#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
ADAM19	8728	hgsc.bcm.edu	37	5	156997963	156997963	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:156997963C>A	ENST00000517905.1	-	2	164	c.120G>T	c.(118-120)aaG>aaT	p.K40N	ADAM19_ENST00000394020.1_Missense_Mutation_p.K42N|ADAM19_ENST00000430702.2_5'UTR|ADAM19_ENST00000257527.4_Missense_Mutation_p.K40N|AC106801.1_ENST00000518054.1_RNA			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	40					heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATGCTGCAGCTTGGGGCTGC	0.478																																																	0													110.0	107.0	108.0					5																	156997963		2203	4300	6503	SO:0001583	missense	8728			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.120G>T	5.37:g.156997963C>A	ENSP00000428654:p.Lys40Asn		Q9BZL5|Q9UHP2	Missense_Mutation	SNP	ENST00000517905.1	37		.	.	.	.	.	.	.	.	.	.	C	6.615	0.481811	0.12581	.	.	ENSG00000135074	ENST00000257527;ENST00000394020;ENST00000517905	T;T;T	0.01548	4.79;4.85;4.78	4.5	1.68	0.24146	.	1.104190	0.06943	N	0.813261	T	0.01627	0.0052	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.49283	-0.8956	10	0.17832	T	0.49	.	6.4914	0.22117	0.0:0.6912:0.0:0.3088	.	40	Q9H013-2	.	N	40;42;40	ENSP00000257527:K40N;ENSP00000377588:K42N;ENSP00000428654:K40N	ENSP00000257527:K40N	K	-	3	2	ADAM19	156930541	0.076000	0.21285	0.008000	0.14137	0.728000	0.41692	0.322000	0.19576	0.599000	0.29845	0.655000	0.94253	AAG		0.478	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000373918.1		NM_033274	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8660979	8660979	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:8660979C>T	ENST00000597188.1	-	11	1585	c.1315G>A	c.(1315-1317)Gac>Aac	p.D439N	ADAMTS10_ENST00000270328.4_Missense_Mutation_p.D439N|ADAMTS10_ENST00000596709.1_5'Flank	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	439	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GTGATGTAGTCACGGCTGCAG	0.577																																																	0													105.0	101.0	103.0					19																	8660979		2203	4300	6503	SO:0001583	missense	81794			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.1315G>A	19.37:g.8660979C>T	ENSP00000471851:p.Asp439Asn		M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684839	0.88639	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.08896	3.04	4.27	4.27	0.50696	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	N	0.12443	0.215	0.80722	D	1	P;D	0.69078	0.637;0.997	B;D	0.73380	0.173;0.98	T	0.35500	-0.9786	10	0.33141	T	0.24	.	15.862	0.79032	0.0:1.0:0.0:0.0	.	193;439	Q59FE5;Q9H324	.;ATS10_HUMAN	N	439;193	ENSP00000270328:D439N	ENSP00000270328:D439N	D	-	1	0	ADAMTS10	8566979	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	7.298000	0.78815	2.205000	0.71048	0.313000	0.20887	GAC		0.577	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3		NM_030957	
AHI1	54806	hgsc.bcm.edu;ucsc.edu	37	6	135644325	135644325	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:135644325A>C	ENST00000367800.4	-	23	3519	c.3303T>G	c.(3301-3303)ttT>ttG	p.F1101L	AHI1_ENST00000417892.2_Missense_Mutation_p.F455L|AHI1_ENST00000457866.2_Missense_Mutation_p.F1101L	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	1101	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		GATTAGCTGGAAAATAACCTT	0.388																																																	0													119.0	110.0	113.0					6																	135644325		1892	4095	5987	SO:0001583	missense	54806			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.3303T>G	6.37:g.135644325A>C	ENSP00000356774:p.Phe1101Leu		E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.98|18.98	3.738224|3.738224	0.69304|0.69304	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367799|ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602	T|T;T;T;T	0.48201|0.44881	0.82|0.91;0.91;0.91;0.91	6.06|6.06	4.89|4.89	0.63831|0.63831	.|Src homology-3 domain (5);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.56352|0.56352	0.1979|0.1979	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.87578	.|0.998;0.996	T|T	0.64706|0.64706	-0.6344|-0.6344	8|10	0.87932|0.87932	D|D	0|0	-20.0225|-20.0225	12.2675|12.2675	0.54686|0.54686	0.9339:0.0:0.0661:0.0|0.9339:0.0:0.0661:0.0	.|.	.|1101;1101	.|Q8N157;Q4FD35	.|AHI1_HUMAN;.	C|L	601|1101;1101;455;1101	ENSP00000356773:F601C|ENSP00000356774:F1101L;ENSP00000388650:F1101L;ENSP00000416867:F455L;ENSP00000265602:F1101L	ENSP00000356773:F601C|ENSP00000265602:F1101L	F|F	-|-	2|3	0|2	AHI1|AHI1	135686018|135686018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.962000|2.962000	0.49176|0.49176	1.107000|1.107000	0.41642|0.41642	0.533000|0.533000	0.62120|0.62120	TTC|TTT		0.388	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1		NM_017651	
ARID1A	8289	hgsc.bcm.edu;ucsc.edu	37	1	27106545	27106545	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:27106545C>A	ENST00000324856.7	+	20	6527	c.6156C>A	c.(6154-6156)tgC>tgA	p.C2052*	ARID1A_ENST00000540690.1_Nonsense_Mutation_p.C380*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.C1669*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.C1835*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2052					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGTGGGACTGCTTGGAGATGC	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													154.0	153.0	153.0					1																	27106545		2203	4300	6503	SO:0001587	stop_gained	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6156C>A	1.37:g.27106545C>A	ENSP00000320485:p.Cys2052*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.829171|9.829171	0.99273|0.99273	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	5.0|5.0	4.09|4.09	0.47781|0.47781	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.62889	.|0.2465	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61540	.|-0.7042	.|4	0.02654|.	T|.	1|.	-8.765|-8.765	11.7695|11.7695	0.51949|0.51949	0.0:0.8526:0.0:0.1474|0.0:0.8526:0.0:0.1474	.|.	.|.	.|.	.|.	X|I	2052;1835;1669;380|949	.|.	ENSP00000320485:C2052X|.	C|L	+|+	3|1	2|0	ARID1A|ARID1A	26979132|26979132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.781000|1.781000	0.38644|0.38644	1.473000|1.473000	0.48159|0.48159	0.591000|0.591000	0.81541|0.81541	TGC|CTT		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2		NM_139135	
ALG14	199857	hgsc.bcm.edu	37	1	95538433	95538433	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:95538433C>G	ENST00000370205.5	-	1	68	c.22G>C	c.(22-24)Gct>Cct	p.A8P	ALG14_ENST00000495856.1_5'Flank	NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	8					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		GCGGCCGCAGCTAGAACGAGA	0.577																																																	0													80.0	76.0	77.0					1																	95538433		2203	4300	6503	SO:0001583	missense	199857				CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.22G>C	1.37:g.95538433C>G	ENSP00000359224:p.Ala8Pro		A8K030	Missense_Mutation	SNP	ENST00000370205.5	37	CCDS752.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.555605	0.45487	.	.	ENSG00000172339	ENST00000370205	T	0.48201	0.82	5.21	3.26	0.37387	.	1.033710	0.07651	N	0.931930	T	0.15739	0.0379	N	0.08118	0	0.09310	N	0.999993	D	0.55385	0.971	P	0.47470	0.548	T	0.03184	-1.1063	10	0.23891	T	0.37	-13.6845	8.2916	0.31960	0.1558:0.7598:0.0:0.0843	.	8	Q96F25	ALG14_HUMAN	P	8	ENSP00000359224:A8P	ENSP00000359224:A8P	A	-	1	0	ALG14	95311021	0.001000	0.12720	0.337000	0.25536	0.034000	0.12701	0.905000	0.28504	1.384000	0.46424	0.591000	0.81541	GCT		0.577	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029699.2		NM_144988	
ARL1	400	hgsc.bcm.edu;ucsc.edu	37	12	101790252	101790252	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:101790252G>C	ENST00000261636.8	-	5	614	c.440C>G	c.(439-441)gCc>gGc	p.A147G	ARL1_ENST00000551688.1_Missense_Mutation_p.A18G|ARL1_ENST00000539055.1_Missense_Mutation_p.A101G|ARL1_ENST00000536227.1_Missense_Mutation_p.A130G|ARL1_ENST00000551828.1_Missense_Mutation_p.A130G|ARL1_ENST00000551671.1_Missense_Mutation_p.A147G	NM_001177.4	NP_001168.1	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	147					activation of phospholipase D activity (GO:0031584)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)|toxin metabolic process (GO:0009404)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	enzyme activator activity (GO:0008047)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			central_nervous_system(1)|upper_aerodigestive_tract(1)	2		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		GTCCTTCAAGGCAGGTAACCC	0.463																																																	0													207.0	203.0	204.0					12																	101790252		1979	4156	6135	SO:0001583	missense	400			BX537387	CCDS44958.1, CCDS73510.1	12q23.3	2014-05-09						"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	692	protein-coding gene	gene with protein product		603425					Standard	XM_005268869		Approved	ARFL1	uc001tib.3	P40616	OTTHUMG00000170271	ENST00000261636.8:c.440C>G	12.37:g.101790252G>C	ENSP00000261636:p.Ala147Gly		B4DWW1|P80417|Q53XB1	Missense_Mutation	SNP	ENST00000261636.8	37	CCDS44958.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439456	0.63067	.	.	ENSG00000120805	ENST00000261636;ENST00000539055;ENST00000536227;ENST00000551688;ENST00000551828;ENST00000551671	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.8	5.8	0.92144	Small GTP-binding protein domain (1);	0.050378	0.85682	D	0.000000	T	0.56202	0.1969	L	0.32530	0.975	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.001;0.004	T	0.49698	-0.8912	10	0.52906	T	0.07	-17.3365	20.0545	0.97645	0.0:0.0:1.0:0.0	.	101;147;147	B4DZG7;F8VYN9;P40616	.;.;ARL1_HUMAN	G	147;101;130;18;130;147	ENSP00000261636:A147G;ENSP00000439590:A101G;ENSP00000441808:A130G;ENSP00000447405:A18G;ENSP00000448850:A130G;ENSP00000448912:A147G	ENSP00000261636:A147G	A	-	2	0	ARL1	100314383	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.608000	0.67654	2.748000	0.94277	0.655000	0.94253	GCC		0.463	ARL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408246.1		NM_001177	
ARNT2	9915	hgsc.bcm.edu;ucsc.edu	37	15	80762590	80762590	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr15:80762590C>T	ENST00000303329.4	+	4	391	c.226C>T	c.(226-228)Cgg>Tgg	p.R76W	ARNT2_ENST00000527771.1_Missense_Mutation_p.R65W|ARNT2_ENST00000531595.3_3'UTR|ARNT2_ENST00000533983.1_Missense_Mutation_p.R65W	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	76	Poly-Arg.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			AAGGCGCAGACGGAACAAGAT	0.502																																																	0													78.0	67.0	71.0					15																	80762590		2203	4300	6503	SO:0001583	missense	9915			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.226C>T	15.37:g.80762590C>T	ENSP00000307479:p.Arg76Trp		B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561062	0.65538	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	D	0.99232	-5.6	5.0	1.73	0.24493	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99594	0.9853	H	0.97983	4.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98336	1.0536	10	0.87932	D	0	.	12.7927	0.57543	0.678:0.322:0.0:0.0	.	76;76	Q9HBZ2;Q86TN1	ARNT2_HUMAN;.	W	65;76;76	ENSP00000307479:R76W	ENSP00000307479:R76W	R	+	1	2	ARNT2	78549645	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	2.417000	0.44653	0.655000	0.30866	0.650000	0.86243	CGG		0.502	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2			
ARSD	414	hgsc.bcm.edu	37	X	2832696	2832696	+	Intron	SNP	T	T	C	rs113031742		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chrX:2832696T>C	ENST00000381154.1	-	6	1076				ARSD_ENST00000217890.6_5'UTR	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCAGCCTCACTGGTCCTCTCC	0.423																																																	0													111.0	103.0	106.0					X																	2832696		2203	4300	6503	SO:0001627	intron_variant	414			X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1000+900A>G	X.37:g.2832696T>C			Q9UHJ8	Silent	SNP	ENST00000381154.1	37	CCDS35196.1																																																																																				0.423	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1			
ASPA	443	hgsc.bcm.edu;ucsc.edu	37	17	3392558	3392558	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr17:3392558G>C	ENST00000263080.2	+	4	714	c.556G>C	c.(556-558)Gtt>Ctt	p.V186L	SPATA22_ENST00000541913.1_Intron|ASPA_ENST00000456349.2_Missense_Mutation_p.V186L	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	186			V -> F (in CAND). {ECO:0000269|PubMed:10407784}.		aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	GCCTCAAGGGGTTCTGAGAGC	0.313																																																	0			GRCh37	CM990194	ASPA	M							120.0	127.0	125.0					17																	3392558		2203	4299	6502	SO:0001583	missense	443			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.556G>C	17.37:g.3392558G>C	ENSP00000263080:p.Val186Leu			Missense_Mutation	SNP	ENST00000263080.2	37	CCDS11028.1	.	.	.	.	.	.	.	.	.	.	g	35	5.459548	0.96240	.	.	ENSG00000108381	ENST00000456349;ENST00000263080	D;D	0.97870	-4.58;-4.58	5.75	5.75	0.90469	.	0.169669	0.52532	D	0.000078	D	0.98055	0.9359	M	0.62016	1.91	0.80722	D	1	D	0.76494	0.999	P	0.59012	0.85	D	0.97502	1.0061	10	0.38643	T	0.18	-31.8027	19.319	0.94229	0.0:0.0:1.0:0.0	.	186	P45381	ACY2_HUMAN	L	186	ENSP00000409976:V186L;ENSP00000263080:V186L	ENSP00000263080:V186L	V	+	1	0	ASPA	3339308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.115000	0.94336	2.894000	0.99253	0.655000	0.94253	GTT		0.313	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207315.1		NM_000049	
ATP13A4	84239	hgsc.bcm.edu	37	3	193174889	193174889	+	Silent	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:193174889C>T	ENST00000342695.4	-	16	2137	c.1815G>A	c.(1813-1815)ctG>ctA	p.L605L	ATP13A4_ENST00000392443.3_Silent_p.L586L	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	605						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TCATTCTTTGCAGTGCCGATG	0.517																																																	0													135.0	117.0	123.0					3																	193174889		2203	4300	6503	SO:0001819	synonymous_variant	84239			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1815G>A	3.37:g.193174889C>T			B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	CCDS3304.2																																																																																				0.517	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4		NM_032279	
EMC10	284361	hgsc.bcm.edu	37	19	50985427	50985427	+	Missense_Mutation	SNP	G	G	A	rs147229320	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:50985427G>A	ENST00000334976.6	+	7	746	c.700G>A	c.(700-702)Gtc>Atc	p.V234I	EMC10_ENST00000376918.3_3'UTR|EMC10_ENST00000598585.1_Missense_Mutation_p.V234I|CTD-2545M3.2_ENST00000598194.1_RNA	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10	234						ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)											CATTCCCGTCGTCCTGTTCCT	0.637													G|||	3	0.000599042	0.0008	0.0	5008	,	,		7065	0.002		0.0	False		,,,				2504	0.0																0								G	,ILE/VAL	0,4406		0,0,2203	79.0	52.0	61.0		,700	0.9	0.5	19	dbSNP_134	61	5,8595	4.3+/-15.6	0,5,4295	yes	utr-3,missense	C19orf63	NM_175063.4,NM_206538.2	,29	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	,probably-damaging	,234/263	50985427	5,13001	2203	4300	6503	SO:0001583	missense	0			BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.700G>A	19.37:g.50985427G>A	ENSP00000334037:p.Val234Ile		Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Missense_Mutation	SNP	ENST00000334976.6	37	CCDS12796.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	17.93	3.508876	0.64410	0.0	5.81E-4	ENSG00000161671	ENST00000334976;ENST00000376920	.	.	.	3.32	0.909	0.19332	.	0.327625	0.27354	N	0.019759	T	0.51193	0.1660	M	0.74881	2.28	0.80722	D	1	D;D	0.65815	0.995;0.979	P;P	0.46825	0.528;0.512	T	0.48007	-0.9072	9	0.40728	T	0.16	-4.055	6.528	0.22312	0.1177:0.1786:0.7038:0.0	.	234;234	Q5UCC4;Q5UCC4-3	INM02_HUMAN;.	I	234	.	ENSP00000334037:V234I	V	+	1	0	C19orf63	55677239	1.000000	0.71417	0.502000	0.27614	0.864000	0.49448	7.801000	0.85960	0.169000	0.19679	-0.378000	0.06908	GTC		0.637	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464760.2		NM_175063	
CAMK4	814	hgsc.bcm.edu;ucsc.edu	37	5	110712609	110712609	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:110712609G>C	ENST00000282356.4	+	4	753	c.355G>C	c.(355-357)Gaa>Caa	p.E119Q	CAMK4_ENST00000512453.1_Missense_Mutation_p.E119Q	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TCTGGTCCTAGAACTCGTCAC	0.348																																																	0													98.0	110.0	106.0					5																	110712609		2202	4300	6502	SO:0001583	missense	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.355G>C	5.37:g.110712609G>C	ENSP00000282356:p.Glu119Gln		D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974305	0.74246	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.68765	-0.11;-0.35;-0.35	5.83	5.83	0.93111	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.054384	0.64402	D	0.000001	D	0.83571	0.5283	M	0.87328	2.875	0.48452	D	0.999657	D	0.61697	0.99	P	0.62382	0.901	D	0.85626	0.1267	10	0.72032	D	0.01	.	18.9504	0.92640	0.0:0.0:1.0:0.0	.	119	Q16566	KCC4_HUMAN	Q	119	ENSP00000426940:E119Q;ENSP00000422634:E119Q;ENSP00000282356:E119Q	ENSP00000282356:E119Q	E	+	1	0	CAMK4	110740508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.887000	0.87295	2.776000	0.95493	0.644000	0.83932	GAA		0.348	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2		NM_001744	
CCDC39	339829	hgsc.bcm.edu;ucsc.edu	37	3	180349355	180349355	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:180349355T>C	ENST00000442201.2	-	14	2019	c.1900A>G	c.(1900-1902)Aaa>Gaa	p.K634E	CCDC39_ENST00000273654.4_Missense_Mutation_p.K718E	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	634					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTCTCAATTTTACTTAGCCGC	0.343																																																	0													74.0	72.0	73.0					3																	180349355		1820	4088	5908	SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1900A>G	3.37:g.180349355T>C	ENSP00000405708:p.Lys634Glu		B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.617477	0.66787	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	.	.	.	5.19	3.95	0.45737	.	0.162092	0.52532	D	0.000075	T	0.51601	0.1684	M	0.66939	2.045	0.38838	D	0.955997	P	0.39601	0.68	B	0.35727	0.209	T	0.56529	-0.7964	9	0.30078	T	0.28	-31.5987	11.7709	0.51958	0.0:0.0:0.1459:0.8541	.	634	Q9UFE4	CCD39_HUMAN	E	718;634	.	ENSP00000273654:K718E	K	-	1	0	CCDC39	181832049	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.828000	0.62730	2.076000	0.62316	0.533000	0.62120	AAA		0.343	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3		XM_291028	
CD101	9398	hgsc.bcm.edu	37	1	117560837	117560837	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:117560837T>C	ENST00000256652.4	+	6	1730	c.1672T>C	c.(1672-1674)Ttt>Ctt	p.F558L	CD101_ENST00000369470.1_Missense_Mutation_p.F558L	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	558	Ig-like C2-type 5.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AACCAACACCTTTGACCTGTC	0.468																																																	0													113.0	86.0	95.0					1																	117560837		2203	4300	6503	SO:0001583	missense	9398			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1672T>C	1.37:g.117560837T>C	ENSP00000256652:p.Phe558Leu		Q15856	Missense_Mutation	SNP	ENST00000256652.4	37	CCDS891.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.784582	0.31593	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	D;D	0.93659	-3.26;-3.26	5.33	1.38	0.22167	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.476428	0.19507	N	0.112609	D	0.85860	0.5795	M	0.77616	2.38	0.30819	N	0.738017	B	0.21071	0.051	B	0.19946	0.027	T	0.78884	-0.2028	10	0.56958	D	0.05	-8.0019	6.1484	0.20298	0.1538:0.0:0.3198:0.5264	.	558	Q93033	IGSF2_HUMAN	L	558	ENSP00000256652:F558L;ENSP00000358482:F558L	ENSP00000256652:F558L	F	+	1	0	CD101	117362360	0.633000	0.27181	0.954000	0.39281	0.183000	0.23260	0.902000	0.28459	0.420000	0.25954	0.533000	0.62120	TTT		0.468	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1		NM_004258	
CHORDC1	26973	hgsc.bcm.edu	37	11	89956063	89956063	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:89956063G>A	ENST00000320585.6	-	1	469	c.60C>T	c.(58-60)tcC>tcT	p.S20S	CHORDC1_ENST00000530765.1_Silent_p.S20S|CHORDC1_ENST00000457199.2_Silent_p.S20S	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	20	CHORD 1. {ECO:0000255|PROSITE- ProRule:PRU00734}.|Interaction with PPP5C. {ECO:0000250}.				chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				TCTTACCGTCGGAATTGGTCT	0.642																																																	0													46.0	38.0	41.0					11																	89956063		2201	4298	6499	SO:0001819	synonymous_variant	26973			AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.60C>T	11.37:g.89956063G>A			B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Silent	SNP	ENST00000320585.6	37	CCDS8289.1																																																																																				0.642	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394111.1		NM_012124	
CLSTN3	9746	hgsc.bcm.edu;ucsc.edu	37	12	7288128	7288128	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:7288128G>A	ENST00000266546.6	+	4	1039	c.589G>A	c.(589-591)Gac>Aac	p.D197N	CLSTN3_ENST00000537408.1_Missense_Mutation_p.D209N	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	197	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CATTGACAATGACGGTGAGTC	0.582																																																	0													160.0	128.0	139.0					12																	7288128		2203	4300	6503	SO:0001583	missense	9746			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.589G>A	12.37:g.7288128G>A	ENSP00000266546:p.Asp197Asn		D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.831656	0.32329	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.44083	0.93;0.93	5.02	5.02	0.67125	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.37461	0.1004	N	0.04994	-0.135	0.80722	D	1	D;B	0.64830	0.994;0.309	P;B	0.56343	0.796;0.23	T	0.29150	-1.0021	10	0.20519	T	0.43	-28.6439	18.5263	0.90974	0.0:0.0:1.0:0.0	.	209;197	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	N	197;209	ENSP00000266546:D197N;ENSP00000440679:D209N	ENSP00000266546:D197N	D	+	1	0	CLSTN3	7179395	1.000000	0.71417	0.471000	0.27229	0.131000	0.20780	9.657000	0.98554	2.619000	0.88677	0.462000	0.41574	GAC		0.582	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2		NM_014718	
COL17A1	1308	hgsc.bcm.edu;ucsc.edu	37	10	105815754	105815755	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr10:105815754_105815755delCT	ENST00000353479.5	-	18	1762_1763	c.1472_1473delAG	c.(1471-1473)gagfs	p.E491fs	COL17A1_ENST00000369733.3_Frame_Shift_Del_p.E491fs|COL17A1_ENST00000480127.1_5'Flank	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	491	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GCTTCCTCACCTCCTCCGCTGC	0.574																																																	0																																										SO:0001589	frameshift_variant	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1472_1473delAG	10.37:g.105815754_105815755delCT	ENSP00000340937:p.Glu491fs		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Frame_Shift_Del	DEL	ENST00000353479.5	37	CCDS7554.1																																																																																				0.574	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1		NM_130778, NM_000494	
COL6A6	131873	hgsc.bcm.edu;ucsc.edu	37	3	130289877	130289877	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:130289877A>G	ENST00000358511.6	+	6	2648	c.2617A>G	c.(2617-2619)Att>Gtt	p.I873V	COL6A6_ENST00000453409.2_Missense_Mutation_p.I873V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	873	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ACTGGAGGTAATTTCAGTGCT	0.522																																																	0													59.0	61.0	60.0					3																	130289877		1923	4130	6053	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2617A>G	3.37:g.130289877A>G	ENSP00000351310:p.Ile873Val		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	2.338	-0.351889	0.05173	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78246	-1.16;-1.16	4.87	3.65	0.41850	von Willebrand factor, type A (3);	0.103160	0.42821	N	0.000647	T	0.63745	0.2537	L	0.31371	0.925	0.09310	N	1	B	0.13145	0.007	B	0.12156	0.007	T	0.45934	-0.9227	10	0.18276	T	0.48	.	10.6766	0.45789	0.9216:0.0:0.0784:0.0	.	873	A6NMZ7	CO6A6_HUMAN	V	873	ENSP00000351310:I873V;ENSP00000399236:I873V	ENSP00000351310:I873V	I	+	1	0	COL6A6	131772567	0.000000	0.05858	0.982000	0.44146	0.306000	0.27790	0.842000	0.27627	0.769000	0.33313	0.459000	0.35465	ATT		0.522	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5		NM_001102608	
COMMD10	51397	hgsc.bcm.edu;ucsc.edu	37	5	115469775	115469775	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:115469775T>A	ENST00000274458.4	+	5	472	c.410T>A	c.(409-411)gTt>gAt	p.V137D	COMMD10_ENST00000515539.1_Missense_Mutation_p.V123D	NM_016144.2	NP_057228.1	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	137	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.									endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(2)	9		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		CTAGAGACCGTTGGATGGCAG	0.418																																																	0													112.0	92.0	98.0					5																	115469775		2202	4300	6502	SO:0001583	missense	51397			AY542165	CCDS34215.1	5q23.1	2008-02-05				ENSG00000145781			30201	protein-coding gene	gene with protein product						15799966	Standard	NM_016144		Approved	PTD002	uc003krt.1	Q9Y6G5		ENST00000274458.4:c.410T>A	5.37:g.115469775T>A	ENSP00000274458:p.Val137Asp		D3DT07|Q9P077	Missense_Mutation	SNP	ENST00000274458.4	37	CCDS34215.1	.	.	.	.	.	.	.	.	.	.	T	18.31	3.595216	0.66219	.	.	ENSG00000145781	ENST00000274458;ENST00000515539	T;T	0.12569	2.67;2.67	6.02	6.02	0.97574	COMM domain (1);	0.161425	0.56097	D	0.000037	T	0.34337	0.0894	M	0.75264	2.295	0.51233	D	0.999913	D	0.59767	0.986	D	0.65573	0.936	T	0.09271	-1.0682	10	0.87932	D	0	-21.0337	10.5466	0.45064	0.0:0.0722:0.0:0.9278	.	137	Q9Y6G5	COMDA_HUMAN	D	137;123	ENSP00000274458:V137D;ENSP00000427319:V123D	ENSP00000274458:V137D	V	+	2	0	COMMD10	115497674	1.000000	0.71417	0.799000	0.32177	0.833000	0.47200	5.084000	0.64462	2.299000	0.77371	0.528000	0.53228	GTT		0.418	COMMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371033.1		NM_016144	
CPS1	1373	hgsc.bcm.edu;ucsc.edu	37	2	211541841	211541841	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr2:211541841C>G	ENST00000233072.5	+	37	4581	c.4385C>G	c.(4384-4386)cCt>cGt	p.P1462R	CPS1_ENST00000451903.2_Missense_Mutation_p.P1011R|CPS1_ENST00000430249.2_Missense_Mutation_p.P1468R	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1462			P -> R (in CPS1D). {ECO:0000269|PubMed:21120950}.		anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGTGGAATCCCTCTCCTCACT	0.403																																																	0													197.0	188.0	191.0					2																	211541841		2203	4300	6503	SO:0001583	missense	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.4385C>G	2.37:g.211541841C>G	ENSP00000233072:p.Pro1462Arg		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022782	0.75275	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.84873	-1.91;-1.91;-1.91	5.66	5.66	0.87406	Methylglyoxal synthase-like domain (4);	0.160065	0.56097	D	0.000033	D	0.94499	0.8229	H	0.95574	3.69	0.35128	D	0.767687	P;P	0.39862	0.692;0.692	P;P	0.55011	0.766;0.766	D	0.97647	1.0152	10	0.87932	D	0	-1.827	19.752	0.96271	0.0:1.0:0.0:0.0	.	1472;1462	Q59HF8;P31327	.;CPSM_HUMAN	R	1468;1470;1462;1011	ENSP00000402608:P1468R;ENSP00000233072:P1462R;ENSP00000406136:P1011R	ENSP00000233072:P1462R	P	+	2	0	CPS1	211250086	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.011000	0.76359	2.668000	0.90789	0.462000	0.41574	CCT		0.403	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5			
DGCR8	54487	hgsc.bcm.edu;ucsc.edu	37	22	20074764	20074764	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr22:20074764A>G	ENST00000351989.3	+	3	1229	c.800A>G	c.(799-801)tAt>tGt	p.Y267C	DGCR8_ENST00000383024.2_Missense_Mutation_p.Y267C|DGCR8_ENST00000407755.1_Missense_Mutation_p.Y267C|MIR1306_ENST00000408439.1_RNA|MIR3618_ENST00000580330.1_RNA	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	267	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					GAGGAAAAATATGGCGGAGAC	0.498																																																	0													144.0	120.0	128.0					22																	20074764		2203	4300	6503	SO:0001583	missense	54487			AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.800A>G	22.37:g.20074764A>G	ENSP00000263209:p.Tyr267Cys		B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Missense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.968475	0.74131	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000407755	T;T;T	0.33216	1.45;1.42;1.42	5.93	4.84	0.62591	.	0.056146	0.64402	D	0.000001	T	0.43545	0.1252	L	0.51422	1.61	0.80722	D	1	D;D	0.65815	0.995;0.992	P;P	0.60415	0.874;0.751	T	0.24905	-1.0147	10	0.46703	T	0.11	-10.4597	11.7945	0.52090	0.8685:0.0:0.0:0.1315	.	267;267	Q8WYQ5-3;Q8WYQ5	.;DGCR8_HUMAN	C	267	ENSP00000263209:Y267C;ENSP00000372488:Y267C;ENSP00000384726:Y267C	ENSP00000263209:Y267C	Y	+	2	0	DGCR8	18454764	0.998000	0.40836	0.951000	0.38953	0.751000	0.42716	3.903000	0.56318	2.271000	0.75665	0.459000	0.35465	TAT		0.498	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1			
DLL1	28514	hgsc.bcm.edu	37	6	170592784	170592784	+	Missense_Mutation	SNP	G	G	T	rs202240161	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:170592784G>T	ENST00000366756.3	-	9	1916	c.1583C>A	c.(1582-1584)gCg>gAg	p.A528E		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	528					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.A528V(1)		NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GTCCACCACCGCTGGGCCCGG	0.697																																																	1	Substitution - Missense(1)	lung(1)											12.0	14.0	14.0					6																	170592784		2155	4241	6396	SO:0001583	missense	28514			AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1583C>A	6.37:g.170592784G>T	ENSP00000355718:p.Ala528Glu		B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	37	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	G	1.783	-0.481378	0.04383	.	.	ENSG00000198719	ENST00000366756	D	0.87650	-2.28	5.41	1.56	0.23342	.	0.674133	0.11869	U	0.521677	T	0.60945	0.2308	N	0.14661	0.345	0.23070	N	0.998345	B	0.24092	0.097	B	0.29716	0.106	T	0.57539	-0.7794	10	0.87932	D	0	.	5.9266	0.19116	0.7104:0.1391:0.1505:0.0	.	528	O00548	DLL1_HUMAN	E	528	ENSP00000355718:A528E	ENSP00000355718:A528E	A	-	2	0	DLL1	170434709	0.237000	0.23815	0.694000	0.30210	0.226000	0.24999	2.160000	0.42348	0.375000	0.24679	-0.302000	0.09304	GCG		0.697	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043254.1			
DPP4	1803	hgsc.bcm.edu;ucsc.edu	37	2	162865775	162865775	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr2:162865775G>A	ENST00000360534.3	-	21	2423	c.1863C>T	c.(1861-1863)aaC>aaT	p.N621N	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	621					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	CAATTCGTTTGTTGTCCACAA	0.363																																																	0													152.0	142.0	146.0					2																	162865775		2203	4300	6503	SO:0001819	synonymous_variant	1803			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1863C>T	2.37:g.162865775G>A			Q53TN1	Silent	SNP	ENST00000360534.3	37	CCDS2216.1																																																																																				0.363	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2			
EIF4H	7458	hgsc.bcm.edu	37	7	73604047	73604047	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr7:73604047G>C	ENST00000265753.8	+	3	431	c.292G>C	c.(292-294)Gcc>Ccc	p.A98P	MIR590_ENST00000385008.1_RNA|EIF4H_ENST00000495187.1_3'UTR|EIF4H_ENST00000353999.6_Missense_Mutation_p.A98P	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	98	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						CCTTAAGGAAGCCTTGACATA	0.398																																																	0													151.0	139.0	143.0					7																	73604047		2203	4300	6503	SO:0001583	missense	7458				CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.292G>C	7.37:g.73604047G>C	ENSP00000265753:p.Ala98Pro		A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	ENST00000265753.8	37	CCDS5564.1	.	.	.	.	.	.	.	.	.	.	G	33	5.261605	0.95368	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	D;D	0.88354	-2.37;-2.37	5.38	5.38	0.77491	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.97077	0.9045	H	0.98754	4.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.999;0.999;0.992;1.0	D	0.98758	1.0723	10	0.87932	D	0	-15.4363	17.6821	0.88246	0.0:0.0:1.0:0.0	.	98;98;98;98	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	P	98	ENSP00000265753:A98P;ENSP00000265754:A98P	ENSP00000265753:A98P	A	+	1	0	EIF4H	73241983	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.394000	0.97261	2.532000	0.85374	0.655000	0.94253	GCC		0.398	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252375.2		NM_022170	
EML5	161436	hgsc.bcm.edu;ucsc.edu	37	14	89128141	89128141	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr14:89128141C>A	ENST00000380664.5	-	25	3531	c.3532G>T	c.(3532-3534)Gta>Tta	p.V1178L	EML5_ENST00000352093.5_Missense_Mutation_p.V1140L|EML5_ENST00000554922.1_Missense_Mutation_p.V1178L			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1178						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AAACCAAGTACACTTGTCCAT	0.373																																																	0													53.0	50.0	51.0					14																	89128141		1844	4087	5931	SO:0001583	missense	161436			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3532G>T	14.37:g.89128141C>A	ENSP00000370039:p.Val1178Leu		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684667	0.88639	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.52983	0.9;0.64;0.94	4.42	4.42	0.53409	.	0.000000	0.64402	D	0.000002	T	0.70789	0.3264	M	0.84156	2.68	0.54753	D	0.99998	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.992	T	0.73304	-0.4025	10	0.39692	T	0.17	-10.7495	17.2287	0.86978	0.0:1.0:0.0:0.0	.	1178;1178	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	L	1178;1140;1178	ENSP00000451998:V1178L;ENSP00000298315:V1140L;ENSP00000370039:V1178L	ENSP00000298315:V1140L	V	-	1	0	EML5	88197894	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.320000	0.79064	2.284000	0.76573	0.460000	0.39030	GTA		0.373	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1			
EP400	57634	hgsc.bcm.edu	37	12	132505639	132505639	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:132505639T>C	ENST00000333577.4	+	24	4680	c.4571T>C	c.(4570-4572)tTt>tCt	p.F1524S	EP400_ENST00000389561.2_Missense_Mutation_p.F1488S|EP400_ENST00000332482.4_Missense_Mutation_p.F1451S|EP400_ENST00000330386.6_Intron|EP400_ENST00000389562.2_Missense_Mutation_p.F1487S			Q96L91	EP400_HUMAN	E1A binding protein p400	1524					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GCAGCCCCGTTTCAGACCTCT	0.512																																																	0													36.0	43.0	41.0					12																	132505639		2203	4300	6503	SO:0001583	missense	57634			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4571T>C	12.37:g.132505639T>C	ENSP00000333602:p.Phe1524Ser		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	T	11.87	1.767518	0.31320	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000541296	D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.51	4.78	1.59	0.23543	.	0.894418	0.09580	N	0.782960	D	0.83036	0.5167	L	0.51422	1.61	0.80722	D	1	B;B	0.15141	0.012;0.012	B;B	0.11329	0.006;0.006	T	0.69075	-0.5241	10	0.22109	T	0.4	.	5.2416	0.15475	0.0:0.1204:0.1664:0.7132	.	1488;1487	Q96L91-2;Q96L91-5	.;.	S	1524;1488;1487;1451;1488	ENSP00000333602:F1524S;ENSP00000374212:F1488S;ENSP00000374213:F1487S;ENSP00000331737:F1451S	ENSP00000331737:F1451S	F	+	2	0	EP400	131071592	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	1.429000	0.34903	0.127000	0.18452	0.459000	0.35465	TTT		0.512	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			NM_015409	
EPC2	26122	hgsc.bcm.edu;ucsc.edu	37	2	149519487	149519487	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr2:149519487T>A	ENST00000258484.6	+	5	837	c.803T>A	c.(802-804)gTt>gAt	p.V268D		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	268					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		ACCTTAGAAGTTGTGGAGAAA	0.348																																																	0													77.0	72.0	74.0					2																	149519487		1836	4076	5912	SO:0001583	missense	26122			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.803T>A	2.37:g.149519487T>A	ENSP00000258484:p.Val268Asp		B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	ENST00000258484.6	37	CCDS46422.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.697381	0.88830	.	.	ENSG00000135999	ENST00000258484	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.78898	0.4356	M	0.81802	2.56	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.82368	-0.0492	9	0.87932	D	0	-3.4451	15.772	0.78176	0.0:0.0:0.0:1.0	.	268	Q52LR7	EPC2_HUMAN	D	268	.	ENSP00000258484:V268D	V	+	2	0	EPC2	149235957	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.133000	0.65898	0.477000	0.44152	GTT		0.348	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332278.1		NM_015630	
EPN3	55040	hgsc.bcm.edu;ucsc.edu	37	17	48618639	48618639	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr17:48618639G>A	ENST00000268933.3	+	8	1878	c.1299G>A	c.(1297-1299)gaG>gaA	p.E433E	EPN3_ENST00000537145.1_Silent_p.E461E|EPN3_ENST00000541226.1_3'UTR|RP11-94C24.8_ENST00000513017.1_RNA	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	433						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			AATCCACAGAGACCAAGGAGG	0.607																																																	0													154.0	162.0	159.0					17																	48618639		2203	4300	6503	SO:0001819	synonymous_variant	55040			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.1299G>A	17.37:g.48618639G>A			A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Silent	SNP	ENST00000268933.3	37	CCDS11570.1																																																																																				0.607	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1		NM_017957	
FAM129C	199786	hgsc.bcm.edu	37	19	17662616	17662616	+	Intron	SNP	G	G	A	rs76629753	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:17662616G>A	ENST00000335393.4	+	16	1981				FAM129C_ENST00000352727.3_Missense_Mutation_p.R586Q|FAM129C_ENST00000600871.1_Missense_Mutation_p.R540Q|FAM129C_ENST00000332386.5_Missense_Mutation_p.R622Q|FAM129C_ENST00000601861.1_Intron|FAM129C_ENST00000599124.1_Missense_Mutation_p.R555Q|FAM129C_ENST00000599164.1_Missense_Mutation_p.R591Q|FAM129C_ENST00000449408.2_Intron	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C											autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						gaggctgagcgggaaggaggg	0.507													g|||	308	0.0615016	0.0885	0.0418	5008	,	,		14475	0.0317		0.0417	False		,,,				2504	0.09																0								G	GLN/ARG,	258,3488		12,234,1627	40.0	43.0	42.0		1865,	0.6	0.1	19	dbSNP_131	42	440,7782		11,418,3682	yes	missense,intron	FAM129C	NM_001098524.1,NM_173544.4	43,	23,652,5309	AA,AG,GG		5.3515,6.8873,5.8322	,	622/652,	17662616	698,11270	1873	4111	5984	SO:0001627	intron_variant	199786			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1844-1506G>A	19.37:g.17662616G>A			B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	CCDS12362.1	102	0.046703296703296704	34	0.06910569105691057	17	0.04696132596685083	19	0.033216783216783216	32	0.04221635883905013	G	3.985	-0.005567	0.07773	0.068873	0.053515	ENSG00000167483	ENST00000332386;ENST00000352727;ENST00000435646	T;T	0.26223	2.14;1.75	0.649	0.649	0.17806	.	.	.	.	.	T	0.00666	0.0022	N	0.08118	0	0.09310	N	1	P;P;P	0.45672	0.658;0.864;0.864	B;B;B	0.32724	0.107;0.151;0.151	T	0.18241	-1.0343	8	0.62326	D	0.03	.	.	.	.	.	540;622;586	E7ENP6;Q86XR2-3;Q86XR2-4	.;.;.	Q	622;586;540	ENSP00000333447:R622Q;ENSP00000341067:R586Q	ENSP00000333447:R622Q	R	+	2	0	FAM129C	17523616	0.062000	0.20869	0.051000	0.19133	0.016000	0.09150	0.342000	0.19926	0.598000	0.29829	0.462000	0.41574	CGG		0.507	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1		NM_173544	
FAM92B	339145	hgsc.bcm.edu;ucsc.edu	37	16	85135890	85135890	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr16:85135890G>A	ENST00000539556.1	-	7	736	c.581C>T	c.(580-582)gCc>gTc	p.A194V		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	194										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						CACCGCTTTGGCATGGAAAAC	0.473																																																	0													93.0	88.0	90.0					16																	85135890		2198	4300	6498	SO:0001583	missense	339145				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.581C>T	16.37:g.85135890G>A	ENSP00000443411:p.Ala194Val			Missense_Mutation	SNP	ENST00000539556.1	37	CCDS32500.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044850	0.75732	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.60171	0.21	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000002	T	0.76550	0.4003	M	0.83603	2.65	0.39786	D	0.972368	D	0.76494	0.999	D	0.73380	0.98	T	0.80306	-0.1438	10	0.72032	D	0.01	-36.5122	13.1321	0.59389	0.0:0.1606:0.8394:0.0	.	194	Q6ZTR7	FA92B_HUMAN	V	194	ENSP00000443411:A194V	ENSP00000376937:A194V	A	-	2	0	FAM92B	83693391	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	5.033000	0.64146	2.745000	0.94114	0.555000	0.69702	GCC		0.473	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			NM_198491	
FBXO5	26271	hgsc.bcm.edu;ucsc.edu	37	6	153294238	153294238	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:153294238G>C	ENST00000229758.3	-	3	910	c.852C>G	c.(850-852)atC>atG	p.I284M	FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_Missense_Mutation_p.I238M	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	284	F-box.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		CATCTTCTAGGATCTTCTTCC	0.348																																					NSCLC(121;372 1757 17721 17977 29669)												0													149.0	125.0	133.0					6																	153294238		2203	4300	6503	SO:0001583	missense	26271			AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.852C>G	6.37:g.153294238G>C	ENSP00000229758:p.Ile284Met		B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Missense_Mutation	SNP	ENST00000229758.3	37	CCDS5242.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184323	0.57800	.	.	ENSG00000112029	ENST00000229758;ENST00000367241	T;T	0.25579	1.79;1.79	5.95	-0.36	0.12568	F-box domain, cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.31389	0.0795	M	0.80183	2.485	0.49051	D	0.999742	D	0.89917	1.0	D	0.79784	0.993	T	0.17776	-1.0358	10	0.72032	D	0.01	-20.8697	4.0269	0.09692	0.4873:0.0:0.2694:0.2434	.	284	Q9UKT4	FBX5_HUMAN	M	284;238	ENSP00000229758:I284M;ENSP00000356210:I238M	ENSP00000229758:I284M	I	-	3	3	FBXO5	153335931	0.994000	0.37717	1.000000	0.80357	0.924000	0.55760	0.321000	0.19558	0.137000	0.18759	-0.471000	0.05019	ATC		0.348	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1			
FCGRT	2217	hgsc.bcm.edu	37	19	50017140	50017140	+	Splice_Site	SNP	A	A	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:50017140A>C	ENST00000221466.5	+	3	561	c.75A>C	c.(73-75)gaA>gaC	p.E25D	FCGRT_ENST00000426395.3_Splice_Site_p.E25D|FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000596975.1_Splice_Site_p.E25D|FCGRT_ENST00000594823.1_3'UTR	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	25	Alpha-1.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		TGTCTGCAGAAAGCCACCTCT	0.622																																																	0													182.0	180.0	180.0					19																	50017140		2203	4300	6503	SO:0001630	splice_region_variant	2217			U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.74-1A>C	19.37:g.50017140A>C			Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	A	15.74	2.922305	0.52653	.	.	ENSG00000104870	ENST00000221466;ENST00000426395;ENST00000415900;ENST00000452439	T;T	0.00760	5.73;5.73	4.6	-6.63	0.01807	MHC classes I/II-like antigen recognition protein (1);	1.333190	0.05462	N	0.551500	T	0.00524	0.0017	N	0.04297	-0.235	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51156	-0.8741	10	0.87932	D	0	.	9.2532	0.37568	0.1647:0.587:0.2483:0.0	.	25	P55899	FCGRN_HUMAN	D	25	ENSP00000221466:E25D;ENSP00000410798:E25D	ENSP00000221466:E25D	E	+	3	2	FCGRT	54708952	0.002000	0.14202	0.000000	0.03702	0.609000	0.37215	-0.496000	0.06436	-0.841000	0.04200	-1.162000	0.01777	GAA		0.622	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1			Missense_Mutation
GIT1	28964	hgsc.bcm.edu	37	17	27902653	27902656	+	Frame_Shift_Del	DEL	CAGT	CAGT	-			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	CAGT	CAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr17:27902653_27902656delCAGT	ENST00000225394.3	-	17	2066_2069	c.1818_1821delACTG	c.(1816-1821)ccactgfs	p.PL606fs	GIT1_ENST00000581348.1_Frame_Shift_Del_p.PL592fs|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000394869.3_Frame_Shift_Del_p.PL615fs|GIT1_ENST00000579937.1_Frame_Shift_Del_p.PL606fs	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	606					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		CTCACCCCAGCAGTGGGTCCCCAC	0.672																																					Colon(81;41 1719 20078 35068)												0																																										SO:0001589	frameshift_variant	28964			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1818_1821delACTG	17.37:g.27902653_27902656delCAGT	ENSP00000225394:p.Pro606fs		B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Frame_Shift_Del	DEL	ENST00000225394.3	37	CCDS11250.1																																																																																				0.672	GIT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256073.1		NM_014030	
GPR137	56834	hgsc.bcm.edu;ucsc.edu	37	11	64054436	64054436	+	Splice_Site	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:64054436G>C	ENST00000313074.3	+	2	462		c.e2-1		GPR137_ENST00000438980.2_Splice_Site|BAD_ENST00000394532.3_5'Flank|BAD_ENST00000394531.3_5'Flank|GPR137_ENST00000377702.4_Splice_Site|GPR137_ENST00000539851.1_Splice_Site|GPR137_ENST00000411458.1_Splice_Site|BAD_ENST00000309032.3_5'Flank|BAD_ENST00000544785.1_5'Flank	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						TCTGCTCCTAGGTGGTGTTCA	0.622																																																	0													89.0	69.0	76.0					11																	64054436		2201	4297	6498	SO:0001630	splice_region_variant	56834			AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.358-1G>C	11.37:g.64054436G>C			B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Splice_Site	SNP	ENST00000313074.3	37	CCDS8066.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376702	0.61735	.	.	ENSG00000173264	ENST00000546139;ENST00000411458;ENST00000539851;ENST00000536667;ENST00000539833;ENST00000377702;ENST00000535675;ENST00000543383;ENST00000538032;ENST00000540969;ENST00000438980;ENST00000313074;ENST00000542190;ENST00000541952	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2732	0.49150	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR137	63811012	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.301000	0.72782	2.024000	0.59613	0.561000	0.74099	.		0.622	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1		NM_020155	Intron
GPR137	56834	hgsc.bcm.edu;ucsc.edu	37	11	64054443	64054443	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:64054443T>G	ENST00000313074.3	+	2	469	c.364T>G	c.(364-366)Ttc>Gtc	p.F122V	GPR137_ENST00000438980.2_Missense_Mutation_p.F122V|BAD_ENST00000394532.3_5'Flank|BAD_ENST00000394531.3_5'Flank|GPR137_ENST00000377702.4_Missense_Mutation_p.F122V|GPR137_ENST00000539851.1_Missense_Mutation_p.F122V|GPR137_ENST00000411458.1_Missense_Mutation_p.F180V|BAD_ENST00000309032.3_5'Flank|BAD_ENST00000544785.1_5'Flank	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	122						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						CTAGGTGGTGTTCAAGGCCAA	0.627																																																	0													86.0	67.0	73.0					11																	64054443		2201	4297	6498	SO:0001583	missense	56834			AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.364T>G	11.37:g.64054443T>G	ENSP00000321698:p.Phe122Val		B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Missense_Mutation	SNP	ENST00000313074.3	37	CCDS8066.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.589753	0.66105	.	.	ENSG00000173264	ENST00000546139;ENST00000411458;ENST00000539851;ENST00000536667;ENST00000539833;ENST00000377702;ENST00000535675;ENST00000543383;ENST00000538032;ENST00000540969;ENST00000438980;ENST00000313074;ENST00000542190;ENST00000541952	T;T;T;T;T;T;T;T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44;2.44	3.91	3.91	0.45181	.	0.074547	0.53938	D	0.000048	T	0.17492	0.0420	L	0.42245	1.32	0.80722	D	1	P;P;B;B;P;P;B	0.50819	0.597;0.939;0.337;0.234;0.597;0.886;0.337	P;B;B;B;P;B;B	0.46110	0.504;0.298;0.057;0.061;0.504;0.298;0.057	T	0.01280	-1.1397	10	0.49607	T	0.09	-16.8723	9.0623	0.36442	0.0:0.0:0.0:1.0	.	122;180;128;122;122;122;122	B7Z7M1;B4DTG7;F5H234;Q96N19-2;F5GXI8;Q96N19;Q96N19-3	.;.;.;.;.;G137A_HUMAN;.	V	128;180;122;10;122;122;122;122;122;122;122;122;122;122	ENSP00000445570:F128V;ENSP00000411827:F180V;ENSP00000442792:F122V;ENSP00000438716:F122V;ENSP00000366931:F122V;ENSP00000446342:F122V;ENSP00000441003:F122V;ENSP00000445000:F122V;ENSP00000415698:F122V;ENSP00000321698:F122V;ENSP00000441034:F122V;ENSP00000442929:F122V	ENSP00000321698:F122V	F	+	1	0	GPR137	63811019	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.882000	0.39648	1.646000	0.50622	0.459000	0.35465	TTC		0.627	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1		NM_020155	
TNIP1	10318	hgsc.bcm.edu	37	5	150407659	150407659	+	IGR	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:150407659C>T	ENST00000389378.2	-	0	3268				GPX3_ENST00000517973.1_3'UTR|GPX3_ENST00000388825.4_Missense_Mutation_p.R217W	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1						defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTACATGAGGCGGCAGGCAGC	0.567																																																	0													27.0	35.0	32.0					5																	150407659		2108	4228	6336	SO:0001628	intergenic_variant	2878			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025			5.37:g.150407659C>T			A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.54|15.54	2.863431|2.863431	0.51482|0.51482	.|.	.|.	ENSG00000211445|ENSG00000211445	ENST00000521632|ENST00000388825	.|T	.|0.03242	.|4.0	5.54|5.54	4.59|4.59	0.56863|0.56863	.|Thioredoxin-like fold (1);	.|0.485564	.|0.21174	.|N	.|0.078934	T|T	0.03651|0.03651	0.0104|0.0104	L|L	0.33339|0.33339	1.005|1.005	0.49483|0.49483	D|D	0.999797|0.999797	.|D	.|0.63046	.|0.992	.|B	.|0.40677	.|0.337	T|T	0.44847|0.44847	-0.9301|-0.9301	5|10	.|0.87932	.|D	.|0	.|.	9.7795|9.7795	0.40640|0.40640	0.2129:0.7115:0.0:0.0756|0.2129:0.7115:0.0:0.0756	.|.	.|217	.|P22352	.|GPX3_HUMAN	V|W	153|217	.|ENSP00000373477:R217W	.|ENSP00000373477:R217W	A|R	+|+	2|1	0|2	GPX3|GPX3	150387852|150387852	0.031000|0.031000	0.19500|0.19500	0.895000|0.895000	0.35142|0.35142	0.890000|0.890000	0.51754|0.51754	0.866000|0.866000	0.27954|0.27954	2.589000|2.589000	0.87451|0.87451	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.567	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1		NM_006058	
GRID1	2894	hgsc.bcm.edu;ucsc.edu	37	10	87379671	87379671	+	Silent	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr10:87379671C>A	ENST00000327946.7	-	14	2398	c.2313G>T	c.(2311-2313)ggG>ggT	p.G771G	GRID1_ENST00000536331.1_Silent_p.G342G	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	771					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GCAGGGCAATCCCGTAACCCT	0.597										Multiple Myeloma(13;0.14)																																							0													105.0	80.0	89.0					10																	87379671		2203	4300	6503	SO:0001819	synonymous_variant	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2313G>T	10.37:g.87379671C>A			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	ENST00000327946.7	37	CCDS31236.1																																																																																				0.597	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3		XM_043613	
HDLBP	3069	hgsc.bcm.edu;ucsc.edu	37	2	242179477	242179477	+	Missense_Mutation	SNP	C	C	T	rs143103039		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr2:242179477C>T	ENST00000391975.1	-	18	2457	c.2230G>A	c.(2230-2232)Ggc>Agc	p.G744S	HDLBP_ENST00000427183.2_Missense_Mutation_p.G711S|HDLBP_ENST00000391976.2_Missense_Mutation_p.G744S|HDLBP_ENST00000310931.4_Missense_Mutation_p.G744S	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	744	KH 9. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCCCCCTTGCCGATGAGGAAT	0.547																																																	0								C	SER/GLY,SER/GLY	0,4406		0,0,2203	167.0	157.0	160.0		2230,2230	1.7	0.0	2	dbSNP_134	160	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	HDLBP	NM_005336.4,NM_203346.3	56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	744/1269,744/1269	242179477	1,13005	2203	4300	6503	SO:0001583	missense	3069				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2230G>A	2.37:g.242179477C>T	ENSP00000375836:p.Gly744Ser		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.543717|4.543717	0.86022|0.86022	0.0|0.0	1.16E-4|1.16E-4	ENSG00000115677|ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000452931|ENST00000373292	D;D;D;D;T|.	0.88586|.	-2.4;-2.4;-2.4;-2.4;1.44|.	5.59|5.59	1.71|1.71	0.24356|0.24356	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);|.	0.094339|.	0.64402|.	N|.	0.000001|.	T|T	0.76659|0.76659	0.4018|0.4018	M|M	0.89715|0.89715	3.055|3.055	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.75833|0.75833	-0.3178|-0.3178	10|5	0.87932|.	D|.	0|.	-32.2504|-32.2504	9.9141|9.9141	0.41423|0.41423	0.0:0.7176:0.0:0.2824|0.0:0.7176:0.0:0.2824	.|.	711;744|.	E7EM71;Q00341|.	.;VIGLN_HUMAN|.	S|Q	744;744;744;711;253|552	ENSP00000375836:G744S;ENSP00000375837:G744S;ENSP00000312042:G744S;ENSP00000399139:G711S;ENSP00000388876:G253S|.	ENSP00000312042:G744S|.	G|R	-|-	1|2	0|0	HDLBP|HDLBP	241828150|241828150	1.000000|1.000000	0.71417|0.71417	0.029000|0.029000	0.17559|0.17559	0.866000|0.866000	0.49608|0.49608	7.736000|7.736000	0.84948|0.84948	0.036000|0.036000	0.15547|0.15547	0.650000|0.650000	0.86243|0.86243	GGC|CGG		0.547	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5		NM_203346	
HERC2	8924	hgsc.bcm.edu	37	15	28366558	28366558	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr15:28366558T>G	ENST00000261609.7	-	86	13314	c.13206A>C	c.(13204-13206)aaA>aaC	p.K4402N		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTTGTACTACTTTCCGGAAAG	0.448																																																	0													119.0	112.0	115.0					15																	28366558		2203	4300	6503	SO:0001583	missense	8924			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13206A>C	15.37:g.28366558T>G	ENSP00000261609:p.Lys4402Asn			Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.373662	0.42105	.	.	ENSG00000128731	ENST00000261609	T	0.41065	1.01	5.52	0.646	0.17789	.	0.000000	0.85682	D	0.000000	T	0.58566	0.2131	M	0.71581	2.175	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.57929	-0.7726	10	0.87932	D	0	.	10.6869	0.45848	0.0:0.4247:0.0:0.5753	.	4402	O95714	HERC2_HUMAN	N	4402	ENSP00000261609:K4402N	ENSP00000261609:K4402N	K	-	3	2	HERC2	26040153	0.996000	0.38824	0.154000	0.22540	0.142000	0.21351	0.373000	0.20484	-0.141000	0.11374	-0.250000	0.11733	AAA		0.448	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2		NM_004667	
HIST1H1C	3006	hgsc.bcm.edu;ucsc.edu	37	6	26056471	26056471	+	Silent	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:26056471C>T	ENST00000343677.2	-	1	228	c.186G>A	c.(184-186)ctG>ctA	p.L62L		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	62	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						ACGCTTTTTTCAGAGCAGCCA	0.567																																																	0													81.0	90.0	87.0					6																	26056471		2203	4300	6503	SO:0001819	synonymous_variant	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.186G>A	6.37:g.26056471C>T			A8K4I2	Silent	SNP	ENST00000343677.2	37	CCDS4577.1																																																																																				0.567	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1		NM_005319	
HLA-DRB1	3123	hgsc.bcm.edu	37	6	32552091	32552091	+	Missense_Mutation	SNP	G	G	C	rs569286159		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:32552091G>C	ENST00000360004.5	-	2	270	c.165C>G	c.(163-165)ttC>ttG	p.F55L		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	55	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						ATCTGTCCAGGAACCGCACCC	0.627										Multiple Myeloma(14;0.17)																																							0													30.0	29.0	29.0					6																	32552091		2182	4245	6427	SO:0001583	missense	3123			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.165C>G	6.37:g.32552091G>C	ENSP00000353099:p.Phe55Leu		P01914|Q9MYF5	Missense_Mutation	SNP	ENST00000360004.5	37	CCDS47409.1	178	0.0815018315018315	33	0.06707317073170732	41	0.1132596685082873	18	0.03146853146853147	86	0.11345646437994723	.	7.847	0.723069	0.15439	.	.	ENSG00000196126	ENST00000360004	T	0.00353	7.94	3.52	-6.57	0.01842	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (2);MHC classes I/II-like antigen recognition protein (1);	1.314130	0.04757	N	0.425694	T	0.00039	0.0001	N	0.04787	-0.16	0.80722	P	0.0	B	0.10296	0.003	B	0.14023	0.01	T	0.04870	-1.0921	9	0.19590	T	0.45	.	6.7875	0.23682	0.706:0.1223:0.1717:0.0	rs17884840	55	P01911	2B1F_HUMAN	L	55	ENSP00000353099:F55L	ENSP00000353099:F55L	F	-	3	2	HLA-DRB1	32660069	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.894000	0.00707	-1.204000	0.02648	-2.818000	0.00109	TTC		0.627	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076393.3		NM_002124	
KCNJ12	3768	hgsc.bcm.edu	37	17	21319519	21319519	+	Missense_Mutation	SNP	G	G	C	rs78113532	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr17:21319519G>C	ENST00000583088.1	+	3	1760	c.865G>C	c.(865-867)Gag>Cag	p.E289Q	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E289Q	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	289				ET -> QM (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.E289Q(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCAGGACCTGGAGACGGACGA	0.612										Prostate(3;0.18)																																							1	Substitution - Missense(1)	lung(1)											95.0	86.0	89.0					17																	21319519		2203	4300	6503	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.865G>C	17.37:g.21319519G>C	ENSP00000463778:p.Glu289Gln		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275709	0.40294	.	.	ENSG00000184185	ENST00000331718	D	0.94000	-3.33	5.44	5.44	0.79542	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.89870	0.6840	L	0.37800	1.135	0.80722	D	1	B	0.17465	0.022	B	0.18871	0.023	D	0.85448	0.1159	10	0.17369	T	0.5	.	19.2719	0.94013	0.0:0.0:1.0:0.0	.	289	Q14500	IRK12_HUMAN	Q	289	ENSP00000328150:E289Q	ENSP00000328150:E289Q	E	+	1	0	KCNJ12	21260112	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.698000	0.98700	2.561000	0.86390	0.561000	0.74099	GAG		0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2		NM_021012	
KIAA1614	57710	hgsc.bcm.edu	37	1	180910302	180910302	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:180910302G>A	ENST00000367588.4	+	7	3095	c.3040G>A	c.(3040-3042)Ggc>Agc	p.G1014S	RP11-46A10.5_ENST00000358073.2_RNA|KIAA1614_ENST00000367587.1_Missense_Mutation_p.G635S	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1014	Ser-rich.									NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CTCAGCCCTGGGCCAGAGTTC	0.652																																																	0													34.0	42.0	39.0					1																	180910302		1931	4124	6055	SO:0001583	missense	57710			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3040G>A	1.37:g.180910302G>A	ENSP00000356560:p.Gly1014Ser		Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.683263	0.29872	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.28666	2.14;1.6	5.21	2.24	0.28232	.	0.311170	0.30244	N	0.010077	T	0.15739	0.0379	L	0.29908	0.895	0.38720	D	0.953411	B;B	0.32693	0.011;0.38	B;B	0.26517	0.025;0.07	T	0.20974	-1.0259	9	0.19590	T	0.45	-19.4224	5.1366	0.14937	0.2479:0.0:0.6067:0.1453	.	635;1014	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	S	1014;635	ENSP00000356560:G1014S;ENSP00000356559:G635S	ENSP00000356559:G635S	G	+	1	0	KIAA1614	179176925	1.000000	0.71417	0.173000	0.22940	0.206000	0.24218	2.173000	0.42472	0.175000	0.19841	-0.254000	0.11334	GGC		0.652	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1		XM_046531	
KIF15	56992	hgsc.bcm.edu;ucsc.edu	37	3	44816879	44816879	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:44816879G>T	ENST00000326047.4	+	3	345	c.196G>T	c.(196-198)Gag>Tag	p.E66*		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	66	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CTCCAACCCTGAGCCCAAGAC	0.443																																																	0													93.0	79.0	84.0					3																	44816879		2203	4300	6503	SO:0001587	stop_gained	56992			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.196G>T	3.37:g.44816879G>T	ENSP00000324020:p.Glu66*		Q17RV9|Q69YL6|Q96JX7|Q9H280	Nonsense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	G	38	6.840705	0.97877	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	.	.	.	5.63	5.63	0.86233	.	0.123302	0.35903	N	0.002915	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.0401	0.97581	0.0:0.0:1.0:0.0	.	.	.	.	X	66;65	.	ENSP00000324020:E66X	E	+	1	0	KIF15	44791883	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.632000	0.98428	2.805000	0.96524	0.655000	0.94253	GAG		0.443	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2			
KRT73	319101	hgsc.bcm.edu;ucsc.edu	37	12	53009994	53009994	+	Silent	SNP	C	C	T	rs139888404		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:53009994C>T	ENST00000305748.3	-	2	652	c.618G>A	c.(616-618)tcG>tcA	p.S206S	RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	206	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCTCAGCTCCGAGTCCAGCC	0.607																																																	0								C		0,4406		0,0,2203	166.0	148.0	154.0		618	-7.2	0.3	12	dbSNP_134	154	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT73	NM_175068.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		206/541	53009994	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.618G>A	12.37:g.53009994C>T			Q32MB2	Silent	SNP	ENST00000305748.3	37	CCDS8834.1																																																																																				0.607	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1		NM_175068	
LAMTOR1	55004	hgsc.bcm.edu	37	11	71809888	71809888	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:71809888A>T	ENST00000278671.5	-	3	367	c.205T>A	c.(205-207)Tct>Act	p.S69T	LAMTOR1_ENST00000535107.1_Missense_Mutation_p.S69T|LRTOMT_ENST00000439209.1_Intron|LRTOMT_ENST00000435085.1_Intron|LRTOMT_ENST00000419228.1_Intron|LAMTOR1_ENST00000538404.1_Missense_Mutation_p.S69T|LAMTOR1_ENST00000545249.1_Missense_Mutation_p.S69T|LRTOMT_ENST00000307198.7_Intron|LAMTOR1_ENST00000539797.1_5'UTR	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1	69				S -> P (in Ref. 2; CAG33528). {ECO:0000305}.	cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						TCTGCAGCAGACACATCAATG	0.567																																																	0													85.0	56.0	66.0					11																	71809888		2010	3829	5839	SO:0001583	missense	55004			AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869	ENST00000278671.5:c.205T>A	11.37:g.71809888A>T	ENSP00000278671:p.Ser69Thr		Q8WZ09|Q9NWT0	Missense_Mutation	SNP	ENST00000278671.5	37	CCDS8209.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.102961|5.102961	0.94245|0.94245	.|.	.|.	ENSG00000149357|ENSG00000149357	ENST00000544594|ENST00000545249;ENST00000535107;ENST00000278671;ENST00000538404	.|T;T;T;T	.|0.45668	.|0.89;0.89;0.89;0.89	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.47248	.|0.1435	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	.|P	.|0.42518	.|0.782	.|B	.|0.40375	.|0.327	.|T	.|0.53408	.|-0.8443	.|10	0.56958|0.62326	D|D	0.05|0.03	.|.	15.8237|15.8237	0.78678|0.78678	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|69	.|Q6IAA8	.|LTOR1_HUMAN	X|T	55|69	.|ENSP00000440738:S69T;ENSP00000445170:S69T;ENSP00000278671:S69T;ENSP00000439011:S69T	ENSP00000439482:C50X|ENSP00000278671:S69T	C|S	-|-	3|1	2|0	LAMTOR1|LAMTOR1	71487536|71487536	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.823000|0.823000	0.46562|0.46562	6.875000|6.875000	0.75551|0.75551	2.224000|2.224000	0.72417|0.72417	0.533000|0.533000	0.62120|0.62120	TGT|TCT		0.567	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396733.1		NM_017907	
LEPRE1	64175	hgsc.bcm.edu;ucsc.edu	37	1	43228105	43228105	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:43228105G>C	ENST00000296388.5	-	2	558	c.507C>G	c.(505-507)ttC>ttG	p.F169L	LEPRE1_ENST00000397054.3_Missense_Mutation_p.F169L|LEPRE1_ENST00000236040.4_Missense_Mutation_p.F169L			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	169					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TGCCCACGAAGAAGGTGTGTG	0.463																																																	0													147.0	140.0	142.0					1																	43228105		2203	4300	6503	SO:0001583	missense	64175			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.507C>G	1.37:g.43228105G>C	ENSP00000296388:p.Phe169Leu		Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412726	0.83340	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.42900	0.96;0.96;0.96	5.73	4.82	0.62117	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.83118	2.625	0.58432	D	0.999993	D;D;D;D	0.76494	0.999;0.999;0.998;0.998	D;D;D;D	0.77557	0.99;0.99;0.989;0.989	T	0.67852	-0.5563	10	0.87932	D	0	-32.4721	8.9065	0.35526	0.1682:0.0:0.8318:0.0	.	169;169;34;169	Q32P28-2;Q32P28-3;B4DNM8;Q32P28	.;.;.;P3H1_HUMAN	L	169;169;169;34	ENSP00000380245:F169L;ENSP00000236040:F169L;ENSP00000296388:F169L	ENSP00000236040:F169L	F	-	3	2	LEPRE1	43000692	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	3.173000	0.50839	1.426000	0.47256	0.563000	0.77884	TTC		0.463	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2		NM_022356	
LLGL1	3996	hgsc.bcm.edu	37	17	18136083	18136083	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr17:18136083A>G	ENST00000316843.4	+	4	455	c.359A>G	c.(358-360)cAg>cGg	p.Q120R		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	120					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					CTCAGTTTCCAGCTGCCCAGC	0.627																																																	0													70.0	71.0	71.0					17																	18136083		2203	4300	6503	SO:0001583	missense	3996				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.359A>G	17.37:g.18136083A>G	ENSP00000321537:p.Gln120Arg		A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	ENST00000316843.4	37	CCDS32586.1	.	.	.	.	.	.	.	.	.	.	A	8.569	0.879630	0.17467	.	.	ENSG00000131899	ENST00000316843	T	0.05382	3.45	5.33	4.13	0.48395	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.720518	0.13648	N	0.372491	T	0.03783	0.0107	N	0.19112	0.55	0.20873	N	0.999831	B	0.22604	0.072	B	0.15870	0.014	T	0.42464	-0.9450	10	0.15952	T	0.53	-19.9686	5.4826	0.16731	0.661:0.0:0.0847:0.2543	.	120	Q15334	L2GL1_HUMAN	R	120	ENSP00000321537:Q120R	ENSP00000321537:Q120R	Q	+	2	0	LLGL1	18076808	0.038000	0.19896	0.999000	0.59377	0.681000	0.39784	0.215000	0.17562	2.168000	0.68352	0.477000	0.44152	CAG		0.627	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132067.3			
MAGEC1	9947	hgsc.bcm.edu	37	X	140993877	140993877	+	Silent	SNP	C	C	A	rs176039	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chrX:140993877C>A	ENST00000285879.4	+	4	973	c.687C>A	c.(685-687)gcC>gcA	p.A229A	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	229										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGTTTTGCCCAGTCTCCTC	0.488										HNSCC(15;0.026)																																							0																																										SO:0001819	synonymous_variant	9947			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.687C>A	X.37:g.140993877C>A			A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																				0.488	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1		NM_005462	
MC3R	4159	hgsc.bcm.edu;ucsc.edu	37	20	54824473	54824473	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr20:54824473C>A	ENST00000243911.2	+	1	686	c.574C>A	c.(574-576)Ctc>Atc	p.L192I		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	192					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			CATTGTGTGCCTCATCACCAT	0.577																																																	0													222.0	192.0	202.0					20																	54824473		2203	4300	6503	SO:0001583	missense	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.574C>A	20.37:g.54824473C>A	ENSP00000243911:p.Leu192Ile		Q4KN27|Q9H517	Missense_Mutation	SNP	ENST00000243911.2	37	CCDS13449.2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803762	0.90623	.	.	ENSG00000124089	ENST00000243911	T	0.38077	1.16	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000021	T	0.71108	0.3301	M	0.93507	3.425	0.58432	D	0.999992	D	0.76494	0.999	D	0.87578	0.998	T	0.80099	-0.1524	10	0.87932	D	0	.	18.4242	0.90604	0.0:1.0:0.0:0.0	.	229	P41968	MC3R_HUMAN	I	192	ENSP00000243911:L192I	ENSP00000243911:L192I	L	+	1	0	MC3R	54257880	1.000000	0.71417	0.972000	0.41901	0.998000	0.95712	4.750000	0.62162	2.430000	0.82344	0.555000	0.69702	CTC		0.577	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079786.2			
MED25	81857	hgsc.bcm.edu	37	19	50333063	50333063	+	Silent	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:50333063T>C	ENST00000312865.6	+	6	599	c.546T>C	c.(544-546)atT>atC	p.I182I	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	182	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		ACTTCTCCATTGTGTCTCCCC	0.657																																					GBM(51;894 1657 37868)												0													13.0	12.0	12.0					19																	50333063		2201	4297	6498	SO:0001819	synonymous_variant	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.546T>C	19.37:g.50333063T>C			A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	ENST00000312865.6	37	CCDS33075.1																																																																																				0.657	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1		NM_030973	
MIR892A	100126342	hgsc.bcm.edu	37	X	145078723	145078723	+	RNA	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chrX:145078723T>C	ENST00000401124.1	-	0	0				MIR888_ENST00000401186.1_RNA|MIR890_ENST00000401256.1_RNA|MIR892B_ENST00000401279.1_RNA	NR_030584.1				microRNA 892a																		TGGTGAGCCTTGCTCTACCCA	0.498																																																	0													37.0	31.0	33.0					X																	145078723		1564	3571	5135			100126307					Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145078723T>C				RNA	SNP	ENST00000401124.1	37																																																																																					0.498	MIR892A-201	KNOWN	basic	miRNA	miRNA			NR_030584	
KMT2D	8085	hgsc.bcm.edu	37	12	49448463	49448463	+	Missense_Mutation	SNP	C	C	T	rs55865069	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:49448463C>T	ENST00000301067.7	-	3	247	c.248G>A	c.(247-249)cGg>cAg	p.R83Q		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	83					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCAAAGCGCCGTAGCTCCCG	0.637													C|||	82	0.0163738	0.0015	0.0231	5008	,	,		17155	0.0		0.0437	False		,,,				2504	0.0204																0								C	GLN/ARG	22,3948		0,22,1963	26.0	31.0	30.0		248	3.3	1.0	12	dbSNP_129	30	256,8034		3,250,3892	yes	missense	MLL2	NM_003482.3	43	3,272,5855	TT,TC,CC		3.0881,0.5542,2.2675	benign	83/5538	49448463	278,11982	1985	4145	6130	SO:0001583	missense	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.248G>A	12.37:g.49448463C>T	ENSP00000301067:p.Arg83Gln		O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	48	0.02197802197802198	2	0.0040650406504065045	8	0.022099447513812154	0	0.0	38	0.05013192612137203	C	11.57	1.677615	0.29783	0.005542	0.030881	ENSG00000167548	ENST00000301067;ENST00000547610	T	0.79653	-1.29	5.18	3.34	0.38264	.	.	.	.	.	T	0.22820	0.0551	N	0.12182	0.205	0.21822	N	0.999527	B	0.11235	0.004	B	0.06405	0.002	T	0.40327	-0.9569	9	0.87932	D	0	.	4.4106	0.11431	0.2781:0.5434:0.0:0.1785	rs55865069	83	O14686	MLL2_HUMAN	Q	83	ENSP00000301067:R83Q	ENSP00000301067:R83Q	R	-	2	0	MLL2	47734730	0.993000	0.37304	1.000000	0.80357	0.994000	0.84299	0.613000	0.24299	0.545000	0.28902	-0.252000	0.11476	CGG		0.637	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2			
KMT2C	58508	hgsc.bcm.edu;ucsc.edu	37	7	151848093	151848093	+	Splice_Site	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr7:151848093C>G	ENST00000262189.6	-	51	12885		c.e51-1		KMT2C_ENST00000485241.1_5'Flank|KMT2C_ENST00000355193.2_Splice_Site	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C						histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CTCGGGAATCCTGAAAAGCAA	0.343																																																	0													76.0	77.0	76.0					7																	151848093		2203	4300	6503	SO:0001630	splice_region_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12667-1G>C	7.37:g.151848093C>G			Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Splice_Site	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965982	0.74131	.	.	ENSG00000055609	ENST00000360104;ENST00000262189;ENST00000355193;ENST00000424877	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9707	0.92713	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MLL3	151479026	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.204000	0.72143	2.484000	0.83849	0.557000	0.71058	.		0.343	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3			Intron
MTOR	2475	hgsc.bcm.edu;ucsc.edu	37	1	11189847	11189847	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:11189847A>G	ENST00000361445.4	-	40	5738	c.5662T>C	c.(5662-5664)Ttc>Ctc	p.F1888L	MTOR_ENST00000495435.1_5'Flank|MTOR_ENST00000376838.1_Missense_Mutation_p.F93L	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1888	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GAACGGAAGAAGCCCTGGACG	0.522																																																	0													177.0	141.0	153.0					1																	11189847		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.5662T>C	1.37:g.11189847A>G	ENSP00000354558:p.Phe1888Leu		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	A	36	5.849474	0.97023	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.75477	-0.94;-0.94	5.79	5.79	0.91817	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.000000	0.85682	D	0.000000	D	0.90380	0.6989	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93054	0.6468	10	0.72032	D	0.01	-25.9408	16.1354	0.81481	1.0:0.0:0.0:0.0	.	1888	P42345	MTOR_HUMAN	L	1888;93	ENSP00000354558:F1888L;ENSP00000366034:F93L	ENSP00000354558:F1888L	F	-	1	0	MTOR	11112434	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.920000	0.92779	2.207000	0.71202	0.533000	0.62120	TTC		0.522	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MTOR	2475	hgsc.bcm.edu;ucsc.edu	37	1	11189851	11189851	+	Silent	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:11189851C>T	ENST00000361445.4	-	40	5734	c.5658G>A	c.(5656-5658)caG>caA	p.Q1886Q	MTOR_ENST00000495435.1_5'Flank|MTOR_ENST00000376838.1_Silent_p.Q91Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1886	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	GGAAGAAGCCCTGGACGGCAG	0.507																																																	0													173.0	138.0	150.0					1																	11189851		2203	4300	6503	SO:0001819	synonymous_variant	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.5658G>A	1.37:g.11189851C>T			Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	CCDS127.1																																																																																				0.507	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1		NM_004958	
MYO5B	4645	hgsc.bcm.edu;ucsc.edu	37	18	47369724	47369724	+	Missense_Mutation	SNP	G	G	T	rs67244969		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr18:47369724G>T	ENST00000285039.7	-	34	4797	c.4498C>A	c.(4498-4500)Ctc>Atc	p.L1500I	SCARNA17_ENST00000589499.1_RNA|MYO5B_ENST00000324581.6_Missense_Mutation_p.L615I|MYO5B_ENST00000592688.1_Missense_Mutation_p.L70I	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1500					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TAGGCGGGGAGACAGGGCACT	0.562																																																	0																																										SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4498C>A	18.37:g.47369724G>T	ENSP00000285039:p.Leu1500Ile		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	G	33	5.288713	0.95517	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.30714	1.52;1.52	4.94	4.94	0.65067	.	0.000000	0.64402	D	0.000002	T	0.53562	0.1804	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.961;0.996	T	0.45249	-0.9274	10	0.35671	T	0.21	.	18.3406	0.90304	0.0:0.0:1.0:0.0	.	1500;615	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	I	1500;615	ENSP00000285039:L1500I;ENSP00000315531:L615I	ENSP00000285039:L1500I	L	-	1	0	MYO5B	45623722	1.000000	0.71417	0.931000	0.37212	0.982000	0.71751	6.477000	0.73591	2.724000	0.93272	0.561000	0.74099	CTC		0.562	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2			
NDUFA3	4696	hgsc.bcm.edu	37	19	54610140	54610140	+	Missense_Mutation	SNP	C	C	G	rs144531279		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:54610140C>G	ENST00000485876.1	+	4	228	c.186C>G	c.(184-186)aaC>aaG	p.N62K	NDUFA3_ENST00000391763.3_3'UTR|NDUFA3_ENST00000391762.1_3'UTR|NDUFA3_ENST00000303553.5_Missense_Mutation_p.N19K|NDUFA3_ENST00000391764.3_Intron			O95167	NDUA3_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa	62			N -> D (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(1)	2	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					ATGATGGGAACATGCCCGACG	0.652																																																	0													28.0	29.0	28.0					19																	54610140		2203	4300	6503	SO:0001583	missense	4696			AF044955	CCDS12877.1	19q13.42	2011-07-04	2002-08-29		ENSG00000170906	ENSG00000170906		"""Mitochondrial respiratory chain complex / Complex I"""	7686	protein-coding gene	gene with protein product	"""complex I B9 subunit"""	603832	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3 (9kD, B9)"""			9878551	Standard	NM_004542		Approved	B9	uc002qde.3	O95167	OTTHUMG00000064972	ENST00000485876.1:c.186C>G	19.37:g.54610140C>G	ENSP00000418438:p.Asn62Lys			Missense_Mutation	SNP	ENST00000485876.1	37	CCDS12877.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899167	0.52227	.	.	ENSG00000170906	ENST00000485876;ENST00000417328	.	.	.	3.68	2.61	0.31194	.	0.000000	0.85682	D	0.000000	T	0.70928	0.3280	.	.	.	0.42608	D	0.993308	D	0.67145	0.996	D	0.75484	0.986	T	0.70824	-0.4767	8	0.49607	T	0.09	-20.4481	9.0905	0.36607	0.0:0.8909:0.0:0.1091	.	62	O95167	NDUA3_HUMAN	K	62	.	ENSP00000410363:N62K	N	+	3	2	NDUFA3	59301952	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	1.757000	0.38400	0.892000	0.36259	0.650000	0.86243	AAC		0.652	NDUFA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139509.5		NM_004542	
NES	10763	hgsc.bcm.edu	37	1	156642149	156642149	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:156642149C>G	ENST00000368223.3	-	4	1963	c.1831G>C	c.(1831-1833)Gta>Cta	p.V611L		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	611	Tail.			ELLKDVEVVRPLEKEAVG -> RAIKGCGGSETSRKRGCR (in Ref. 1; CAA46780). {ECO:0000305}.	brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGTTGGCCTACAGCCTCTTTT	0.378																																																	0													92.0	92.0	92.0					1																	156642149		2203	4300	6503	SO:0001583	missense	10763			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1831G>C	1.37:g.156642149C>G	ENSP00000357206:p.Val611Leu		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	4.072	0.011246	0.07912	.	.	ENSG00000132688	ENST00000368223	D	0.85773	-2.03	5.22	2.22	0.28083	.	1.071090	0.07516	N	0.909773	T	0.41719	0.1171	N	0.03177	-0.4	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37079	-0.9721	10	0.08599	T	0.76	.	7.9977	0.30277	0.0:0.3037:0.4085:0.2879	.	611	P48681	NEST_HUMAN	L	611	ENSP00000357206:V611L	ENSP00000357206:V611L	V	-	1	0	NES	154908773	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.142000	0.31540	0.182000	0.20032	-0.499000	0.04595	GTA		0.378	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2		NM_006617	
NLRP12	91662	hgsc.bcm.edu	37	19	54312936	54312936	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:54312936G>A	ENST00000324134.6	-	3	2145	c.1977C>T	c.(1975-1977)agC>agT	p.S659S	NLRP12_ENST00000354278.3_Silent_p.S659S|NLRP12_ENST00000345770.5_Silent_p.S659S|NLRP12_ENST00000391772.1_Silent_p.S659S|NLRP12_ENST00000535162.1_Silent_p.S659S|NLRP12_ENST00000391773.1_Silent_p.S659S|NLRP12_ENST00000351894.4_Silent_p.S659S|NLRP12_ENST00000391775.3_Silent_p.S659S	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	659					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCACCTGGGCGCTCCTGCAGC	0.627																																																	0													53.0	49.0	50.0					19																	54312936		2203	4300	6503	SO:0001819	synonymous_variant	91662			AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1977C>T	19.37:g.54312936G>A			A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	37	CCDS12864.1																																																																																				0.627	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1		NM_144687	
NOTCH2	4853	hgsc.bcm.edu;ucsc.edu	37	1	120478185	120478185	+	Missense_Mutation	SNP	C	C	G	rs185917176		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:120478185C>G	ENST00000256646.2	-	22	3784	c.3565G>C	c.(3565-3567)Gat>Cat	p.D1189H		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1189	EGF-like 31; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGCACTCATCCACTTCATAC	0.483			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													146.0	129.0	135.0					1																	120478185		2203	4300	6503	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.3565G>C	1.37:g.120478185C>G	ENSP00000256646:p.Asp1189His		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933056	0.73442	.	.	ENSG00000134250	ENST00000256646	T	0.61158	0.13	5.78	5.78	0.91487	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.39020	U	0.001491	T	0.81312	0.4796	M	0.93197	3.39	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.936	D	0.84701	0.0728	10	0.72032	D	0.01	.	19.3546	0.94407	0.0:1.0:0.0:0.0	.	1189;1189	Q6IQ50;Q04721	.;NOTC2_HUMAN	H	1189	ENSP00000256646:D1189H	ENSP00000256646:D1189H	D	-	1	0	NOTCH2	120279708	0.935000	0.31712	0.997000	0.53966	0.981000	0.71138	1.775000	0.38584	2.894000	0.99253	0.655000	0.94253	GAT		0.483	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1		NM_024408	
NOTCH3	4854	hgsc.bcm.edu	37	19	15298776	15298776	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:15298776C>T	ENST00000263388.2	-	10	1597	c.1522G>A	c.(1522-1524)Gtg>Atg	p.V508M		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	508	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CATTCGTCCACGTCCAGCTGA	0.667																																																	0													24.0	18.0	20.0					19																	15298776		1903	3583	5486	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1522G>A	19.37:g.15298776C>T	ENSP00000263388:p.Val508Met		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	c	17.67	3.445958	0.63178	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.87491	-2.26	5.0	3.97	0.46021	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.81403	0.4815	M	0.64170	1.965	0.43372	D	0.995464	D;P	0.53151	0.958;0.894	B;B	0.38458	0.265;0.274	T	0.82478	-0.0437	9	0.72032	D	0.01	.	5.7658	0.18225	0.0:0.7353:0.0:0.2647	.	511;508	Q59FL3;Q9UM47	.;NOTC3_HUMAN	M	508;510	ENSP00000263388:V508M	ENSP00000263388:V508M	V	-	1	0	NOTCH3	15159776	1.000000	0.71417	0.987000	0.45799	0.758000	0.43043	2.591000	0.46163	2.328000	0.79073	0.461000	0.40582	GTG		0.667	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1		NM_000435	
OR10H2	26538	hgsc.bcm.edu;ucsc.edu	37	19	15839750	15839750	+	Missense_Mutation	SNP	G	G	T	rs368109893		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:15839750G>T	ENST00000305899.3	+	1	917	c.897G>T	c.(895-897)aaG>aaT	p.K299N		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					AAGAACTGAAGGTTGCCATGA	0.537																																																	0													85.0	75.0	78.0					19																	15839750		2203	4300	6503	SO:0001583	missense	26538			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.897G>T	19.37:g.15839750G>T	ENSP00000306095:p.Lys299Asn		Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	1.652	-0.513783	0.04200	.	.	ENSG00000171942	ENST00000305899	T	0.40756	1.02	3.39	-0.178	0.13303	.	0.000000	0.50627	D	0.000110	T	0.36853	0.0982	M	0.75615	2.305	0.09310	N	1	B	0.21606	0.058	B	0.27076	0.076	T	0.39921	-0.9590	10	0.72032	D	0.01	.	2.6802	0.05091	0.2211:0.0:0.358:0.4209	.	299	O60403	O10H2_HUMAN	N	299	ENSP00000306095:K299N	ENSP00000306095:K299N	K	+	3	2	OR10H2	15700750	0.003000	0.15002	0.012000	0.15200	0.010000	0.07245	0.318000	0.19504	0.003000	0.14656	-1.854000	0.00565	AAG		0.537	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1			
OR8B12	219858	hgsc.bcm.edu;ucsc.edu	37	11	124412848	124412848	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:124412848T>G	ENST00000306842.2	-	1	727	c.703A>C	c.(703-705)Aaa>Caa	p.K235Q		NM_001005195.1	NP_001005195.1	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B, member 12	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		CTAAAGGCTTTGGACCTGCCT	0.453																																																	0													89.0	80.0	83.0					11																	124412848		2201	4299	6500	SO:0001583	missense	219858				CCDS31711.1	11q24.2	2013-09-24			ENSG00000170953	ENSG00000170953		"""GPCR / Class A : Olfactory receptors"""	15307	protein-coding gene	gene with protein product							Standard	NM_001005195		Approved		uc010sam.2	Q8NGG6	OTTHUMG00000165922	ENST00000306842.2:c.703A>C	11.37:g.124412848T>G	ENSP00000307159:p.Lys235Gln		B2RNF6|Q6IEW8|Q96RC7	Missense_Mutation	SNP	ENST00000306842.2	37	CCDS31711.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709520	0.48517	.	.	ENSG00000170953	ENST00000306842	T	0.00372	7.73	3.89	3.89	0.44902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000015	T	0.01730	0.0055	H	0.97611	4.04	0.38601	D	0.950676	D	0.89917	1.0	D	0.97110	1.0	T	0.11867	-1.0570	10	0.87932	D	0	.	12.6428	0.56718	0.0:0.0:0.0:1.0	.	235	Q8NGG6	OR8BC_HUMAN	Q	235	ENSP00000307159:K235Q	ENSP00000307159:K235Q	K	-	1	0	OR8B12	123918058	1.000000	0.71417	0.992000	0.48379	0.176000	0.22953	5.590000	0.67530	1.988000	0.58038	0.528000	0.53228	AAA		0.453	OR8B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387061.1			
PCBP2	5094	hgsc.bcm.edu;ucsc.edu	37	12	53865471	53865471	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:53865471G>A	ENST00000439930.3	+	13	963	c.941G>A	c.(940-942)cGt>cAt	p.R314H	PCBP2_ENST00000552296.2_Missense_Mutation_p.R310H|PCBP2_ENST00000455667.3_Missense_Mutation_p.R267H|PCBP2_ENST00000552819.1_Missense_Mutation_p.R271H|PCBP2_ENST00000603815.1_Missense_Mutation_p.R314H|PCBP2_ENST00000447282.1_Missense_Mutation_p.R284H|PCBP2_ENST00000549863.1_Missense_Mutation_p.R270H|PCBP2_ENST00000359282.5_Missense_Mutation_p.R280H|PCBP2_ENST00000359462.5_Missense_Mutation_p.R315H|PCBP2_ENST00000437231.1_Missense_Mutation_p.R267H|PCBP2_ENST00000548933.1_Missense_Mutation_p.R284H|PCBP2_ENST00000546463.1_Missense_Mutation_p.R311H			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	314	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						AATGAGATCCGTCAGATGTCT	0.493																																																	0													67.0	55.0	59.0					12																	53865471		2203	4300	6503	SO:0001583	missense	5094			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.941G>A	12.37:g.53865471G>A	ENSP00000408949:p.Arg314His		A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	ENST00000439930.3	37	CCDS44901.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655600	0.67586	.	.	ENSG00000197111	ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000379777;ENST00000553064	T;T;T;T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.12	4.24	0.50183	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	H	0.95982	3.75	0.54753	D	0.999986	B;B;B;B;B;P;B;B;B;B	0.36753	0.001;0.411;0.08;0.127;0.194;0.568;0.201;0.08;0.08;0.24	B;B;B;B;B;B;B;B;B;B	0.39465	0.002;0.3;0.114;0.046;0.24;0.16;0.102;0.062;0.114;0.114	T	0.68044	-0.5513	10	0.87932	D	0	.	12.6068	0.56527	0.0816:0.0:0.9184:0.0	.	271;272;314;257;284;267;310;280;315;311	B4DXP5;F8VRG9;Q15366;F8VWQ4;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.;.;PCBP2_HUMAN;.;.;.;.;.;.;.	H	280;284;267;314;270;315;257;311;310;272;271;267;284;231;144	ENSP00000352228:R280H;ENSP00000394116:R284H;ENSP00000390304:R267H;ENSP00000408949:R314H;ENSP00000447670:R270H;ENSP00000352438:R315H;ENSP00000448762:R311H;ENSP00000448927:R310H;ENSP00000449070:R271H;ENSP00000388008:R267H;ENSP00000449062:R284H	ENSP00000352228:R280H	R	+	2	0	PCBP2	52151738	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.738000	0.84966	1.396000	0.46663	0.650000	0.86243	CGT		0.493	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2		NM_005016	
PIK3C2B	5287	hgsc.bcm.edu	37	1	204397328	204397328	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:204397328G>C	ENST00000367187.3	-	31	4975	c.4419C>G	c.(4417-4419)ttC>ttG	p.F1473L	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.F1445L	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1473	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GTGGGTGGAAGAAGGTGTACA	0.498																																																	0													72.0	63.0	66.0					1																	204397328		2203	4300	6503	SO:0001583	missense	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.4419C>G	1.37:g.204397328G>C	ENSP00000356155:p.Phe1473Leu		O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916637	0.73098	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.79554	-1.28;-1.28	5.24	1.17	0.20885	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	D	0.88991	0.6588	M	0.88512	2.96	0.40370	D	0.979334	D;D	0.76494	0.994;0.999	D;D	0.79108	0.976;0.992	D	0.87556	0.2468	10	0.87932	D	0	.	9.1659	0.37052	0.4717:0.0:0.5283:0.0	.	1445;1473	F5GWN5;O00750	.;P3C2B_HUMAN	L	1473;1445	ENSP00000356155:F1473L;ENSP00000400561:F1445L	ENSP00000356155:F1473L	F	-	3	2	PIK3C2B	202663951	1.000000	0.71417	0.997000	0.53966	0.898000	0.52572	0.817000	0.27281	-0.038000	0.13624	0.591000	0.81541	TTC		0.498	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1		NM_002646	
PIK3R1	5295	hgsc.bcm.edu;ucsc.edu	37	5	67589208	67589208	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:67589208G>A	ENST00000521381.1	+	10	1812	c.1196G>A	c.(1195-1197)aGt>aAt	p.S399N	PIK3R1_ENST00000336483.5_Missense_Mutation_p.S129N|PIK3R1_ENST00000396611.1_Missense_Mutation_p.S399N|PIK3R1_ENST00000523872.1_Missense_Mutation_p.S36N|PIK3R1_ENST00000521657.1_Missense_Mutation_p.S399N|PIK3R1_ENST00000274335.5_Missense_Mutation_p.S399N|PIK3R1_ENST00000320694.8_Missense_Mutation_p.S99N	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	399	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TTAACCTTCAGTTCTGTGGTT	0.323			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																														Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)											53.0	57.0	56.0					5																	67589208		2202	4298	6500	SO:0001583	missense	5295			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1196G>A	5.37:g.67589208G>A	ENSP00000428056:p.Ser399Asn		B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	A	6.905	0.536522	0.13188	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000521409;ENST00000336483;ENST00000519025;ENST00000523872	D;D;D;D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	5.22	5.22	0.72569	SH2 motif (4);	0.042312	0.85682	N	0.000000	T	0.75532	0.3862	N	0.12527	0.23	0.23598	N	0.997322	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.55598	-0.8116	10	0.02654	T	1	-26.3464	11.4879	0.50365	0.9297:0.0:0.0703:0.0	.	69;129;99;399	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	N	399;399;399;399;99;36;129;72;36	ENSP00000428056:S399N;ENSP00000429277:S399N;ENSP00000379855:S399N;ENSP00000274335:S399N;ENSP00000323512:S99N;ENSP00000431058:S36N;ENSP00000338554:S129N;ENSP00000429156:S72N;ENSP00000430098:S36N	ENSP00000274335:S399N	S	+	2	0	PIK3R1	67624964	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.940000	0.63533	1.105000	0.41606	-0.269000	0.10298	AGT		0.323	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2		NM_181504	
PLXNB1	5364	hgsc.bcm.edu	37	3	48460339	48460339	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:48460339C>T	ENST00000358536.4	-	13	3211	c.2942G>A	c.(2941-2943)tGc>tAc	p.C981Y	PLXNB1_ENST00000358459.4_Missense_Mutation_p.C798Y|PLXNB1_ENST00000456774.1_Missense_Mutation_p.C798Y|PLXNB1_ENST00000296440.6_Missense_Mutation_p.C981Y|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	981					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGCTGCTGGCAGGTGACATG	0.632																																																	0													74.0	65.0	68.0					3																	48460339		2203	4300	6503	SO:0001583	missense	5364			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2942G>A	3.37:g.48460339C>T	ENSP00000351338:p.Cys981Tyr		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692316	0.68271	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.05925	3.37;3.46;3.37;3.46	4.84	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	L	0.53671	1.685	0.80722	D	1	P;D	0.71674	0.814;0.998	B;D	0.72625	0.429;0.978	T	0.00367	-1.1785	10	0.87932	D	0	.	13.6344	0.62215	0.1555:0.8445:0.0:0.0	.	981;798	O43157;O43157-2	PLXB1_HUMAN;.	Y	981;798;981;798	ENSP00000296440:C981Y;ENSP00000351242:C798Y;ENSP00000351338:C981Y;ENSP00000414199:C798Y	ENSP00000296440:C981Y	C	-	2	0	PLXNB1	48435343	1.000000	0.71417	0.787000	0.31911	0.921000	0.55340	5.213000	0.65230	1.027000	0.39758	0.561000	0.74099	TGC		0.632	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1		NM_002673	
PRAMEF12	390999	hgsc.bcm.edu	37	1	12837652	12837652	+	Silent	SNP	C	C	T	rs200113689	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:12837652C>T	ENST00000357726.4	+	3	1389	c.1362C>T	c.(1360-1362)gtC>gtT	p.V454V		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	454					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGCACTGTCCCCTGCCCTC	0.522																																																	0																																										SO:0001819	synonymous_variant	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.1362C>T	1.37:g.12837652C>T				Silent	SNP	ENST00000357726.4	37	CCDS41254.1																																																																																				0.522	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1		XM_372760	
PTGS2	5743	hgsc.bcm.edu;ucsc.edu	37	1	186646828	186646828	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:186646828T>C	ENST00000367468.5	-	5	728	c.592A>G	c.(592-594)Aca>Gca	p.T198A	PTGS2_ENST00000490885.2_5'UTR|RP5-973M2.2_ENST00000608917.1_lincRNA	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	198					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TTATGATCTGTCTTGAAAAAC	0.423																																																	0													115.0	119.0	118.0					1																	186646828		2203	4300	6503	SO:0001583	missense	5743			D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.592A>G	1.37:g.186646828T>C	ENSP00000356438:p.Thr198Ala		A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	T	15.93	2.979369	0.53827	.	.	ENSG00000073756	ENST00000367468	T	0.71579	-0.58	5.8	2.08	0.27032	.	0.256756	0.45606	D	0.000347	D	0.82655	0.5084	H	0.94847	3.59	0.49051	D	0.999744	P;P	0.40619	0.587;0.724	B;P	0.49332	0.365;0.607	D	0.83509	0.0079	10	0.87932	D	0	-12.1267	11.1306	0.48345	0.345:0.0:0.0:0.655	.	198;198	Q8IZA9;P35354	.;PGH2_HUMAN	A	198	ENSP00000356438:T198A	ENSP00000356438:T198A	T	-	1	0	PTGS2	184913451	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.255000	0.32909	0.085000	0.17107	-0.388000	0.06559	ACA		0.423	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2		NM_000963	
PSEN2	5664	hgsc.bcm.edu;ucsc.edu	37	1	227076606	227076606	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:227076606G>A	ENST00000366783.3	+	8	1079	c.643G>A	c.(643-645)Ggc>Agc	p.G215S	PSEN2_ENST00000366782.1_Missense_Mutation_p.G248S|PSEN2_ENST00000391872.2_Missense_Mutation_p.G248S|PSEN2_ENST00000472139.2_Missense_Mutation_p.G71S|PSEN2_ENST00000422240.2_Missense_Mutation_p.G215S|PSEN2_ENST00000340188.4_Missense_Mutation_p.G215S	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	215					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CGGGGCAGTGGGCATGGTGTG	0.582																																																	0													140.0	122.0	128.0					1																	227076606		2203	4300	6503	SO:0001583	missense	5664			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.643G>A	1.37:g.227076606G>A	ENSP00000355747:p.Gly215Ser		A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	ENST00000366783.3	37	CCDS1556.1	.	.	.	.	.	.	.	.	.	.	G	35	5.441558	0.96187	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D;D	0.99903	-7.67;-7.67;-7.67;-7.67;-7.67;-7.67;-7.67	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.99921	0.9963	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.98	D	0.96041	0.9024	10	0.87932	D	0	.	18.7799	0.91928	0.0:0.0:1.0:0.0	.	215;215	A8K8D4;P49810	.;PSN2_HUMAN	S	215;215;215;42;248;248;71	ENSP00000355747:G215S;ENSP00000339860:G215S;ENSP00000403737:G215S;ENSP00000427912:G42S;ENSP00000355746:G248S;ENSP00000375745:G248S;ENSP00000427806:G71S	ENSP00000339860:G215S	G	+	1	0	PSEN2	225143229	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.790000	0.99075	2.426000	0.82243	0.561000	0.74099	GGC		0.582	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1		NM_000447	
RBM20	282996	hgsc.bcm.edu;ucsc.edu	37	10	112540644	112540644	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr10:112540644C>A	ENST00000369519.3	+	2	335	c.277C>A	c.(277-279)Caa>Aaa	p.Q93K		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	93					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CCAGCTGGCTCAACTGCAGGC	0.592																																																	0													70.0	84.0	80.0					10																	112540644		692	1591	2283	SO:0001583	missense	282996			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.277C>A	10.37:g.112540644C>A	ENSP00000358532:p.Gln93Lys		A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910650	0.92107	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.95853	-3.83	5.96	5.96	0.96718	.	0.193957	0.45361	D	0.000377	D	0.96340	0.8806	L	0.29908	0.895	0.53688	D	0.999971	D	0.69078	0.997	D	0.77004	0.989	D	0.96797	0.9586	10	0.87932	D	0	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	93	Q5T481	RBM20_HUMAN	K	93	ENSP00000358532:Q93K	ENSP00000358532:Q93K	Q	+	1	0	RBM20	112530634	1.000000	0.71417	0.918000	0.36340	0.996000	0.88848	7.420000	0.80191	2.832000	0.97577	0.655000	0.94253	CAA		0.592	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2		NM_001134363	
RCOR2	283248	hgsc.bcm.edu	37	11	63681731	63681731	+	Splice_Site	SNP	A	A	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:63681731A>T	ENST00000301459.4	-	7	1063		c.e7+1		RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						CTGGGAGCTCACCTCTCTCTT	0.627																																																	0													60.0	49.0	53.0					11																	63681731		2201	4297	6498	SO:0001630	splice_region_variant	283248			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.675+1T>A	11.37:g.63681731A>T			Q96FP3	Splice_Site	SNP	ENST00000301459.4	37	CCDS8052.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.787774	0.49997	.	.	ENSG00000167771	ENST00000301459	.	.	.	4.73	3.6	0.41247	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3652	0.38219	0.913:0.0:0.087:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RCOR2	63438307	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	7.170000	0.77587	0.775000	0.33450	0.459000	0.35465	.		0.627	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1		NM_173587	Intron
SAMD9	54809	hgsc.bcm.edu;ucsc.edu	37	7	92735216	92735216	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr7:92735216A>C	ENST00000379958.2	-	3	464	c.195T>G	c.(193-195)atT>atG	p.I65M		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	65	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTCTATTTGAATAGCTGGTC	0.388																																																	0													140.0	137.0	138.0					7																	92735216		2203	4300	6503	SO:0001583	missense	54809			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.195T>G	7.37:g.92735216A>C	ENSP00000369292:p.Ile65Met		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	A	15.65	2.896413	0.52121	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.47869	0.83;0.83	4.79	0.969	0.19686	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.401197	0.20891	N	0.083840	T	0.41396	0.1157	N	0.13140	0.3	0.22468	N	0.999073	D	0.54772	0.968	P	0.58331	0.837	T	0.24728	-1.0152	10	0.59425	D	0.04	.	8.1987	0.31411	0.4148:0.0:0.5852:0.0	.	65	Q5K651	SAMD9_HUMAN	M	65	ENSP00000369292:I65M;ENSP00000414529:I65M	ENSP00000369292:I65M	I	-	3	3	SAMD9	92573152	0.000000	0.05858	0.997000	0.53966	0.708000	0.40852	-0.221000	0.09202	0.337000	0.23665	-0.237000	0.12165	ATT		0.388	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1		NM_017654	
SEC24D	9871	hgsc.bcm.edu;ucsc.edu	37	4	119736750	119736750	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr4:119736750T>A	ENST00000280551.6	-	5	767	c.529A>T	c.(529-531)Aca>Tca	p.T177S	SEC24D_ENST00000379735.5_Missense_Mutation_p.T177S|SEC24D_ENST00000419654.2_5'UTR			O94855	SC24D_HUMAN	SEC24 family member D	177	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						CCATTGAGTGTGGTGGGTGGT	0.582																																																	0													252.0	220.0	231.0					4																	119736750		2203	4300	6503	SO:0001583	missense	9871			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.529A>T	4.37:g.119736750T>A	ENSP00000280551:p.Thr177Ser		Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	37	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.327046	0.24080	.	.	ENSG00000150961	ENST00000280551;ENST00000379735	T;T	0.75367	-0.92;-0.93	5.71	-2.26	0.06867	.	0.883002	0.10144	N	0.710432	T	0.53367	0.1792	N	0.14661	0.345	0.09310	N	0.999998	B;B	0.11235	0.004;0.002	B;B	0.16289	0.015;0.006	T	0.34976	-0.9807	10	0.18276	T	0.48	-2.5431	11.0698	0.47997	0.0:0.2251:0.0:0.7749	.	177;177	O94855-2;O94855	.;SC24D_HUMAN	S	177	ENSP00000280551:T177S;ENSP00000369059:T177S	ENSP00000280551:T177S	T	-	1	0	SEC24D	119956198	0.001000	0.12720	0.004000	0.12327	0.623000	0.37688	0.020000	0.13466	-0.276000	0.09206	0.533000	0.62120	ACA		0.582	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4			
SECISBP2L	9728	hgsc.bcm.edu;ucsc.edu	37	15	49284777	49284777	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr15:49284777T>A	ENST00000559471.1	-	18	3233	c.2970A>T	c.(2968-2970)gaA>gaT	p.E990D	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.E945D	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	990							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						catcttcttcttcttcAAGCA	0.458																																																	0													76.0	73.0	74.0					15																	49284777		2197	4295	6492	SO:0001583	missense	9728			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2970A>T	15.37:g.49284777T>A	ENSP00000453854:p.Glu990Asp		Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760357	0.69763	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.75938	-0.98	5.19	2.88	0.33553	.	0.000000	0.85682	D	0.000000	T	0.74794	0.3763	L	0.29908	0.895	0.37000	D	0.895238	D;D	0.71674	0.997;0.998	D;D	0.77557	0.978;0.99	T	0.74833	-0.3530	10	0.49607	T	0.09	.	7.1633	0.25677	0.0:0.3456:0.0:0.6544	.	990;945	Q93073;Q93073-2	SBP2L_HUMAN;.	D	945;990	ENSP00000261847:E945D	ENSP00000261847:E945D	E	-	3	2	SECISBP2L	47072069	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.591000	0.36665	0.444000	0.26612	0.533000	0.62120	GAA		0.458	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1		NM_014701	
SERPINE2	5270	hgsc.bcm.edu;ucsc.edu	37	2	224862980	224862980	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr2:224862980G>A	ENST00000258405.4	-	3	581	c.339C>T	c.(337-339)gcC>gcT	p.A113A	SERPINE2_ENST00000409304.1_Silent_p.A113A|SERPINE2_ENST00000409840.3_Silent_p.A113A|SERPINE2_ENST00000447280.2_Silent_p.A125A	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	113					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TAACAAACACGGCGTTAGCCA	0.398																																																	0													114.0	111.0	112.0					2																	224862980		2203	4300	6503	SO:0001819	synonymous_variant	5270			M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.339C>T	2.37:g.224862980G>A			B2R6A4|B4DIF2|Q53S15|Q5D0C4	Silent	SNP	ENST00000258405.4	37	CCDS2460.1																																																																																				0.398	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2		NM_006216	
SGSM1	129049	hgsc.bcm.edu;ucsc.edu	37	22	25294340	25294340	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr22:25294340A>T	ENST00000400359.4	+	20	2596	c.2589A>T	c.(2587-2589)gaA>gaT	p.E863D	SGSM1_ENST00000400358.4_Missense_Mutation_p.E808D|SNORD56_ENST00000362913.1_RNA	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	863	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CCCTGCCTGAAAAGGACGATG	0.597																																																	0													70.0	78.0	75.0					22																	25294340		2161	4258	6419	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2589A>T	22.37:g.25294340A>T	ENSP00000383212:p.Glu863Asp		A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.530307	0.27387	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06849	3.26;3.25	5.24	-6.92	0.01644	Rab-GAP/TBC domain (2);	0.411752	0.25578	U	0.029704	T	0.04227	0.0117	N	0.16656	0.425	0.18873	N	0.999987	B;B;B;B	0.10296	0.0;0.003;0.001;0.0	B;B;B;B	0.08055	0.001;0.001;0.003;0.001	T	0.28839	-1.0031	10	0.40728	T	0.16	-5.7014	13.0894	0.59158	0.1135:0.5212:0.3653:0.0	.	808;863;880;863	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	D	863;808;863	ENSP00000383211:E808D;ENSP00000383212:E863D	ENSP00000383211:E808D	E	+	3	2	SGSM1	23624340	0.004000	0.15560	0.310000	0.25168	0.800000	0.45204	-1.909000	0.01586	-0.919000	0.03803	0.482000	0.46254	GAA		0.597	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1		XM_059318	
SIGLEC10	89790	hgsc.bcm.edu;ucsc.edu	37	19	51920109	51920109	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:51920109A>C	ENST00000339313.5	-	3	633	c.517T>G	c.(517-519)Tgt>Ggt	p.C173G	SIGLEC10_ENST00000356298.5_Missense_Mutation_p.C173G|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.C173G|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.C173G|CTD-2616J11.2_ENST00000526996.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	173	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGGGGTGGACATTCCTCAAAG	0.607																																																	0													102.0	100.0	100.0					19																	51920109		2203	4300	6503	SO:0001583	missense	89790			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.517T>G	19.37:g.51920109A>C	ENSP00000345243:p.Cys173Gly		A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	0.641	-0.813212	0.02798	.	.	ENSG00000142512	ENST00000353836;ENST00000356298;ENST00000525998;ENST00000339313;ENST00000530476	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	4.69	1.17	0.20885	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.226724	0.32055	N	0.006647	T	0.62502	0.2433	N	0.13168	0.305	0.09310	N	1	P;B;B	0.49635	0.926;0.207;0.047	P;B;B	0.56563	0.801;0.122;0.012	T	0.53351	-0.8451	10	0.19590	T	0.45	.	5.0108	0.14312	0.4319:0.3974:0.0:0.1707	.	173;173;173	E9PL79;Q96LC7-2;Q96LC7	.;.;SIG10_HUMAN	G	173;173;173;173;140	ENSP00000342389:C173G;ENSP00000348646:C173G;ENSP00000431444:C173G;ENSP00000345243:C173G;ENSP00000433838:C140G	ENSP00000345243:C173G	C	-	1	0	SIGLEC10	56611921	0.000000	0.05858	0.019000	0.16419	0.015000	0.08874	0.694000	0.25512	0.631000	0.30412	0.260000	0.18958	TGT		0.607	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2		NM_033130	
SLC17A6	57084	hgsc.bcm.edu;ucsc.edu	37	11	22381043	22381043	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr11:22381043C>G	ENST00000263160.3	+	4	980	c.543C>G	c.(541-543)atC>atG	p.I181M	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	181					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GATGTGTCATCTTTGTCAGAA	0.408																																																	0													153.0	138.0	143.0					11																	22381043		2203	4300	6503	SO:0001583	missense	57084			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.543C>G	11.37:g.22381043C>G	ENSP00000263160:p.Ile181Met		A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.338208	0.24253	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.60171	0.21	5.29	3.31	0.37934	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.046382	0.85682	D	0.000000	T	0.47469	0.1447	L	0.37800	1.135	0.51482	D	0.999922	B	0.18166	0.026	B	0.30943	0.122	T	0.38993	-0.9635	10	0.28530	T	0.3	.	10.6738	0.45774	0.1316:0.7972:0.0:0.0712	.	181	Q9P2U8	VGLU2_HUMAN	M	181;69	ENSP00000263160:I181M	ENSP00000263160:I181M	I	+	3	3	SLC17A6	22337619	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	0.800000	0.27042	1.375000	0.46248	-0.225000	0.12378	ATC		0.408	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1		NM_020346	
SMG1	23049	hgsc.bcm.edu;ucsc.edu	37	16	18844384	18844384	+	Silent	SNP	A	A	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr16:18844384A>T	ENST00000446231.2	-	51	9082	c.8670T>A	c.(8668-8670)ctT>ctA	p.L2890L	SMG1_ENST00000389467.3_Silent_p.L2890L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2890					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TCTGCTCAATAAGACCGTCCA	0.448																																																	0													203.0	194.0	197.0					16																	18844384		1936	4132	6068	SO:0001819	synonymous_variant	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8670T>A	16.37:g.18844384A>T			O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	ENST00000446231.2	37	CCDS45430.1																																																																																				0.448	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1		NM_015092	
SMO	6608	hgsc.bcm.edu	37	7	128848598	128848598	+	Splice_Site	SNP	A	A	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr7:128848598A>T	ENST00000249373.3	+	7	1544		c.e7-1		RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor						adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	CCTTCTGTTCAGGAGTCATGA	0.592			Mis		skin basal cell																																			Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	0													51.0	42.0	45.0					7																	128848598		2203	4300	6503	SO:0001630	splice_region_variant	6608			U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1265-1A>T	7.37:g.128848598A>T			A4D1K5	Splice_Site	SNP	ENST00000249373.3	37	CCDS5811.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.271073	0.80469	.	.	ENSG00000128602	ENST00000249373	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5136	0.61528	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMO	128635834	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.045000	0.93812	1.873000	0.54277	0.533000	0.62120	.		0.592	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1		NM_005631	Intron
SPRED1	161742	hgsc.bcm.edu;ucsc.edu	37	15	38632059	38632059	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	PGM			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr15:38632059A>G	ENST00000299084.4	+	5	1405	c.545A>G	c.(544-546)aAt>aGt	p.N182S		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	182					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GAAGATCTGAATGCCAGAAGA	0.378									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)												0													96.0	95.0	95.0					15																	38632059		2200	4297	6497	SO:0001583	missense	161742	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.545A>G	15.37:g.38632059A>G	ENSP00000299084:p.Asn182Ser		B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	37	CCDS32193.1	.	.	.	.	.	.	.	.	.	.	A	10.17	1.277078	0.23307	.	.	ENSG00000166068	ENST00000299084	T	0.72394	-0.65	4.64	2.3	0.28687	.	0.522358	0.21958	N	0.066622	T	0.54615	0.1869	L	0.31065	0.9	0.24318	N	0.995054	P	0.50443	0.935	P	0.45753	0.492	T	0.49615	-0.8921	10	0.08599	T	0.76	-8.063	7.6327	0.28249	0.8287:0.0:0.1713:0.0	.	182	Q7Z699	SPRE1_HUMAN	S	182	ENSP00000299084:N182S	ENSP00000299084:N182S	N	+	2	0	SPRED1	36419351	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.618000	0.46393	0.252000	0.21531	-0.361000	0.07541	AAT		0.378	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1			
SPTAN1	6709	hgsc.bcm.edu;ucsc.edu	37	9	131374049	131374049	+	Silent	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr9:131374049G>A	ENST00000372731.4	+	37	4925	c.4815G>A	c.(4813-4815)cgG>cgA	p.R1605R	SPTAN1_ENST00000372739.3_Silent_p.R1610R|SPTAN1_ENST00000358161.5_Silent_p.R1610R	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1605					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ACGCTGACCGGATCCGTGGGG	0.537																																					NSCLC(120;833 1744 2558 35612 37579)												0													75.0	64.0	68.0					9																	131374049		2203	4300	6503	SO:0001819	synonymous_variant	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4815G>A	9.37:g.131374049G>A			Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																				0.537	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1		NM_003127	
SPTAN1	6709	hgsc.bcm.edu;ucsc.edu	37	9	131374053	131374053	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr9:131374053C>G	ENST00000372731.4	+	37	4929	c.4819C>G	c.(4819-4821)Cgt>Ggt	p.R1607G	SPTAN1_ENST00000372739.3_Missense_Mutation_p.R1612G|SPTAN1_ENST00000358161.5_Missense_Mutation_p.R1612G	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1607					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TGACCGGATCCGTGGGGTTAT	0.542																																					NSCLC(120;833 1744 2558 35612 37579)												0													76.0	65.0	69.0					9																	131374053		2203	4300	6503	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4819C>G	9.37:g.131374053C>G	ENSP00000361816:p.Arg1607Gly		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467939	0.63625	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.50813	0.73;1.34;0.73	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.39064	0.1064	N	0.20685	0.6	0.80722	D	1	B;P;P	0.38597	0.008;0.586;0.639	B;B;B	0.38755	0.048;0.185;0.281	T	0.20505	-1.0273	10	0.39692	T	0.17	.	19.756	0.96291	0.0:1.0:0.0:0.0	.	1587;1612;1607	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	G	1612;1607;1612;1587	ENSP00000350882:R1612G;ENSP00000361816:R1607G;ENSP00000361824:R1612G	ENSP00000350882:R1612G	R	+	1	0	SPTAN1	130413874	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	5.963000	0.70372	2.665000	0.90641	0.655000	0.94253	CGT		0.542	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1		NM_003127	
SRP72	6731	hgsc.bcm.edu	37	4	57335832	57335832	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr4:57335832C>A	ENST00000342756.5	+	2	844	c.123C>A	c.(121-123)aaC>aaA	p.N41K	SRP72_ENST00000504757.1_Missense_Mutation_p.N41K|SRP72_ENST00000510663.1_Missense_Mutation_p.N41K	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	41					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					TACAGATCAACAAAGATGACG	0.363																																																	0													145.0	133.0	137.0					4																	57335832		2203	4300	6503	SO:0001583	missense	6731			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.123C>A	4.37:g.57335832C>A	ENSP00000342181:p.Asn41Lys		G5E9Z8|Q7Z3C0	Missense_Mutation	SNP	ENST00000342756.5	37	CCDS3506.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.832408	0.32421	.	.	ENSG00000174780	ENST00000342756;ENST00000537129;ENST00000510663	T;T	0.39997	1.05;1.05	5.27	5.27	0.74061	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.256468	0.46442	D	0.000298	T	0.32585	0.0834	L	0.46157	1.445	0.48087	D	0.999588	B;B	0.30068	0.099;0.267	B;B	0.31101	0.029;0.124	T	0.07065	-1.0792	10	0.07325	T	0.83	.	11.5106	0.50490	0.179:0.821:0.0:0.0	.	41;41	G5E9Z8;O76094	.;SRP72_HUMAN	K	41;47;41	ENSP00000342181:N41K;ENSP00000424576:N41K	ENSP00000342181:N41K	N	+	3	2	SRP72	57030589	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.693000	0.54735	2.461000	0.83175	0.655000	0.94253	AAC		0.363	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250782.7			
SSPO	23145	hgsc.bcm.edu	37	7	149512019	149512019	+	RNA	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr7:149512019C>G	ENST00000378016.2	+	0	10569							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGAAAATTCCACCCAGTGCA	0.652																																																	0													9.0	11.0	10.0					7																	149512019		2150	4192	6342			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149512019C>G			Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																					0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript				
SYNE1	23345	hgsc.bcm.edu;ucsc.edu	37	6	152639292	152639292	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr6:152639292T>G	ENST00000367255.5	-	86	17097	c.16496A>C	c.(16495-16497)aAg>aCg	p.K5499T	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.K5499T|SYNE1_ENST00000448038.1_Missense_Mutation_p.K5428T|SYNE1_ENST00000356820.4_Missense_Mutation_p.K23T|SYNE1_ENST00000423061.1_Missense_Mutation_p.K5428T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5499					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCTATCTTCTTGGCCAGTGG	0.453										HNSCC(10;0.0054)																																							0													232.0	203.0	213.0					6																	152639292		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16496A>C	6.37:g.152639292T>G	ENSP00000356224:p.Lys5499Thr		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	11.05	1.525765	0.27299	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000356820	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.66	3.27	0.37495	.	0.171380	0.41194	D	0.000930	T	0.13798	0.0334	L	0.57536	1.79	0.24184	N	0.995573	P;B;B;B	0.38767	0.646;0.304;0.304;0.43	B;B;B;B	0.36666	0.23;0.05;0.05;0.1	T	0.14282	-1.0478	10	0.21014	T	0.42	.	9.1761	0.37112	0.0:0.2066:0.0:0.7934	.	5499;5499;5499;5428	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	T	5499;5428;5499;5428;23	ENSP00000356224:K5499T;ENSP00000396024:K5428T;ENSP00000265368:K5499T;ENSP00000390975:K5428T;ENSP00000349276:K23T	ENSP00000265368:K5499T	K	-	2	0	SYNE1	152680985	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	2.112000	0.41892	0.425000	0.26087	-1.054000	0.02325	AAG		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2		NM_182961	
TACR2	6865	hgsc.bcm.edu;ucsc.edu	37	10	71166860	71166860	+	Silent	SNP	G	G	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr10:71166860G>T	ENST00000373306.4	-	4	1461	c.918C>A	c.(916-918)atC>atA	p.I306I	TACR2_ENST00000373307.1_Silent_p.I94I	NM_001057.2	NP_001048.2	P21452	NK2R_HUMAN	tachykinin receptor 2	306					excretion (GO:0007588)|intestine smooth muscle contraction (GO:0014827)|muscle contraction (GO:0006936)|negative regulation of luteinizing hormone secretion (GO:0033685)|operant conditioning (GO:0035106)|positive regulation of acetylcholine secretion, neurotransmission (GO:0014057)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|prolactin secretion (GO:0070459)|tachykinin receptor signaling pathway (GO:0007217)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance K receptor activity (GO:0016497)|tachykinin receptor activity (GO:0004995)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	11						GACAGCAGTAGATGATGGGAT	0.597																																																	0													196.0	167.0	177.0					10																	71166860		2203	4300	6503	SO:0001819	synonymous_variant	6865				CCDS7293.1	10q22.1	2012-09-20			ENSG00000075073	ENSG00000075073		"""GPCR / Class A : Tachykinin receptors"""	11527	protein-coding gene	gene with protein product		162321		TAC2R, NKNAR			Standard	NM_001057		Approved	SKR, NK2R	uc001jpn.2	P21452	OTTHUMG00000018377	ENST00000373306.4:c.918C>A	10.37:g.71166860G>T			A8K7I1|Q4QRI5|Q8NGQ8|Q9UDE6|Q9UDE7	Silent	SNP	ENST00000373306.4	37	CCDS7293.1																																																																																				0.597	TACR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048411.1			
TBC1D10B	26000	hgsc.bcm.edu	37	16	30370551	30370551	+	Silent	SNP	G	G	A	rs113035492		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr16:30370551G>A	ENST00000409939.3	-	7	1664	c.1584C>T	c.(1582-1584)ttC>ttT	p.F528F	RP11-347C12.10_ENST00000563252.1_lincRNA	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	528	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GGGTGCGGGCGAAGATGCACA	0.642																																																	0													32.0	30.0	31.0					16																	30370551		2197	4298	6495	SO:0001819	synonymous_variant	26000			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1584C>T	16.37:g.30370551G>A			B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Silent	SNP	ENST00000409939.3	37	CCDS10676.2																																																																																				0.642	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3		NM_015527	
TBC1D21	161514	hgsc.bcm.edu;ucsc.edu	37	15	74174089	74174089	+	Splice_Site	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr15:74174089G>A	ENST00000300504.2	+	3	355		c.e3+1		TBC1D21_ENST00000535547.2_Splice_Site|TBC1D21_ENST00000562056.1_Splice_Site	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21							acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						GCATGAGGAGGTAGAACACTC	0.602																																																	0													37.0	36.0	36.0					15																	74174089		2198	4297	6495	SO:0001630	splice_region_variant	161514			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.272+1G>A	15.37:g.74174089G>A			B9A6M2	Splice_Site	SNP	ENST00000300504.2	37	CCDS10252.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516354	0.64634	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3201	0.54979	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D21	71961142	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.724000	0.61972	2.279000	0.76181	0.563000	0.77884	.		0.602	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268994.1		NM_153356	Intron
TBL1X	6907	hgsc.bcm.edu;ucsc.edu	37	X	9660211	9660211	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chrX:9660211A>G	ENST00000217964.7	+	9	1448	c.808A>G	c.(808-810)Acc>Gcc	p.T270A	TBL1X_ENST00000380961.1_Missense_Mutation_p.T219A|TBL1X_ENST00000407597.2_Missense_Mutation_p.T270A|TBL1X_ENST00000424279.1_Missense_Mutation_p.T219A|TBL1X_ENST00000536365.1_Missense_Mutation_p.T219A	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	270					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				CGGGGGCTCCACCCAGCTCGT	0.507																																																	0													112.0	109.0	110.0					X																	9660211		2203	4300	6503	SO:0001583	missense	6907			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.808A>G	X.37:g.9660211A>G	ENSP00000217964:p.Thr270Ala		A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.410071	0.25465	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.56103	0.48;3.58;3.58;3.58;0.48	4.35	4.35	0.52113	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.30070	0.0753	N	0.04880	-0.145	0.54753	D	0.999987	B;B	0.28552	0.215;0.116	B;B	0.32465	0.146;0.101	T	0.11348	-1.0591	10	0.07990	T	0.79	.	13.0748	0.59081	1.0:0.0:0.0:0.0	.	233;270	Q59F53;O60907	.;TBL1X_HUMAN	A	270;219;219;219;270	ENSP00000385988:T270A;ENSP00000394097:T219A;ENSP00000445317:T219A;ENSP00000370348:T219A;ENSP00000217964:T270A	ENSP00000217964:T270A	T	+	1	0	TBL1X	9620211	1.000000	0.71417	0.972000	0.41901	0.086000	0.17979	6.806000	0.75195	1.524000	0.49035	0.486000	0.48141	ACC		0.507	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1		NM_005647	
TCTA	6988	hgsc.bcm.edu;ucsc.edu	37	3	49450062	49450062	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr3:49450062A>C	ENST00000273590.3	+	1	424	c.203A>C	c.(202-204)tAt>tCt	p.Y68S	RHOA_ENST00000454011.2_5'Flank|RHOA_ENST00000265538.3_Intron|RHOA_ENST00000422781.1_5'Flank|RHOA_ENST00000418115.1_5'Flank|TCTA_ENST00000493381.1_3'UTR	NM_022171.2	NP_071503.1	P57738	TCTA_HUMAN	T-cell leukemia translocation altered	68						integral component of membrane (GO:0016021)				large_intestine(4)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACCGGGTTGTATCACCGTCCA	0.622																																																	0													97.0	104.0	102.0					3																	49450062		2203	4300	6503	SO:0001583	missense	6988				CCDS2796.1	3p21	2012-02-27	2012-02-27		ENSG00000145022	ENSG00000145022			11692	protein-coding gene	gene with protein product		600690	"""T-cell leukemia translocation altered gene"""			7728759	Standard	NM_022171		Approved		uc003cwv.4	P57738	OTTHUMG00000156846	ENST00000273590.3:c.203A>C	3.37:g.49450062A>C	ENSP00000273590:p.Tyr68Ser		B2R4I4|Q6I9U4|Q9BSB0	Missense_Mutation	SNP	ENST00000273590.3	37	CCDS2796.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.227375	0.79576	.	.	ENSG00000145022	ENST00000273590	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.65249	0.2673	L	0.36672	1.1	0.47819	D	0.999524	D	0.76494	0.999	D	0.78314	0.991	T	0.68142	-0.5487	9	0.87932	D	0	-6.6947	10.9752	0.47461	1.0:0.0:0.0:0.0	.	68	P57738	TCTA_HUMAN	S	68	.	ENSP00000273590:Y68S	Y	+	2	0	TCTA	49425066	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.695000	0.54749	2.093000	0.63338	0.454000	0.30748	TAT		0.622	TCTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346210.1		NM_022171	
TMEM117	84216	hgsc.bcm.edu;ucsc.edu	37	12	44782260	44782260	+	Silent	SNP	A	A	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:44782260A>G	ENST00000266534.3	+	8	1477	c.1350A>G	c.(1348-1350)cgA>cgG	p.R450R	TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000536799.1_Silent_p.R346R	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	450						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		GAATCACTCGAGAAAACACCC	0.423																																																	0													135.0	132.0	133.0					12																	44782260		2203	4300	6503	SO:0001819	synonymous_variant	84216			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1350A>G	12.37:g.44782260A>G				Silent	SNP	ENST00000266534.3	37	CCDS8745.1																																																																																				0.423	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1		NM_032256	
TMX4	56255	hgsc.bcm.edu	37	20	7962927	7962927	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr20:7962927T>C	ENST00000246024.2	-	8	1236	c.1021A>G	c.(1021-1023)Aaa>Gaa	p.K341E		NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	341					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						TGCTGACTTTTACGCTGCCTC	0.502																																																	0													80.0	72.0	75.0					20																	7962927		2203	4300	6503	SO:0001583	missense	56255				CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.1021A>G	20.37:g.7962927T>C	ENSP00000246024:p.Lys341Glu		Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	ENST00000246024.2	37	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.708777	0.48517	.	.	ENSG00000125827	ENST00000246024	T	0.13657	2.57	5.84	4.72	0.59763	.	0.356550	0.29021	N	0.013400	T	0.13329	0.0323	L	0.53249	1.67	0.28353	N	0.920793	P	0.37525	0.598	B	0.32211	0.142	T	0.10660	-1.0620	10	0.87932	D	0	-13.2187	10.0969	0.42480	0.0:0.0:0.1685:0.8315	.	341	Q9H1E5	TMX4_HUMAN	E	341	ENSP00000246024:K341E	ENSP00000246024:K341E	K	-	1	0	TMX4	7910927	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	1.883000	0.39658	1.017000	0.39495	0.455000	0.32223	AAA		0.502	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2		NM_021156	
TPH2	121278	hgsc.bcm.edu;ucsc.edu	37	12	72425132	72425132	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:72425132T>G	ENST00000333850.3	+	10	1400	c.1259T>G	c.(1258-1260)tTt>tGt	p.F420C		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	420					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GAAGCCTACTTTGTTTCAGAA	0.393																																																	0													107.0	113.0	111.0					12																	72425132		2203	4300	6503	SO:0001583	missense	121278			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1259T>G	12.37:g.72425132T>G	ENSP00000329093:p.Phe420Cys		A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.799415	0.70567	.	.	ENSG00000139287	ENST00000333850	D	0.99857	-7.22	5.43	5.43	0.79202	Aromatic amino acid hydroxylase, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99900	0.9952	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96142	0.9101	10	0.87932	D	0	-20.8662	15.7608	0.78080	0.0:0.0:0.0:1.0	.	420	Q8IWU9	TPH2_HUMAN	C	420	ENSP00000329093:F420C	ENSP00000329093:F420C	F	+	2	0	TPH2	70711399	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.997000	0.88414	2.187000	0.69744	0.402000	0.26972	TTT		0.393	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1		NM_173353	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751274	19751274	+	Silent	SNP	G	G	A	rs143115179	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr13:19751274G>A	ENST00000400113.3	-	4	953	c.849C>T	c.(847-849)caC>caT	p.H283H		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	283					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ACAGCTGCTCGTGGTAGGCCT	0.607																																																	0													143.0	128.0	133.0					13																	19751274		2203	4300	6503	SO:0001819	synonymous_variant	7278			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.849C>T	13.37:g.19751274G>A			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2		NM_006001	
UTS2	10911	hgsc.bcm.edu	37	1	7913400	7913400	+	5'Flank	SNP	T	T	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr1:7913400T>A	ENST00000361696.5	-	0	0				UTS2_ENST00000377516.2_5'UTR|UTS2_ENST00000054668.5_Missense_Mutation_p.Y31F	NM_006786.3	NP_006777.1	O95399	UTS2_HUMAN	urotensin 2						muscle contraction (GO:0006936)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell differentiation (GO:0045597)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of heart rate (GO:0010460)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to testosterone (GO:0033574)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			kidney(1)|lung(4)|urinary_tract(1)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		AAGGCTTGGATATGAGTTGAA	0.363																																																	0													132.0	127.0	129.0					1																	7913400		2203	4300	6503	SO:0001631	upstream_gene_variant	10911			AF104118	CCDS90.1, CCDS91.1	1p36	2013-02-28			ENSG00000049247	ENSG00000049247		"""Endogenous ligands"""	12636	protein-coding gene	gene with protein product	"""prepro U-II"""	604097				9861051, 10499587	Standard	NM_021995		Approved	UII, U-II, UCN2, PRO1068	uc001aos.3	O95399	OTTHUMG00000001218		1.37:g.7913400T>A	Exception_encountered		Q5H8X7|Q6UXF6|Q9UKP7	Missense_Mutation	SNP	ENST00000361696.5	37	CCDS91.1	.	.	.	.	.	.	.	.	.	.	T	0.614	-0.823671	0.02755	.	.	ENSG00000049247	ENST00000054668	T	0.29917	1.55	4.4	1.2	0.21068	.	.	.	.	.	T	0.13500	0.0327	.	.	.	0.09310	N	1	B	0.33135	0.399	B	0.29353	0.101	T	0.21314	-1.0249	8	0.18276	T	0.48	.	3.1214	0.06392	0.1895:0.4821:0.0:0.3284	.	31	O95399-2	.	F	31	ENSP00000054668:Y31F	ENSP00000054668:Y31F	Y	-	2	0	UTS2	7835987	0.369000	0.25039	0.002000	0.10522	0.005000	0.04900	1.128000	0.31369	0.317000	0.23160	0.533000	0.62120	TAT		0.363	UTS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003612.1		NM_006786	
VAV2	7410	hgsc.bcm.edu	37	9	136633699	136633699	+	Missense_Mutation	SNP	G	G	C	rs61751477	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr9:136633699G>C	ENST00000371850.3	-	29	2485	c.2454C>G	c.(2452-2454)atC>atG	p.I818M	VAV2_ENST00000406606.3_Missense_Mutation_p.I779M|VAV2_ENST00000371851.1_Missense_Mutation_p.I808M	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	818	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		CAGCTGTGCCGATGACGCGGG	0.627													G|||	53	0.0105831	0.0091	0.0231	5008	,	,		20442	0.002		0.0169	False		,,,				2504	0.0061																0								G	MET/ILE,MET/ILE	35,4371	40.0+/-72.8	0,35,2168	68.0	57.0	61.0		2454,2337	1.0	1.0	9	dbSNP_129	61	119,8481	60.2+/-122.0	1,117,4182	yes	missense,missense	VAV2	NM_001134398.1,NM_003371.3	10,10	1,152,6350	CC,CG,GG		1.3837,0.7944,1.1841	benign,benign	818/879,779/840	136633699	154,12852	2203	4300	6503	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2454C>G	9.37:g.136633699G>C	ENSP00000360916:p.Ile818Met		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	CCDS48053.1	26	0.011904761904761904	6	0.012195121951219513	8	0.022099447513812154	2	0.0034965034965034965	10	0.013192612137203167	G	14.32	2.500060	0.44455	0.007944	0.013837	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;D	0.82619	2.27;2.27;-1.63	4.98	0.998	0.19857	Src homology-3 domain (2);	0.061924	0.64402	D	0.000002	T	0.66237	0.2769	L	0.33624	1.015	0.35581	D	0.806302	D;B	0.62365	0.991;0.411	P;B	0.55545	0.778;0.33	T	0.74788	-0.3546	10	0.66056	D	0.02	.	4.4133	0.11443	0.3831:0.0:0.395:0.2219	rs61751477	818;779	P52735;P52735-3	VAV2_HUMAN;.	M	818;808;779;808	ENSP00000360916:I818M;ENSP00000360917:I808M;ENSP00000385362:I779M	ENSP00000317258:I808M	I	-	3	3	VAV2	135623520	0.330000	0.24705	1.000000	0.80357	0.522000	0.34438	-0.406000	0.07187	0.152000	0.19188	-0.244000	0.11960	ATC		0.627	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1			
VPS13B	157680	hgsc.bcm.edu	37	8	100832149	100832149	+	Splice_Site	SNP	G	G	A			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr8:100832149G>A	ENST00000358544.2	+	49	8979	c.8868G>A	c.(8866-8868)agG>agA	p.R2956R	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Splice_Site_p.R2931R	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2956					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTTGGAACAGGAATGAACAGC	0.403																																					Colon(161;2205 2542 7338 31318)												0													118.0	110.0	113.0					8																	100832149		2203	4300	6503	SO:0001630	splice_region_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8868-1G>A	8.37:g.100832149G>A			C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	37	CCDS6280.1																																																																																				0.403	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1		NM_184042	Silent
ZCCHC6	79670	hgsc.bcm.edu	37	9	88937854	88937854	+	Missense_Mutation	SNP	T	T	A	rs58050565|rs77621374|rs397759922	byFrequency	TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr9:88937854T>A	ENST00000375963.3	-	13	2983	c.2811A>T	c.(2809-2811)aaA>aaT	p.K937N	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.K937N|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.K226N|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.K814N|ZCCHC6_ENST00000469004.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	937				Missing (in Ref. 1; CAI45944/CAH56219). {ECO:0000305}.	RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CAGGTGAATTTTTTTCTTCAC	0.343																																																	0													29.0	32.0	31.0					9																	88937854		2059	4076	6135	SO:0001583	missense	79670			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2811A>T	9.37:g.88937854T>A	ENSP00000365130:p.Lys937Asn		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	-	4.685	0.127420	0.08981	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.56611	0.45;0.9;0.87;0.88	5.24	2.89	0.33648	.	0.839607	0.08576	U	0.925223	T	0.32285	0.0824	N	0.08118	0	0.09310	N	1	B;P	0.39094	0.003;0.659	B;B	0.42959	0.0;0.403	T	0.17167	-1.0378	10	0.19590	T	0.45	.	3.5944	0.08001	0.2793:0.1598:0.0:0.5609	.	814;937	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	N	226;814;937;937	ENSP00000277141:K226N;ENSP00000365127:K814N;ENSP00000365128:K937N;ENSP00000365130:K937N	ENSP00000277141:K226N	K	-	3	2	ZCCHC6	88127674	0.000000	0.05858	0.997000	0.53966	0.445000	0.32107	-0.165000	0.09968	0.453000	0.26858	0.528000	0.53228	AAA		0.343	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1		NM_024617	
ZNF268	10795	hgsc.bcm.edu;ucsc.edu	37	12	133779908	133779908	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr12:133779908C>T	ENST00000536435.2	+	6	1966	c.1636C>T	c.(1636-1638)Cat>Tat	p.H546Y	ZNF268_ENST00000537565.1_Missense_Mutation_p.H385Y|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.H546Y|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	546					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GCTCATTATACATCAGAGGAT	0.403																																																	0													37.0	36.0	36.0					12																	133779908		692	1590	2282	SO:0001583	missense	10795			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1636C>T	12.37:g.133779908C>T	ENSP00000444412:p.His546Tyr		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	ENST00000536435.2	37	CCDS45012.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199727	0.58126	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	D;D	0.86769	-2.17;-2.17	3.78	2.86	0.33363	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94282	0.8163	H	0.95884	3.735	0.32454	N	0.545012	D;D	0.76494	0.994;0.999	P;P	0.59948	0.866;0.865	D	0.94572	0.7772	8	.	.	.	.	11.346	0.49561	0.1833:0.8167:0.0:0.0	.	546;385	Q14587;Q14587-2	ZN268_HUMAN;.	Y	546;546;385;385	ENSP00000228289:H546Y;ENSP00000445713:H385Y	.	H	+	1	0	ZNF268	.	0.819000	0.29175	0.802000	0.32245	0.901000	0.52897	1.459000	0.35234	0.753000	0.32945	0.655000	0.94253	CAT		0.403	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2		NM_152943	
ZNF473	25888	hgsc.bcm.edu;ucsc.edu	37	19	50550173	50550173	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr19:50550173C>G	ENST00000595661.1	+	6	2968	c.2473C>G	c.(2473-2475)Ctc>Gtc	p.L825V	CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.L825V|ZNF473_ENST00000445728.3_Missense_Mutation_p.L813V|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.L825V			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	825					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		AGCTTTTGTCCTCAGTGCCCA	0.507											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													81.0	80.0	80.0					19																	50550173		2203	4300	6503	SO:0001583	missense	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2473C>G	19.37:g.50550173C>G	ENSP00000472808:p.Leu825Val	970	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	C	0.090	-1.168521	0.01660	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.08720	3.06;3.06;3.06	4.38	-6.11	0.02131	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.478840	0.15107	N	0.280180	T	0.03305	0.0096	N	0.16743	0.435	0.09310	N	1	B	0.31485	0.325	B	0.28385	0.089	T	0.41627	-0.9498	10	0.17369	T	0.5	-3.4304	7.7864	0.29095	0.0:0.3563:0.1131:0.5306	.	825	Q8WTR7	ZN473_HUMAN	V	825;825;813	ENSP00000270617:L825V;ENSP00000375697:L825V;ENSP00000388961:L813V	ENSP00000270617:L825V	L	+	1	0	ZNF473	55241985	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.997000	0.03705	-1.097000	0.03042	-0.140000	0.14226	CTC		0.507	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1		XM_046390	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60839350	60839350	+	Missense_Mutation	SNP	A	A	G	rs545343406		TCGA-CZ-4857-01A-01D-1373-10	TCGA-CZ-4857-11A-01D-1373-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			SOLID	45c7eea2-42be-4cc7-b658-9cb273fae580	a465c09a-09bc-4057-a658-e29daf498813	g.chr5:60839350A>G	ENST00000252744.5	+	14	2854	c.2854A>G	c.(2854-2856)Ata>Gta	p.I952V		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	952					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GGCCACAAGTATAGTTGCAAC	0.547													a|||	1	0.000199681	0.0008	0.0	5008	,	,		18794	0.0		0.0	False		,,,				2504	0.0																0													108.0	88.0	94.0					5																	60839350		692	1591	2283	SO:0001583	missense	57688			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2854A>G	5.37:g.60839350A>G	ENSP00000252744:p.Ile952Val			Missense_Mutation	SNP	ENST00000252744.5	37	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	a	14.95	2.689351	0.48097	.	.	ENSG00000130449	ENST00000252744	T	0.45276	0.9	4.96	4.96	0.65561	.	0.111196	0.64402	D	0.000015	T	0.44307	0.1287	L	0.57536	1.79	0.44282	D	0.997142	B	0.24186	0.099	B	0.34991	0.193	T	0.32214	-0.9915	10	0.21014	T	0.42	-10.2533	14.7952	0.69873	1.0:0.0:0.0:0.0	.	952	Q9HCJ5	ZSWM6_HUMAN	V	952	ENSP00000252744:I952V	ENSP00000252744:I952V	I	+	1	0	ZSWIM6	60875107	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.337000	0.79256	2.084000	0.62774	0.454000	0.30748	ATA		0.547	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1		NM_020928	
