0.10132	-1.0643	10	0.17832	T	0.49	0.2853	2.9893	0.05978	0.2081:0.452:0.0:0.3399	.	38	Q6P5W5	S39A4_HUMAN	T	38	ENSP00000301305:A38T;ENSP00000434512:A38T	ENSP00000301305:A38T	A	-	1	0	SLC39A4	145612870	0.000000	0.05858	0.120000	0.21714	0.199000	0.23934	-3.764000	0.00372	0.113000	0.18004	0.306000	0.20318	GCT		0.677	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1			
SPAG5	10615	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	26905536	26905536	+	Missense_Mutation	SNP	T	T	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:26905536T>A	ENST00000321765.5	-	21	3541	c.3209A>T	c.(3208-3210)gAg>gTg	p.E1070V	ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000226253.4_5'Flank|ALDOC_ENST00000395321.2_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1070					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)		p.E1070V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					GGTCACCTCCTCTCTAAGGCT	0.537																																																	1	Substitution - Missense(1)	kidney(1)											70.0	71.0	70.0					17																	26905536		2203	4300	6503	SO:0001583	missense	10615			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3209A>T	17.37:g.26905536T>A	ENSP00000323300:p.Glu1070Val		O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	t	17.58	3.426021	0.62733	.	.	ENSG00000076382	ENST00000321765	T	0.33438	1.41	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000018	T	0.45135	0.1327	L	0.36672	1.1	0.38428	D	0.946366	D	0.89917	1.0	D	0.91635	0.999	T	0.48410	-0.9038	10	0.59425	D	0.04	-14.3707	13.0493	0.58946	0.0:0.0:0.0:1.0	.	1070	Q96R06	SPAG5_HUMAN	V	1070	ENSP00000323300:E1070V	ENSP00000323300:E1070V	E	-	2	0	SPAG5	23929663	0.209000	0.23505	1.000000	0.80357	0.988000	0.76386	1.604000	0.36804	2.076000	0.62316	0.529000	0.55759	GAG		0.537	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2		NM_006461	
SSH3	54961	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	11	67072383	67072383	+	Missense_Mutation	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr11:67072383G>A	ENST00000308127.4	+	3	422	c.244G>A	c.(244-246)Ggg>Agg	p.G82R	SSH3_ENST00000308298.7_Missense_Mutation_p.G82R|SSH3_ENST00000532181.1_3'UTR|SSH3_ENST00000376757.5_Missense_Mutation_p.G82R	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	82					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.G82R(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GACAGACTTCGGGCAAGGATC	0.617																																																	1	Substitution - Missense(1)	kidney(1)											50.0	51.0	51.0					11																	67072383		2199	4295	6494	SO:0001583	missense	54961			AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.244G>A	11.37:g.67072383G>A	ENSP00000312081:p.Gly82Arg		Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	37	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.700273	0.30142	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757	T;T;T	0.32988	3.55;1.43;3.71	5.06	3.07	0.35406	.	3.311630	0.00918	N	0.002558	T	0.29556	0.0737	L	0.31664	0.95	0.29908	N	0.823846	D	0.58620	0.983	P	0.45856	0.495	T	0.21314	-1.0249	10	0.62326	D	0.03	-26.039	5.8242	0.18544	0.098:0.0:0.7134:0.1886	.	82	Q8TE77	SSH3_HUMAN	R	82	ENSP00000312081:G82R;ENSP00000310055:G82R;ENSP00000365948:G82R	ENSP00000312081:G82R	G	+	1	0	SSH3	66828959	0.685000	0.27652	0.912000	0.35992	0.201000	0.24016	1.886000	0.39688	1.145000	0.42336	-0.221000	0.12465	GGG		0.617	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1		NM_018276	
ST18	9705	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	53085059	53085059	+	Missense_Mutation	SNP	C	C	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr8:53085059C>A	ENST00000276480.7	-	10	1045	c.362G>T	c.(361-363)tGt>tTt	p.C121F		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	121					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C121F(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CTCTTGATAACAAGAGTATCT	0.348																																																	1	Substitution - Missense(1)	kidney(1)											51.0	53.0	52.0					8																	53085059		2203	4300	6503	SO:0001583	missense	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.362G>T	8.37:g.53085059C>A	ENSP00000276480:p.Cys121Phe		Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421463	0.25639	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.45668	0.93;0.89	5.25	4.37	0.52481	.	0.274088	0.41097	D	0.000960	T	0.36608	0.0973	L	0.47716	1.5	0.28376	N	0.919761	B	0.33448	0.412	B	0.31614	0.133	T	0.41233	-0.9520	10	0.51188	T	0.08	-2.6654	14.0932	0.65004	0.0:0.9262:0.0:0.0738	.	121	O60284	ST18_HUMAN	F	121	ENSP00000276480:C121F;ENSP00000428521:C121F	ENSP00000276480:C121F	C	-	2	0	ST18	53247612	0.046000	0.20272	0.803000	0.32268	0.445000	0.32107	1.389000	0.34453	2.445000	0.82738	0.655000	0.94253	TGT		0.348	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1			
STAG1	10274	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	136062787	136062787	+	Silent	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr3:136062787G>T	ENST00000383202.2	-	30	3589	c.3333C>A	c.(3331-3333)ccC>ccA	p.P1111P	STAG1_ENST00000434713.2_Silent_p.P851P|STAG1_ENST00000236698.5_Silent_p.P1111P|STAG1_ENST00000536929.1_Silent_p.P695P	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1111					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.P1111P(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						GTGCTGGCAGGGGGCCAGGAG	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											133.0	115.0	121.0					3																	136062787		2203	4300	6503	SO:0001819	synonymous_variant	10274			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.3333C>A	3.37:g.136062787G>T			O00539|Q6P275	Silent	SNP	ENST00000383202.2	37	CCDS3090.1																																																																																				0.507	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1		NM_005862	
SUZ12	23512	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	30321020	30321020	+	Missense_Mutation	SNP	A	A	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:30321020A>C	ENST00000322652.5	+	12	1659	c.1430A>C	c.(1429-1431)aAc>aCc	p.N477T	SUZ12_ENST00000580398.1_Missense_Mutation_p.N454T	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	477					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)	p.N477T(1)	SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TTTATCTTCAACTATGTTGTG	0.333			T	JAZF1	endometrial stromal tumours																																			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	1	Substitution - Missense(1)	kidney(1)											62.0	59.0	60.0					17																	30321020		2203	4300	6503	SO:0001583	missense	23512			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1430A>C	17.37:g.30321020A>C	ENSP00000316578:p.Asn477Thr		Q96BD9	Missense_Mutation	SNP	ENST00000322652.5	37	CCDS11270.1	.	.	.	.	.	.	.	.	.	.	a	12.36	1.913393	0.33815	.	.	ENSG00000178691	ENST00000322652	T	0.39997	1.05	5.38	5.38	0.77491	.	0.183132	0.56097	D	0.000034	T	0.25121	0.0610	N	0.16790	0.44	0.48632	D	0.99968	B;P	0.43024	0.002;0.798	B;B	0.39465	0.001;0.3	T	0.12041	-1.0563	10	0.02654	T	1	-1.398	15.4188	0.74995	1.0:0.0:0.0:0.0	.	477;477	A8K1U9;Q15022	.;SUZ12_HUMAN	T	477	ENSP00000316578:N477T	ENSP00000316578:N477T	N	+	2	0	SUZ12	27345133	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.448000	0.80631	2.044000	0.60594	0.524000	0.50904	AAC		0.333	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256260.2		NM_015355	
SYK	6850	broad.mit.edu;ucsc.edu	37	9	93606288	93606288	+	Silent	SNP	T	T	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr9:93606288T>C	ENST00000375754.4	+	2	256	c.108T>C	c.(106-108)gaT>gaC	p.D36D	SYK_ENST00000375746.1_Silent_p.D36D|SYK_ENST00000375751.4_Silent_p.D36D|SYK_ENST00000476708.1_3'UTR|SYK_ENST00000375747.1_Silent_p.D36D	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	36	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.D36D(2)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						GCATGAGTGATGGGCTTTATT	0.627			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	2	Substitution - coding silent(2)	kidney(2)											61.0	41.0	48.0					9																	93606288		2203	4300	6503	SO:0001819	synonymous_variant	6850			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.108T>C	9.37:g.93606288T>C				Silent	SNP	ENST00000375754.4	37	CCDS6688.1																																																																																				0.627	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053018.1			
TAF1B	9014	hgsc.bcm.edu	37	2	9989571	9989571	+	Frame_Shift_Del	DEL	A	A	-	rs528368939		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:9989571delA	ENST00000263663.5	+	3	375	c.187delA	c.(187-189)aaafs	p.K65fs	TAF1B_ENST00000396242.3_5'UTR|TAF1B_ENST00000402170.1_3'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	65	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGGGGGCTTAAAAAAAAAAA	0.333																																																	0										139,495,3606		1,2,135,2,489,1491	20.0	22.0	21.0			1.7	0.9	2		23	207,946,7081		0,0,207,0,946,2964	no	codingComplex	TAF1B	NM_005680.2		1,2,342,2,1435,4455	A1A1,A1A2,A1R,A2A2,A2R,RR		14.0029,14.9528,14.3258			9989571	346,1441,10687	2194	4292	6486	SO:0001589	frameshift_variant	9014			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.187delA	2.37:g.9989571delA	ENSP00000263663:p.Lys65fs		B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	ENST00000263663.5	37	CCDS33143.1																																																																																				0.333	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2		NM_005680	
TBC1D3G	654341	hgsc.bcm.edu	37	17	34746599	34746600	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr17:34746599_34746600insG	ENST00000330458.7	-	14	1640_1641	c.1484_1485insC	c.(1483-1485)gctfs	p.A495fs	TBC1D3H_ENST00000455054.2_Frame_Shift_Ins_p.A495fs|TBC1D3G_ENST00000535592.1_Frame_Shift_Ins_p.A473fs|TBC1D3G_ENST00000535805.1_Frame_Shift_Ins_p.A415fs|TBC1D3C_ENST00000451448.2_Intron|TBC1D3H_ENST00000394359.3_Frame_Shift_Ins_p.A473fs|TBC1D3C_ENST00000308078.7_Intron|TBC1D3H_ENST00000535446.1_Intron|TBC1D3H_ENST00000400684.4_Intron			Q6DHY5	TBC3G_HUMAN	TBC1 domain family, member 3G	495						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)	1		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGGGTGTTCAGCCTGCCAGCA	0.624																																																	0																																										SO:0001589	frameshift_variant	729877					17q12	2014-04-11			ENSG00000161583	ENSG00000260287			29860	protein-coding gene	gene with protein product						16863688	Standard			Approved			Q6DHY5	OTTHUMG00000132711	ENST00000330458.7:c.1485dupC	17.37:g.34746600_34746600dupG	ENSP00000332729:p.Ala495fs		A8K8H9	Frame_Shift_Ins	INS	ENST00000330458.7	37																																																																																					0.624	TBC1D3G-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_001040282	
TM6SF2	53345	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	19380554	19380554	+	Silent	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:19380554G>C	ENST00000389363.4	-	5	498	c.426C>G	c.(424-426)ctC>ctG	p.L142L	TM6SF2_ENST00000586107.1_5'UTR|AC138430.4_ENST00000586064.2_RNA	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	142						integral component of membrane (GO:0016021)		p.L142L(1)		breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			CCAGCCAGTAGAGTCCAAAAT	0.542																																																	1	Substitution - coding silent(1)	kidney(1)											163.0	171.0	169.0					19																	19380554		1940	4143	6083	SO:0001819	synonymous_variant	53345			AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.426C>G	19.37:g.19380554G>C			Q0IJ64	Silent	SNP	ENST00000389363.4	37	CCDS42528.1																																																																																				0.542	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460122.2		NM_203510	
TMBIM1	64114	broad.mit.edu	37	2	219146894	219146894	+	De_novo_Start_InFrame	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr2:219146894G>T	ENST00000444881.1	-	0	696				PNKD_ENST00000273077.4_Intron|TMBIM1_ENST00000258412.3_De_novo_Start_InFrame|TMBIM1_ENST00000445635.1_Intron|TMBIM1_ENST00000396809.2_De_novo_Start_InFrame|PNKD_ENST00000472650.1_Intron			Q969X1	LFG3_HUMAN	transmembrane BAX inhibitor motif containing 1						negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of Fas signaling pathway (GO:1902045)|negative regulation of metalloenzyme activity (GO:0048553)|positive regulation of blood vessel remodeling (GO:2000504)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	death receptor binding (GO:0005123)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)	9		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGAACCCCAGCTGCTGGGAC	0.647																																																	0													16.0	19.0	18.0					2																	219146894		2188	4286	6474			64114			BN000408	CCDS2412.1	2q35	2010-03-18			ENSG00000135926	ENSG00000135926			23410	protein-coding gene	gene with protein product		610364				12477932	Standard	NM_022152		Approved	PP1201, RECS1, LFG3	uc002vhp.1	Q969X1	OTTHUMG00000133105		2.37:g.219146894G>T			B3KQY6|Q8N1R3|Q8TAM3|Q96K13	Translation_Start_Site	SNP	ENST00000444881.1	37	CCDS2412.1																																																																																				0.647	TMBIM1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338559.1		NM_022152	
TMTC2	160335	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	83525988	83525988	+	Splice_Site	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr12:83525988G>C	ENST00000321196.3	+	12	3038		c.e12-1		TMTC2_ENST00000549919.1_Splice_Site	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2						calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.?(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TCTTGTTGCAGTATCCGGCTG	0.478																																																	1	Unknown(1)	kidney(1)											94.0	85.0	88.0					12																	83525988		2203	4300	6503	SO:0001630	splice_region_variant	160335			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.2332-1G>C	12.37:g.83525988G>C			B2RCU7|Q8N2K8	Splice_Site	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772442	0.31411	.	.	ENSG00000179104	ENST00000321196;ENST00000549919;ENST00000546590	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3253	0.90251	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMTC2	82050119	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	9.804000	0.99143	2.581000	0.87130	0.591000	0.81541	.		0.478	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1		NM_152588	Intron
UBE3A	7337	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	25616769	25616769	+	Missense_Mutation	SNP	G	G	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr15:25616769G>C	ENST00000397954.2	-	4	560	c.561C>G	c.(559-561)gaC>gaG	p.D187E	SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000428984.2_Missense_Mutation_p.D164E|UBE3A_ENST00000232165.3_Missense_Mutation_p.D184E|UBE3A_ENST00000566215.1_Missense_Mutation_p.D164E|UBE3A_ENST00000438097.1_Missense_Mutation_p.D164E			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	187					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)	p.D187E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CTTCATCTTTGTCTTCATCTT	0.423																																																	1	Substitution - Missense(1)	kidney(1)											167.0	163.0	165.0					15																	25616769		2203	4300	6503	SO:0001583	missense	7337			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.561C>G	15.37:g.25616769G>C	ENSP00000381045:p.Asp187Glu		A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	37	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236490	0.39498	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.22743	1.95;1.94;1.94;1.94	5.84	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.17109	0.0411	L	0.49350	1.555	0.58432	D	0.999997	B;P	0.35077	0.035;0.483	B;B	0.27887	0.013;0.084	T	0.03103	-1.1072	10	0.59425	D	0.04	.	8.7247	0.34463	0.283:0.0:0.717:0.0	.	184;187	Q05086-3;Q05086	.;UBE3A_HUMAN	E	184;184;187;164;164	ENSP00000232165:D184E;ENSP00000381045:D187E;ENSP00000411258:D164E;ENSP00000401265:D164E	ENSP00000232165:D184E	D	-	3	2	UBE3A	23167862	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	0.377000	0.20552	0.830000	0.34757	0.591000	0.81541	GAC		0.423	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1		NM_000462	
Unknown	0	broad.mit.edu	37	1	143255819	143255820	+	IGR	INS	-	-	TTTT	rs191599017|rs145582883		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:143255819_143255820insTTTT								RP11-782C8.1 (22402 upstream) : RP11-435B5.3 (92149 downstream)																							gtcaatatggatttttttttga	0.356																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.143255824_143255827dupTTTT				RNA	INS		37																																																																																				0	0.356									
Unknown	0	broad.mit.edu	37	1	148891580	148891580	+	IGR	SNP	A	A	T	rs374678179		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:148891580A>T								RP11-763B22.6 (37863 upstream) : RNA5SP59 (21692 downstream)																							GAATCAGGGAAGACTCAGTTA	0.358																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.148891580A>T				RNA	SNP		37																																																																																				0	0.358									
Unknown	0	broad.mit.edu	37	1	148891643	148891643	+	IGR	SNP	A	A	G	rs200975583		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr1:148891643A>G								RP11-763B22.6 (37926 upstream) : RNA5SP59 (21629 downstream)																							CCAAAACTGAAATTGAAGATT	0.423																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.148891643A>G				RNA	SNP		37																																																																																				0	0.423									
SMPD4P1	645280	broad.mit.edu	37	22	20980390	20980390	+	RNA	SNP	A	A	G			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr22:20980390A>G	ENST00000443839.1	-	0	1388									sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3) pseudogene 1																		TACCAGTAGAAAGCTGGGCCG	0.473																																																	0																																												0					22q11.21	2011-03-22			ENSG00000223553	ENSG00000223553			39673	pseudogene	pseudogene							Standard	NG_028286		Approved				OTTHUMG00000030245		22.37:g.20980390A>G				RNA	SNP	ENST00000443839.1	37																																																																																					0.473	SMPD4P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000319965.1			
MIR4477B	100616194	broad.mit.edu	37	9	68413654	68413654	+	RNA	SNP	G	G	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr9:68413654G>A	ENST00000581659.1	+	0	0					NR_039688.1|NR_039689.1				microRNA 4477b																		GAGTGCAGACGAGAGCCCCGG	0.642																																																	0																																												0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68413654G>A				RNA	SNP	ENST00000581659.1	37																																																																																					0.642	MIR4477B-201	KNOWN	basic	miRNA	miRNA			NR_039689	
WDFY4	57705	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	10	50108353	50108353	+	Splice_Site	SNP	T	T	A			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr10:50108353T>A	ENST00000325239.5	+	45	7550		c.e45+2		WDFY4_ENST00000413659.2_Splice_Site|RP11-523O18.7_ENST00000430438.1_RNA	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral component of membrane (GO:0016021)		p.?(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTTTAAAAGGTAAGAGCTTGA	0.458																																																	1	Unknown(1)	kidney(1)											156.0	132.0	139.0					10																	50108353		692	1591	2283	SO:0001630	splice_region_variant	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7523+2T>A	10.37:g.50108353T>A			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Splice_Site	SNP	ENST00000325239.5	37	CCDS44385.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.161792	0.57368	.	.	ENSG00000128815	ENST00000426033;ENST00000325239;ENST00000312002;ENST00000265453	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6773	0.51438	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDFY4	49778359	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	4.278000	0.58946	2.064000	0.61679	0.533000	0.62120	.		0.458	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			XM_033379	Intron
ZHX3	23051	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	39831405	39831405	+	Missense_Mutation	SNP	C	C	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr20:39831405C>T	ENST00000309060.3	-	4	2567	c.2152G>A	c.(2152-2154)Gca>Aca	p.A718T	ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000432768.2_Missense_Mutation_p.A718T|ZHX3_ENST00000540170.1_Missense_Mutation_p.A718T|ZHX3_ENST00000559234.1_Missense_Mutation_p.A718T|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000544979.2_Missense_Mutation_p.A718T|ZHX3_ENST00000560361.1_Missense_Mutation_p.A718T			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	718					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.A718T(1)		endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				TTGCGCTCTGCCAAGATATGG	0.547																																																	1	Substitution - Missense(1)	kidney(1)											80.0	79.0	80.0					20																	39831405		2203	4300	6503	SO:0001583	missense	23051			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2152G>A	20.37:g.39831405C>T	ENSP00000312222:p.Ala718Thr		E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.635|5.635	0.301905|0.301905	0.10678|0.10678	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262|ENST00000421422	T;T;T|.	0.11930|.	2.95;2.95;2.73|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.366620|.	0.28062|.	N|.	0.016758|.	T|T	0.54415|0.54415	0.1857|0.1857	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	0.999999|0.999999	P;P;B|.	0.43094|.	0.799;0.651;0.049|.	B;B;B|.	0.33339|.	0.162;0.058;0.029|.	T|T	0.50874|0.50874	-0.8776|-0.8776	10|5	0.26408|.	T|.	0.33|.	-16.6036|-16.6036	13.7909|13.7909	0.63140|0.63140	0.0:0.9305:0.0:0.0695|0.0:0.9305:0.0:0.0695	.|.	718;718;718|.	A8K8Q0;Q9H4I2;F5H820|.	.;ZHX3_HUMAN;.|.	T|D	718;718;718;718;496|426	ENSP00000362360:A718T;ENSP00000442290:A718T;ENSP00000443783:A718T|.	ENSP00000312222:A718T|.	A|G	-|-	1|2	0|0	ZHX3|ZHX3	39264819|39264819	0.003000|0.003000	0.15002|0.15002	0.459000|0.459000	0.27081|0.27081	0.367000|0.367000	0.29736|0.29736	1.235000|1.235000	0.32671|0.32671	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GCA|GGC		0.547	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3		NM_015035	
ZNF625	90589	broad.mit.edu	37	19	12258560	12258560	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:12258560G>T	ENST00000355738.1	-	0	216				ZNF625_ENST00000542938.1_De_novo_Start_OutOfFrame|ZNF625-ZNF20_ENST00000430024.1_Missense_Mutation_p.L21M|ZNF625_ENST00000455799.1_Missense_Mutation_p.L21M|ZNF625_ENST00000439556.2_Missense_Mutation_p.L21M			Q96I27	ZN625_HUMAN	zinc finger protein 625						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L21M(1)		breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						GAAGGATCCAGCAAAGCCCAC	0.458																																																	1	Substitution - Missense(1)	kidney(1)																																										7568			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000355738.1:c.-134C>A	19.37:g.12258560G>T			A4FU45|I3L0E9	Translation_Start_Site	SNP	ENST00000355738.1	37		.	.	.	.	.	.	.	.	.	.	G	10.33	1.321687	0.23994	.	.	ENSG00000257591	ENST00000414892;ENST00000455799;ENST00000439556	T;T;T	0.18960	2.18;2.18;2.18	0.981	0.981	0.19756	.	.	.	.	.	T	0.20088	0.0483	.	.	.	0.20196	N	0.999929	.	.	.	.	.	.	T	0.25222	-1.0138	6	0.87932	D	0	.	4.2081	0.10498	0.0:0.0:0.602:0.398	.	.	.	.	M	20;21;21	ENSP00000405156:L20M;ENSP00000398518:L21M;ENSP00000394380:L21M	ENSP00000405156:L20M	L	-	1	2	AC022415.5	12119560	0.055000	0.20627	0.078000	0.20375	0.008000	0.06430	0.268000	0.18571	0.844000	0.35094	0.460000	0.39030	CTG		0.458	ZNF625-201	KNOWN	basic	protein_coding	protein_coding			NM_145233	
ZNF492	57615	hgsc.bcm.edu	37	19	22836805	22836805	+	Missense_Mutation	SNP	G	G	A	rs200144130		TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:22836805G>A	ENST00000456783.2	+	3	362	c.118G>A	c.(118-120)Gct>Act	p.A40T		NM_020855.2	NP_065906.1	Q9P255	ZN492_HUMAN	zinc finger protein 492	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A40T(2)		endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				TGAGATGGTAGCTGAACCCCC	0.408																																																	2	Substitution - Missense(2)	prostate(2)																																								SO:0001583	missense	57615			AB040906	CCDS46032.1	19p13.11	2013-01-08				ENSG00000229676		"""Zinc fingers, C2H2-type"""	23707	protein-coding gene	gene with protein product			"""zinc finger protein 115 (Y20)"""	ZNF115		10819331	Standard	NM_020855		Approved	KIAA1473	uc002nqw.3	Q9P255		ENST00000456783.2:c.118G>A	19.37:g.22836805G>A	ENSP00000413660:p.Ala40Thr		Q08EI7|Q08EI8	Missense_Mutation	SNP	ENST00000456783.2	37	CCDS46032.1	.	.	.	.	.	.	.	.	.	.	.	10.18	1.279365	0.23307	.	.	ENSG00000229676	ENST00000456783	T	0.07688	3.17	0.458	0.458	0.16670	Krueppel-associated box (1);	.	.	.	.	T	0.13372	0.0324	M	0.72576	2.205	0.09310	N	1	P	0.45011	0.848	P	0.46585	0.521	T	0.13899	-1.0492	8	0.42905	T	0.14	.	.	.	.	.	40	Q9P255	ZN492_HUMAN	T	40	ENSP00000413660:A40T	ENSP00000413660:A40T	A	+	1	0	ZNF492	22628645	0.064000	0.20934	0.002000	0.10522	0.002000	0.02628	1.318000	0.33643	0.482000	0.27582	0.484000	0.47621	GCT		0.408	ZNF492-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464581.1		NM_020855	
ZNF546	339327	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	40519782	40519782	+	Missense_Mutation	SNP	T	T	C			TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:40519782T>C	ENST00000347077.4	+	7	821	c.605T>C	c.(604-606)aTa>aCa	p.I202T	ZNF546_ENST00000600094.1_Missense_Mutation_p.I176T|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I202T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAAAAACAAATATCTCATCCT	0.353																																																	1	Substitution - Missense(1)	kidney(1)											86.0	84.0	84.0					19																	40519782		2203	4300	6503	SO:0001583	missense	339327			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.605T>C	19.37:g.40519782T>C	ENSP00000339823:p.Ile202Thr		A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	t	0.307	-0.970352	0.02232	.	.	ENSG00000187187	ENST00000347077	T	0.06687	3.27	2.55	1.53	0.23141	.	.	.	.	.	T	0.03136	0.0092	N	0.04090	-0.28	0.09310	N	1	B;B	0.17667	0.023;0.005	B;B	0.17433	0.018;0.003	T	0.48055	-0.9068	9	0.12430	T	0.62	.	4.4285	0.11515	0.0:0.3085:0.0:0.6914	.	176;202	B3KVL3;Q86UE3	.;ZN546_HUMAN	T	202	ENSP00000339823:I202T	ENSP00000339823:I202T	I	+	2	0	ZNF546	45211622	0.000000	0.05858	0.018000	0.16275	0.043000	0.13939	-1.752000	0.01819	0.396000	0.25283	0.482000	0.46254	ATA		0.353	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2		NM_178544	
ZNF772	400720	hgsc.bcm.edu	37	19	57988666	57988667	+	In_Frame_Ins	INS	-	-	GCC	rs77164240|rs528587884|rs34678661|rs193920834	byFrequency	TCGA-CW-5589-01A-01D-1534-10	TCGA-CW-5589-11A-01D-1535-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1b353345-c75f-45fa-a2e3-86782b868abc	f3decfca-d5a9-49b9-8a45-98a8f305dd77	g.chr19:57988666_57988667insGCC	ENST00000343280.4	-	1	271_272	c.11_12insGGC	c.(10-12)gct>gcGGCt	p.4_4A>AA	AC004076.9_ENST00000415705.3_5'UTR|ZNF772_ENST00000601768.1_In_Frame_Ins_p.4_4A>AA|AC004076.9_ENST00000596831.1_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000427512.2_5'UTR|ZNF772_ENST00000600175.1_In_Frame_Ins_p.4_4A>AA|AC003005.2_ENST00000595422.1_lincRNA|ZNF772_ENST00000425074.3_In_Frame_Ins_p.4_4A>AA|ZNF772_ENST00000356584.3_In_Frame_Ins_p.4_4A>AA	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		CCATCGGCTCAGCCGCCGCCAT	0.644											OREG0025695	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		2037	0.406749	0.3124	0.4481	5008	,	,		16965	0.5823		0.2753	False		,,,				2504	0.4591				Melanoma(5;289 436 14293 15924 30817)												0									,	1273,2975		195,883,1046					,	-4.0	0.0		dbSNP_126	62	2294,5946		320,1654,2146	no	coding,coding	ZNF772	NM_001144068.1,NM_001024596.2	,	515,2537,3192	A1A1,A1R,RR		27.8398,29.967,28.5634	,	,		3567,8921				SO:0001652	inframe_insertion	400720			BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.9_11dupGGC	19.37:g.57988673_57988675dupGCC	ENSP00000341165:p.Ala4dup	1027	A6NJK9|B4DH56|B4DYS0	In_Frame_Ins	INS	ENST00000343280.4	37	CCDS33133.1																																																																																				0.644	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1		NM_001024596	
