#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification
AAGAB	79719	hgsc.bcm.edu;ucsc.edu	37	15	67496448	67496448	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr15:67496448G>A	ENST00000261880.5	-	8	858	c.754C>T	c.(754-756)Ctt>Ttt	p.L252F	AAGAB_ENST00000561452.1_Missense_Mutation_p.L143F|AAGAB_ENST00000538028.1_5'UTR|AAGAB_ENST00000542650.1_Missense_Mutation_p.L143F	NM_001271885.1|NM_001271886.1|NM_024666.3	NP_001258814.1|NP_001258815.1|NP_078942.3	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin binding protein	252					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9						CCAGTGGTAAGACTGGCTAAT	0.368																																																	0													128.0	117.0	120.0					15																	67496448		1868	4114	5982	SO:0001583	missense	79719			AL136715	CCDS42050.1, CCDS61679.1	15q22.33-q23	2014-02-12	2009-07-20		ENSG00000103591	ENSG00000103591			25662	protein-coding gene	gene with protein product		614888				11230166, 10477754	Standard	NM_024666		Approved	FLJ11506, p34	uc002aqk.5	Q6PD74	OTTHUMG00000172246	ENST00000261880.5:c.754C>T	15.37:g.67496448G>A	ENSP00000261880:p.Leu252Phe		B4DG44|Q6FI86|Q7Z5X9|Q9H0P1|Q9HAK0	Missense_Mutation	SNP	ENST00000261880.5	37	CCDS42050.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619848	0.87460	.	.	ENSG00000103591	ENST00000261880;ENST00000538028;ENST00000542650	T;T	0.52057	0.72;0.68	5.44	5.44	0.79542	.	0.061128	0.64402	N	0.000002	T	0.66366	0.2782	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66356	-0.5944	10	0.51188	T	0.08	-13.7114	16.1796	0.81890	0.0:0.0:1.0:0.0	.	252	Q6PD74	AAGAB_HUMAN	F	252;12;143	ENSP00000261880:L252F;ENSP00000440735:L143F	ENSP00000261880:L252F	L	-	1	0	AAGAB	65283502	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	8.342000	0.90049	2.562000	0.86427	0.491000	0.48974	CTT		0.368	AAGAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417472.1		NM_024666	
AASDHPPT	60496	hgsc.bcm.edu;ucsc.edu	37	11	105967561	105967561	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr11:105967561C>T	ENST00000278618.4	+	6	1079	c.857C>T	c.(856-858)cCt>cTt	p.P286L	RP11-677I18.3_ENST00000527594.1_RNA|RP11-677I18.3_ENST00000532422.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	286					macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		CCCATGACACCTGAAGATCCT	0.388																																																	0													108.0	97.0	101.0					11																	105967561		2201	4298	6499	SO:0001583	missense	60496			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.857C>T	11.37:g.105967561C>T	ENSP00000278618:p.Pro286Leu		B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	CCDS31664.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857715	0.51376	.	.	ENSG00000149313	ENST00000278618	.	.	.	5.5	4.59	0.56863	.	0.349676	0.33916	N	0.004429	T	0.39545	0.1082	N	0.12182	0.205	0.41564	D	0.988649	B	0.14012	0.009	B	0.20955	0.032	T	0.33523	-0.9865	9	0.54805	T	0.06	.	11.7035	0.51585	0.0:0.9176:0.0:0.0824	.	286	Q9NRN7	ADPPT_HUMAN	L	286	.	ENSP00000278618:P286L	P	+	2	0	AASDHPPT	105472771	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.278000	0.43426	2.589000	0.87451	0.650000	0.86243	CCT		0.388	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1		NM_015423	
ABCC3	8714	hgsc.bcm.edu;ucsc.edu	37	17	48741447	48741447	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:48741447T>G	ENST00000285238.8	+	10	1393	c.1313T>G	c.(1312-1314)aTc>aGc	p.I438S	ABCC3_ENST00000427699.1_Missense_Mutation_p.I438S	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	438	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CTGCAGATCATCCTGGCGATC	0.547																																																	0													124.0	110.0	115.0					17																	48741447		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1313T>G	17.37:g.48741447T>G	ENSP00000285238:p.Ile438Ser		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	T	4.558	0.103711	0.08731	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.90444	-2.67;-2.67	4.71	1.23	0.21249	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.056440	0.07351	N	0.882342	D	0.88276	0.6393	M	0.66506	2.035	0.30413	N	0.778909	B;B	0.19331	0.035;0.014	B;B	0.17979	0.018;0.02	T	0.76822	-0.2817	10	0.38643	T	0.18	-4.5941	7.2189	0.25975	0.0:0.1556:0.4318:0.4126	.	438;438	O15438;O15438-5	MRP3_HUMAN;.	S	438	ENSP00000395160:I438S;ENSP00000285238:I438S	ENSP00000285238:I438S	I	+	2	0	ABCC3	46096446	0.001000	0.12720	0.983000	0.44433	0.642000	0.38348	0.518000	0.22847	0.014000	0.14944	-0.326000	0.08463	ATC		0.547	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2		NM_020038	
AGAP7P	653268	hgsc.bcm.edu	37	10	51485991	51485991	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr10:51485991delC	ENST00000374095.5	-	1	336	c.211delG	c.(211-213)gagfs	p.E71fs		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		71					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						TCAGGCATCTCCCGGTCACGA	0.592																																																	0													1.0	1.0	1.0					10																	51485991		7	1	8	SO:0001589	frameshift_variant	653268																														ENST00000374095.5:c.211delG	10.37:g.51485991delC	ENSP00000363208:p.Glu71fs		A6NGH4	Frame_Shift_Del	DEL	ENST00000374095.5	37	CCDS41524.1																																																																																				0.592	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048033.1			
AKAP12	9590	hgsc.bcm.edu;ucsc.edu	37	6	151670340	151670340	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:151670340delA	ENST00000253332.1	+	3	1003	c.814delA	c.(814-816)aaafs	p.K272fs	AKAP12_ENST00000354675.6_Frame_Shift_Del_p.K174fs|AKAP12_ENST00000402676.2_Frame_Shift_Del_p.K272fs|AKAP12_ENST00000359755.5_Frame_Shift_Del_p.K167fs|snoU13_ENST00000458767.1_RNA			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	272	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGGAGAAGAGAAACAAGAAAA	0.493																																					Melanoma(141;1616 1805 10049 24534 51979)												0													47.0	52.0	50.0					6																	151670340		2203	4300	6503	SO:0001589	frameshift_variant	9590			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.814delA	6.37:g.151670340delA	ENSP00000253332:p.Lys272fs		O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Frame_Shift_Del	DEL	ENST00000253332.1	37	CCDS5229.1																																																																																				0.493	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1			
LVRN	206338	hgsc.bcm.edu;ucsc.edu	37	5	115350147	115350147	+	Silent	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr5:115350147G>A	ENST00000357872.4	+	16	2497	c.2373G>A	c.(2371-2373)gcG>gcA	p.A791A	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		791						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										TTGTAACTGCGTGTTGGTTGG	0.363																																																	0													119.0	114.0	116.0					5																	115350147		2202	4300	6502	SO:0001819	synonymous_variant	206338																														ENST00000357872.4:c.2373G>A	5.37:g.115350147G>A			A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																				0.363	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1			
TICRR	90381	hgsc.bcm.edu;ucsc.edu	37	15	90128974	90128974	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr15:90128974C>T	ENST00000268138.7	+	4	1317	c.1212C>T	c.(1210-1212)ccC>ccT	p.P404P	TICRR_ENST00000560985.1_Silent_p.P403P|RP11-429B14.1_ENST00000559041.1_RNA			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	404					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCCGGCCCCCCATCACTGGAG	0.483																																																	0													64.0	66.0	65.0					15																	90128974		1951	4138	6089	SO:0001819	synonymous_variant	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1212C>T	15.37:g.90128974C>T			B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																				0.483	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1		NM_152259	
C6orf211	79624	hgsc.bcm.edu;ucsc.edu	37	6	151789551	151789551	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:151789551T>C	ENST00000367294.3	+	5	891	c.632T>C	c.(631-633)cTa>cCa	p.L211P	C6orf211_ENST00000545879.1_Missense_Mutation_p.L92P	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	211										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		ACCAATGTACTAAATTCATTG	0.333																																																	0													79.0	84.0	82.0					6																	151789551		2203	4300	6503	SO:0001583	missense	79624			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.632T>C	6.37:g.151789551T>C	ENSP00000356263:p.Leu211Pro		Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	T	10.06	1.247160	0.22796	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.06849	3.25;3.25	5.69	5.69	0.88448	Domain of unknown function DUF89 (2);	0.464512	0.23577	N	0.046698	T	0.11324	0.0276	M	0.74647	2.275	0.28872	N	0.894872	P	0.35793	0.521	P	0.47162	0.54	T	0.08229	-1.0732	10	0.34782	T	0.22	.	15.9458	0.79792	0.0:0.0:0.0:1.0	.	211	Q9H993	CF211_HUMAN	P	211;92	ENSP00000356263:L211P;ENSP00000444121:L92P	ENSP00000356263:L211P	L	+	2	0	C6orf211	151831244	0.982000	0.34865	0.003000	0.11579	0.049000	0.14656	7.963000	0.87922	2.162000	0.67917	0.459000	0.35465	CTA		0.333	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1		NM_024573	
CCNK	8812	hgsc.bcm.edu;ucsc.edu	37	14	99969172	99969172	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr14:99969172G>C	ENST00000389879.5	+	8	985	c.862G>C	c.(862-864)Gta>Cta	p.V288L	CCNK_ENST00000555049.1_Missense_Mutation_p.V288L	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	288					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				AGTGCCGCAAGTACAGCAGTC	0.582																																																	0													108.0	135.0	126.0					14																	99969172		2132	4248	6380	SO:0001583	missense	8812			AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.862G>C	14.37:g.99969172G>C	ENSP00000374529:p.Val288Leu		Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	ENST00000389879.5	37	CCDS45160.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787178	0.49997	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000555049	T;D	0.91180	2.27;-2.8	5.71	5.71	0.89125	.	0.435853	0.24613	N	0.037023	D	0.87815	0.6272	L	0.51422	1.61	0.09310	N	1	B;B	0.20261	0.043;0.021	B;B	0.19946	0.027;0.02	T	0.75216	-0.3396	10	0.26408	T	0.33	-5.7999	15.4687	0.75422	0.0:0.0:0.8609:0.1391	.	288;288	O75909;O75909-2	CCNK_HUMAN;.	L	288;290;290;288;288	ENSP00000374529:V288L;ENSP00000452307:V288L	ENSP00000216279:V290L	V	+	1	0	CCNK	99038925	1.000000	0.71417	0.039000	0.18376	0.809000	0.45718	3.964000	0.56780	2.709000	0.92574	0.655000	0.94253	GTA		0.582	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413721.1			
CDK2	1017	hgsc.bcm.edu;ucsc.edu	37	12	56360850	56360850	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr12:56360850A>G	ENST00000266970.4	+	1	298	c.58A>G	c.(58-60)Aaa>Gaa	p.K20E	PMEL_ENST00000550447.1_5'Flank|PMEL_ENST00000550464.1_5'Flank|CDK2_ENST00000440311.2_Missense_Mutation_p.K20E|PMEL_ENST00000548493.1_5'Flank|CDK2_ENST00000354056.4_Missense_Mutation_p.K20E|PMEL_ENST00000548747.1_5'Flank|PMEL_ENST00000552882.1_5'Flank|RP11-973D8.4_ENST00000554022.1_RNA|PMEL_ENST00000548689.1_5'Flank|CDK2_ENST00000553376.1_Missense_Mutation_p.K20E|PMEL_ENST00000360714.4_5'Flank|PMEL_ENST00000536427.1_5'Flank|PMEL_ENST00000449260.2_5'Flank|PMEL_ENST00000539511.1_5'Flank	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	20	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	AGTTGTGTACAAAGCCAGAAA	0.597																																																	0													138.0	130.0	133.0					12																	56360850		2203	4300	6503	SO:0001583	missense	1017			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.58A>G	12.37:g.56360850A>G	ENSP00000266970:p.Lys20Glu		A8K7C6|O75100	Missense_Mutation	SNP	ENST00000266970.4	37	CCDS8898.1	.	.	.	.	.	.	.	.	.	.	A	35	5.467755	0.96257	.	.	ENSG00000123374	ENST00000266970;ENST00000553376;ENST00000440311;ENST00000354056	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	4.65	4.65	0.58169	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.78078	0.4227	L	0.58969	1.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.80525	-0.1344	10	0.87932	D	0	-7.7538	13.4748	0.61301	1.0:0.0:0.0:0.0	.	20;20;20	E7ESI2;P24941-2;P24941	.;.;CDK2_HUMAN	E	20	ENSP00000266970:K20E;ENSP00000452514:K20E;ENSP00000393605:K20E;ENSP00000243067:K20E	ENSP00000266970:K20E	K	+	1	0	CDK2	54647117	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.123000	0.94387	2.088000	0.63022	0.402000	0.26972	AAA		0.597	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409650.1			
CEP250	11190	hgsc.bcm.edu;ucsc.edu	37	20	34053567	34053567	+	Splice_Site	SNP	G	G	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr20:34053567G>C	ENST00000397527.1	+	6	963		c.e6-1		CEP250_ENST00000342580.4_Splice_Site|CEP250_ENST00000397524.1_Splice_Site	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa						centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GTCTGGCGCAGGGACCAATCC	0.527																																																	0													70.0	61.0	64.0					20																	34053567		2202	4299	6501	SO:0001630	splice_region_variant	11190			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.244-1G>C	20.37:g.34053567G>C			E1P5Q3|O14812|O60588|Q9H450	Splice_Site	SNP	ENST00000397527.1	37	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	G	12.44	1.939048	0.34189	.	.	ENSG00000126001	ENST00000446710;ENST00000420564;ENST00000397527;ENST00000342580;ENST00000397524;ENST00000425934	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.867	0.86032	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP250	33516981	1.000000	0.71417	0.996000	0.52242	0.514000	0.34195	5.486000	0.66856	2.701000	0.92244	0.655000	0.94253	.		0.527	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7		NM_007186	Intron
COL24A1	255631	hgsc.bcm.edu;ucsc.edu	37	1	86591606	86591606	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:86591606A>G	ENST00000370571.2	-	3	779	c.413T>C	c.(412-414)cTa>cCa	p.L138P	COL24A1_ENST00000436319.1_Missense_Mutation_p.L138P	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	138					extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTTTTTAGGTAGTAATTGTAC	0.358																																																	0													51.0	48.0	49.0					1																	86591606		1839	4086	5925	SO:0001583	missense	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.413T>C	1.37:g.86591606A>G	ENSP00000359603:p.Leu138Pro		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	A	12.98	2.100084	0.37048	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	T;T	0.02103	4.45;4.45	5.82	5.82	0.92795	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.31370	N	0.007773	T	0.07773	0.0195	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.998	T	0.02491	-1.1151	10	0.62326	D	0.03	.	15.3471	0.74346	1.0:0.0:0.0:0.0	.	138;138	F8WDM8;Q17RW2	.;COOA1_HUMAN	P	138	ENSP00000359603:L138P;ENSP00000392531:L138P	ENSP00000359603:L138P	L	-	2	0	COL24A1	86364194	1.000000	0.71417	0.952000	0.39060	0.854000	0.48673	4.846000	0.62860	2.220000	0.72140	0.533000	0.62120	CTA		0.358	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4		NM_152890	
CXorf36	79742	hgsc.bcm.edu;ucsc.edu	37	X	45016973	45016973	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chrX:45016973G>A	ENST00000398000.2	-	3	733	c.659C>T	c.(658-660)cCc>cTc	p.P220L	CXorf36_ENST00000477281.1_Intron	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	220						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						TAGGAGGATGGGGTGCGAGTT	0.602																																																	0													55.0	50.0	51.0					X																	45016973		1563	3577	5140	SO:0001583	missense	79742			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.659C>T	X.37:g.45016973G>A	ENSP00000381086:p.Pro220Leu		A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	ENST00000398000.2	37	CCDS48096.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840214	0.51057	.	.	ENSG00000147113	ENST00000398000	T	0.37915	1.17	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000002	T	0.61702	0.2368	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63844	-0.6545	10	0.39692	T	0.17	.	17.1375	0.86743	0.0:0.0:1.0:0.0	.	220	Q9H7Y0	CX036_HUMAN	L	220	ENSP00000381086:P220L	ENSP00000381086:P220L	P	-	2	0	CXorf36	44901917	1.000000	0.71417	0.995000	0.50966	0.096000	0.18686	7.004000	0.76317	1.967000	0.57214	0.429000	0.28392	CCC		0.602	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056333.2		NM_024689	
DCHS2	54798	hgsc.bcm.edu;ucsc.edu	37	4	155157548	155157548	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr4:155157548delA	ENST00000357232.4	-	25	6890	c.6891delT	c.(6889-6891)tttfs	p.F2297fs		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2297	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACACAACTGCAAAAGAAAAAT	0.368																																																	0													86.0	83.0	84.0					4																	155157548		2203	4300	6503	SO:0001589	frameshift_variant	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6891delT	4.37:g.155157548delA	ENSP00000349768:p.Phe2297fs		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000357232.4	37	CCDS3785.1																																																																																				0.368	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2		NM_001142552	
DHX9	1660	hgsc.bcm.edu;ucsc.edu	37	1	182849640	182849640	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:182849640G>A	ENST00000367549.3	+	22	2631	c.2521G>A	c.(2521-2523)Gca>Aca	p.A841T	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	841					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AGAGCTTGATGCATTAGATGC	0.388																																					Colon(69;210 1162 3697 13559 39565)												0													105.0	100.0	102.0					1																	182849640		1916	4131	6047	SO:0001583	missense	1660			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2521G>A	1.37:g.182849640G>A	ENSP00000356520:p.Ala841Thr		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	33	5.212915	0.95069	.	.	ENSG00000135829	ENST00000367549	T	0.56275	0.47	5.55	5.55	0.83447	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.80507	0.4636	H	0.95151	3.63	0.80722	D	1	P;D	0.54207	0.88;0.965	P;P	0.61722	0.708;0.893	D	0.86042	0.1520	10	0.72032	D	0.01	.	19.5106	0.95140	0.0:0.0:1.0:0.0	.	120;841	B3KU66;Q08211	.;DHX9_HUMAN	T	841	ENSP00000356520:A841T	ENSP00000356520:A841T	A	+	1	0	DHX9	181116263	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.140000	0.94607	2.587000	0.87381	0.650000	0.86243	GCA		0.388	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2		NM_030588	
EIF4A3	9775	hgsc.bcm.edu;ucsc.edu	37	17	78110034	78110034	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:78110034T>C	ENST00000269349.3	-	10	1305	c.1084A>G	c.(1084-1086)Ata>Gta	p.I362V		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	362	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TACCTGTGTATGTACAATTCT	0.393																																																	0													103.0	100.0	101.0					17																	78110034		2203	4300	6503	SO:0001583	missense	9775			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.1084A>G	17.37:g.78110034T>C	ENSP00000269349:p.Ile362Val		Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	ENST00000269349.3	37	CCDS11767.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562046	0.27915	.	.	ENSG00000141543	ENST00000269349	T	0.78003	-1.14	4.03	4.03	0.46877	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.73916	0.3648	L	0.35542	1.07	0.80722	D	1	B	0.27791	0.189	B	0.41723	0.365	T	0.74765	-0.3554	10	0.62326	D	0.03	-16.8333	10.9528	0.47341	0.0:0.0:0.0:1.0	.	362	P38919	IF4A3_HUMAN	V	362	ENSP00000269349:I362V	ENSP00000269349:I362V	I	-	1	0	EIF4A3	75724629	1.000000	0.71417	0.612000	0.29024	0.043000	0.13939	7.315000	0.78998	1.714000	0.51371	0.459000	0.35465	ATA		0.393	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437446.1		NM_014740	
EML6	400954	hgsc.bcm.edu;ucsc.edu	37	2	55195335	55195335	+	Missense_Mutation	SNP	T	T	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr2:55195335T>A	ENST00000356458.6	+	39	6189	c.5669T>A	c.(5668-5670)gTg>gAg	p.V1890E	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1890						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						TGCGCATGTGTGACCCACGCT	0.483																																																	0													132.0	117.0	122.0					2																	55195335		692	1591	2283	SO:0001583	missense	400954				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.5669T>A	2.37:g.55195335T>A	ENSP00000348842:p.Val1890Glu		A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	T	31	5.074146	0.94000	.	.	ENSG00000214595	ENST00000356458	T	0.18502	2.21	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.45316	0.1336	M	0.82056	2.57	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.42085	-0.9472	9	0.49607	T	0.09	.	16.1814	0.81903	0.0:0.0:0.0:1.0	.	1890	Q6ZMW3	EMAL6_HUMAN	E	1890	ENSP00000348842:V1890E	ENSP00000348842:V1890E	V	+	2	0	EML6	55048839	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.662000	0.83803	2.234000	0.73211	0.533000	0.62120	GTG		0.483	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3		XM_001725002	
EPB41L3	23136	hgsc.bcm.edu;ucsc.edu	37	18	5428360	5428360	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr18:5428360C>T	ENST00000341928.2	-	9	1357	c.1017G>A	c.(1015-1017)aaG>aaA	p.K339K	EPB41L3_ENST00000400111.3_Silent_p.K339K|EPB41L3_ENST00000342933.3_Silent_p.K339K|EPB41L3_ENST00000540638.2_Silent_p.K339K|EPB41L3_ENST00000544123.1_Silent_p.K339K|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	339	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGTATGAAATCTTTAGAACCT	0.453																																																	0													146.0	144.0	145.0					18																	5428360		2203	4300	6503	SO:0001819	synonymous_variant	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1017G>A	18.37:g.5428360C>T			B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	ENST00000341928.2	37	CCDS11838.1																																																																																				0.453	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1		NM_012307	
FAM162B	221303	hgsc.bcm.edu;ucsc.edu	37	6	117083156	117083156	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:117083156A>G	ENST00000368557.4	-	3	520	c.374T>C	c.(373-375)aTa>aCa	p.I125T		NM_001085480.2	NP_001078949.1	Q5T6X4	F162B_HUMAN	family with sequence similarity 162, member B	125						integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)	6						GGCTGACACTATCACAGCAAA	0.403																																																	0													177.0	169.0	171.0					6																	117083156		1908	4125	6033	SO:0001583	missense	221303			BC038997	CCDS43497.1	6q22.31	2014-01-28	2008-06-05	2008-06-05	ENSG00000183807	ENSG00000183807			21549	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 189"""	C6orf189			Standard	NM_001085480		Approved	bA86F4.2	uc003pxi.2	Q5T6X4	OTTHUMG00000015446	ENST00000368557.4:c.374T>C	6.37:g.117083156A>G	ENSP00000357545:p.Ile125Thr		Q8IXW8	Missense_Mutation	SNP	ENST00000368557.4	37	CCDS43497.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.321591	0.23994	.	.	ENSG00000183807	ENST00000368557	T	0.38887	1.11	4.48	3.29	0.37713	.	0.066621	0.56097	D	0.000021	T	0.44030	0.1274	M	0.72118	2.19	0.39726	D	0.971548	D	0.55605	0.972	P	0.57204	0.815	T	0.50457	-0.8826	10	0.87932	D	0	-12.8342	10.5254	0.44945	0.8367:0.1632:0.0:0.0	.	125	Q5T6X4	F162B_HUMAN	T	125	ENSP00000357545:I125T	ENSP00000357545:I125T	I	-	2	0	FAM162B	117189849	1.000000	0.71417	0.494000	0.27515	0.016000	0.09150	6.171000	0.71926	0.838000	0.34948	-0.321000	0.08615	ATA		0.403	FAM162B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041965.1		XM_927381	
FAM47A	158724	hgsc.bcm.edu	37	X	34149658	34149693	+	In_Frame_Del	DEL	ATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	ATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	-	rs367563899|rs201090915|rs201363312|rs373732464		TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	ATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	ATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chrX:34149658_34149693delATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	ENST00000346193.3	-	1	754_789	c.703_738delCTCCGCCCGGAGCCTCCAGAGACTGGAGTGTCCCAT	c.(703-738)ctccgcccggagcctccagagactggagtgtcccatdel	p.LRPEPPETGVSH235del		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	235	Pro-rich.							p.L235_H246delLRPEPPETGVSH(1)|p.P240P(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CCGGGCGGATATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAGATGGGACACT	0.627														5	0.0013245	0.0	0.0	3775	,	,		15035	0.0		0.004	False		,,,				2504	0.001																2	Substitution - coding silent(1)|Deletion - In frame(1)	ovary(1)|lung(1)								33,3667		0,20,13,1562,523						-0.3	0.0			32	98,6373		2,62,32,2290,1731	no	coding	FAM47A	NM_203408.3		2,82,45,3852,2254	A1A1,A1R,A1,RR,R		1.5144,0.8919,1.288				131,10040				SO:0001651	inframe_deletion	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.703_738delCTCCGCCCGGAGCCTCCAGAGACTGGAGTGTCCCAT	X.37:g.34149658_34149693delATGGGACACTCCAGTCTCTGGAGGCTCCGGGCGGAG	ENSP00000345029:p.Leu235_His246del		A8K8I9|Q8TAA0	In_Frame_Del	DEL	ENST00000346193.3	37	CCDS43926.1																																																																																				0.627	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1		NM_203408	
FAM65B	9750	hgsc.bcm.edu;ucsc.edu	37	6	24843341	24843341	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:24843341C>G	ENST00000259698.4	-	14	1844	c.1669G>C	c.(1669-1671)Gac>Cac	p.D557H	FAM65B_ENST00000510784.2_Missense_Mutation_p.D541H|FAM65B_ENST00000538035.1_Missense_Mutation_p.D536H|FAM65B_ENST00000473070.1_5'UTR|FAM65B_ENST00000378023.4_Missense_Mutation_p.D507H|FAM65B_ENST00000540914.1_Missense_Mutation_p.D507H	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	557					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TCCGAAGTGTCCAGTTCCACA	0.547																																																	0													163.0	164.0	163.0					6																	24843341		1999	4185	6184	SO:0001583	missense	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1669G>C	6.37:g.24843341C>G	ENSP00000259698:p.Asp557His		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	ENST00000259698.4	37	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840422	0.51057	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.64757	0.2627	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.65018	-0.6270	10	0.54805	T	0.06	-35.184	19.6853	0.95977	0.0:1.0:0.0:0.0	.	541;536;507;557	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	H	557;536;507;507;541	ENSP00000259698:D557H;ENSP00000441138:D536H;ENSP00000367262:D507H;ENSP00000438425:D507H;ENSP00000441305:D541H	ENSP00000259698:D557H	D	-	1	0	FAM65B	24951320	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	7.294000	0.78760	2.642000	0.89623	0.655000	0.94253	GAC		0.547	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2			
FCRL4	83417	hgsc.bcm.edu;ucsc.edu	37	1	157557663	157557663	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:157557663T>C	ENST00000271532.1	-	4	689	c.554A>G	c.(553-555)aAa>aGa	p.K185R	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	185					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				ACCTTGAATTTTAATTATTTT	0.323																																																	0													34.0	35.0	35.0					1																	157557663		2201	4298	6499	SO:0001583	missense	83417			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.554A>G	1.37:g.157557663T>C	ENSP00000271532:p.Lys185Arg		Q96PJ3|Q96RE0	Missense_Mutation	SNP	ENST00000271532.1	37	CCDS1166.1	.	.	.	.	.	.	.	.	.	.	T	7.779	0.709014	0.15239	.	.	ENSG00000163518	ENST00000271532	T	0.18502	2.21	3.97	-1.51	0.08664	Immunoglobulin subtype (1);	1.809700	0.03107	N	0.161921	T	0.03220	0.0094	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.18263	0.021	T	0.36529	-0.9744	10	0.13470	T	0.59	.	7.6222	0.28191	0.0:0.4105:0.0:0.5895	.	185	Q96PJ5	FCRL4_HUMAN	R	185	ENSP00000271532:K185R	ENSP00000271532:K185R	K	-	2	0	FCRL4	155824287	0.018000	0.18449	0.016000	0.15963	0.248000	0.25809	0.133000	0.15912	-0.402000	0.07633	0.383000	0.25322	AAA		0.323	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1		NM_031282	
FUT10	84750	hgsc.bcm.edu;ucsc.edu	37	8	33246865	33246865	+	Silent	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr8:33246865A>G	ENST00000327671.5	-	4	1459	c.828T>C	c.(826-828)ttT>ttC	p.F276F	FUT10_ENST00000524021.1_Silent_p.F248F|FUT10_ENST00000335589.3_Silent_p.F214F|FUT10_ENST00000518672.1_Silent_p.F248F|FUT10_ENST00000518076.1_5'UTR	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	276					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		AAGCTAGGATAAACTTATACT	0.443																																																	0													101.0	94.0	96.0					8																	33246865		2203	4300	6503	SO:0001819	synonymous_variant	84750			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.828T>C	8.37:g.33246865A>G			A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Silent	SNP	ENST00000327671.5	37	CCDS6088.1																																																																																				0.443	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1		NM_032664	
G3BP2	9908	hgsc.bcm.edu;ucsc.edu	37	4	76572287	76572287	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr4:76572287G>A	ENST00000359707.4	-	10	1768	c.983C>T	c.(982-984)cCa>cTa	p.P328L	G3BP2_ENST00000357854.3_Missense_Mutation_p.P295L|G3BP2_ENST00000395719.3_Missense_Mutation_p.P328L	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	328					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATGACTATCTGGATAGCGAAT	0.343																																																	0													103.0	102.0	103.0					4																	76572287		2203	4299	6502	SO:0001583	missense	9908			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.983C>T	4.37:g.76572287G>A	ENSP00000352738:p.Pro328Leu		A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	G	33	5.225560	0.95173	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	T;T;T	0.74842	-0.88;-0.88;-0.88	6.04	6.04	0.98038	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.86694	0.5994	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.958	D	0.86058	0.1530	10	0.62326	D	0.03	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	295;328	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	L	328;328;295	ENSP00000379069:P328L;ENSP00000352738:P328L;ENSP00000350518:P295L	ENSP00000350518:P295L	P	-	2	0	G3BP2	76791311	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.873000	0.98535	0.561000	0.74099	CCA		0.343	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2		NM_012297	
GAN	8139	hgsc.bcm.edu;ucsc.edu	37	16	81398605	81398605	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr16:81398605G>T	ENST00000568107.2	+	8	1425	c.1263G>T	c.(1261-1263)aaG>aaT	p.K421N		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	421					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				CTATGAAAAAGAAAATCTACG	0.468																																					GBM(106;1239 1507 7582 9741 33976)												0													66.0	66.0	66.0					16																	81398605		2202	4300	6502	SO:0001583	missense	8139			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1263G>T	16.37:g.81398605G>T	ENSP00000476795:p.Lys421Asn			Missense_Mutation	SNP	ENST00000568107.2	37	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171039	0.78452	.	.	ENSG00000127688	ENST00000248272	T	0.74315	-0.83	5.61	2.46	0.29980	Galactose oxidase, beta-propeller (1);	0.189921	0.56097	D	0.000035	T	0.61874	0.2382	N	0.03115	-0.41	0.58432	D	0.999996	D	0.57257	0.979	P	0.57620	0.824	T	0.59621	-0.7420	10	0.27082	T	0.32	.	10.5503	0.45083	0.2182:0.0:0.7818:0.0	.	421	Q9H2C0	GAN_HUMAN	N	421	ENSP00000248272:K421N	ENSP00000248272:K421N	K	+	3	2	GAN	79956106	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.435000	0.52849	0.664000	0.31047	0.557000	0.71058	AAG		0.468	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3			
GGT1	2678	hgsc.bcm.edu	37	22	25007113	25007113	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr22:25007113T>C	ENST00000400382.1	+	5	820	c.65T>C	c.(64-66)cTc>cCc	p.L22P	GGT1_ENST00000248923.4_Missense_Mutation_p.L22P|GGT1_ENST00000406383.2_Missense_Mutation_p.L22P|GGT1_ENST00000400383.1_Missense_Mutation_p.L22P|GGT1_ENST00000400380.1_Missense_Mutation_p.L22P			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	22					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	ATTGTCGGCCTCTGTCTCTGG	0.612																																																	0													13.0	13.0	13.0					22																	25007113		1974	4134	6108	SO:0001583	missense	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.65T>C	22.37:g.25007113T>C	ENSP00000383232:p.Leu22Pro		Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	6.664	0.490966	0.12702	.	.	ENSG00000100031	ENST00000248923;ENST00000456869;ENST00000411974;ENST00000412658;ENST00000445029;ENST00000419133;ENST00000400382;ENST00000438643;ENST00000452551;ENST00000400383;ENST00000412898;ENST00000400380;ENST00000455483;ENST00000430289;ENST00000447416;ENST00000432867;ENST00000451366;ENST00000406383;ENST00000428855	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.29397	3.51;1.75;3.4;1.57;1.81;3.51;1.75;3.51;1.66;3.51;1.71;1.73;1.75;1.73;1.75;3.51;1.75	3.5	3.5	0.40072	.	0.228496	0.37053	U	0.002267	T	0.40595	0.1123	L	0.59436	1.845	0.35923	D	0.831968	D	0.64830	0.994	P	0.56343	0.796	T	0.48801	-0.9003	10	0.30854	T	0.27	-15.9708	10.0722	0.42339	0.0:0.0:0.0:1.0	.	22	P19440	GGT1_HUMAN	P	22	ENSP00000248923:L22P;ENSP00000389935:L22P;ENSP00000393537:L22P;ENSP00000393135:L22P;ENSP00000395271:L22P;ENSP00000383232:L22P;ENSP00000415553:L22P;ENSP00000383233:L22P;ENSP00000408151:L22P;ENSP00000383231:L22P;ENSP00000415024:L22P;ENSP00000417044:L22P;ENSP00000400621:L22P;ENSP00000398589:L22P;ENSP00000387796:L22P;ENSP00000385975:L22P;ENSP00000415068:L22P	ENSP00000248923:L22P	L	+	2	0	GGT1	23337113	0.274000	0.24191	0.036000	0.18154	0.190000	0.23558	3.168000	0.50801	1.554000	0.49487	0.528000	0.53228	CTC		0.612	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1		NM_013430	
GRIK5	2901	hgsc.bcm.edu;ucsc.edu	37	19	42566909	42566909	+	Splice_Site	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr19:42566909C>A	ENST00000262895.3	-	3	342		c.e3+1		GRIK5_ENST00000593562.1_Splice_Site|GRIK5_ENST00000301218.4_Splice_Site	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5						cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				CCCCATCTCACCTCCTTCTCT	0.612																																																	0													80.0	77.0	78.0					19																	42566909		2203	4300	6503	SO:0001630	splice_region_variant	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.342+1G>T	19.37:g.42566909C>A			Q8WWG8	Splice_Site	SNP	ENST00000262895.3	37	CCDS12595.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668334	0.88348	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.147	0.89661	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIK5	47258749	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.258000	0.78371	2.595000	0.87683	0.643000	0.83706	.		0.612	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1			Intron
GTSF1	121355	hgsc.bcm.edu;ucsc.edu	37	12	54856986	54856986	+	Silent	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr12:54856986A>G	ENST00000552397.1	-	4	1109	c.213T>C	c.(211-213)tgT>tgC	p.C71C	RP11-753H16.5_ENST00000552785.1_RNA|GTSF1_ENST00000305879.5_Silent_p.C71C|GTSF1_ENST00000552395.1_5'UTR|RP11-753H16.3_ENST00000550474.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1	71						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				TTCTGTCATCACAGCTTGAGA	0.403																																																	0													118.0	107.0	111.0					12																	54856986		2203	4300	6503	SO:0001819	synonymous_variant	121355			AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.213T>C	12.37:g.54856986A>G			B3KQ60|Q0VGM4|Q8N778	Silent	SNP	ENST00000552397.1	37	CCDS8881.1																																																																																				0.403	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1		NM_144594	
GZMK	3003	hgsc.bcm.edu;ucsc.edu	37	5	54326407	54326407	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr5:54326407G>A	ENST00000231009.2	+	3	428	c.358G>A	c.(358-360)Gtt>Att	p.V120I	CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	120	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TATCATGCTGGTTAAGGTAGG	0.348																																																	0													152.0	147.0	149.0					5																	54326407		2203	4300	6503	SO:0001583	missense	3003			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.358G>A	5.37:g.54326407G>A	ENSP00000231009:p.Val120Ile		B2R563	Missense_Mutation	SNP	ENST00000231009.2	37	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	G	9.287	1.049590	0.19827	.	.	ENSG00000113088	ENST00000231009	D	0.88046	-2.33	4.79	-0.282	0.12878	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.355674	0.25978	N	0.027096	T	0.57051	0.2027	N	0.01134	-0.995	0.24628	N	0.993632	B	0.02656	0.0	B	0.10450	0.005	T	0.57027	-0.7881	10	0.02654	T	1	.	7.3771	0.26835	0.6178:0.0:0.3822:0.0	.	120	P49863	GRAK_HUMAN	I	120	ENSP00000231009:V120I	ENSP00000231009:V120I	V	+	1	0	GZMK	54362164	0.979000	0.34478	0.994000	0.49952	0.417000	0.31264	0.305000	0.19254	0.036000	0.15547	0.655000	0.94253	GTT		0.348	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1		NM_002104	
HECW1	23072	hgsc.bcm.edu;ucsc.edu	37	7	43351595	43351595	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr7:43351595C>A	ENST00000395891.2	+	4	866	c.261C>A	c.(259-261)taC>taA	p.Y87*	HECW1_ENST00000453890.1_Nonsense_Mutation_p.Y87*	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	87					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCAGCTCCTACTATTCCATCG	0.607																																																	0													72.0	79.0	77.0					7																	43351595		2116	4243	6359	SO:0001587	stop_gained	23072			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.261C>A	7.37:g.43351595C>A	ENSP00000379228:p.Tyr87*		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Nonsense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	36	5.876188	0.97055	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.87	4.05	0.47172	.	0.307065	0.37577	N	0.002038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	8.0523	0.30585	0.1359:0.7355:0.0:0.1285	.	.	.	.	X	87;87;86	.	ENSP00000265522:Y86X	Y	+	3	2	HECW1	43318120	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.525000	0.45598	1.462000	0.47948	0.655000	0.94253	TAC		0.607	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2		NM_015052	
HTR2A	3356	hgsc.bcm.edu;ucsc.edu	37	13	47409628	47409628	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr13:47409628A>G	ENST00000378688.4	-	3	891	c.760T>C	c.(760-762)Tac>Cac	p.Y254H	HTR2A_ENST00000543956.1_Missense_Mutation_p.Y170H|HTR2A_ENST00000542664.1_Missense_Mutation_p.Y254H			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	254					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTTAGAAAGTAGGTGATCACC	0.443																																																	0													79.0	76.0	77.0					13																	47409628		2203	4300	6503	SO:0001583	missense	3356			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.760T>C	13.37:g.47409628A>G	ENSP00000367959:p.Tyr254His		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	ENST00000378688.4	37	CCDS9405.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121648	0.77436	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.60424	0.19;0.19;0.19	5.67	5.67	0.87782	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84946	0.5585	H	0.98155	4.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.90483	0.4461	10	0.87932	D	0	.	15.3729	0.74581	1.0:0.0:0.0:0.0	.	170;254	F5GWE8;P28223	.;5HT2A_HUMAN	H	254;170;254	ENSP00000367959:Y254H;ENSP00000441861:Y170H;ENSP00000437737:Y254H	ENSP00000367959:Y254H	Y	-	1	0	HTR2A	46307629	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.287000	0.76781	0.482000	0.46254	TAC		0.443	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3		NM_000621	
ILDR2	387597	hgsc.bcm.edu;ucsc.edu	37	1	166891956	166891956	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:166891956G>A	ENST00000271417.3	-	8	1140	c.1085C>T	c.(1084-1086)cCt>cTt	p.P362L	ILDR2_ENST00000526687.1_Missense_Mutation_p.P254L|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.P303L|ILDR2_ENST00000469934.2_Missense_Mutation_p.P362L|ILDR2_ENST00000525740.1_Missense_Mutation_p.P235L|ILDR2_ENST00000529071.1_Missense_Mutation_p.P343L	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	362					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						CCCAGACACAGGGAACTGCTT	0.537																																																	0													166.0	161.0	162.0					1																	166891956		2203	4300	6503	SO:0001583	missense	387597			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1085C>T	1.37:g.166891956G>A	ENSP00000271417:p.Pro362Leu			Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119421	0.77323	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;D;T;T;D;T	0.82893	0.04;-1.66;0.31;0.04;-1.61;-0.57	4.96	3.98	0.46160	.	0.113484	0.64402	D	0.000008	T	0.78830	0.4345	M	0.64997	1.995	0.54753	D	0.999989	D	0.53619	0.961	P	0.47206	0.541	T	0.82374	-0.0489	10	0.66056	D	0.02	.	13.1216	0.59329	0.0:0.1603:0.8397:0.0	.	362	Q71H61	ILDR2_HUMAN	L	362;235;362;343;254;303	ENSP00000271417:P362L;ENSP00000436120:P235L;ENSP00000437008:P362L;ENSP00000436882:P343L;ENSP00000434273:P254L;ENSP00000432750:P303L	ENSP00000271417:P362L	P	-	2	0	ILDR2	165158580	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.259000	0.65485	2.284000	0.76573	0.561000	0.74099	CCT		0.537	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2		NM_199351	
ITGB5	3693	hgsc.bcm.edu;ucsc.edu	37	3	124536468	124536468	+	Splice_Site	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr3:124536468A>G	ENST00000296181.4	-	8	1424	c.1128T>C	c.(1126-1128)aaT>aaC	p.N376N		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	376	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GATGACTTACATTGTATGCAT	0.488																																																	0													86.0	90.0	89.0					3																	124536468		2203	4300	6503	SO:0001630	splice_region_variant	3693			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1128+1T>C	3.37:g.124536468A>G			B0LPF8|B2RD70	Silent	SNP	ENST00000296181.4	37	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	A	2.067	-0.413992	0.04799	.	.	ENSG00000082781	ENST00000481591	.	.	.	5.67	-1.39	0.08997	.	.	.	.	.	T	0.58878	0.2153	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56786	-0.7921	4	.	.	.	.	12.3278	0.55022	0.6148:0.0:0.3852:0.0	.	.	.	.	T	111	.	.	M	-	2	0	ITGB5	126019158	0.199000	0.23386	0.827000	0.32855	0.023000	0.10783	-0.303000	0.08210	-0.162000	0.10964	-1.140000	0.01884	ATG		0.488	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3		NM_002213	Silent
ITIH5	80760	hgsc.bcm.edu;ucsc.edu	37	10	7627983	7627983	+	Missense_Mutation	SNP	C	C	T	rs529878669		TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr10:7627983C>T	ENST00000256861.6	-	8	1067	c.989G>A	c.(988-990)cGt>cAt	p.R330H	ITIH5_ENST00000298441.6_Missense_Mutation_p.R116H|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Missense_Mutation_p.R330H|ITIH5_ENST00000397146.2_Missense_Mutation_p.R330H|ITIH5_ENST00000446830.2_Missense_Mutation_p.R112H	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	330	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R330H(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GATACTGAAACGGTCCTGGGG	0.473																																																	1	Substitution - Missense(1)	large_intestine(1)											148.0	127.0	134.0					10																	7627983		2203	4300	6503	SO:0001583	missense	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.989G>A	10.37:g.7627983C>T	ENSP00000256861:p.Arg330His		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	C	0.568	-0.842188	0.02671	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08	5.3	-4.52	0.03472	von Willebrand factor, type A (3);	0.446927	0.26623	N	0.023357	T	0.72112	0.3420	.	.	.	0.20403	N	0.999908	B;B;B	0.12013	0.005;0.004;0.003	B;B;B	0.15052	0.012;0.003;0.002	T	0.55970	-0.8056	9	0.12103	T	0.63	-5.4197	13.2689	0.60150	0.0:0.2223:0.0:0.7777	.	330;330;116	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	H	330;330;116;112;330	ENSP00000256861:R330H;ENSP00000380333:R330H;ENSP00000298441:R116H;ENSP00000387969:R112H;ENSP00000380332:R330H	ENSP00000256861:R330H	R	-	2	0	ITIH5	7667989	0.017000	0.18338	0.009000	0.14445	0.699000	0.40488	-0.105000	0.10907	-1.191000	0.02695	-0.997000	0.02515	CGT		0.473	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1		NM_030569	
KCTD18	130535	hgsc.bcm.edu;ucsc.edu	37	2	201371733	201371733	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr2:201371733C>G	ENST00000359878.3	-	2	517	c.7G>C	c.(7-9)Ggc>Cgc	p.G3R	KCTD18_ENST00000409157.1_Missense_Mutation_p.G3R|KCTD18_ENST00000468413.1_5'UTR	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	3					protein homooligomerization (GO:0051260)					endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						GCCTTGTGGCCTTCCATTTCT	0.507																																																	0													90.0	99.0	96.0					2																	201371733		2203	4300	6503	SO:0001583	missense	130535			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.7G>C	2.37:g.201371733C>G	ENSP00000352941:p.Gly3Arg		Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	ENST00000359878.3	37	CCDS2330.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.398072	0.62177	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	T;T	0.35973	1.28;1.28	5.46	4.59	0.56863	.	0.511109	0.19720	N	0.107614	T	0.32071	0.0817	N	0.22421	0.69	0.34449	D	0.700434	B;P	0.43477	0.126;0.808	B;P	0.45037	0.05;0.467	T	0.50923	-0.8770	10	0.72032	D	0.01	-5.6258	13.8153	0.63287	0.0:0.9266:0.0:0.0734	.	3;3	Q6PI47-2;Q6PI47	.;KCD18_HUMAN	R	3	ENSP00000352941:G3R;ENSP00000386751:G3R	ENSP00000352941:G3R	G	-	1	0	KCTD18	201079978	0.901000	0.30685	0.990000	0.47175	0.904000	0.53231	1.787000	0.38704	1.544000	0.49359	0.655000	0.94253	GGC		0.507	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256188.1		NM_152387	
KIF20B	9585	hgsc.bcm.edu;ucsc.edu	37	10	91497621	91497621	+	Missense_Mutation	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr10:91497621A>G	ENST00000371728.3	+	20	3088	c.3023A>G	c.(3022-3024)aAt>aGt	p.N1008S	KIF20B_ENST00000394289.2_Missense_Mutation_p.N1008S|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Missense_Mutation_p.N1038S|KIF20B_ENST00000260753.4_Missense_Mutation_p.N968S	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1008					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GATTTGCTCAATCTCAGGGAT	0.318																																																	0													60.0	64.0	63.0					10																	91497621		2203	4299	6502	SO:0001583	missense	9585			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3023A>G	10.37:g.91497621A>G	ENSP00000360793:p.Asn1008Ser		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	1.288	-0.608536	0.03717	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.69040	-0.29;-0.32;-0.37;-0.31	5.69	-0.949	0.10376	.	0.458672	0.20462	N	0.091875	T	0.53562	0.1804	L	0.53249	1.67	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.40646	-0.9552	10	0.28530	T	0.3	-1.644	7.5967	0.28052	0.5218:0.0:0.3746:0.1036	.	1008;968	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	S	968;1038;1008;1008	ENSP00000260753:N968S;ENSP00000411545:N1038S;ENSP00000377830:N1008S;ENSP00000360793:N1008S	ENSP00000260753:N968S	N	+	2	0	KIF20B	91487601	0.000000	0.05858	0.187000	0.23214	0.251000	0.25915	0.111000	0.15458	0.039000	0.15632	-1.039000	0.02377	AAT		0.318	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1		NM_016195	
LINS	55180	hgsc.bcm.edu;ucsc.edu	37	15	101110153	101110153	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr15:101110153C>G	ENST00000314742.8	-	7	1786	c.1564G>C	c.(1564-1566)Gaa>Caa	p.E522Q	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	522										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						ACAAAATATTCAAGAAAACAG	0.284																																																	0													27.0	28.0	28.0					15																	101110153		2199	4299	6498	SO:0001583	missense	55180			AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1564G>C	15.37:g.101110153C>G	ENSP00000318423:p.Glu522Gln		Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506303	0.85282	.	.	ENSG00000140471	ENST00000314742	T	0.19669	2.13	5.56	5.56	0.83823	.	0.112655	0.56097	D	0.000026	T	0.47322	0.1439	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.41822	-0.9487	10	0.87932	D	0	-26.5827	19.534	0.95242	0.0:1.0:0.0:0.0	.	522	Q8NG48	LINES_HUMAN	Q	522	ENSP00000318423:E522Q	ENSP00000318423:E522Q	E	-	1	0	LINS	98927676	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.227000	0.72282	2.613000	0.88420	0.655000	0.94253	GAA		0.284	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1		NM_018148	
LSM14B	149986	hgsc.bcm.edu;ucsc.edu	37	20	60708449	60708449	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr20:60708449G>A	ENST00000279068.6	+	8	1250	c.1090G>A	c.(1090-1092)Gga>Aga	p.G364R	LSM14B_ENST00000253001.4_Missense_Mutation_p.G364R	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	364					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CGGATTCCGAGGAGGCAGGGG	0.637																																																	0													75.0	89.0	84.0					20																	60708449		2024	4162	6186	SO:0001583	missense	149986			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.1090G>A	20.37:g.60708449G>A	ENSP00000279068:p.Gly364Arg		Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	37	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551755	0.65311	.	.	ENSG00000149657	ENST00000279068;ENST00000253001	T;T	0.59906	0.26;0.23	4.7	4.7	0.59300	.	0.000000	0.64402	D	0.000001	T	0.62097	0.2400	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.61277	-0.7095	10	0.32370	T	0.25	.	16.0166	0.80443	0.0:0.0:1.0:0.0	.	284;364;364	E9PG81;Q9BX40;Q9BX40-2	.;LS14B_HUMAN;.	R	364	ENSP00000279068:G364R;ENSP00000253001:G364R	ENSP00000253001:G364R	G	+	1	0	LSM14B	60141844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.304000	0.59104	2.437000	0.82529	0.655000	0.94253	GGA		0.637	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4		NM_144703	
LY86	9450	hgsc.bcm.edu;ucsc.edu	37	6	6591390	6591390	+	Intron	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:6591390C>A	ENST00000379953.2	+	2	488				LY86-AS1_ENST00000429345.1_RNA|LY86_ENST00000230568.4_Intron|LY86-AS1_ENST00000435641.1_RNA			O95711	LY86_HUMAN	lymphocyte antigen 86						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				large_intestine(2)|lung(6)	8	Ovarian(93;0.0377)					CAGACTCACCCTCTGCCTGCA	0.512																																																	0													54.0	48.0	50.0					6																	6591390		692	1591	2283	SO:0001627	intron_variant	285780			AF057178	CCDS4498.1	6p24.3	2010-07-08			ENSG00000112799	ENSG00000112799			16837	protein-coding gene	gene with protein product		605241				9763566	Standard	NM_004271		Approved	MD-1, dJ80N2.1	uc003mwy.1	O95711	OTTHUMG00000014190	ENST00000379953.2:c.136+2287C>A	6.37:g.6591390C>A			Q9UQC4	RNA	SNP	ENST00000379953.2	37	CCDS4498.1																																																																																				0.512	LY86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039762.2			
LYST	1130	hgsc.bcm.edu;ucsc.edu	37	1	235884146	235884146	+	Silent	SNP	A	A	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:235884146A>G	ENST00000389794.3	-	40	9549	c.9375T>C	c.(9373-9375)taT>taC	p.Y3125Y	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Silent_p.Y3125Y			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3125	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGATGTTACCATATTCCAGAA	0.348																																																	0													130.0	128.0	128.0					1																	235884146		2203	4300	6503	SO:0001819	synonymous_variant	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9375T>C	1.37:g.235884146A>G			O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																				0.348	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5			
MED12L	116931	hgsc.bcm.edu;ucsc.edu	37	3	150845653	150845653	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr3:150845653A>T	ENST00000474524.1	+	4	476	c.438A>T	c.(436-438)ttA>ttT	p.L146F	MED12L_ENST00000273432.4_Missense_Mutation_p.L146F|MED12L_ENST00000422248.2_Missense_Mutation_p.L146F|MED12L_ENST00000309237.4_Missense_Mutation_p.L146F	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	146						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGCATATTTAGCTAAATATT	0.333																																																	0													95.0	91.0	93.0					3																	150845653		2203	4300	6503	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.438A>T	3.37:g.150845653A>T	ENSP00000417235:p.Leu146Phe		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739368	0.69304	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.71461	-0.33;-0.34;-0.39;-0.57	5.54	4.36	0.52297	Mediator complex, subunit Med12 (1);	0.087235	0.45606	D	0.000351	D	0.82342	0.5016	M	0.78049	2.395	0.27407	N	0.954689	D;D;D;P	0.76494	0.999;0.999;0.999;0.946	D;D;D;P	0.87578	0.996;0.998;0.996;0.624	T	0.75833	-0.3178	10	0.87932	D	0	-4.9324	10.1375	0.42715	0.9226:0.0:0.0774:0.0	.	146;146;146;146	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	F	146	ENSP00000403308:L146F;ENSP00000310760:L146F;ENSP00000417235:L146F;ENSP00000273432:L146F	ENSP00000273432:L146F	L	+	3	2	MED12L	152328343	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	1.889000	0.39718	0.891000	0.36235	0.529000	0.55759	TTA		0.333	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2		NM_053002	
MED18	54797	hgsc.bcm.edu;ucsc.edu	37	1	28660959	28660959	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:28660959C>T	ENST00000373842.4	+	3	314	c.105C>T	c.(103-105)ctC>ctT	p.L35L	MED18_ENST00000479574.1_3'UTR|MED18_ENST00000398997.2_Silent_p.L35L	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	35						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		TGGAAAGCCTCATCCACCGCC	0.448																																																	0													183.0	174.0	177.0					1																	28660959		2203	4300	6503	SO:0001819	synonymous_variant	54797			BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.105C>T	1.37:g.28660959C>T			D3DPM1|Q9NXU9	Silent	SNP	ENST00000373842.4	37	CCDS322.1																																																																																				0.448	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009856.1		NM_017638	
KMT2A	4297	hgsc.bcm.edu;ucsc.edu	37	11	118375051	118375051	+	Missense_Mutation	SNP	C	C	A	rs545159100		TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr11:118375051C>A	ENST00000389506.5	+	27	8435	c.8435C>A	c.(8434-8436)aCa>aAa	p.T2812K	KMT2A_ENST00000354520.4_Missense_Mutation_p.T2774K|KMT2A_ENST00000534358.1_Missense_Mutation_p.T2815K			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2812					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGAGTCCACACAAGTACCCCC	0.443																																																	0													88.0	92.0	91.0					11																	118375051		2200	4296	6496	SO:0001583	missense	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8435C>A	11.37:g.118375051C>A	ENSP00000374157:p.Thr2812Lys		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318772	0.23994	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82081	-1.57;-1.57;-1.54	6.17	6.17	0.99709	.	0.093009	0.52532	D	0.000068	T	0.74596	0.3737	N	0.22421	0.69	0.38082	D	0.936693	B;B	0.32245	0.361;0.361	B;B	0.24541	0.054;0.054	T	0.76179	-0.3054	10	0.72032	D	0.01	.	19.0599	0.93085	0.0:1.0:0.0:0.0	.	2815;2812	E9PQG7;Q03164	.;MLL1_HUMAN	K	2815;2812;2774;1722	ENSP00000436786:T2815K;ENSP00000374157:T2812K;ENSP00000346516:T2774K	ENSP00000346516:T2774K	T	+	2	0	MLL	117880261	0.998000	0.40836	1.000000	0.80357	0.891000	0.51852	3.365000	0.52335	2.941000	0.99782	0.655000	0.94253	ACA		0.443	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2		NM_005933	
MPP5	64398	hgsc.bcm.edu;ucsc.edu	37	14	67746078	67746078	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr14:67746078delA	ENST00000261681.4	+	3	852	c.191delA	c.(190-192)gagfs	p.E64fs	MPP5_ENST00000555925.1_Frame_Shift_Del_p.E30fs|MPP5_ENST00000556345.1_Frame_Shift_Del_p.E64fs	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	64	Interaction with PARD6B. {ECO:0000250}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		CAACAACAGGAGGACATGAGG	0.488																																																	0													131.0	118.0	122.0					14																	67746078		2203	4300	6503	SO:0001589	frameshift_variant	64398			AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.191delA	14.37:g.67746078delA	ENSP00000261681:p.Glu64fs		A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Frame_Shift_Del	DEL	ENST00000261681.4	37	CCDS9779.1																																																																																				0.488	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412498.1		NM_022474	
MYH2	4620	hgsc.bcm.edu;ucsc.edu	37	17	10435069	10435069	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:10435069C>A	ENST00000245503.5	-	22	2962	c.2578G>T	c.(2578-2580)Gaa>Taa	p.E860*	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Nonsense_Mutation_p.E860*	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	860					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TGAAATTCTTCCTTCATGGTG	0.418																																																	0													131.0	127.0	128.0					17																	10435069		2203	4300	6503	SO:0001587	stop_gained	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2578G>T	17.37:g.10435069C>A	ENSP00000245503:p.Glu860*		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Nonsense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	43	10.155831	0.99349	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	.	.	.	4.71	4.71	0.59529	.	0.182884	0.25753	U	0.028531	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	17.8356	0.88696	0.0:1.0:0.0:0.0	.	.	.	.	X	860	.	ENSP00000245503:E860X	E	-	1	0	MYH2	10375794	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.617000	0.46385	2.447000	0.82792	0.561000	0.74099	GAA		0.418	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3		NM_017534	
NAA20	51126	hgsc.bcm.edu;ucsc.edu	37	20	20006327	20006327	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr20:20006327A>C	ENST00000334982.4	+	3	366	c.85A>C	c.(85-87)Att>Ctt	p.I29L	NAA20_ENST00000398602.2_Missense_Mutation_p.I17L|NAA20_ENST00000310450.4_Missense_Mutation_p.I29L|NAA20_ENST00000484480.1_3'UTR	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	29	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						CTAGTATGGGATTCCTTTCTA	0.368																																																	0													135.0	135.0	135.0					20																	20006327		2203	4300	6503	SO:0001583	missense	51126			AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.85A>C	20.37:g.20006327A>C	ENSP00000335636:p.Ile29Leu		A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Missense_Mutation	SNP	ENST00000334982.4	37	CCDS13141.1	.	.	.	.	.	.	.	.	.	.	A	7.657	0.684054	0.14907	.	.	ENSG00000173418	ENST00000334982;ENST00000310450;ENST00000398602	T;T;T	0.62232	0.63;0.7;0.04	4.76	4.76	0.60689	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.28267	0.0698	N	0.00630	-1.315	0.58432	D	0.999999	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.25779	-1.0122	9	.	.	.	-14.3605	13.3899	0.60818	1.0:0.0:0.0:0.0	.	17;29;29	A8MZB2;A6NHA3;P61599	.;.;NAA20_HUMAN	L	29;29;17	ENSP00000335636:I29L;ENSP00000311027:I29L;ENSP00000381603:I17L	.	I	+	1	0	NAA20	19954327	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.019000	0.93662	1.993000	0.58246	0.533000	0.62120	ATT		0.368	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078217.2		NM_016100	
NAP1L2	4674	hgsc.bcm.edu;ucsc.edu	37	X	72432980	72432980	+	Missense_Mutation	SNP	T	T	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chrX:72432980T>G	ENST00000373517.3	-	1	1704	c.1349A>C	c.(1348-1350)aAc>aCc	p.N450T	NAP1L2_ENST00000536638.1_Missense_Mutation_p.N308T	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	450					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					TGCCTCAAGGTTTTTGCAACA	0.368																																																	0													63.0	52.0	56.0					X																	72432980		2203	4300	6503	SO:0001583	missense	4674			AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.1349A>C	X.37:g.72432980T>G	ENSP00000362616:p.Asn450Thr		B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	ENST00000373517.3	37	CCDS14423.1	.	.	.	.	.	.	.	.	.	.	t	15.02	2.709948	0.48517	.	.	ENSG00000186462	ENST00000373517;ENST00000536638	T;T	0.37411	1.39;1.2	3.03	3.03	0.35002	.	0.118616	0.53938	U	0.000044	T	0.26122	0.0637	N	0.08118	0	0.29450	N	0.858545	D	0.61697	0.99	P	0.51701	0.677	T	0.08432	-1.0722	10	0.87932	D	0	-19.7897	8.7734	0.34747	0.0:0.0:0.0:1.0	.	450	Q9ULW6	NP1L2_HUMAN	T	450;308	ENSP00000362616:N450T;ENSP00000441555:N308T	ENSP00000362616:N450T	N	-	2	0	NAP1L2	72349705	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.416000	0.52707	1.416000	0.47057	0.417000	0.27973	AAC		0.368	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1		NM_021963	
NCAPG2	54892	hgsc.bcm.edu;ucsc.edu	37	7	158457439	158457439	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr7:158457439delA	ENST00000409423.1	-	15	1655	c.1483delT	c.(1483-1485)tggfs	p.W495fs	NCAPG2_ENST00000275830.10_Frame_Shift_Del_p.W287fs|NCAPG2_ENST00000409339.3_Frame_Shift_Del_p.W495fs|NCAPG2_ENST00000356309.3_Frame_Shift_Del_p.W495fs|NCAPG2_ENST00000541468.1_5'UTR|NCAPG2_ENST00000449727.2_Frame_Shift_Del_p.W495fs	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	495					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CATATTTTCCAAAACTGTGCA	0.428																																																	0													40.0	41.0	41.0					7																	158457439		1933	4145	6078	SO:0001589	frameshift_variant	54892			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.1483delT	7.37:g.158457439delA	ENSP00000386569:p.Trp495fs		A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Frame_Shift_Del	DEL	ENST00000409423.1	37	CCDS43686.1																																																																																				0.428	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1		NM_017760	
NDC80	10403	hgsc.bcm.edu;ucsc.edu	37	18	2608738	2608738	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr18:2608738G>C	ENST00000261597.4	+	15	1779	c.1597G>C	c.(1597-1599)Gag>Cag	p.E533Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	533	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						CAGTGAGCTTGAGTCCTTGGA	0.428																																																	0													118.0	110.0	113.0					18																	2608738		2203	4300	6503	SO:0001583	missense	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1597G>C	18.37:g.2608738G>C	ENSP00000261597:p.Glu533Gln		Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657567	0.47467	.	.	ENSG00000080986	ENST00000261597	T	0.51574	0.7	5.53	5.53	0.82687	.	0.092869	0.64402	D	0.000001	T	0.43986	0.1272	L	0.59436	1.845	0.46774	D	0.999192	P	0.42785	0.79	B	0.37650	0.255	T	0.43491	-0.9388	10	0.42905	T	0.14	-8.0368	13.3812	0.60768	0.0762:0.0:0.9238:0.0	.	533	O14777	NDC80_HUMAN	Q	533	ENSP00000261597:E533Q	ENSP00000261597:E533Q	E	+	1	0	NDC80	2598738	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	3.632000	0.54287	2.600000	0.87896	0.491000	0.48974	GAG		0.428	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1		NM_006101	
NT5M	56953	hgsc.bcm.edu;ucsc.edu	37	17	17248196	17248196	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:17248196T>C	ENST00000389022.4	+	4	734	c.518T>C	c.(517-519)cTc>cCc	p.L173P	NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	173					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						GCTGACCTTCTCATAGACGAC	0.607																																																	0													142.0	118.0	126.0					17																	17248196		2203	4300	6503	SO:0001583	missense	56953			AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.518T>C	17.37:g.17248196T>C	ENSP00000373674:p.Leu173Pro			Missense_Mutation	SNP	ENST00000389022.4	37	CCDS32581.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.867568	0.91587	.	.	ENSG00000205309	ENST00000446264;ENST00000389022	T	0.55588	0.51	5.78	5.78	0.91487	HAD-like domain (2);	0.117593	0.64402	D	0.000014	T	0.77644	0.4161	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.82705	-0.0325	10	0.87932	D	0	-42.8199	14.943	0.71009	0.0:0.0:0.0:1.0	.	173;173;173	Q2I378;Q9NPB1;F6S3X3	.;NT5M_HUMAN;.	P	173	ENSP00000373674:L173P	ENSP00000373674:L173P	L	+	2	0	NT5M	17188921	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.946000	0.75953	2.194000	0.70268	0.533000	0.62120	CTC		0.607	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1			
OR5B12	390191	hgsc.bcm.edu;ucsc.edu	37	11	58207098	58207098	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr11:58207098A>T	ENST00000302572.2	-	1	548	c.527T>A	c.(526-528)tTc>tAc	p.F176Y		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGCATCACAGAAAAAGTGTTC	0.423																																																	0													104.0	95.0	98.0					11																	58207098		2201	4295	6496	SO:0001583	missense	390191			AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.527T>A	11.37:g.58207098A>T	ENSP00000306657:p.Phe176Tyr		B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.467313	0.43839	.	.	ENSG00000172362	ENST00000302572	T	0.00249	8.44	4.3	3.12	0.35913	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000065	T	0.00384	0.0012	M	0.66506	2.035	0.25192	N	0.990123	D	0.69078	0.997	D	0.66196	0.942	T	0.51458	-0.8703	10	0.30854	T	0.27	-21.3611	8.8739	0.35334	0.704:0.0:0.0:0.296	.	176	Q96R08	OR5BC_HUMAN	Y	176	ENSP00000306657:F176Y	ENSP00000306657:F176Y	F	-	2	0	OR5B12	57963674	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	2.672000	0.46850	0.750000	0.32877	0.379000	0.24179	TTC		0.423	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1		NM_001004733	
OR7G3	390883	hgsc.bcm.edu;ucsc.edu	37	19	9236856	9236856	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr19:9236856C>T	ENST00000305444.2	-	1	770	c.771G>A	c.(769-771)ggG>ggA	p.G257G		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						TAAGGTACACCCCAAACCCTG	0.463																																																	0													94.0	89.0	91.0					19																	9236856		2203	4300	6503	SO:0001819	synonymous_variant	390883				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.771G>A	19.37:g.9236856C>T			Q6IFJ6|Q96R99	Silent	SNP	ENST00000305444.2	37	CCDS32899.1																																																																																				0.463	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1			
PIK3R6	146850	hgsc.bcm.edu;ucsc.edu	37	17	8730539	8730539	+	Missense_Mutation	SNP	G	G	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:8730539G>T	ENST00000311434.9	-	13	1704	c.1465C>A	c.(1465-1467)Cag>Aag	p.Q489K	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	489					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										ACGTTGCTCTGGTACCACGGG	0.662																																																	0													35.0	41.0	39.0					17																	8730539		2105	4227	6332	SO:0001583	missense	146850			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1465C>A	17.37:g.8730539G>T	ENSP00000475670:p.Gln489Lys		Q658R3	Missense_Mutation	SNP	ENST00000311434.9	37																																																																																					0.662	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			NM_001010855	
PKHD1	5314	hgsc.bcm.edu;ucsc.edu	37	6	51609213	51609213	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:51609213C>A	ENST00000371117.3	-	60	10401	c.10126G>T	c.(10126-10128)Gca>Tca	p.A3376S	PKHD1_ENST00000340994.4_Missense_Mutation_p.A3376S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3376					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTCCATTCTGCCTCTGTTTTA	0.473																																																	0													147.0	144.0	145.0					6																	51609213		2203	4300	6503	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10126G>T	6.37:g.51609213C>A	ENSP00000360158:p.Ala3376Ser		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347999	0.24426	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86956	-1.98;-2.19	5.21	4.21	0.49690	.	0.361008	0.26467	N	0.024214	T	0.60779	0.2295	N	0.13043	0.29	0.22835	N	0.998674	B;B;B	0.13594	0.005;0.008;0.005	B;B;B	0.13407	0.004;0.009;0.006	T	0.45086	-0.9285	10	0.24483	T	0.36	.	10.582	0.45261	0.368:0.632:0.0:0.0	.	3376;3376;3376	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	S	3376	ENSP00000360158:A3376S;ENSP00000341097:A3376S	ENSP00000341097:A3376S	A	-	1	0	PKHD1	51717172	0.025000	0.19082	0.896000	0.35187	0.748000	0.42578	2.689000	0.46993	2.615000	0.88500	0.650000	0.86243	GCA		0.473	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1		NM_138694	
PLCE1	51196	hgsc.bcm.edu;ucsc.edu	37	10	95791806	95791806	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr10:95791806G>T	ENST00000371380.3	+	1	1238	c.1003G>T	c.(1003-1005)Gaa>Taa	p.E335*	PLCE1_ENST00000260766.3_Nonsense_Mutation_p.E335*			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	335					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AAATGACAGAGAAGTTAAGAA	0.408																																																	0													87.0	87.0	87.0					10																	95791806		1864	4103	5967	SO:0001587	stop_gained	51196				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1003G>T	10.37:g.95791806G>T	ENSP00000360431:p.Glu335*		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Nonsense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	44	11.274072	0.99539	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	.	.	.	5.28	4.38	0.52667	.	0.091756	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	11.235	0.48936	0.1468:0.0:0.8532:0.0	.	.	.	.	X	335	.	ENSP00000260766:E335X	E	+	1	0	PLCE1	95781796	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	3.823000	0.55715	1.241000	0.43820	-0.137000	0.14449	GAA		0.408	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3		NM_016341	
PLG	5340	hgsc.bcm.edu;ucsc.edu	37	6	161134106	161134106	+	Missense_Mutation	SNP	A	A	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:161134106A>T	ENST00000308192.9	+	5	559	c.496A>T	c.(496-498)Act>Tct	p.T166S	PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	166	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTGGTGCTATACTACTGATCC	0.493																																																	0													146.0	143.0	144.0					6																	161134106		2203	4300	6503	SO:0001583	missense	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.496A>T	6.37:g.161134106A>T	ENSP00000308938:p.Thr166Ser		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814674	0.70912	.	.	ENSG00000122194	ENST00000308192	T	0.70516	-0.49	5.11	5.11	0.69529	Kringle (4);Kringle-like fold (1);	0.000000	0.40385	U	0.001104	D	0.86863	0.6035	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91005	0.4845	10	0.87932	D	0	.	14.1696	0.65500	1.0:0.0:0.0:0.0	.	166	P00747	PLMN_HUMAN	S	166	ENSP00000308938:T166S	ENSP00000308938:T166S	T	+	1	0	PLG	161054096	1.000000	0.71417	0.919000	0.36401	0.137000	0.21094	8.584000	0.90798	2.054000	0.61138	0.528000	0.53228	ACT		0.493	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2		NM_000301	
POLR1A	25885	hgsc.bcm.edu;ucsc.edu	37	2	86292438	86292438	+	Missense_Mutation	SNP	G	G	C	rs191928354	byFrequency	TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr2:86292438G>C	ENST00000263857.6	-	14	2395	c.2017C>G	c.(2017-2019)Cct>Gct	p.P673A	POLR1A_ENST00000483538.1_5'UTR|POLR1A_ENST00000409681.1_Missense_Mutation_p.P673A			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	673					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						AGGATGGAAGGAGAAAGGAGC	0.502													G|||	4	0.000798722	0.003	0.0	5008	,	,		18673	0.0		0.0	False		,,,				2504	0.0																0								G	ALA/PRO	15,3881		0,15,1933	125.0	127.0	126.0		2017	6.0	1.0	2		126	1,8299		0,1,4149	yes	missense	POLR1A	NM_015425.3	27	0,16,6082	CC,CG,GG		0.012,0.385,0.1312	probably-damaging	673/1721	86292438	16,12180	1948	4150	6098	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2017C>G	2.37:g.86292438G>C	ENSP00000263857:p.Pro673Ala		B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	21.3	4.125330	0.77436	0.00385	1.2E-4	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.79653	-1.29;-1.29	5.97	5.97	0.96955	RNA polymerase Rpb1, domain 3 (1);	0.000000	0.85682	D	0.000000	D	0.92388	0.7584	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94169	0.7421	10	0.87932	D	0	-14.333	20.0343	0.97551	0.0:0.0:1.0:0.0	.	673	O95602	RPA1_HUMAN	A	673	ENSP00000263857:P673A;ENSP00000386300:P673A	ENSP00000263857:P673A	P	-	1	0	POLR1A	86145949	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.476000	0.97823	2.828000	0.97474	0.655000	0.94253	CCT		0.502	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2		NM_015425	
PSMD4	5710	hgsc.bcm.edu;ucsc.edu	37	1	151236485	151236485	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:151236485C>T	ENST00000368884.3	+	3	343	c.263C>T	c.(262-264)aCg>aTg	p.T88M	PSMD4_ENST00000368881.4_Missense_Mutation_p.T88M|PSMD4_ENST00000469786.2_3'UTR	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	88	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACCTTCTGCACGGGCATCCGC	0.572																																																	0													103.0	74.0	84.0					1																	151236485		2203	4300	6503	SO:0001583	missense	5710			U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.263C>T	1.37:g.151236485C>T	ENSP00000357879:p.Thr88Met		D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	ENST00000368884.3	37	CCDS991.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.366026	0.61513	.	.	ENSG00000159352	ENST00000368884;ENST00000368881;ENST00000437736	T;T;T	0.22336	1.96;1.96;1.96	5.27	4.33	0.51752	Ssl1-like (1);von Willebrand factor, type A (2);	0.000000	0.64402	D	0.000001	T	0.21718	0.0523	M	0.86502	2.82	0.54753	D	0.999987	P;B	0.39003	0.654;0.426	B;B	0.39068	0.149;0.289	T	0.06625	-1.0816	10	0.62326	D	0.03	-22.1375	12.4513	0.55679	0.0:0.9196:0.0:0.0804	.	88;88	Q5VWC4;P55036	.;PSMD4_HUMAN	M	88;88;73	ENSP00000357879:T88M;ENSP00000357876:T88M;ENSP00000414499:T73M	ENSP00000357876:T88M	T	+	2	0	PSMD4	149503109	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.598000	0.67585	2.750000	0.94351	0.563000	0.77884	ACG		0.572	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3		NM_002810	
REPS2	9185	hgsc.bcm.edu;ucsc.edu	37	X	17092279	17092279	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chrX:17092279C>G	ENST00000357277.3	+	12	1547	c.1376C>G	c.(1375-1377)tCc>tGc	p.S459C	REPS2_ENST00000303843.7_Missense_Mutation_p.S458C|REPS2_ENST00000380064.4_Intron	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	459					epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					AGACCAAGATCCAGGTAGTGT	0.418																																																	0													220.0	178.0	193.0					X																	17092279		2203	4300	6503	SO:0001583	missense	9185			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1376C>G	X.37:g.17092279C>G	ENSP00000349824:p.Ser459Cys		A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	CCDS14180.2	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594483	0.66219	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843	T;T	0.34667	1.36;1.35	5.39	4.52	0.55395	.	0.297498	0.29473	N	0.012056	T	0.57519	0.2059	M	0.70595	2.14	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.68039	0.955;0.817	T	0.60647	-0.7222	10	0.59425	D	0.04	-3.5166	14.3183	0.66468	0.1498:0.8502:0.0:0.0	.	458;459	Q8NFH8-4;Q8NFH8	.;REPS2_HUMAN	C	459;459;458	ENSP00000349824:S459C;ENSP00000306033:S458C	ENSP00000306033:S458C	S	+	2	0	REPS2	17002200	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.785000	0.62418	1.025000	0.39708	-0.237000	0.12165	TCC		0.418	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316778.1		NM_004726	
RLIM	51132	hgsc.bcm.edu;ucsc.edu	37	X	73812508	73812508	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chrX:73812508C>G	ENST00000332687.6	-	4	860	c.642G>C	c.(640-642)agG>agC	p.R214S	RLIM_ENST00000349225.2_Missense_Mutation_p.R214S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	214					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGTCTGGGCTCCTGCTTCTTG	0.478																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)												0													158.0	130.0	140.0					X																	73812508		2203	4300	6503	SO:0001583	missense	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.642G>C	X.37:g.73812508C>G	ENSP00000328059:p.Arg214Ser		B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796282	0.50208	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.10668	2.85;2.85	6.05	3.21	0.36854	.	0.101919	0.64402	D	0.000008	T	0.10809	0.0264	L	0.39898	1.24	0.52099	D	0.999942	D	0.53151	0.958	P	0.45343	0.477	T	0.07328	-1.0778	10	0.44086	T	0.13	-3.5251	8.7377	0.34539	0.0:0.6824:0.0:0.3176	.	214	Q9NVW2	RNF12_HUMAN	S	214	ENSP00000328059:R214S;ENSP00000253571:R214S	ENSP00000328059:R214S	R	-	3	2	RLIM	73729233	0.992000	0.36948	1.000000	0.80357	0.966000	0.64601	0.237000	0.17985	0.610000	0.30035	0.594000	0.82650	AGG		0.478	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1		NM_016120	
RLTPR	146206	hgsc.bcm.edu	37	16	67680181	67680181	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr16:67680181C>T	ENST00000334583.6	+	5	670	c.342C>T	c.(340-342)gcC>gcT	p.A114A	RLTPR_ENST00000545661.1_Silent_p.A114A	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	114					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGGCTGCAGCCATCAAGAAGG	0.627																																																	0													56.0	64.0	61.0					16																	67680181		2092	4227	6319	SO:0001819	synonymous_variant	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.342C>T	16.37:g.67680181C>T			B8X2Z3	Silent	SNP	ENST00000334583.6	37	CCDS45513.1																																																																																				0.627	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1		NM_001013838	
SFRP4	6424	hgsc.bcm.edu;ucsc.edu	37	7	37953984	37953984	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr7:37953984G>C	ENST00000436072.2	-	2	894	c.517C>G	c.(517-519)Cta>Gta	p.L173V	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	173					brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						CCGGGGCTTAGGCGTTTACAG	0.463																																																	0													178.0	157.0	164.0					7																	37953984		2203	4300	6503	SO:0001583	missense	6424			AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.517C>G	7.37:g.37953984G>C	ENSP00000410715:p.Leu173Val		B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Missense_Mutation	SNP	ENST00000436072.2	37	CCDS5453.1	.	.	.	.	.	.	.	.	.	.	G	3.772	-0.047334	0.07407	.	.	ENSG00000106483	ENST00000436072;ENST00000446575;ENST00000447200	T;T	0.64085	-0.08;0.87	5.66	3.83	0.44106	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.449411	0.26590	N	0.023539	T	0.39279	0.1072	N	0.22421	0.69	0.25971	N	0.982505	B	0.24132	0.098	B	0.14023	0.01	T	0.15838	-1.0423	10	0.17369	T	0.5	.	4.4128	0.11441	0.2337:0.0:0.6045:0.1618	.	173	Q6FHJ7	SFRP4_HUMAN	V	173;170;39	ENSP00000410715:L173V;ENSP00000402262:L39V	ENSP00000410715:L173V	L	-	1	2	SFRP4	37920509	0.998000	0.40836	1.000000	0.80357	0.908000	0.53690	1.518000	0.35877	0.712000	0.32039	0.655000	0.94253	CTA		0.463	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220017.2		NM_003014	
SPEN	23013	hgsc.bcm.edu;ucsc.edu	37	1	16254657	16254658	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:16254657_16254658delCT	ENST00000375759.3	+	11	2126_2127	c.1922_1923delCT	c.(1921-1923)actfs	p.T641fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	641	Arg-rich.|Tyr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACTCCAGGCACTTATCCTGAGG	0.431																																																	0																																										SO:0001589	frameshift_variant	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1922_1923delCT	1.37:g.16254657_16254658delCT	ENSP00000364912:p.Thr641fs		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	ENST00000375759.3	37	CCDS164.1																																																																																				0.431	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SPEN	23013	hgsc.bcm.edu;ucsc.edu	37	1	16255323	16255323	+	Missense_Mutation	SNP	A	A	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:16255323A>C	ENST00000375759.3	+	11	2792	c.2588A>C	c.(2587-2589)gAc>gCc	p.D863A		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	863					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAGAAAGCTGACAAAGAGGGA	0.478																																																	0													87.0	91.0	90.0					1																	16255323		2203	4300	6503	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2588A>C	1.37:g.16255323A>C	ENSP00000364912:p.Asp863Ala		Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.207760	0.58343	.	.	ENSG00000065526	ENST00000375759	T	0.11604	2.76	5.01	5.01	0.66863	.	.	.	.	.	T	0.29652	0.0740	M	0.62723	1.935	0.52501	D	0.99995	D	0.89917	1.0	D	0.80764	0.994	T	0.01051	-1.1468	9	0.42905	T	0.14	-25.0369	14.8956	0.70642	1.0:0.0:0.0:0.0	.	863	Q96T58	MINT_HUMAN	A	863	ENSP00000364912:D863A	ENSP00000364912:D863A	D	+	2	0	SPEN	16127910	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.449000	0.73473	2.098000	0.63641	0.533000	0.62120	GAC		0.478	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1		NM_015001	
SNRNP40	9410	hgsc.bcm.edu;ucsc.edu	37	1	31766074	31766074	+	Missense_Mutation	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:31766074C>T	ENST00000263694.4	-	2	281	c.263G>A	c.(262-264)cGa>cAa	p.R88Q	SNRNP40_ENST00000446633.2_Missense_Mutation_p.R88Q	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	88					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						ACATATCAGTCGGTCAAATCC	0.438																																																	0													85.0	75.0	79.0					1																	31766074		2203	4300	6503	SO:0001583	missense	9410			AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.263G>A	1.37:g.31766074C>T	ENSP00000263694:p.Arg88Gln		B4DQJ1|O75938|O95320	Missense_Mutation	SNP	ENST00000263694.4	37	CCDS340.1	.	.	.	.	.	.	.	.	.	.	C	35	5.413911	0.96072	.	.	ENSG00000060688	ENST00000263694;ENST00000446633	T;T	0.61510	0.1;0.1	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	L	0.60904	1.88	0.80722	D	1	P;P	0.51240	0.943;0.943	P;P	0.56127	0.792;0.63	T	0.67181	-0.5735	10	0.42905	T	0.14	.	20.051	0.97627	0.0:1.0:0.0:0.0	.	88;88	B4DQJ1;Q96DI7	.;SNR40_HUMAN	Q	88	ENSP00000263694:R88Q;ENSP00000406841:R88Q	ENSP00000263694:R88Q	R	-	2	0	SNRNP40	31538661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.751000	0.85126	2.740000	0.93945	0.650000	0.86243	CGA		0.438	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010657.1		NM_004814	
STK31	56164	hgsc.bcm.edu;ucsc.edu	37	7	23827642	23827642	+	Missense_Mutation	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr7:23827642C>G	ENST00000355870.3	+	21	2650	c.2531C>G	c.(2530-2532)aCa>aGa	p.T844R	STK31_ENST00000428484.1_Missense_Mutation_p.T821R|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.T844R|STK31_ENST00000354639.3_Missense_Mutation_p.T821R	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	844	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGTCTGCATACATTGCATAAG	0.358																																																	0													160.0	148.0	152.0					7																	23827642		2203	4300	6503	SO:0001583	missense	56164			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2531C>G	7.37:g.23827642C>G	ENSP00000348132:p.Thr844Arg		B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638495	0.47153	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.180279	0.49916	D	0.000131	T	0.64283	0.2584	N	0.20766	0.605	0.37765	D	0.926482	D;D;D	0.71674	0.997;0.998;0.994	D;D;D	0.72338	0.959;0.977;0.917	T	0.63778	-0.6560	10	0.27082	T	0.32	-12.1101	13.0262	0.58817	0.0:0.9259:0.0:0.0741	.	844;844;844	B4DZ06;A4D159;Q9BXU1	.;.;STK31_HUMAN	R	844;844;821;821	ENSP00000348132:T844R;ENSP00000411852:T844R;ENSP00000346660:T821R;ENSP00000406146:T821R	ENSP00000346660:T821R	T	+	2	0	STK31	23794167	0.988000	0.35896	1.000000	0.80357	0.905000	0.53344	2.455000	0.44988	2.764000	0.94973	0.650000	0.86243	ACA		0.358	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2		NM_031414	
TMEM106A	113277	hgsc.bcm.edu	37	17	41368531	41368531	+	Missense_Mutation	SNP	G	G	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:41368531G>A	ENST00000331615.3	+	6	730	c.493G>A	c.(493-495)Gtt>Att	p.V165I	TMEM106A_ENST00000588659.1_Missense_Mutation_p.V165I|LINC00854_ENST00000593624.1_RNA|TMEM106A_ENST00000541594.1_Missense_Mutation_p.V117I|LINC00854_ENST00000427995.1_RNA|TMEM106A_ENST00000536052.1_Intron|LINC00854_ENST00000595400.1_RNA	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	165						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		GACCCTCGAGGTTCTGCACCT	0.537																																																	0													230.0	220.0	224.0					17																	41368531		2203	4296	6499	SO:0001583	missense	113277			AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.493G>A	17.37:g.41368531G>A	ENSP00000330774:p.Val165Ile		A8K2X2|B7Z698	Missense_Mutation	SNP	ENST00000331615.3	37	CCDS11462.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435404	0.25813	.	.	ENSG00000184988	ENST00000331615;ENST00000541594	T;T	0.26518	1.73;1.73	5.52	3.55	0.40652	.	0.202868	0.42172	N	0.000741	T	0.26666	0.0652	M	0.62723	1.935	0.29784	N	0.833732	B;B	0.21753	0.06;0.06	B;B	0.26770	0.032;0.073	T	0.15549	-1.0433	10	0.34782	T	0.22	-21.9915	10.3795	0.44104	0.1566:0.0:0.8434:0.0	.	117;165	B7Z698;Q96A25	.;T106A_HUMAN	I	165;117	ENSP00000330774:V165I;ENSP00000439844:V117I	ENSP00000330774:V165I	V	+	1	0	TMEM106A	38724057	1.000000	0.71417	0.850000	0.33497	0.185000	0.23345	3.250000	0.51445	0.822000	0.34565	-0.126000	0.14955	GTT		0.537	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2		NM_145041	
TMEM138	51524	hgsc.bcm.edu;ucsc.edu	37	11	61135391	61135391	+	Intron	SNP	T	T	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr11:61135391T>A	ENST00000278826.6	+	4	859				TMEM138_ENST00000381787.2_Intron|TMEM138_ENST00000542946.1_3'UTR	NM_016464.4	NP_057548.1	Q9NPI0	TM138_HUMAN	transmembrane protein 138						cilium assembly (GO:0042384)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|vacuole (GO:0005773)				central_nervous_system(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5						CACATCTCCTTCAGAACTTAC	0.428																																																	0													214.0	218.0	216.0					11																	61135391		2203	4299	6502	SO:0001627	intron_variant	51524			AF151030	CCDS8005.1	11q12.2	2014-01-28			ENSG00000149483	ENSG00000149483			26944	protein-coding gene	gene with protein product		614459					Standard	NM_016464		Approved	HSPC196, JBTS16	uc001nrl.2	Q9NPI0	OTTHUMG00000168145	ENST00000278826.6:c.301-4T>A	11.37:g.61135391T>A			A6NGA7|B4E044|Q5JPE1	RNA	SNP	ENST00000278826.6	37	CCDS8005.1																																																																																				0.428	TMEM138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398399.2		NM_016464	
TMEM17	200728	hgsc.bcm.edu;ucsc.edu	37	2	62728623	62728623	+	Splice_Site	SNP	C	C	G			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr2:62728623C>G	ENST00000335390.5	-	4	530		c.e4-1			NM_198276.2	NP_938017.2	Q86X19	TMM17_HUMAN	transmembrane protein 17						cilium assembly (GO:0042384)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			ACTCAGGAACCTGCAATGACA	0.368																																																	0													45.0	51.0	49.0					2																	62728623		2203	4300	6503	SO:0001630	splice_region_variant	200728				CCDS1871.1	2p15	2008-02-05			ENSG00000186889	ENSG00000186889			26623	protein-coding gene	gene with protein product		614950				12477932	Standard	NM_198276		Approved	FLJ34583	uc002sbt.2	Q86X19	OTTHUMG00000129455	ENST00000335390.5:c.319-1G>C	2.37:g.62728623C>G			Q53QP7|Q53R98	Splice_Site	SNP	ENST00000335390.5	37	CCDS1871.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823945	0.71143	.	.	ENSG00000186889	ENST00000335390	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8212	0.96595	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM17	62582127	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.151000	0.77411	2.694000	0.91930	0.650000	0.86243	.		0.368	TMEM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251618.3		NM_198276	Intron
TP53	7157	hgsc.bcm.edu;ucsc.edu	37	17	7577559	7577559	+	Missense_Mutation	SNP	G	G	C	rs397516437|rs28934573		TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	PGM			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr17:7577559G>C	ENST00000269305.4	-	7	911	c.722C>G	c.(721-723)tCc>tGc	p.S241C	TP53_ENST00000413465.2_Missense_Mutation_p.S241C|TP53_ENST00000445888.2_Missense_Mutation_p.S241C|TP53_ENST00000359597.4_Missense_Mutation_p.S241C|TP53_ENST00000420246.2_Missense_Mutation_p.S241C|TP53_ENST00000455263.2_Missense_Mutation_p.S241C|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241F(85)|p.S241C(26)|p.0?(8)|p.S241Y(8)|p.C242fs*5(6)|p.?(5)|p.S241del(5)|p.S148F(4)|p.N239_C242delNSSC(3)|p.N239_C242>S(1)|p.C238fs*21(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.S148C(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCATGCAGGAACTGTTACA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	160	Substitution - Missense(124)|Deletion - In frame(13)|Deletion - Frameshift(9)|Whole gene deletion(8)|Unknown(5)|Complex - deletion inframe(1)	urinary_tract(19)|large_intestine(18)|breast(17)|endometrium(15)|ovary(15)|lung(12)|skin(9)|biliary_tract(8)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(7)|upper_aerodigestive_tract(6)|stomach(6)|oesophagus(5)|bone(5)|liver(3)|pancreas(3)|eye(2)|thyroid(1)|kidney(1)	GRCh37	CM920673	TP53	M	rs28934573						139.0	108.0	118.0					17																	7577559		2203	4300	6503	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.722C>G	17.37:g.7577559G>C	ENSP00000269305:p.Ser241Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276619	0.59758	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	4.62	3.64	0.41730	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99871	0.9939	M	0.92784	3.345	0.51233	D	0.999916	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;0.999	D	0.96551	0.9408	10	0.87932	D	0	-35.4617	12.8645	0.57932	0.0:0.1651:0.8349:0.0	.	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241C;ENSP00000352610:S241C;ENSP00000269305:S241C;ENSP00000398846:S241C;ENSP00000391127:S241C;ENSP00000391478:S241C;ENSP00000425104:S109C;ENSP00000423862:S148C	ENSP00000269305:S241C	S	-	2	0	TP53	7518284	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.346000	0.44027	1.295000	0.44724	0.462000	0.41574	TCC		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1		NM_000546	
TTK	7272	hgsc.bcm.edu;ucsc.edu	37	6	80746291	80746291	+	Missense_Mutation	SNP	C	C	A			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr6:80746291C>A	ENST00000369798.2	+	17	2135	c.2024C>A	c.(2023-2025)aCa>aAa	p.T675K	TTK_ENST00000509894.1_Missense_Mutation_p.T674K|TTK_ENST00000230510.3_Missense_Mutation_p.T674K	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	675	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CAACCAGATACAACAAGTGTT	0.343																																																	0													127.0	121.0	123.0					6																	80746291		2202	4299	6501	SO:0001583	missense	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2024C>A	6.37:g.80746291C>A	ENSP00000358813:p.Thr675Lys		A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341432	0.60963	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.64260	-0.09;-0.09;-0.09	6.08	5.11	0.69529	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.110621	0.64402	D	0.000005	T	0.27419	0.0673	N	0.20530	0.585	0.38935	D	0.958026	B;B	0.22683	0.045;0.073	B;B	0.18263	0.021;0.016	T	0.33369	-0.9871	10	0.59425	D	0.04	-27.5677	4.646	0.12572	0.0:0.7395:0.0:0.2605	.	675;674	P33981;A8K8U5	TTK_HUMAN;.	K	674;674;675	ENSP00000422936:T674K;ENSP00000230510:T674K;ENSP00000358813:T675K	ENSP00000230510:T674K	T	+	2	0	TTK	80803010	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.893000	0.69798	2.894000	0.99253	0.591000	0.81541	ACA		0.343	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2			
TUBGCP3	10426	hgsc.bcm.edu;ucsc.edu	37	13	113158951	113158951	+	Missense_Mutation	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr13:113158951T>C	ENST00000261965.3	-	18	2350	c.2164A>G	c.(2164-2166)Atc>Gtc	p.I722V	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.I722V	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	722					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TCAAATGTGATGTAATACTGC	0.383																																																	0													103.0	88.0	93.0					13																	113158951		2203	4300	6503	SO:0001583	missense	10426			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2164A>G	13.37:g.113158951T>C	ENSP00000261965:p.Ile722Val		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	ENST00000261965.3	37	CCDS9525.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294287	0.40594	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.08370	3.1;3.1	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.11410	0.0278	L	0.55481	1.735	0.58432	D	0.999998	B;B;B	0.14012	0.005;0.001;0.009	B;B;B	0.23574	0.032;0.007;0.047	T	0.05818	-1.0862	10	0.31617	T	0.26	-20.7176	14.7282	0.69360	0.0:0.0:0.0:1.0	.	712;722;722	B4DYP7;Q96CW5-2;Q96CW5	.;.;GCP3_HUMAN	V	722	ENSP00000261965:I722V;ENSP00000364821:I722V	ENSP00000261965:I722V	I	-	1	0	TUBGCP3	112206952	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	4.519000	0.60517	1.880000	0.54463	0.524000	0.50904	ATC		0.383	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2		NM_006322	
UCK2	7371	hgsc.bcm.edu;ucsc.edu	37	1	165859456	165859456	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr1:165859456A>T	ENST00000367879.4	+	2	418	c.115A>T	c.(115-117)Aag>Tag	p.K39*	UCK2_ENST00000372212.4_Nonsense_Mutation_p.K39*	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	39					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					CGTGTGTGCTAAGATCGTGCA	0.547																																																	0													135.0	118.0	124.0					1																	165859456		2203	4300	6503	SO:0001587	stop_gained	7371			AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.115A>T	1.37:g.165859456A>T	ENSP00000356853:p.Lys39*		Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Nonsense_Mutation	SNP	ENST00000367879.4	37	CCDS1252.1	.	.	.	.	.	.	.	.	.	.	A	38	6.660753	0.97743	.	.	ENSG00000143179	ENST00000367879;ENST00000372212	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.9363	14.0437	0.64693	1.0:0.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000356853:K39X	K	+	1	0	UCK2	164126080	1.000000	0.71417	0.937000	0.37676	0.407000	0.30961	9.027000	0.93706	2.186000	0.69663	0.533000	0.62120	AAG		0.547	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1		NM_012474	
UGT2B4	7363	hgsc.bcm.edu;ucsc.edu	37	4	70361487	70361487	+	Silent	SNP	T	T	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr4:70361487T>C	ENST00000305107.6	-	1	139	c.93A>G	c.(91-93)acA>acG	p.T31T	UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_Silent_p.T31T	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	31					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GGCTGAATTCTGTGGGCCACA	0.463																																																	0													146.0	148.0	147.0					4																	70361487		2203	4300	6503	SO:0001819	synonymous_variant	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.93A>G	4.37:g.70361487T>C			A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	ENST00000305107.6	37	CCDS43234.1																																																																																				0.463	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1		NM_021139	
ULK3	25989	hgsc.bcm.edu;ucsc.edu	37	15	75134635	75134635	+	Missense_Mutation	SNP	G	G	C			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr15:75134635G>C	ENST00000440863.2	-	2	320	c.229C>G	c.(229-231)Ctg>Gtg	p.L77V	ULK3_ENST00000569437.1_Missense_Mutation_p.L77V|ULK3_ENST00000568667.1_Missense_Mutation_p.L88V	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	77	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						AAGTCTTTCAGCTGCACAATG	0.552																																																	0													118.0	118.0	118.0					15																	75134635		1997	4157	6154	SO:0001583	missense	25989			BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.229C>G	15.37:g.75134635G>C	ENSP00000400312:p.Leu77Val		B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	ENST00000440863.2	37	CCDS45305.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843677	0.91197	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.32753	1.44	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.53948	0.1828	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.85130	0.978;0.994;0.997	T	0.55315	-0.8160	10	0.72032	D	0.01	-8.3553	18.0244	0.89264	0.0:0.0:1.0:0.0	.	88;77;77	B4DFT0;Q6PHR2;Q6PHR2-3	.;ULK3_HUMAN;.	V	77;88	ENSP00000400312:L77V	ENSP00000393658:L88V	L	-	1	2	ULK3	72921688	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.081000	0.94049	2.495000	0.84180	0.655000	0.94253	CTG		0.552	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4		NM_015518	
USP25	29761	hgsc.bcm.edu;ucsc.edu	37	21	17246743	17246743	+	Silent	SNP	C	C	T			TCGA-CZ-4865-01A-02D-1501-10	TCGA-CZ-4865-11A-01D-1501-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f8eac30d-1155-44cc-a2ad-95427fecf4bf	e97e6356-82e8-49d3-ad59-f621e0cf6a85	g.chr21:17246743C>T	ENST00000285679.6	+	22	3066	c.2697C>T	c.(2695-2697)ttC>ttT	p.F899F	USP25_ENST00000351097.5_Silent_p.F294F|USP25_ENST00000400183.2_Silent_p.F969F|USP25_ENST00000285681.2_Silent_p.F931F	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	899					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		CCTTGCTGTTCCTCATCTGTG	0.294																																																	0													115.0	118.0	117.0					21																	17246743		2203	4299	6502	SO:0001819	synonymous_variant	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2697C>T	21.37:g.17246743C>T			C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	C	9.227	1.034780	0.19590	.	.	ENSG00000155313	ENST00000449491	.	.	.	5.71	1.35	0.21983	.	.	.	.	.	T	0.59959	0.2232	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55823	-0.8080	4	.	.	.	.	11.7405	0.51790	0.0:0.7191:0.0:0.2809	.	.	.	.	F	198	.	.	S	+	2	0	USP25	16168614	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.681000	0.25320	0.353000	0.24079	0.460000	0.39030	TCC		0.294	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1			
