#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ACAP2	23527	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	195009916	195009916	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:195009916G>A	ENST00000326793.6	-	21	2338	c.2108C>T	c.(2107-2109)aCt>aTt	p.T703I		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	703					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.T703I(1)		cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TTCTTCATCAGTGGCATGTTG	0.368																																																	1	Substitution - Missense(1)	kidney(1)											167.0	146.0	153.0					3																	195009916		2203	4300	6503	SO:0001583	missense	23527				CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.2108C>T	3.37:g.195009916G>A	ENSP00000324287:p.Thr703Ile		A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532229	0.45073	.	.	ENSG00000114331	ENST00000326793	T	0.65364	-0.15	5.52	5.52	0.82312	Ankyrin repeat-containing domain (4);	0.053437	0.85682	D	0.000000	T	0.49012	0.1532	N	0.20610	0.595	0.41134	D	0.985906	B	0.23806	0.091	B	0.27170	0.077	T	0.45585	-0.9251	10	0.37606	T	0.19	.	14.0916	0.64995	0.0:0.1504:0.8496:0.0	.	703	Q15057	ACAP2_HUMAN	I	703	ENSP00000324287:T703I	ENSP00000324287:T703I	T	-	2	0	ACAP2	196491205	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.018000	0.49625	2.583000	0.87209	0.650000	0.86243	ACT		0.368	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2		NM_012287	
SLC35G3	146861	broad.mit.edu;hgsc.bcm.edu	37	17	33521121	33521121	+	Missense_Mutation	SNP	G	G	A	rs149963193		TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:33521121G>A	ENST00000297307.5	-	1	291	c.206C>T	c.(205-207)tCg>tTg	p.S69L	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	69	EamA 1.					integral component of membrane (GO:0016021)		p.S69L(1)									CAGCTCCAGCGAGGGCAGGTT	0.637																																																	1	Substitution - Missense(1)	kidney(1)						G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	124.0	125.0	124.0		206		0.4	17	dbSNP_134	124	0,8600		0,0,4300	no	missense	SLC35G3	NM_152462.2	145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	69/339	33521121	1,13005	2203	4300	6503	SO:0001583	missense	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.206C>T	17.37:g.33521121G>A	ENSP00000297307:p.Ser69Leu		B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548358	0.45383	2.27E-4	0.0	ENSG00000164729	ENST00000297307	T	0.52754	0.65	.	.	.	.	0.000000	0.38897	N	0.001522	T	0.49253	0.1546	L	0.34521	1.04	0.40176	D	0.977238	D	0.76494	0.999	D	0.80764	0.994	T	0.43410	-0.9393	9	0.46703	T	0.11	-2.9895	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	69	Q8N808	S35G3_HUMAN	L	69	ENSP00000297307:S69L	ENSP00000297307:S69L	S	-	2	0	SLC35G3	30545234	1.000000	0.71417	0.406000	0.26421	0.407000	0.30961	4.343000	0.59348	0.064000	0.16427	0.064000	0.15345	TCG		0.637	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256445.2		NM_152462	
ANXA6	309	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	150519791	150519791	+	Missense_Mutation	SNP	C	C	T	rs200516508		TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr5:150519791C>T	ENST00000354546.5	-	3	259	c.32G>A	c.(31-33)cGg>cAg	p.R11Q	ANXA6_ENST00000377751.5_Missense_Mutation_p.R11Q|ANXA6_ENST00000521512.1_Missense_Mutation_p.R11Q|ANXA6_ENST00000356496.5_Missense_Mutation_p.R11Q|ANXA6_ENST00000523714.1_5'UTR	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	11					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)	p.R11Q(1)|p.R63Q(1)		endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATGGAGCCCCGGTACTTGGC	0.597																																																	2	Substitution - Missense(2)	kidney(2)						C	GLN/ARG,	3,3797		0,3,1897	54.0	61.0	59.0		32,	4.4	1.0	5		59	0,8232		0,0,4116	yes	missense,utr-5	ANXA6	NM_001155.4,NM_001193544.1	43,	0,3,6013	TT,TC,CC		0.0,0.0789,0.0249	probably-damaging,	11/674,	150519791	3,12029	1900	4116	6016	SO:0001583	missense	309			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.32G>A	5.37:g.150519791C>T	ENSP00000346550:p.Arg11Gln		B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	ENST00000354546.5	37	CCDS47315.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692583	0.68271	7.89E-4	0.0	ENSG00000197043	ENST00000354546;ENST00000377751;ENST00000356496;ENST00000521512;ENST00000517486;ENST00000523164	T;T;T;T;T;T	0.11604	2.76;4.46;2.76;3.57;3.57;3.57	5.31	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.26122	0.0637	L	0.55743	1.74	0.50632	D	0.999881	B;D;D	0.89917	0.003;1.0;1.0	B;D;D	0.77557	0.003;0.99;0.99	T	0.00792	-1.1564	10	0.34782	T	0.22	.	12.9161	0.58207	0.0:0.9201:0.0:0.0799	.	11;11;11	E5RK69;A6NN80;P08133	.;.;ANXA6_HUMAN	Q	11	ENSP00000346550:R11Q;ENSP00000366980:R11Q;ENSP00000348889:R11Q;ENSP00000430420:R11Q;ENSP00000428916:R11Q;ENSP00000431078:R11Q	ENSP00000346550:R11Q	R	-	2	0	ANXA6	150499984	1.000000	0.71417	0.964000	0.40570	0.420000	0.31355	6.650000	0.74368	1.236000	0.43740	-0.258000	0.10820	CGG		0.597	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2		NM_001155	
APH1B	83464	broad.mit.edu;hgsc.bcm.edu	37	15	63569840	63569840	+	Silent	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr15:63569840C>T	ENST00000261879.5	+	1	88	c.18C>T	c.(16-18)ttC>ttT	p.F6F	APH1B_ENST00000380343.4_Silent_p.F6F	NM_001145646.1|NM_031301.3	NP_001139118.1|NP_112591.2	Q8WW43	APH1B_HUMAN	APH1B gamma secretase subunit	6					apoptotic signaling pathway (GO:0097190)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	peptidase activity (GO:0008233)	p.F6F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	12						CGGCCGTGTTCTTCGGCTGCG	0.687																																																	1	Substitution - coding silent(1)	kidney(1)											38.0	39.0	39.0					15																	63569840		2203	4300	6503	SO:0001819	synonymous_variant	83464			AY358698	CCDS10184.1, CCDS45276.1	15q22.2	2013-05-01	2013-05-01		ENSG00000138613	ENSG00000138613			24080	protein-coding gene	gene with protein product		607630	"""anterior pharynx defective 1 homolog B (C. elegans)"""			12110170, 11230166	Standard	NM_031301		Approved	PSFL, APH-1B, DKFZp564D0372	uc002ama.3	Q8WW43	OTTHUMG00000132863	ENST00000261879.5:c.18C>T	15.37:g.63569840C>T			A8K589|Q564N3|Q6UWQ1|Q9H0S0	Silent	SNP	ENST00000261879.5	37	CCDS10184.1																																																																																				0.687	APH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256337.1		NM_031301	
ARMCX5	64860	broad.mit.edu	37	X	101858509	101858509	+	Silent	SNP	A	A	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chrX:101858509A>T	ENST00000604957.1	+	1	4062	c.1440A>T	c.(1438-1440)gcA>gcT	p.A480A	RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000541409.1_Silent_p.A480A|ARMCX5_ENST00000536530.1_Silent_p.A480A|RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000537008.1_Silent_p.A480A|ARMCX5_ENST00000372742.1_Silent_p.A480A|ARMCX5_ENST00000246174.2_Silent_p.A480A	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	480								p.A480A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						CATTGGTTGCACCCTTTAACA	0.303																																																	1	Substitution - coding silent(1)	kidney(1)											56.0	53.0	54.0					X																	101858509		2203	4298	6501	SO:0001819	synonymous_variant	64860				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.1440A>T	X.37:g.101858509A>T			B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Silent	SNP	ENST00000604957.1	37	CCDS14500.1																																																																																				0.303	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1		NM_022838	
ATP2A1	487	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	28909648	28909648	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr16:28909648C>T	ENST00000357084.3	+	14	1907	c.1640C>T	c.(1639-1641)gCg>gTg	p.A547V	ATP2A1_ENST00000395503.4_Missense_Mutation_p.A547V|ATP2A1_ENST00000536376.1_Missense_Mutation_p.A422V	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	547					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)	p.A547V(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						AAGATCATGGCGGTGATCAAG	0.652																																																	1	Substitution - Missense(1)	kidney(1)											55.0	61.0	59.0					16																	28909648		2197	4300	6497	SO:0001583	missense	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.1640C>T	16.37:g.28909648C>T	ENSP00000349595:p.Ala547Val		A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	ENST00000357084.3	37	CCDS10643.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459903	0.63401	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000395498;ENST00000536376	D;D;D	0.83419	-1.72;-1.72;-1.72	5.43	5.43	0.79202	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.604497	0.17647	N	0.166834	D	0.84955	0.5587	M	0.75264	2.295	0.33436	D	0.581712	B;B;B	0.24618	0.107;0.021;0.056	B;B;B	0.29176	0.014;0.099;0.06	D	0.87229	0.2259	10	0.66056	D	0.02	.	17.9902	0.89166	0.0:1.0:0.0:0.0	.	422;547;547	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	V	547;547;584;422	ENSP00000349595:A547V;ENSP00000378879:A547V;ENSP00000443101:A422V	ENSP00000349595:A547V	A	+	2	0	ATP2A1	28817149	0.014000	0.17966	0.013000	0.15412	0.517000	0.34286	2.609000	0.46317	2.533000	0.85409	0.655000	0.94253	GCG		0.652	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2		NM_004320	
BRPF3	27154	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	36185716	36185716	+	Silent	SNP	A	A	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:36185716A>G	ENST00000357641.6	+	9	3265	c.3012A>G	c.(3010-3012)aaA>aaG	p.K1004K	BRPF3_ENST00000543502.1_Silent_p.K734K|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000534400.1_Silent_p.K1004K|BRPF3_ENST00000339717.7_Silent_p.K734K|BRPF3_ENST00000443324.2_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	1004					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.K1004K(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GCTTTGGAAAACACACCGAAA	0.517																																																	1	Substitution - coding silent(1)	kidney(1)											169.0	138.0	149.0					6																	36185716		2203	4300	6503	SO:0001819	synonymous_variant	27154			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.3012A>G	6.37:g.36185716A>G			A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Silent	SNP	ENST00000357641.6	37	CCDS34437.1																																																																																				0.517	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3		NM_015695	
BMP5	653	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	55620404	55620404	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:55620404T>A	ENST00000370830.3	-	7	1990	c.1292A>T	c.(1291-1293)tAc>tTc	p.Y431F	BMP5_ENST00000446683.2_Missense_Mutation_p.Y394F	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	431					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)	p.Y431F(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			GTCATCAAAGTACAGAACAGA	0.348																																																	1	Substitution - Missense(1)	kidney(1)											105.0	105.0	105.0					6																	55620404		2203	4299	6502	SO:0001583	missense	653				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.1292A>T	6.37:g.55620404T>A	ENSP00000359866:p.Tyr431Phe		B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.258985	0.80246	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	D;D	0.84370	-1.84;-1.84	5.73	5.73	0.89815	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88945	0.6575	L	0.54965	1.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89813	0.3983	10	0.59425	D	0.04	.	16.3197	0.82945	0.0:0.0:0.0:1.0	.	394;431	B4E0Y4;P22003	.;BMP5_HUMAN	F	431;394	ENSP00000359866:Y431F;ENSP00000391818:Y394F	ENSP00000359866:Y431F	Y	-	2	0	BMP5	55728363	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.997000	0.88414	2.302000	0.77476	0.533000	0.62120	TAC		0.348	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1			
ARL14EP	120534	broad.mit.edu;hgsc.bcm.edu	37	11	30358133	30358133	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr11:30358133A>T	ENST00000282032.3	+	4	789	c.574A>T	c.(574-576)Agt>Tgt	p.S192C		NM_152316.1	NP_689529.1	Q8N8R7	AL14E_HUMAN	ADP-ribosylation factor-like 14 effector protein	192						cytoplasm (GO:0005737)		p.S192C(1)									ACCAGCAAAGAGTAAGGTCTA	0.348																																																	1	Substitution - Missense(1)	kidney(1)											137.0	116.0	123.0					11																	30358133		2202	4299	6501	SO:0001583	missense	0			AK096287	CCDS7869.1	11p14.1	2014-09-17	2012-07-09	2012-07-09	ENSG00000152219	ENSG00000152219			26798	protein-coding gene	gene with protein product		612295	"""chromosome 11 open reading frame 46"""	C11orf46		21458045	Standard	XM_005252792		Approved	FLJ38968, ARF7EP	uc001mso.1	Q8N8R7	OTTHUMG00000166154	ENST00000282032.3:c.574A>T	11.37:g.30358133A>T	ENSP00000282032:p.Ser192Cys		Q5HYH9	Missense_Mutation	SNP	ENST00000282032.3	37	CCDS7869.1	.	.	.	.	.	.	.	.	.	.	A	19.83	3.899564	0.72754	.	.	ENSG00000152219	ENST00000282032	T	0.65178	-0.14	5.87	5.87	0.94306	.	0.136113	0.52532	D	0.000079	T	0.72930	0.3522	L	0.46157	1.445	0.58432	D	0.999992	D	0.71674	0.998	D	0.64506	0.926	T	0.74359	-0.3691	10	0.59425	D	0.04	-14.4295	16.5764	0.84681	1.0:0.0:0.0:0.0	.	192	Q8N8R7	CK046_HUMAN	C	192	ENSP00000282032:S192C	ENSP00000282032:S192C	S	+	1	0	C11orf46	30314709	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	7.207000	0.77899	2.371000	0.80710	0.533000	0.62120	AGT		0.348	ARL14EP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388129.1		NM_152316	
MIS18BP1	55320	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	45673409	45673409	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr14:45673409C>T	ENST00000310806.4	-	17	3760	c.3302G>A	c.(3301-3303)gGa>gAa	p.G1101E		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	1101					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G1101E(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						AGAGTTTTCTCCTAAGTCTGT	0.274																																																	1	Substitution - Missense(1)	kidney(1)											26.0	29.0	28.0					14																	45673409		2191	4277	6468	SO:0001583	missense	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.3302G>A	14.37:g.45673409C>T	ENSP00000309790:p.Gly1101Glu		D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	37	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060823	0.36373	.	.	ENSG00000129534	ENST00000310806	T	0.19394	2.15	5.51	-1.22	0.09494	.	0.736603	0.13396	N	0.391038	T	0.12944	0.0314	L	0.44542	1.39	0.09310	N	0.999999	P	0.34462	0.454	B	0.22152	0.038	T	0.11641	-1.0579	10	0.56958	D	0.05	-2.2894	6.2905	0.21057	0.211:0.2876:0.436:0.0654	.	1101	Q6P0N0	M18BP_HUMAN	E	1101	ENSP00000309790:G1101E	ENSP00000309790:G1101E	G	-	2	0	MIS18BP1	44743159	0.002000	0.14202	0.891000	0.34965	0.869000	0.49853	-0.861000	0.04268	-0.204000	0.10235	-0.315000	0.08773	GGA		0.274	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2			
C17orf80	55028	hgsc.bcm.edu	37	17	71241322	71241325	+	Intron	DEL	GTAA	GTAA	-	rs150601360|rs202220073	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:71241322_71241325delGTAA	ENST00000535032.2	+	5	1842				RP11-661C3.2_ENST00000579037.1_RNA|C17orf80_ENST00000268942.8_Intron|C17orf80_ENST00000577615.1_Intron|C17orf80_ENST00000359042.2_Intron|C17orf80_ENST00000255557.4_Frame_Shift_Del_p.RK546fs|C17orf80_ENST00000426147.2_Frame_Shift_Del_p.RK582fs|C17orf80_ENST00000582793.1_Intron			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			CAGCGGTGGCGTAAGTAGTGTTGA	0.422														21	0.00419329	0.0008	0.0029	5008	,	,		17069	0.0		0.0159	False		,,,				2504	0.002																0									,,	10,3874		0,10,1932					,,	4.8	1.0			80	93,7941		2,89,3926	no	intron,frameshift,intron	C17orf80	NM_017941.4,NM_001100622.1,NM_001100621.1	,,	2,99,5858	A1A1,A1R,RR		1.1576,0.2575,0.8642	,,	,,		103,11815				SO:0001627	intron_variant	55028			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.1730-2055GTAA>-	17.37:g.71241322_71241325delGTAA			A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Frame_Shift_Del	DEL	ENST00000535032.2	37	CCDS11694.1																																																																																				0.422	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441893.1		NM_017941	
C9orf131	138724	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	9	35044086	35044086	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr9:35044086C>T	ENST00000312292.5	+	2	1507	c.1460C>T	c.(1459-1461)cCc>cTc	p.P487L	C9orf131_ENST00000421362.2_Missense_Mutation_p.P439L|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000354479.5_Missense_Mutation_p.P414L	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	487								p.P487L(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GTAATGGGCCCCCAGGGAGTC	0.537																																																	1	Substitution - Missense(1)	kidney(1)											74.0	80.0	78.0					9																	35044086		2203	4300	6503	SO:0001583	missense	138724			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1460C>T	9.37:g.35044086C>T	ENSP00000308279:p.Pro487Leu		A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	37	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	C	9.446	1.089386	0.20390	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292	T;T;T	0.17854	2.25;2.25;2.26	5.24	-1.01	0.10169	.	1.380470	0.04498	N	0.380714	T	0.11922	0.0290	L	0.28115	0.83	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.33471	-0.9867	10	0.28530	T	0.3	3.0964	6.611	0.22751	0.0:0.5596:0.1246:0.3158	.	487;414;439	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	L	439;414;487	ENSP00000393683:P439L;ENSP00000346472:P414L;ENSP00000308279:P487L	ENSP00000308279:P487L	P	+	2	0	C9orf131	35034086	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.340000	0.07821	-0.100000	0.12241	-1.990000	0.00449	CCC		0.537	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5		NM_203299	
MCU	90550	hgsc.bcm.edu;ucsc.edu	37	10	74645575	74645578	+	Stop_Codon_Del	DEL	GATT	GATT	-	rs142030206	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	GATT	GATT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr10:74645575_74645578delGATT	ENST00000373053.3	+	0	1072_1075				MCU_ENST00000605416.1_3'UTR|MCU_ENST00000357157.6_Stop_Codon_Del|MCU_ENST00000536019.1_Stop_Codon_Del	NM_138357.2	NP_612366.1	Q8NE86	MCU_HUMAN	mitochondrial calcium uniporter						calcium ion transmembrane import into mitochondrion (GO:0036444)|calcium-mediated signaling (GO:0019722)|glucose homeostasis (GO:0042593)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein complex oligomerization (GO:0035786)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|uniplex complex (GO:1990246)	calcium channel activity (GO:0005262)|uniporter activity (GO:0015292)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	14						TGGTGAAAAAGATTGATCTGCAAA	0.436																																																	0																																										SO:0001567	stop_retained_variant	0			BC034235	CCDS7317.1, CCDS59218.1, CCDS59219.1	10q22.2	2011-06-23	2011-06-23	2011-06-23	ENSG00000156026	ENSG00000156026			23526	protein-coding gene	gene with protein product		614197	"""coiled-coil domain containing 109A"""	C10orf42, CCDC109A		21685886, 21685888	Standard	NM_138357		Approved	FLJ46135	uc001jtc.3	Q8NE86	OTTHUMG00000018443	Exception_encountered	10.37:g.74645575_74645578delGATT	ENSP00000362144:p.*352Leuext*52		B2RDF3|B3KXV7|Q96FL3	Frame_Shift_Del	DEL	ENST00000373053.3	37	CCDS7317.1																																																																																				0.436	MCU-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048594.1		NM_138357	
CD1D	912	hgsc.bcm.edu;ucsc.edu	37	1	158151283	158151284	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:158151283_158151284insG	ENST00000368171.3	+	3	599_600	c.100_101insG	c.(100-102)tcgfs	p.S34fs		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	34					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CCTCCAGATCTCGTCCTTCGCC	0.624																																																	0																																										SO:0001589	frameshift_variant	912			BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	Exception_encountered	1.37:g.158151283_158151284insG	ENSP00000357153:p.Ser34fs		D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Frame_Shift_Ins	INS	ENST00000368171.3	37	CCDS1173.1																																																																																				0.624	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1		NM_001766	
CEP290	80184	hgsc.bcm.edu;ucsc.edu	37	12	88471086	88471086	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr12:88471086delA	ENST00000552810.1	-	41	5965	c.5622delT	c.(5620-5622)attfs	p.I1874fs	CEP290_ENST00000309041.7_Frame_Shift_Del_p.I1876fs|CEP290_ENST00000547691.2_Frame_Shift_Del_p.I934fs|CEP290_ENST00000397838.3_Frame_Shift_Del_p.I934fs	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1874					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						GGAGTTCTTCAATTAGACTTT	0.289																																																	0													78.0	65.0	69.0					12																	88471086		1789	4053	5842	SO:0001589	frameshift_variant	80184			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.5622delT	12.37:g.88471086delA	ENSP00000448012:p.Ile1874fs		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Frame_Shift_Del	DEL	ENST00000552810.1	37	CCDS55858.1																																																																																				0.289	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1		NM_025114	
CIC	23152	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	42797181	42797181	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr19:42797181G>C	ENST00000575354.2	+	15	3583	c.3543G>C	c.(3541-3543)aaG>aaC	p.K1181N	CIC_ENST00000160740.3_Missense_Mutation_p.K1179N|CIC_ENST00000572681.2_Missense_Mutation_p.K2088N	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1181	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K1181N(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				AGAAAGTGAAGGCAGCCATCG	0.657			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	1	Substitution - Missense(1)	kidney(1)											23.0	26.0	25.0					19																	42797181		2175	4240	6415	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3543G>C	19.37:g.42797181G>C	ENSP00000458663:p.Lys1181Asn		Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633274	0.47049	.	.	ENSG00000079432	ENST00000160740	.	.	.	5.06	4.02	0.46733	.	.	.	.	.	T	0.54078	0.1836	N	0.19112	0.55	0.40999	D	0.98491	D	0.71674	0.998	D	0.78314	0.991	T	0.58544	-0.7618	8	0.87932	D	0	-16.7766	8.1889	0.31357	0.1838:0.0:0.8162:0.0	.	1181	Q96RK0	CIC_HUMAN	N	1181	.	ENSP00000160740:K1181N	K	+	3	2	CIC	47489021	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.555000	0.53727	1.276000	0.44395	0.484000	0.47621	AAG		0.657	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2			
CSMD2	114784	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	34033301	34033301	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:34033301G>A	ENST00000373381.4	-	53	8448	c.8272C>T	c.(8272-8274)Cgg>Tgg	p.R2758W		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2735	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2735W(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				ACACTGCCCCGGTAGCTGTAG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											119.0	96.0	104.0					1																	34033301		2203	4300	6503	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8272C>T	1.37:g.34033301G>A	ENSP00000362479:p.Arg2758Trp		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	17.37	3.372953	0.61624	.	.	ENSG00000121904	ENST00000373381	T	0.66099	-0.19	5.31	3.36	0.38483	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.77916	0.4202	M	0.81614	2.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.78856	-0.2039	10	0.62326	D	0.03	.	11.6293	0.51164	0.0:0.1344:0.7259:0.1397	.	2735;2758	Q7Z408;E7EUA6	CSMD2_HUMAN;.	W	2758	ENSP00000362479:R2758W	ENSP00000241312:R2735W	R	-	1	2	CSMD2	33805888	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.875000	0.56108	0.680000	0.31366	0.655000	0.94253	CGG		0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_052896	
DNAH9	1770	broad.mit.edu;hgsc.bcm.edu	37	17	11593688	11593688	+	Nonsense_Mutation	SNP	C	C	T	rs144649934	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:11593688C>T	ENST00000262442.4	+	20	4617	c.4549C>T	c.(4549-4551)Cga>Tga	p.R1517*	DNAH9_ENST00000454412.2_Nonsense_Mutation_p.R1517*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1517	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1517*(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGAAGTGCAGCGAACATGGAC	0.483																																																	1	Substitution - Nonsense(1)	kidney(1)						C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	81.0	80.0	80.0		4549	4.6	1.0	17	dbSNP_134	80	0,8600		0,0,4300	no	stop-gained	DNAH9	NM_001372.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1517/4487	11593688	1,13005	2203	4300	6503	SO:0001587	stop_gained	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4549C>T	17.37:g.11593688C>T	ENSP00000262442:p.Arg1517*		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	41	9.058837	0.99051	2.27E-4	0.0	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	5.57	4.6	0.57074	.	0.066681	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1697	0.37074	0.1453:0.7818:0.0:0.0728	.	.	.	.	X	1517;1517;99	.	ENSP00000262442:R1517X	R	+	1	2	DNAH9	11534413	1.000000	0.71417	0.954000	0.39281	0.193000	0.23685	0.824000	0.27379	1.366000	0.46076	0.655000	0.94253	CGA		0.483	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2		NM_001372	
DST	667	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	56357198	56357198	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:56357198G>A	ENST00000361203.3	-	80	19631	c.19624C>T	c.(19624-19626)Cag>Tag	p.Q6542*	DST_ENST00000370788.2_Nonsense_Mutation_p.Q4456*|DST_ENST00000370769.4_Nonsense_Mutation_p.Q6653*|DST_ENST00000244364.6_Nonsense_Mutation_p.Q4239*|DST_ENST00000370754.5_Nonsense_Mutation_p.Q6831*|DST_ENST00000446842.2_Nonsense_Mutation_p.Q6327*|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Nonsense_Mutation_p.Q4565*|DST_ENST00000340834.4_5'Flank			Q03001	DYST_HUMAN	dystonin	6542					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.Q4239*(1)|p.Q6653*(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCTATTATCTGCTCACGATGA	0.328																																																	2	Substitution - Nonsense(2)	kidney(2)											103.0	96.0	99.0					6																	56357198		1806	4066	5872	SO:0001587	stop_gained	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19624C>T	6.37:g.56357198G>A	ENSP00000354508:p.Gln6542*		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	58	32.223853	0.99980	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	.	.	.	5.08	5.08	0.68730	.	0.000000	0.47852	D	0.000203	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	18.821	0.92097	0.0:0.0:1.0:0.0	.	.	.	.	X	4239;6831;6653;4565;6327;4456;6542	.	ENSP00000244364:Q4239X	Q	-	1	0	DST	56465157	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.715000	0.98748	2.525000	0.85131	0.591000	0.81541	CAG		0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3		NM_001723	
AGO2	27161	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	141559213	141559213	+	Splice_Site	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr8:141559213C>T	ENST00000220592.5	-	12	1700	c.1588G>A	c.(1588-1590)Gcc>Acc	p.A530T	AGO2_ENST00000519980.1_Splice_Site_p.A530T	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	530	Interaction with guide RNA.|Piwi. {ECO:0000255|HAMAP-Rule:MF_03031}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)	p.A530T(1)									CCACACCTACCGTACACGGGC	0.647																																																	1	Substitution - Missense(1)	kidney(1)											40.0	40.0	40.0					8																	141559213		2203	4299	6502	SO:0001630	splice_region_variant	27161			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1588+1G>A	8.37:g.141559213C>T			Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	37	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400185	0.83120	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.29917	1.55;1.55	5.06	5.06	0.68205	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	M	0.71206	2.165	0.80722	D	1	D;D	0.60575	0.988;0.966	P;P	0.58210	0.814;0.835	T	0.50857	-0.8778	9	.	.	.	-7.199	18.7924	0.91980	0.0:1.0:0.0:0.0	.	530;530	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	T	530	ENSP00000220592:A530T;ENSP00000430176:A530T	.	A	-	1	0	EIF2C2	141628395	1.000000	0.71417	0.837000	0.33122	0.016000	0.09150	7.713000	0.84693	2.523000	0.85059	0.563000	0.77884	GCC		0.647	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4			Missense_Mutation
AGO3	192669	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	36509078	36509078	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:36509078A>G	ENST00000373191.4	+	17	2552	c.2203A>G	c.(2203-2205)Aca>Gca	p.T735A	AGO3_ENST00000246314.6_Missense_Mutation_p.T501A|AGO3_ENST00000471099.1_3'UTR	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	735	Piwi. {ECO:0000255|HAMAP-Rule:MF_03032}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)	p.T735A(1)									CCCAGCTGGAACAACAGTTGA	0.343																																																	1	Substitution - Missense(1)	kidney(1)											126.0	117.0	120.0					1																	36509078		2203	4300	6503	SO:0001583	missense	192669			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.2203A>G	1.37:g.36509078A>G	ENSP00000362287:p.Thr735Ala		B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.730681	0.89390	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.42513	0.97;0.97	5.7	5.7	0.88788	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.78953	0.4365	H	0.98901	4.365	0.80722	D	1	D	0.57571	0.98	D	0.71414	0.973	D	0.87771	0.2605	10	0.87932	D	0	-2.748	15.971	0.80019	1.0:0.0:0.0:0.0	.	735	Q9H9G7	AGO3_HUMAN	A	735;501	ENSP00000362287:T735A;ENSP00000246314:T501A	ENSP00000246314:T501A	T	+	1	0	EIF2C3	36281665	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.175000	0.68902	0.533000	0.62120	ACA		0.343	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4		NM_024852	
F11	2160	broad.mit.edu;hgsc.bcm.edu	37	4	187201213	187201213	+	Missense_Mutation	SNP	G	G	A	rs201688862		TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr4:187201213G>A	ENST00000403665.2	+	8	1155	c.803G>A	c.(802-804)cGc>cAc	p.R268H	F11_ENST00000264692.4_Missense_Mutation_p.R216H	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	268	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.R268H(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	CCCAGTACACGCATTAAAAAG	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19173	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	kidney(1)	GRCh37	CM083501	F11	M							80.0	81.0	80.0					4																	187201213		2203	4300	6503	SO:0001583	missense	2160			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.803G>A	4.37:g.187201213G>A	ENSP00000384957:p.Arg268His		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	37	CCDS3847.1	2|2	9.157509157509158E-4|9.157509157509158E-4	2|2	0.0040650406504065045|0.0040650406504065045	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	12.23|12.23	1.876356|1.876356	0.33162|0.33162	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000452239|ENST00000403665;ENST00000264692	.|D;D	.|0.90004	.|-2.6;-2.6	5.49|5.49	3.73|3.73	0.42828|0.42828	.|Apple domain (3);PAN-1 domain (1);Apple-like (1);	.|0.578150	.|0.17984	.|N	.|0.155446	D|D	0.91081|0.91081	0.7193|0.7193	M|M	0.77313|0.77313	2.365|2.365	0.09310|0.09310	N|N	1|1	.|D	.|0.69078	.|0.997	.|P	.|0.61658	.|0.892	T|T	0.80834|0.80834	-0.1205|-0.1205	5|10	.|0.14656	.|T	.|0.56	.|.	6.0532|6.0532	0.19796|0.19796	0.0744:0.1135:0.641:0.1711|0.0744:0.1135:0.641:0.1711	.|.	.|268	.|P03951	.|FA11_HUMAN	T|H	84|268;216	.|ENSP00000384957:R268H;ENSP00000264692:R216H	.|ENSP00000264692:R216H	A|R	+|+	1|2	0|0	F11|F11	187438207|187438207	0.001000|0.001000	0.12720|0.12720	0.374000|0.374000	0.26016|0.26016	0.188000|0.188000	0.23474|0.23474	0.734000|0.734000	0.26101|0.26101	0.774000|0.774000	0.33427|0.33427	0.644000|0.644000	0.83932|0.83932	GCA|CGC		0.393	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4			
FGD5	152273	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	3	14964587	14964587	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:14964587C>T	ENST00000285046.5	+	16	3952	c.3842C>T	c.(3841-3843)cCg>cTg	p.P1281L	FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000543601.1_Missense_Mutation_p.P1040L|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1281					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.P1281L(1)|p.P1040L(1)		NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AACAAGTACCCGCTGAAGTAC	0.617																																																	2	Substitution - Missense(2)	kidney(2)											74.0	78.0	77.0					3																	14964587		2027	4183	6210	SO:0001583	missense	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3842C>T	3.37:g.14964587C>T	ENSP00000285046:p.Pro1281Leu		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175793	0.78564	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.10860	2.83;2.83	4.85	4.85	0.62838	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);	0.000000	0.53938	D	0.000055	T	0.26484	0.0647	L	0.41236	1.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01444	-1.1353	10	0.56958	D	0.05	-17.5501	17.9776	0.89132	0.0:1.0:0.0:0.0	.	1040;1281	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	L	1281;1040	ENSP00000285046:P1281L;ENSP00000445949:P1040L	ENSP00000285046:P1281L	P	+	2	0	FGD5	14939591	0.991000	0.36638	0.996000	0.52242	0.967000	0.64934	3.408000	0.52651	2.240000	0.73641	0.484000	0.47621	CCG		0.617	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1		NM_152536	
FNDC3B	64778	broad.mit.edu	37	3	172096213	172096213	+	Silent	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:172096213C>T	ENST00000336824.4	+	24	3261	c.3162C>T	c.(3160-3162)ccC>ccT	p.P1054P	FNDC3B_ENST00000416957.1_Silent_p.P1054P|FNDC3B_ENST00000415807.2_Silent_p.P1054P	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1054					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.P1054P(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AAAGTGTCCCCCCCACCATCA	0.463																																																	1	Substitution - coding silent(1)	kidney(1)											66.0	67.0	67.0					3																	172096213		2203	4300	6503	SO:0001819	synonymous_variant	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.3162C>T	3.37:g.172096213C>T			B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	ENST00000336824.4	37	CCDS3217.1																																																																																				0.463	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2		NM_022763	
FSTL4	23105	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	132736492	132736492	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr5:132736492C>T	ENST00000265342.7	-	4	596	c.347G>A	c.(346-348)cGt>cAt	p.R116H		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	116	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.R116H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCAAGCAGCACGGTGGAGCTT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											51.0	47.0	49.0					5																	132736492		2203	4300	6503	SO:0001583	missense	23105			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.347G>A	5.37:g.132736492C>T	ENSP00000265342:p.Arg116His		Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690541	0.68271	.	.	ENSG00000053108	ENST00000265342;ENST00000510685	T;T	0.04758	3.56;3.56	5.57	4.7	0.59300	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.063903	0.64402	D	0.000012	T	0.26011	0.0634	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.07849	-1.0751	10	0.87932	D	0	-12.5822	13.7393	0.62838	0.0:0.9261:0.0:0.0739	.	116	Q6MZW2	FSTL4_HUMAN	H	116;118	ENSP00000265342:R116H;ENSP00000427662:R118H	ENSP00000265342:R116H	R	-	2	0	FSTL4	132764391	1.000000	0.71417	0.971000	0.41717	0.317000	0.28152	4.546000	0.60705	1.374000	0.46228	-0.137000	0.14449	CGT		0.572	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1		XM_048786	
GGT5	2687	broad.mit.edu	37	22	24621029	24621029	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr22:24621029T>C	ENST00000327365.4	-	11	1965	c.1549A>G	c.(1549-1551)Att>Gtt	p.I517V	GGT5_ENST00000263112.7_Missense_Mutation_p.I485V|GGT5_ENST00000418439.2_Missense_Mutation_p.I441V|GGT5_ENST00000398292.3_Missense_Mutation_p.I518V	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	517					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.I517V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GGGGCTGCAATGGCCGCTCTC	0.602																																																	1	Substitution - Missense(1)	kidney(1)											35.0	29.0	31.0					22																	24621029		2203	4299	6502	SO:0001583	missense	2687			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1549A>G	22.37:g.24621029T>C	ENSP00000330080:p.Ile517Val		Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	T	8.665	0.901573	0.17760	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	4.54	1.17	0.20885	.	0.104163	0.64402	N	0.000004	T	0.10208	0.0250	L	0.35249	1.045	0.43622	D	0.996009	D;D;D;P;D	0.89917	1.0;0.97;0.976;0.681;0.976	D;P;D;P;D	0.87578	0.998;0.873;0.923;0.604;0.923	T	0.38908	-0.9639	10	0.10636	T	0.68	-9.8612	7.0533	0.25085	0.0:0.2894:0.0:0.7106	.	441;485;517;518;517	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	V	517;485;432;518;441	ENSP00000330080:I517V;ENSP00000263112:I485V;ENSP00000381340:I518V;ENSP00000392146:I441V	ENSP00000263112:I485V	I	-	1	0	GGT5	22951029	1.000000	0.71417	0.441000	0.26858	0.027000	0.11550	2.184000	0.42575	0.021000	0.15133	-1.108000	0.02087	ATT		0.602	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1		NM_004121	
GPRASP2	114928	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	X	101971084	101971084	+	Silent	SNP	C	C	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chrX:101971084C>A	ENST00000535209.1	+	4	2118	c.1287C>A	c.(1285-1287)tcC>tcA	p.S429S	GPRASP2_ENST00000332262.5_Silent_p.S429S|GPRASP2_ENST00000543253.1_Silent_p.S429S			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	429						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)	p.S429S(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGGAAAAGTCCAGTTTGGGGG	0.577																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	77.0	77.0					X																	101971084		2203	4300	6503	SO:0001819	synonymous_variant	114928			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1287C>A	X.37:g.101971084C>A			D3DXA0|Q8NAB4	Silent	SNP	ENST00000535209.1	37	CCDS14501.1																																																																																				0.577	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2		NM_138437	
GPRC5A	9052	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	12	13061472	13061472	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr12:13061472C>G	ENST00000014914.5	+	2	1179	c.289C>G	c.(289-291)Cgc>Ggc	p.R97G	GPRC5A_ENST00000542056.1_Intron	NM_003979.3	NP_003970.1	Q8NFJ5	RAI3_HUMAN	G protein-coupled receptor, class C, group 5, member A	97					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R97G(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	18		Prostate(47;0.141)		BRCA - Breast invasive adenocarcinoma(232;0.0708)	Tretinoin(DB00755)	AGGGCCCACACGCTTCTTCCT	0.572																																																	1	Substitution - Missense(1)	kidney(1)											168.0	158.0	161.0					12																	13061472		2203	4300	6503	SO:0001583	missense	9052			AF095448	CCDS8657.1	12p13-p12.3	2014-01-30	2014-01-30	2005-05-03		ENSG00000013588		"""GPCR / Class C : Orphans"""	9836	protein-coding gene	gene with protein product		604138	"""retinoic acid induced 3"", ""G protein-coupled receptor, family C, group 5, member A"""	RAI3, GPCR5A		9857033	Standard	NM_003979		Approved	RAIG1	uc001rba.3	Q8NFJ5		ENST00000014914.5:c.289C>G	12.37:g.13061472C>G	ENSP00000014914:p.Arg97Gly		B3KV45|O95357	Missense_Mutation	SNP	ENST00000014914.5	37	CCDS8657.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658405	0.67586	.	.	ENSG00000013588	ENST00000014914;ENST00000534831	D;D	0.90620	-2.7;-2.7	5.63	5.63	0.86233	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95348	0.8490	M	0.83774	2.66	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95592	0.8655	10	0.87932	D	0	-4.1183	14.5045	0.67743	0.1467:0.8533:0.0:0.0	.	97;97	Q8NFJ5;A8K556	RAI3_HUMAN;.	G	97	ENSP00000014914:R97G;ENSP00000441627:R97G	ENSP00000014914:R97G	R	+	1	0	GPRC5A	12952739	0.998000	0.40836	0.987000	0.45799	0.439000	0.31926	3.750000	0.55157	2.659000	0.90383	0.561000	0.74099	CGC		0.572	GPRC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400682.1			
GRIN2B	2904	broad.mit.edu;hgsc.bcm.edu	37	12	13717155	13717155	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr12:13717155C>G	ENST00000609686.1	-	13	3226	c.3017G>C	c.(3016-3018)tGt>tCt	p.C1006S		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1006					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.C1006S(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGGTTGTCACAGTCGTAGAG	0.587																																																	1	Substitution - Missense(1)	kidney(1)											129.0	100.0	109.0					12																	13717155		2203	4300	6503	SO:0001583	missense	2904				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3017G>C	12.37:g.13717155C>G	ENSP00000477455:p.Cys1006Ser		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037091	0.35893	.	.	ENSG00000150086	ENST00000279593	T	0.11385	2.78	4.97	4.97	0.65823	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.20618	0.0496	L	0.36672	1.1	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	T	0.01371	-1.1372	10	0.02654	T	1	.	18.4248	0.90605	0.0:1.0:0.0:0.0	.	1006	Q13224	NMDE2_HUMAN	S	1006	ENSP00000279593:C1006S	ENSP00000279593:C1006S	C	-	2	0	GRIN2B	13608422	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.725000	0.68507	2.596000	0.87737	0.655000	0.94253	TGT		0.587	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2			
HIVEP1	3096	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	12120167	12120167	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:12120167G>A	ENST00000379388.2	+	4	471	c.139G>A	c.(139-141)Ggt>Agt	p.G47S		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	47					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G47S(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATCCCTTAAAGGTGTGAAACG	0.363																																																	1	Substitution - Missense(1)	kidney(1)											161.0	146.0	151.0					6																	12120167		1856	4086	5942	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.139G>A	6.37:g.12120167G>A	ENSP00000368698:p.Gly47Ser		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.456725|4.456725	0.84317|0.84317	.|.	.|.	ENSG00000095951|ENSG00000095951	ENST00000442081|ENST00000491710;ENST00000487103;ENST00000379388;ENST00000478545	.|T	.|0.13657	.|2.57	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|0.000000	0.37012|0.37012	N|N	0.002291|0.002291	T|T	0.25901|0.25901	0.0631|0.0631	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|P	.|0.60541	.|0.876	T|T	0.00276|0.00276	-1.1855|-1.1855	7|10	0.87932|0.48119	D|T	0|0.1	-24.7348|-24.7348	20.04|20.04	0.97581|0.97581	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|47	.|P15822	.|ZEP1_HUMAN	R|S	56|47	.|ENSP00000368698:G47S	ENSP00000409078:G56R|ENSP00000368698:G47S	G|G	+|+	1|1	0|0	HIVEP1|HIVEP1	12228153|12228153	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.557000|7.557000	0.82243|0.82243	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	GGA|GGT		0.363	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2		NM_002114	
IRAK1BP1	134728	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	79607842	79607842	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:79607842C>A	ENST00000369940.2	+	4	679	c.574C>A	c.(574-576)Ctt>Att	p.L192I	IRAK1BP1_ENST00000607739.1_Missense_Mutation_p.L105I	NM_001010844.2	NP_001010844.1	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1 binding protein 1	192					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L192I(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(3)	12		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		AGTCTGTAACCTTGTTGGCCA	0.408																																																	1	Substitution - Missense(1)	kidney(1)											93.0	91.0	92.0					6																	79607842		2203	4300	6503	SO:0001583	missense	134728			AI478629	CCDS34488.1	6q14-q15	2006-04-12				ENSG00000146243			17368	protein-coding gene	gene with protein product		615375				11096118	Standard	XM_005248654		Approved	AIP70, SIMPL	uc003pim.4	Q5VVH5		ENST00000369940.2:c.574C>A	6.37:g.79607842C>A	ENSP00000358956:p.Leu192Ile			Missense_Mutation	SNP	ENST00000369940.2	37	CCDS34488.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.273855	0.59649	.	.	ENSG00000146243	ENST00000369940	.	.	.	4.84	4.84	0.62591	.	0.072292	0.56097	D	0.000025	T	0.44008	0.1273	L	0.59436	1.845	0.34974	D	0.753474	P	0.40398	0.716	P	0.48063	0.565	T	0.47522	-0.9111	8	.	.	.	-3.0086	10.2953	0.43620	0.0:0.9093:0.0:0.0907	.	192	Q5VVH5	IKBP1_HUMAN	I	192	.	.	L	+	1	0	IRAK1BP1	79664561	0.479000	0.25925	1.000000	0.80357	0.998000	0.95712	0.818000	0.27295	2.506000	0.84524	0.655000	0.94253	CTT		0.408	IRAK1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041296.2		XM_059729	
KLHL17	339451	hgsc.bcm.edu;ucsc.edu|broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	897301	897302	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:897301_897302GG>TT	ENST00000338591.3	+	4	692_693	c.585_586GG>TT	c.(583-588)ctGGgt>ctTTgt	p.G196C	NOC2L_ENST00000487214.1_5'Flank|NOC2L_ENST00000327044.6_5'Flank	NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	196	BACK.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)	p.G196C(2)		central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCAACTGCCTGGGTATCCGGGG	0.629																																																	2	Substitution - Missense(2)	lung(1)|kidney(1)																																								SO:0001583	missense	339451			AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	Exception_encountered	1.37:g.897301_897302delinsTT	ENSP00000343930:p.Gly196Cys		Q5SV94	Silent|Missense_Mutation	SNP	ENST00000338591.3	37	CCDS30550.1																																																																																				0.629	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097875.3		NM_198317	
KPRP	448834	hgsc.bcm.edu;ucsc.edu	37	1	152732937	152732937	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:152732937delC	ENST00000606109.1	+	1	901	c.873delC	c.(871-873)ttcfs	p.F291fs	KPRP_ENST00000368773.1_Frame_Shift_Del_p.F291fs			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	291	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGAAGGTTTCCCTAACTACT	0.597																																																	0													45.0	50.0	48.0					1																	152732937		2203	4300	6503	SO:0001589	frameshift_variant	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.873delC	1.37:g.152732937delC	ENSP00000475216:p.Phe291fs			Frame_Shift_Del	DEL	ENST00000606109.1	37	CCDS30862.1																																																																																				0.597	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2		NM_001025231	
LY6E	4061	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	8	144103076	144103077	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr8:144103076_144103077GC>CT	ENST00000520466.1	+	5	669_670	c.266_267GC>CT	c.(265-267)gGC>gCT	p.G89A	LY6E_ENST00000521182.1_3'UTR|LY6E_ENST00000292494.6_Missense_Mutation_p.G89A|LY6E_ENST00000522971.1_Missense_Mutation_p.G89A|LY6E_ENST00000429120.2_Missense_Mutation_p.G89A|LY6E_ENST00000519611.1_3'UTR|LY6E_ENST00000517503.1_3'UTR|LY6E_ENST00000521003.1_Missense_Mutation_p.G89A|LY6E_ENST00000521699.1_Missense_Mutation_p.G89A|LY6E_ENST00000523847.1_Intron|LY6E_ENST00000522528.1_3'UTR|LY6E_ENST00000522024.1_Missense_Mutation_p.G89A|LY6E_ENST00000519546.1_3'UTR			Q16553	LY6E_HUMAN	lymphocyte antigen 6 complex, locus E	89	UPAR/Ly6.				adrenal gland development (GO:0030325)|cell surface receptor signaling pathway (GO:0007166)|epinephrine secretion (GO:0048242)|in utero embryonic development (GO:0001701)|norepinephrine metabolic process (GO:0042415)|organ growth (GO:0035265)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)		p.G89A(1)|p.G89G(1)|p.G89>?(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	7	all_cancers(97;1.94e-10)|all_epithelial(106;1.22e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCTTCCATGGGCATCAGCTGCT	0.629																																																	3	Substitution - Missense(1)|Complex(1)|Substitution - coding silent(1)	kidney(3)																																								SO:0001583	missense	4061			U42376	CCDS6394.1	8q24	2008-08-07				ENSG00000160932			6727	protein-coding gene	gene with protein product	"""retinoic acid induced gene E"""	601384				8757598, 8650192	Standard	NM_001127213		Approved	TSA-1, RIG-E, SCA-2	uc003yxm.2	Q16553		Exception_encountered	8.37:g.144103076_144103077delinsCT	ENSP00000428572:p.Gly89Ala		B2R4X5|D3DWJ2|Q0VDE5	Missense_Mutation|Silent	SNP	ENST00000520466.1	37	CCDS6394.1																																																																																				0.629	LY6E-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380125.1		NM_001127213	
LYL1	4066	broad.mit.edu	37	19	13211728	13211728	+	Silent	SNP	C	C	T	rs200927941	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr19:13211728C>T	ENST00000264824.4	-	2	618	c.258G>A	c.(256-258)ccG>ccA	p.P86P		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	86					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P86P(1)		cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			GTTGCAGCAGCGGGGGCCGCA	0.682			T	TRB@	T-ALL								C|||	2	0.000399361	0.0	0.0	5008	,	,		10709	0.0		0.001	False		,,,				2504	0.001							Dom	yes		19	19p13.2-p13.1	4066	lymphoblastic leukemia derived sequence 1		L	1	Substitution - coding silent(1)	kidney(1)						C		3,4259		0,3,2128	11.0	14.0	13.0		258	-9.3	0.1	19		13	6,8318		0,6,4156	no	coding-synonymous	LYL1	NM_005583.4		0,9,6284	TT,TC,CC		0.0721,0.0704,0.0715		86/281	13211728	9,12577	2131	4162	6293	SO:0001819	synonymous_variant	4066				CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.258G>A	19.37:g.13211728C>T			O76102	Silent	SNP	ENST00000264824.4	37	CCDS12292.1																																																																																				0.682	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452827.1		NM_005583	
MARCH7	64844	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	2	160585646	160585646	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr2:160585646A>G	ENST00000259050.4	+	2	235	c.113A>G	c.(112-114)cAc>cGc	p.H38R	MARCH7_ENST00000539065.1_Missense_Mutation_p.H38R|MARCH7_ENST00000409175.1_Missense_Mutation_p.H38R|MARCH7_ENST00000473749.1_3'UTR	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	38	Ser-rich.				protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.H38R(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						GATACCTATCACTCAAGAGAC	0.373																																																	1	Substitution - Missense(1)	kidney(1)											69.0	70.0	70.0					2																	160585646		2203	4300	6503	SO:0001583	missense	64844			AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.113A>G	2.37:g.160585646A>G	ENSP00000259050:p.His38Arg		A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	37	CCDS2210.1	.	.	.	.	.	.	.	.	.	.	A	9.751	1.167575	0.21621	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000421037	T;T;T;T	0.42131	2.79;2.76;2.79;0.98	5.9	4.75	0.60458	.	0.451628	0.25186	N	0.032490	T	0.29458	0.0734	L	0.44542	1.39	0.24772	N	0.992867	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.26815	-1.0092	10	0.10636	T	0.68	1.7908	6.9301	0.24437	0.7877:0.0:0.2123:0.0	.	38;38	F5H6W4;Q9H992	.;MARH7_HUMAN	R	38	ENSP00000386830:H38R;ENSP00000442992:H38R;ENSP00000259050:H38R;ENSP00000392862:H38R	ENSP00000259050:H38R	H	+	2	0	MARCH7	160293892	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	2.284000	0.43478	1.067000	0.40740	0.374000	0.22700	CAC		0.373	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3		NM_022826	
AP5M1	55745	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	14	57748924	57748924	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr14:57748924G>A	ENST00000261558.3	+	4	1472	c.1066G>A	c.(1066-1068)Gcc>Acc	p.A356T	AP5M1_ENST00000431972.2_Missense_Mutation_p.A370T|AP5M1_ENST00000556723.1_3'UTR	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	356	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)		p.A356T(1)									ATTCTGTGAAGCCCATATACC	0.299																																																	1	Substitution - Missense(1)	kidney(1)											34.0	36.0	35.0					14																	57748924		2199	4280	6479	SO:0001583	missense	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1066G>A	14.37:g.57748924G>A	ENSP00000261558:p.Ala356Thr		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	ENST00000261558.3	37	CCDS9729.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174331	0.94807	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.19938	2.11;2.11	5.96	5.96	0.96718	Clathrin adaptor, mu subunit, C-terminal (3);	0.044831	0.85682	D	0.000000	T	0.48786	0.1519	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.26430	-1.0103	10	0.46703	T	0.11	.	20.4123	0.99019	0.0:0.0:1.0:0.0	.	356	Q9H0R1	MUDEN_HUMAN	T	356;370	ENSP00000261558:A356T;ENSP00000390531:A370T	ENSP00000261558:A356T	A	+	1	0	MUDENG	56818677	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.471000	0.97696	2.824000	0.97209	0.655000	0.94253	GCC		0.299	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1		NM_018229	
NID1	4811	broad.mit.edu	37	1	236192916	236192916	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:236192916G>T	ENST00000264187.6	-	7	1754	c.1672C>A	c.(1672-1674)Cag>Aag	p.Q558K	NID1_ENST00000366595.3_Missense_Mutation_p.Q558K	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	558	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)	p.Q558K(1)		breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	AACGGAATCTGCGGCACGCGG	0.647																																																	1	Substitution - Missense(1)	kidney(1)											46.0	32.0	36.0					1																	236192916		2202	4300	6502	SO:0001583	missense	4811			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1672C>A	1.37:g.236192916G>T	ENSP00000264187:p.Gln558Lys		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	G	8.319	0.823953	0.16678	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.31247	1.5;1.5	5.4	2.25	0.28309	G2 nidogen/fibulin G2F (3);Green fluorescent protein-like (1);	0.304527	0.39210	N	0.001437	T	0.25827	0.0629	L	0.50333	1.59	0.26487	N	0.975003	B;B	0.15719	0.0;0.014	B;B	0.20184	0.001;0.028	T	0.17684	-1.0361	10	0.27785	T	0.31	.	10.0779	0.42370	0.0:0.5129:0.3703:0.1168	.	558;558	P14543-2;P14543	.;NID1_HUMAN	K	558	ENSP00000264187:Q558K;ENSP00000355554:Q558K	ENSP00000264187:Q558K	Q	-	1	0	NID1	234259539	0.998000	0.40836	0.127000	0.21898	0.211000	0.24417	3.398000	0.52579	0.783000	0.33636	0.563000	0.77884	CAG		0.647	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2		NM_002508	
OR5P2	120065	broad.mit.edu;hgsc.bcm.edu	37	11	7818120	7818120	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr11:7818120T>A	ENST00000329434.2	-	1	400	c.370A>T	c.(370-372)Agt>Tgt	p.S124C	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S124C(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGCAGTGGACTGCAAATTGCC	0.473																																																	1	Substitution - Missense(1)	kidney(1)											77.0	89.0	85.0					11																	7818120		2104	4292	6396	SO:0001583	missense	120065			AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.370A>T	11.37:g.7818120T>A	ENSP00000331823:p.Ser124Cys		Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.712432	0.30322	.	.	ENSG00000183303	ENST00000329434	T	0.00482	7.1	5.5	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.608344	0.17335	N	0.177942	T	0.00412	0.0013	L	0.28192	0.835	0.09310	N	0.99999	P	0.51147	0.942	P	0.48227	0.571	T	0.58216	-0.7675	10	0.72032	D	0.01	-24.2936	7.0284	0.24952	0.0:0.1711:0.0:0.8289	.	124	Q8WZ92	OR5P2_HUMAN	C	124	ENSP00000331823:S124C	ENSP00000331823:S124C	S	-	1	0	OR5P2	7774696	0.002000	0.14202	0.990000	0.47175	0.250000	0.25880	0.161000	0.16481	1.098000	0.41479	0.454000	0.30748	AGT		0.473	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1		NM_153444	
PABPC1	26986	hgsc.bcm.edu	37	8	101730036	101730037	+	Frame_Shift_Ins	INS	-	-	C	rs545344384	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr8:101730036_101730037insC	ENST00000318607.5	-	3	1595_1596	c.467_468insG	c.(466-468)gaafs	p.E156fs	PABPC1_ENST00000519596.1_5'Flank|PABPC1_ENST00000519004.1_Frame_Shift_Ins_p.E111fs|PABPC1_ENST00000522387.1_Frame_Shift_Ins_p.E124fs	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	156	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CATTCATTTTTTCAATAGCTCT	0.337													-|-|C|insertion	726	0.144968	0.2133	0.1124	5008	,	,		20837	0.0764		0.0825	False		,,,				2504	0.2106																0																																										SO:0001589	frameshift_variant	26986			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.467_468insG	8.37:g.101730036_101730037insC	ENSP00000313007:p.Glu156fs		Q15097|Q93004	Frame_Shift_Ins	INS	ENST00000318607.5	37	CCDS6289.1																																																																																				0.337	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1		NM_002568	
PCDHGB3	56102	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	5	140750994	140750994	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr5:140750994C>T	ENST00000576222.1	+	1	1164	c.1033C>T	c.(1033-1035)Ccg>Tcg	p.P345S	PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	345	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAATGCCCCGGAGATAAC	0.438																																																	0													52.0	53.0	52.0					5																	140750994		1917	4138	6055	SO:0001583	missense	56102			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1033C>T	5.37:g.140750994C>T	ENSP00000461862:p.Pro345Ser		A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																				0.438	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1		NM_018924	
PDE6B	5158	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	654278	654278	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr4:654278C>G	ENST00000496514.1	+	12	1511	c.1490C>G	c.(1489-1491)aCc>aGc	p.T497S	RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.T497S|PDE6B_ENST00000429163.2_Missense_Mutation_p.T218S			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	497					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.T497S(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CCAGGGCCCACCACATTTGAC	0.567																																					GBM(71;463 1194 9848 25922 46834)												1	Substitution - Missense(1)	kidney(1)											86.0	71.0	76.0					4																	654278		2203	4300	6503	SO:0001583	missense	5158			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1490C>G	4.37:g.654278C>G	ENSP00000420295:p.Thr497Ser		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	C	0.478	-0.881225	0.02530	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.76578	-1.03;-1.03;-1.03	4.25	-3.28	0.05033	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.605907	0.17503	N	0.171912	T	0.62258	0.2413	L	0.42245	1.32	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.47736	-0.9094	10	0.21540	T	0.41	.	8.1805	0.31307	0.4683:0.2976:0.2341:0.0	.	497;497	P35913;P35913-2	PDE6B_HUMAN;.	S	497;497;218	ENSP00000255622:T497S;ENSP00000420295:T497S;ENSP00000406334:T218S	ENSP00000255622:T497S	T	+	2	0	PDE6B	644278	0.000000	0.05858	0.785000	0.31869	0.531000	0.34715	-1.739000	0.01840	-0.313000	0.08728	0.297000	0.19635	ACC		0.567	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1		NM_000283	
PLA2G4A	5321	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	1	186839572	186839572	+	Silent	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:186839572G>A	ENST00000367466.3	+	3	191	c.39G>A	c.(37-39)gaG>gaA	p.E13E	PLA2G4A_ENST00000442353.2_Silent_p.E13E|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	13	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.E13E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TCCAGGTGGAGCACCAGTATT	0.368																																																	1	Substitution - coding silent(1)	kidney(1)											77.0	75.0	76.0					1																	186839572		2203	4300	6503	SO:0001819	synonymous_variant	5321			M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.39G>A	1.37:g.186839572G>A			B1AKG4|Q29R80	Silent	SNP	ENST00000367466.3	37	CCDS1372.1																																																																																				0.368	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1		NM_024420	
PODXL	5420	broad.mit.edu;hgsc.bcm.edu	37	7	131194125	131194125	+	Splice_Site	SNP	C	C	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr7:131194125C>T	ENST00000378555.3	-	4	1269	c.1022G>A	c.(1021-1023)tGg>tAg	p.W341*	PODXL_ENST00000537928.1_Nonsense_Mutation_p.W309*|PODXL_ENST00000541194.1_Splice_Site_p.W343*|PODXL_ENST00000322985.9_Splice_Site_p.W309*|PODXL_ENST00000465001.1_5'Flank			O00592	PODXL_HUMAN	podocalyxin-like	341					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.W341*(1)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					TGGAGTTACCCAGTTACTCTC	0.557																																																	1	Substitution - Nonsense(1)	kidney(1)											132.0	126.0	128.0					7																	131194125		2203	4300	6503	SO:0001630	splice_region_variant	5420				CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.1023+1G>A	7.37:g.131194125C>T			A6NHX8|Q52LZ7|Q53ER6	Nonsense_Mutation	SNP	ENST00000378555.3	37	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783504	0.70222	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000544955;ENST00000378555;ENST00000322985	.	.	.	3.45	-3.32	0.04973	.	1.462480	0.04204	N	0.330471	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-5.8433	4.4635	0.11678	0.0:0.2042:0.3329:0.4629	.	.	.	.	X	343;309;299;341;309	.	ENSP00000319782:W309X	W	-	2	0	PODXL	130844665	0.053000	0.20554	0.011000	0.14972	0.008000	0.06430	-0.162000	0.10012	-0.700000	0.05070	-0.145000	0.13849	TGG		0.557	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2		NM_001018111	Nonsense_Mutation
POLDIP2	26073	broad.mit.edu	37	17	26681591	26681591	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:26681591delA	ENST00000540200.1	-	4	260	c.261delT	c.(259-261)tttfs	p.F87fs	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	88					mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CTCGGTAGCCAAAAATGCTAT	0.542																																																	0													38.0	38.0	38.0					17																	26681591		1917	4122	6039	SO:0001589	frameshift_variant	26073			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.261delT	17.37:g.26681591delA	ENSP00000475924:p.Phe87fs		B2R846|Q96JE4	Frame_Shift_Del	DEL	ENST00000540200.1	37																																																																																					0.542	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_015584	
PPP1R3C	5507	hgsc.bcm.edu;ucsc.edu	37	10	93389894	93389894	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr10:93389894delG	ENST00000238994.5	-	2	828	c.744delC	c.(742-744)aacfs	p.N249fs		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				GACCATCATTGTTGTCCCAAA	0.458																																																	0													105.0	93.0	97.0					10																	93389894		2203	4300	6503	SO:0001589	frameshift_variant	5507			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.744delC	10.37:g.93389894delG	ENSP00000238994:p.Asn249fs			Frame_Shift_Del	DEL	ENST00000238994.5	37	CCDS7416.1																																																																																				0.458	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049372.1		NM_005398	
PRKG2	5593	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	4	82126123	82126123	+	Missense_Mutation	SNP	G	G	A	rs187350442		TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr4:82126123G>A	ENST00000395578.1	-	2	195	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W	PRKG2_ENST00000418486.2_Missense_Mutation_p.R27W|PRKG2_ENST00000264399.1_Missense_Mutation_p.R27W			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	27					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.R27W(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						ACCTTGTTCCGCAGAGCATCA	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19454	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	kidney(2)						G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	86.0	80.0	82.0		79	4.2	1.0	4		82	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PRKG2	NM_006259.1	101	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	27/763	82126123	3,13003	2203	4300	6503	SO:0001583	missense	5593			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.79C>T	4.37:g.82126123G>A	ENSP00000378945:p.Arg27Trp		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	37	CCDS3589.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	11.71	1.720797	0.30503	2.27E-4	2.33E-4	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	T;T;T	0.70869	-0.4;-0.4;-0.52	5.1	4.25	0.50352	.	0.218260	0.45361	D	0.000375	T	0.55752	0.1940	N	0.24115	0.695	0.80722	D	1	D;D	0.65815	0.995;0.988	B;B	0.44315	0.446;0.353	T	0.59595	-0.7425	10	0.72032	D	0.01	-10.0862	6.7167	0.23308	0.0809:0.0:0.4711:0.448	.	27;27	E7EPE6;Q13237	.;KGP2_HUMAN	W	27	ENSP00000378945:R27W;ENSP00000264399:R27W;ENSP00000389038:R27W	ENSP00000264399:R27W	R	-	1	2	PRKG2	82345147	0.972000	0.33761	1.000000	0.80357	0.561000	0.35649	0.506000	0.22658	1.366000	0.46076	0.585000	0.79938	CGG		0.527	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1		NM_006259	
PTPRT	11122	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	20	40944543	40944544	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr20:40944543_40944544CC>AA	ENST00000373187.1	-	12	1957_1958	c.1958_1959GG>TT	c.(1957-1959)cGG>cTT	p.R653L	PTPRT_ENST00000373198.4_Missense_Mutation_p.R653L|PTPRT_ENST00000356100.2_Missense_Mutation_p.R653L|PTPRT_ENST00000373193.3_Missense_Mutation_p.R653L|PTPRT_ENST00000373184.1_Missense_Mutation_p.R653L|PTPRT_ENST00000373190.1_Missense_Mutation_p.R653L|PTPRT_ENST00000373201.1_Missense_Mutation_p.R653L			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	653	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.R653L(2)|p.R653>?(1)|p.R653Q(1)|p.R653R(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGGAGGCATTCCGATAGCTCAC	0.515																																																	5	Substitution - Missense(3)|Substitution - coding silent(1)|Complex(1)	kidney(3)|lung(1)|skin(1)																																								SO:0001583	missense	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1958_1959delinsAA	20.37:g.40944543_40944544delinsAA	ENSP00000362283:p.Arg653Leu		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent|Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																				0.515	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1			
RPAP1	26015	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	15	41822090	41822090	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr15:41822090G>A	ENST00000304330.4	-	8	1147	c.1031C>T	c.(1030-1032)cCc>cTc	p.P344L	RPAP1_ENST00000568413.1_5'UTR|RPAP1_ENST00000561603.1_Missense_Mutation_p.P344L	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	344						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.P344L(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCGGACAGGGGGCAAGTCCTG	0.622																																																	1	Substitution - Missense(1)	kidney(1)											47.0	43.0	44.0					15																	41822090		2203	4300	6503	SO:0001583	missense	26015			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1031C>T	15.37:g.41822090G>A	ENSP00000306123:p.Pro344Leu		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682842	0.88542	.	.	ENSG00000103932	ENST00000304330	T	0.14391	2.51	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.38026	0.1025	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19811	-1.0294	10	0.87932	D	0	-19.59	16.8033	0.85619	0.0:0.0:1.0:0.0	.	344	Q9BWH6	RPAP1_HUMAN	L	344	ENSP00000306123:P344L	ENSP00000306123:P344L	P	-	2	0	RPAP1	39609382	1.000000	0.71417	0.998000	0.56505	0.705000	0.40729	8.620000	0.90943	2.471000	0.83476	0.563000	0.77884	CCC		0.622	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2		NM_015540	
RSPRY1	89970	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	16	57265168	57265168	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr16:57265168T>C	ENST00000537866.1	+	13	2339	c.1466T>C	c.(1465-1467)aTg>aCg	p.M489T	RSPRY1_ENST00000563073.1_3'UTR|RSPRY1_ENST00000394420.4_Missense_Mutation_p.M489T			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	489						extracellular region (GO:0005576)	zinc ion binding (GO:0008270)	p.M489T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						CCACCATCTATGAAATTTAGC	0.368																																																	1	Substitution - Missense(1)	kidney(1)											109.0	104.0	106.0					16																	57265168		2198	4300	6498	SO:0001583	missense	89970			AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1466T>C	16.37:g.57265168T>C	ENSP00000443176:p.Met489Thr		Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	37	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	T	6.239	0.412152	0.11812	.	.	ENSG00000159579	ENST00000394420;ENST00000537866	D;D	0.84223	-1.82;-1.82	5.78	3.55	0.40652	.	0.605012	0.19927	N	0.102955	T	0.65207	0.2669	N	0.08118	0	0.31305	N	0.687781	B	0.06786	0.001	B	0.04013	0.001	T	0.55315	-0.8160	10	0.13470	T	0.59	.	5.2582	0.15558	0.0:0.2134:0.1396:0.647	.	489	Q96DX4	RSPRY_HUMAN	T	489	ENSP00000377942:M489T;ENSP00000443176:M489T	ENSP00000377942:M489T	M	+	2	0	RSPRY1	55822669	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	2.556000	0.45862	0.470000	0.27294	0.528000	0.53228	ATG		0.368	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1		NM_133368	
SETBP1	26040	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	18	42618593	42618593	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr18:42618593G>A	ENST00000282030.5	+	5	4440	c.4144G>A	c.(4144-4146)Gct>Act	p.A1382T		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1382						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A1382T(1)|p.A1328T(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ATCTCTCCTTGCTGCATCTGC	0.517									Schinzel-Giedion syndrome																																								2	Substitution - Missense(2)	kidney(2)											178.0	138.0	152.0					18																	42618593		2203	4300	6503	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4144G>A	18.37:g.42618593G>A	ENSP00000282030:p.Ala1382Thr		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	37	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	G	9.620	1.133560	0.21041	.	.	ENSG00000152217	ENST00000282030	T	0.69175	-0.38	5.84	5.84	0.93424	.	0.282780	0.35838	N	0.002951	T	0.48750	0.1517	N	0.24115	0.695	0.32840	D	0.505171	B	0.32829	0.386	B	0.31101	0.124	T	0.57441	-0.7811	10	0.21014	T	0.42	.	10.4694	0.44626	0.0:0.1803:0.693:0.1267	.	1382	Q9Y6X0	SETBP_HUMAN	T	1382	ENSP00000282030:A1382T	ENSP00000282030:A1382T	A	+	1	0	SETBP1	40872591	0.999000	0.42202	0.977000	0.42913	0.174000	0.22865	3.439000	0.52878	2.763000	0.94921	0.650000	0.86243	GCT		0.517	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4		NM_001130110	
SLC13A5	284111	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	6594203	6594203	+	Silent	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:6594203G>A	ENST00000433363.2	-	10	1565	c.1332C>T	c.(1330-1332)ccC>ccT	p.P444P	SLC13A5_ENST00000381074.4_Silent_p.P401P|SLC13A5_ENST00000573648.1_Silent_p.P444P|SLC13A5_ENST00000293800.6_Silent_p.P427P	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	444					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)	p.P444P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						TGGCTGCCGGGGGCACTGCGT	0.617																																																	1	Substitution - coding silent(1)	kidney(1)											179.0	157.0	165.0					17																	6594203		2203	4300	6503	SO:0001819	synonymous_variant	284111			AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.1332C>T	17.37:g.6594203G>A			B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Silent	SNP	ENST00000433363.2	37	CCDS11079.1																																																																																				0.617	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2		NM_177550	
SLC17A5	26503	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	6	74354149	74354149	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr6:74354149T>G	ENST00000355773.5	-	2	540	c.272A>C	c.(271-273)aAa>aCa	p.K91T	SLC17A5_ENST00000481996.1_5'UTR|SLC17A5_ENST00000393019.3_Missense_Mutation_p.K91T	NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	91					amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)	p.K91T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ATGATGAACTTTTATGGGAGC	0.323																																																	1	Substitution - Missense(1)	kidney(1)											62.0	63.0	63.0					6																	74354149		2203	4300	6503	SO:0001583	missense	26503			AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.272A>C	6.37:g.74354149T>G	ENSP00000348019:p.Lys91Thr		Q5SZ76|Q8NBR5|Q9UGH0	Missense_Mutation	SNP	ENST00000355773.5	37	CCDS4981.1	.	.	.	.	.	.	.	.	.	.	T	0.360	-0.939949	0.02322	.	.	ENSG00000119899	ENST00000355773;ENST00000393019	T;T	0.80393	-0.23;-1.37	5.61	2.81	0.32909	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.811931	0.11280	N	0.580415	T	0.41282	0.1152	N	0.22421	0.69	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.22417	-1.0217	10	0.15066	T	0.55	.	3.5544	0.07858	0.1198:0.076:0.2463:0.5579	.	91	Q9NRA2	S17A5_HUMAN	T	91	ENSP00000348019:K91T;ENSP00000376742:K91T	ENSP00000348019:K91T	K	-	2	0	SLC17A5	74410870	0.004000	0.15560	0.022000	0.16811	0.416000	0.31233	0.647000	0.24812	0.905000	0.36596	0.482000	0.46254	AAA		0.323	SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1			
VHL	7428	broad.mit.edu;ucsc.edu	37	3	10188322	10188322	+	Splice_Site	SNP	T	T	C	rs5030814|rs397516443	byFrequency	TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:10188322T>C	ENST00000256474.2	+	2	1303		c.e2+2		VHL_ENST00000345392.2_Intron|VHL_ENST00000477538.1_Splice_Site	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase						cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.?(15)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CACTGCCAGGTACTGACGTTT	0.403		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																														yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	15	Unknown(15)	kidney(15)	GRCh37	CS961707	VHL	S	rs5030815						164.0	157.0	159.0					3																	10188322		2203	4300	6503	SO:0001630	splice_region_variant	7428	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.463+2T>C	3.37:g.10188322T>C			B2RE45|Q13599|Q6PDA9	Splice_Site	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.198543	0.58126	.	.	ENSG00000134086	ENST00000256474;ENST00000450183	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3362	0.55069	0.0:0.0:0.0:1.0	rs5030815	.	.	.	.	-1	.	.	.	+	.	.	VHL	10163322	1.000000	0.71417	0.976000	0.42696	0.760000	0.43138	5.968000	0.70413	1.873000	0.54277	0.379000	0.24179	.		0.403	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250559.1		NM_000551	Intron
WDR25	79446	hgsc.bcm.edu;ucsc.edu	37	14	100847481	100847481	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr14:100847481delG	ENST00000335290.6	+	2	446	c.220delG	c.(220-222)gggfs	p.G75fs	WDR25_ENST00000402312.3_Frame_Shift_Del_p.G75fs|WDR25_ENST00000554998.1_Frame_Shift_Del_p.G75fs|WDR25_ENST00000542471.2_5'Flank|WDR25_ENST00000554175.1_Frame_Shift_Del_p.G75fs	NM_024515.4	NP_078791.3	Q64LD2	WDR25_HUMAN	WD repeat domain 25	75										central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|skin(1)	20		Melanoma(154;0.212)				TGAAGACCCAGGGGGCTATCG	0.597																																																	0													46.0	45.0	46.0					14																	100847481		2203	4300	6503	SO:0001589	frameshift_variant	79446			BC007953	CCDS32157.1	14q32.32	2013-01-09				ENSG00000176473		"""WD repeat domain containing"""	21064	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 67"""	C14orf67		15587985	Standard	NM_001161476		Approved	MGC4645	uc001yhn.3	Q64LD2		ENST00000335290.6:c.220delG	14.37:g.100847481delG	ENSP00000334148:p.Gly75fs		A8K7E5|Q6NVV6|Q86TQ4|Q9BTK5	Frame_Shift_Del	DEL	ENST00000335290.6	37	CCDS32157.1																																																																																				0.597	WDR25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414312.1		NM_024515	
ZMYM4	9202	broad.mit.edu;hgsc.bcm.edu	37	1	35870746	35870746	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr1:35870746G>A	ENST00000314607.6	+	24	3731	c.3651G>A	c.(3649-3651)tgG>tgA	p.W1217*	ZMYM4_ENST00000373297.2_Nonsense_Mutation_p.W1128*	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1217					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.W1217*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGAAGAACTGGGTTCAGTGGA	0.458																																																	1	Substitution - Nonsense(1)	kidney(1)											99.0	103.0	102.0					1																	35870746		2203	4300	6503	SO:0001587	stop_gained	9202			AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.3651G>A	1.37:g.35870746G>A	ENSP00000322915:p.Trp1217*		A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Nonsense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.328621|8.328621	0.98762|0.98762	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000457946|ENST00000314607;ENST00000373297	.|.	.|.	.|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47469|.	0.1447|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34104|.	-0.9842|.	3|.	.|0.02654	.|T	.|1	-6.4036|-6.4036	19.4279|19.4279	0.94751|0.94751	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	S|X	876|1217;1128	.|.	.|ENSP00000322915:W1217X	G|W	+|+	1|3	0|0	ZMYM4|ZMYM4	35643333|35643333	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.236000|8.236000	0.89805|0.89805	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	GGT|TGG		0.458	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3		NM_005095	
ZNF594	84622	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	17	5086703	5086703	+	Silent	SNP	G	G	T			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr17:5086703G>T	ENST00000399604.4	-	1	989	c.849C>A	c.(847-849)gtC>gtA	p.V283V	ZNF594_ENST00000575779.1_Silent_p.V283V			Q96JF6	ZN594_HUMAN	zinc finger protein 594	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V283V(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCTGATGTGGGACAAGGTGTG	0.418																																																	1	Substitution - coding silent(1)	kidney(1)											74.0	78.0	76.0					17																	5086703		2190	4292	6482	SO:0001819	synonymous_variant	84622			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.849C>A	17.37:g.5086703G>T			Q6RFS0	Silent	SNP	ENST00000399604.4	37	CCDS42241.1																																																																																				0.418	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1		XM_290737	
ZNF749	388567	broad.mit.edu;hgsc.bcm.edu;ucsc.edu	37	19	57954668	57954668	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr19:57954668A>C	ENST00000334181.4	+	3	402	c.152A>C	c.(151-153)cAt>cCt	p.H51P	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H51P(1)		breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		GGTTGTTGGCATGGAGCCAAG	0.507																																																	1	Substitution - Missense(1)	kidney(1)											68.0	66.0	67.0					19																	57954668		2203	4300	6503	SO:0001583	missense	388567			AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.152A>C	19.37:g.57954668A>C	ENSP00000333980:p.His51Pro			Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	A	11.01	1.513011	0.27123	.	.	ENSG00000186230	ENST00000334181	T	0.00768	5.72	2.07	-0.261	0.12963	Krueppel-associated box (3);	.	.	.	.	T	0.00724	0.0024	N	0.16166	0.38	0.09310	N	1	D	0.61080	0.989	P	0.50708	0.648	T	0.52019	-0.8631	9	0.35671	T	0.21	.	2.102	0.03682	0.4441:0.0:0.3118:0.2441	.	51	O43361	ZN749_HUMAN	P	51	ENSP00000333980:H51P	ENSP00000333980:H51P	H	+	2	0	ZNF749	62646480	0.000000	0.05858	0.006000	0.13384	0.311000	0.27955	-0.501000	0.06398	-0.150000	0.11195	0.260000	0.18958	CAT		0.507	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1		NM_001023561	
EPHA6	285220	broad.mit.edu	37	3	96706398	96706398	+	Silent	SNP	A	A	G			TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454	.		Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:96706398A>G	ENST00000389672.5	+	3	713	c.675A>G	c.(673-675)gaA>gaG	p.E225E	EPHA6_ENST00000542517.1_Silent_p.E131E|EPHA6_ENST00000470610.2_Silent_p.E225E	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	131						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)	p.E131E(2)|p.E225E(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						TTTATATGGAATCAGATGAGT	0.383																																						.											3	Substitution - coding silent(3)	kidney(3)											134.0	137.0	136.0					3																	96706398		1868	4101	5969	SO:0001819	synonymous_variant	285220			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.675A>G	3.37:g.96706398A>G			D6RAL5	Silent	SNP	ENST00000389672.5	37	CCDS46876.1	.	.	.	.	.	.	.	.	.	.	A	6.670	0.492192	0.12702	.	.	ENSG00000080224	ENST00000506569	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	T	0.59932	0.2230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59804	-0.7385	4	.	.	.	.	8.4773	0.33021	0.8517:0.0:0.1483:0.0	.	.	.	.	V	170	.	.	I	+	1	0	EPHA6	98189088	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.386000	0.59620	2.183000	0.69458	0.533000	0.62120	ATC		0.383	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3		NM_001080448	
CLSTN2	64084	broad.mit.edu	37	3	140122558	140122558	+	Missense_Mutation	SNP	G	G	A	rs145666342		TCGA-CZ-4856-01A-02D-1429-08	TCGA-CZ-4856-11A-01D-1429-08	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454	.		Illumina GAIIx	85e26450-4cb1-4a91-ad86-a6d44890ee97	10b5b613-7abd-42dd-bb9d-a166c34e4222	g.chr3:140122558G>A	ENST00000458420.3	+	3	510	c.320G>A	c.(319-321)cGt>cAt	p.R107H	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.R107H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GGCCGGCTCCGTGCCAAGAGC	0.562										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	.											1	Substitution - Missense(1)	kidney(1)						G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	146.0	138.0	140.0		320	5.6	1.0	3	dbSNP_134	140	0,8600		0,0,4300	yes	missense	CLSTN2	NM_022131.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	107/956	140122558	1,13005	2203	4300	6503	SO:0001583	missense	64084			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.320G>A	3.37:g.140122558G>A	ENSP00000402460:p.Arg107His		B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876514	0.91664	2.27E-4	0.0	ENSG00000158258	ENST00000458420	T	0.47869	0.83	5.64	5.64	0.86602	Cadherin (3);Cadherin-like (1);	0.062472	0.64402	D	0.000007	T	0.65322	0.2680	M	0.74881	2.28	0.58432	D	0.999997	D	0.71674	0.998	P	0.57324	0.818	T	0.69168	-0.5216	10	0.87932	D	0	-12.6193	17.2112	0.86930	0.0:0.0:1.0:0.0	.	107	Q9H4D0	CSTN2_HUMAN	H	107	ENSP00000402460:R107H	ENSP00000402460:R107H	R	+	2	0	CLSTN2	141605248	0.939000	0.31865	0.951000	0.38953	0.965000	0.64279	3.815000	0.55651	2.653000	0.90120	0.655000	0.94253	CGT		0.562	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3		NM_022131	
