#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBIAD1	29914	hgsc.bcm.edu	37	1	11346095	11346095	+	Silent	SNP	G	G	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:11346095G>C	ENST00000376810.5	+	2	1250	c.924G>C	c.(922-924)ctG>ctC	p.L308L	UBIAD1_ENST00000376804.2_Intron	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	308					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		TCAACAAACTGCCCCAGAGGA	0.547																																					p.L308L		Atlas-SNP	.											.	UBIAD1	27	.	0			c.G924C						PASS	.						110.0	107.0	108.0					1																	11346095		2203	4300	6503	SO:0001819	synonymous_variant	29914	exon2			CAAACTGCCCCAG		CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.924G>C	chr1.hg19:g.11346095G>C		157.0	0.0	.		152.0	62.0	.	NM_013319	B3KQG3|Q53GX3|Q5THD4	Silent	SNP	ENST00000376810.5	hg19	CCDS129.1																																																																																			.	.	.	none		0.547	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005773.1	NM_013319	
PADI3	51702	hgsc.bcm.edu	37	1	17609568	17609568	+	Silent	SNP	G	G	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:17609568G>A	ENST00000375460.3	+	16	2029	c.1989G>A	c.(1987-1989)gtG>gtA	p.V663V		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	663					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGAACATGGTGCCCTGAGACA	0.572																																					p.V663V		Atlas-SNP	.											.	PADI3	81	.	0			c.G1989A						PASS	.						90.0	74.0	79.0					1																	17609568		2203	4300	6503	SO:0001819	synonymous_variant	51702	exon16			CATGGTGCCCTGA	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1989G>A	chr1.hg19:g.17609568G>A		53.0	0.0	.		62.0	13.0	.	NM_016233	Q58EY7|Q70SX5	Silent	SNP	ENST00000375460.3	hg19	CCDS179.1																																																																																			.	.	.	none		0.572	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
ZDHHC18	84243	hgsc.bcm.edu	37	1	27176925	27176925	+	Silent	SNP	G	G	A	rs373583803		TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:27176925G>A	ENST00000374142.4	+	4	875	c.780G>A	c.(778-780)acG>acA	p.T260T		NM_032283.2	NP_115659.1	Q9NUE0	ZDH18_HUMAN	zinc finger, DHHC-type containing 18	260					cellular protein localization (GO:0034613)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)	3		all_cancers(24;5.82e-22)|all_epithelial(13;9.91e-20)|Colorectal(325;0.000147)|Breast(348;0.000706)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;5.71e-53)|Epithelial(14;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(117;1.53e-29)|Colorectal(126;1.9e-09)|COAD - Colon adenocarcinoma(152;4.2e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000548)|STAD - Stomach adenocarcinoma(196;0.00065)|KIRC - Kidney renal clear cell carcinoma(1967;0.000779)|GBM - Glioblastoma multiforme(114;0.0265)|READ - Rectum adenocarcinoma(331;0.0455)|Lung(427;0.163)|LUSC - Lung squamous cell carcinoma(448;0.237)		CCCACCTGACGTTGCGTGAGT	0.567																																					p.T260T		Atlas-SNP	.											.	ZDHHC18	20	.	0			c.G780A						PASS	.	G		0,4406		0,0,2203	159.0	139.0	145.0		780	-3.6	1.0	1		145	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ZDHHC18	NM_032283.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		260/389	27176925	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	84243	exon4			CCTGACGTTGCGT	AK056427	CCDS30650.1	1p36.11	2008-05-02			ENSG00000204160	ENSG00000204160		"""Zinc fingers, DHHC-type"""	20712	protein-coding gene	gene with protein product							Standard	NM_032283		Approved	DKFZp667O2416	uc001bnb.3	Q9NUE0	OTTHUMG00000004092	ENST00000374142.4:c.780G>A	chr1.hg19:g.27176925G>A		201.0	0.0	.		185.0	76.0	.	NM_032283	A6NHY9|B4DQ84|Q5JYH0|Q9H020	Silent	SNP	ENST00000374142.4	hg19	CCDS30650.1	.	.	.	.	.	.	.	.	.	.	G	8.860	0.946706	0.18356	0.0	2.33E-4	ENSG00000204160	ENST00000488397	.	.	.	5.05	-3.58	0.04597	.	.	.	.	.	T	0.36496	0.0969	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35968	-0.9767	4	.	.	.	-4.0065	0.8159	0.01102	0.389:0.2593:0.1417:0.21	.	.	.	.	I	25	.	.	V	+	1	0	ZDHHC18	27049512	0.000000	0.05858	0.965000	0.40720	0.894000	0.52154	-1.818000	0.01717	-0.387000	0.07809	-0.215000	0.12644	GTT	.	.	.	none		0.567	ZDHHC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011706.3	NM_032283	
KIAA1522	57648	hgsc.bcm.edu	37	1	33237745	33237745	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:33237745C>A	ENST00000373480.1	+	6	2891	c.2788C>A	c.(2788-2790)Cct>Act	p.P930T	KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.P989T|KIAA1522_ENST00000373481.3_Missense_Mutation_p.P941T	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	930	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				GCCCGTGTCCCCTGAGACCCA	0.647																																					p.P989T		Atlas-SNP	.											.	KIAA1522	68	.	0			c.C2965A						PASS	.						20.0	27.0	25.0					1																	33237745		1981	4161	6142	SO:0001583	missense	57648	exon6			GTGTCCCCTGAGA	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2788C>A	chr1.hg19:g.33237745C>A	ENSP00000362579:p.Pro930Thr	31.0	0.0	.		40.0	13.0	.	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	hg19	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793037	0.70452	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.17054	2.3;2.33;2.35	4.85	4.85	0.62838	.	0.315683	0.28011	N	0.016953	T	0.36358	0.0964	L	0.59436	1.845	0.32817	D	0.502245	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.988;0.988	T	0.33394	-0.9870	10	0.37606	T	0.19	-12.0197	14.185	0.65601	0.0:0.8504:0.1496:0.0	.	941;930;989	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	T	989;941;930	ENSP00000383851:P989T;ENSP00000362580:P941T;ENSP00000362579:P930T	ENSP00000362579:P930T	P	+	1	0	KIAA1522	33010332	0.987000	0.35691	1.000000	0.80357	0.799000	0.45148	2.754000	0.47532	2.682000	0.91365	0.650000	0.86243	CCT	.	.	.	none		0.647	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
MACF1	23499	hgsc.bcm.edu	37	1	39835802	39835802	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:39835802C>G	ENST00000372915.3	+	50	13141	c.13054C>G	c.(13054-13056)Cct>Gct	p.P4352A	MACF1_ENST00000564288.1_Missense_Mutation_p.P4347A|MACF1_ENST00000361689.2_Missense_Mutation_p.P2285A|MACF1_ENST00000317713.7_Missense_Mutation_p.P2285A|MACF1_ENST00000289893.4_Missense_Mutation_p.P2787A|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.P2285A|MACF1_ENST00000539005.1_Missense_Mutation_p.P2285A|MACF1_ENST00000567887.1_Missense_Mutation_p.P4384A			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4352					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGTATTCCACCTACGGAAAC	0.448																																					p.P2285A		Atlas-SNP	.											.	MACF1	909	.	0			c.C6853G						PASS	.						75.0	76.0	76.0					1																	39835802		2203	4300	6503	SO:0001583	missense	23499	exon47			ATTCCACCTACGG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.13054C>G	chr1.hg19:g.39835802C>G	ENSP00000362006:p.Pro4352Ala	48.0	0.0	.		35.0	18.0	.	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.632|0.632	-0.816867|-0.816867	0.02776|0.02776	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.32023|.	1.47;1.47;1.47;1.47;1.47;1.47|.	5.37|5.37	-0.194|-0.194	0.13240|0.13240	.|.	0.900226|.	0.09361|.	N|.	0.812758|.	T|T	0.20292|0.20292	0.0488|0.0488	N|N	0.16368|0.16368	0.405|0.405	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.15141|.	0.012;0.003;0.002;0.001|.	B;B;B;B|.	0.25759|.	0.063;0.004;0.007;0.006|.	T|T	0.29518|0.29518	-1.0009|-1.0009	10|5	0.07175|.	T|.	0.84|.	.|.	6.3552|6.3552	0.21397|0.21397	0.0:0.4709:0.249:0.28|0.0:0.4709:0.249:0.28	.|.	4352;2285;2285;2250|.	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	MACF1_HUMAN;.;.;.|.	A|S	2285;4352;2285;2285;2285;2787|1418	ENSP00000439537:P2285A;ENSP00000362006:P4352A;ENSP00000354573:P2285A;ENSP00000313438:P2285A;ENSP00000444364:P2285A;ENSP00000289893:P2787A|.	ENSP00000289893:P2787A|.	P|T	+|+	1|2	0|0	MACF1|MACF1	39608389|39608389	0.000000|0.000000	0.05858|0.05858	0.116000|0.116000	0.21606|0.21606	0.992000|0.992000	0.81027|0.81027	0.181000|0.181000	0.16880|0.16880	0.245000|0.245000	0.21373|0.21373	0.655000|0.655000	0.94253|0.94253	CCT|ACC	.	.	.	none		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
TMEM81	388730	hgsc.bcm.edu	37	1	205052751	205052751	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:205052751G>T	ENST00000367167.3	-	1	894	c.698C>A	c.(697-699)gCc>gAc	p.A233D		NM_203376.1	NP_976310.1	Q6P7N7	TMM81_HUMAN	transmembrane protein 81	233						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9	all_cancers(21;0.144)|Breast(84;0.0437)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CACTCCAATGGCAATTCCTAT	0.512																																					p.A233D		Atlas-SNP	.											.	TMEM81	23	.	0			c.C698A						PASS	.						133.0	120.0	124.0					1																	205052751		2203	4300	6503	SO:0001583	missense	388730	exon1			CCAATGGCAATTC	BC061592	CCDS1450.1	1q32.1	2013-01-11			ENSG00000174529	ENSG00000174529		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32349	protein-coding gene	gene with protein product							Standard	NM_203376		Approved	UNQ2788, MGC75217, HC3107, KVLA2788	uc001hbt.3	Q6P7N7	OTTHUMG00000037103	ENST00000367167.3:c.698C>A	chr1.hg19:g.205052751G>T	ENSP00000356135:p.Ala233Asp	123.0	0.0	.		113.0	37.0	.	NM_203376	Q6UVZ4	Missense_Mutation	SNP	ENST00000367167.3	hg19	CCDS1450.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569050	0.65765	.	.	ENSG00000174529	ENST00000367167	T	0.35605	1.3	5.79	-0.62	0.11567	.	1.790840	0.02843	N	0.128129	T	0.37183	0.0994	L	0.57536	1.79	0.09310	N	1	P	0.37276	0.589	B	0.38616	0.277	T	0.34354	-0.9832	10	0.66056	D	0.02	-30.4547	5.7266	0.18017	0.3683:0.291:0.3406:0.0	.	233	Q6P7N7	TMM81_HUMAN	D	233	ENSP00000356135:A233D	ENSP00000356135:A233D	A	-	2	0	TMEM81	203319374	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	0.115000	0.15540	-0.133000	0.11537	0.655000	0.94253	GCC	.	.	.	none		0.512	TMEM81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090076.1	NM_203376	
CR2	1380	hgsc.bcm.edu	37	1	207642031	207642031	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr1:207642031A>C	ENST00000367058.3	+	3	794	c.605A>C	c.(604-606)aAa>aCa	p.K202T	CR2_ENST00000367057.3_Missense_Mutation_p.K202T|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000458541.2_Missense_Mutation_p.K202T|CR2_ENST00000367059.3_Missense_Mutation_p.K202T	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	202	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TCTTCGGGAAAATGGAGTGCT	0.413																																					p.K202T		Atlas-SNP	.											.	CR2	164	.	0			c.A605C						PASS	.						270.0	250.0	257.0					1																	207642031		2203	4300	6503	SO:0001583	missense	1380	exon3			CGGGAAAATGGAG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.605A>C	chr1.hg19:g.207642031A>C	ENSP00000356025:p.Lys202Thr	288.0	0.0	.		195.0	85.0	.	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	A	1.073	-0.669450	0.03403	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.82	-5.11	0.02901	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.25121	0.0610	N	0.02158	-0.66	0.09310	N	1	B;B;B	0.13594	0.008;0.004;0.002	B;B;B	0.17979	0.02;0.015;0.007	T	0.24870	-1.0148	9	0.13470	T	0.59	.	3.9575	0.09396	0.2886:0.4405:0.0679:0.203	.	202;202;202	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	T	202	ENSP00000356025:K202T;ENSP00000356024:K202T;ENSP00000356026:K202T;ENSP00000404222:K202T	ENSP00000356024:K202T	K	+	2	0	CR2	205708654	0.000000	0.05858	0.013000	0.15412	0.042000	0.13812	-0.669000	0.05262	-0.440000	0.07211	-0.445000	0.05633	AAA	.	.	.	none		0.413	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
SPEG	10290	hgsc.bcm.edu	37	2	220338577	220338577	+	Silent	SNP	C	C	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr2:220338577C>A	ENST00000312358.7	+	18	4531	c.4399C>A	c.(4399-4401)Cga>Aga	p.R1467R	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1467	Ig-like 7.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTGCACCGCCCGAAACCGTCA	0.647																																					p.R1467R		Atlas-SNP	.											.	SPEG	272	.	0			c.C4399A						PASS	.						56.0	66.0	63.0					2																	220338577		2052	4184	6236	SO:0001819	synonymous_variant	10290	exon18			ACCGCCCGAAACC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4399C>A	chr2.hg19:g.220338577C>A		156.0	0.0	.		157.0	86.0	.	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	hg19	CCDS42824.1																																																																																			.	.	.	none		0.647	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
ATG7	10533	hgsc.bcm.edu	37	3	11356947	11356947	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr3:11356947T>A	ENST00000354449.3	+	7	683	c.658T>A	c.(658-660)Ttc>Atc	p.F220I	ATG7_ENST00000354956.5_Missense_Mutation_p.F220I|ATG7_ENST00000446450.2_Missense_Mutation_p.F181I	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	220					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CAGTGATTTCTTCCAAGGTCA	0.348																																					p.F220I		Atlas-SNP	.											.	ATG7	56	.	0			c.T658A						PASS	.						110.0	97.0	101.0					3																	11356947		2203	4300	6503	SO:0001583	missense	10533	exon7			GATTTCTTCCAAG	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.658T>A	chr3.hg19:g.11356947T>A	ENSP00000346437:p.Phe220Ile	66.0	0.0	.		71.0	30.0	.	NM_001136031	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	hg19	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.499788	0.64298	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	T;T;T	0.48522	0.81;0.81;0.81	4.67	4.67	0.58626	.	0.069886	0.64402	D	0.000020	T	0.50429	0.1615	M	0.88105	2.93	0.43381	D	0.995487	P;B;B	0.36086	0.536;0.134;0.083	B;B;B	0.29598	0.104;0.028;0.02	T	0.57751	-0.7757	9	.	.	.	-13.2176	11.6384	0.51217	0.0:0.0:0.0:1.0	.	181;220;220	E9PB95;O95352-2;O95352	.;.;ATG7_HUMAN	I	181;220;220	ENSP00000412580:F181I;ENSP00000347042:F220I;ENSP00000346437:F220I	.	F	+	1	0	ATG7	11331947	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.439000	0.59968	1.726000	0.51525	0.482000	0.46254	TTC	.	.	.	none		0.348	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395	
DHX30	22907	hgsc.bcm.edu	37	3	47882520	47882520	+	Silent	SNP	C	C	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr3:47882520C>A	ENST00000445061.1	+	7	927	c.520C>A	c.(520-522)Cga>Aga	p.R174R	DHX30_ENST00000446256.2_Silent_p.R135R|DHX30_ENST00000348968.4_Silent_p.R146R|DHX30_ENST00000457607.1_Silent_p.R202R	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	174						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		AGAGAGTATTCGACCAGGGGG	0.597																																					p.R174R		Atlas-SNP	.											DHX30,NS,carcinoma,0,1	DHX30	101	.	0			c.C520A						PASS	.						34.0	34.0	34.0					3																	47882520		2203	4300	6503	SO:0001819	synonymous_variant	22907	exon7			AGTATTCGACCAG	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.520C>A	chr3.hg19:g.47882520C>A		39.0	0.0	.		46.0	4.0	.	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	hg19	CCDS2759.1																																																																																			.	.	.	none		0.597	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
ATP13A4	84239	hgsc.bcm.edu	37	3	193132518	193132518	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr3:193132518G>C	ENST00000342695.4	-	26	3186	c.2864C>G	c.(2863-2865)cCt>cGt	p.P955R	ATP13A4_ENST00000482964.1_5'Flank|ATP13A4_ENST00000400270.2_5'UTR|ATP13A4_ENST00000392443.3_Missense_Mutation_p.P936R	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	955						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CACCAGCTTAGGGTAGGCACC	0.408																																					p.P955R		Atlas-SNP	.											.	ATP13A4	154	.	0			c.C2864G						PASS	.						76.0	69.0	72.0					3																	193132518		2203	4300	6503	SO:0001583	missense	84239	exon26			AGCTTAGGGTAGG	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.2864C>G	chr3.hg19:g.193132518G>C	ENSP00000339182:p.Pro955Arg	89.0	0.0	.		68.0	23.0	.	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	hg19	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847905	0.71603	.	.	ENSG00000127249	ENST00000392443;ENST00000342695	D;D	0.89485	-2.52;-2.52	6.02	6.02	0.97574	.	0.000000	0.64402	D	0.000001	D	0.94082	0.8103	M	0.78637	2.42	0.80722	D	1	D	0.69078	0.997	D	0.67103	0.949	D	0.92892	0.6332	10	0.40728	T	0.16	-24.9732	18.0311	0.89285	0.0:0.0:1.0:0.0	.	955	Q4VNC1	AT134_HUMAN	R	936;955	ENSP00000376238:P936R;ENSP00000339182:P955R	ENSP00000339182:P955R	P	-	2	0	ATP13A4	194615212	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.191000	0.65110	2.857000	0.98124	0.650000	0.86243	CCT	.	.	.	none		0.408	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
PARM1	25849	hgsc.bcm.edu	37	4	75937687	75937687	+	Silent	SNP	G	G	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr4:75937687G>C	ENST00000307428.7	+	2	308	c.96G>C	c.(94-96)ccG>ccC	p.P32P	PARM1_ENST00000513238.1_Intron|RP11-44F21.2_ENST00000513770.1_RNA	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	32					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						TTTCTCTTCCGACAAACATTG	0.488																																					p.P32P		Atlas-SNP	.											PARM1_ENST00000307428,colon,carcinoma,0,3	PARM1	52	.	0			c.G96C						PASS	.																																			SO:0001819	synonymous_variant	25849	exon2			TCTTCCGACAAAC	AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.96G>C	chr4.hg19:g.75937687G>C		81.0	0.0	.		67.0	32.0	.	NM_015393	B3KMQ9|Q96DV8|Q9Y4S1	Silent	SNP	ENST00000307428.7	hg19	CCDS47077.1																																																																																			.	.	.	none		0.488	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393	
ENPEP	2028	hgsc.bcm.edu	37	4	111397845	111397845	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr4:111397845G>A	ENST00000265162.5	+	1	617	c.275G>A	c.(274-276)cGa>cAa	p.R92Q		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	92					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AAAAACTTTCGACTGCCGGAC	0.612																																					p.R92Q		Atlas-SNP	.											.	ENPEP	149	.	0			c.G275A						PASS	.						75.0	80.0	78.0					4																	111397845		2203	4300	6503	SO:0001583	missense	2028	exon1			ACTTTCGACTGCC	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.275G>A	chr4.hg19:g.111397845G>A	ENSP00000265162:p.Arg92Gln	133.0	0.0	.		93.0	36.0	.	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	hg19	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865651	0.71949	.	.	ENSG00000138792	ENST00000265162	T	0.03181	4.02	5.83	5.83	0.93111	.	0.098719	0.64402	D	0.000003	T	0.23210	0.0561	M	0.89785	3.06	0.58432	D	0.999999	D	0.89917	1.0	D	0.76575	0.988	T	0.00599	-1.1651	10	0.87932	D	0	.	14.2874	0.66254	0.0708:0.0:0.9292:0.0	.	92	Q07075	AMPE_HUMAN	Q	92	ENSP00000265162:R92Q	ENSP00000265162:R92Q	R	+	2	0	ENPEP	111617294	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	7.579000	0.82511	2.758000	0.94735	0.561000	0.74099	CGA	.	.	.	none		0.612	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
ADCY2	108	hgsc.bcm.edu	37	5	7820695	7820695	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr5:7820695G>A	ENST00000338316.4	+	24	3105	c.3016G>A	c.(3016-3018)Gtg>Atg	p.V1006M	ADCY2_ENST00000537121.1_Missense_Mutation_p.V826M	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1006					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCATGGACCTGTGATAGCTGG	0.428																																					p.V1006M		Atlas-SNP	.											.	ADCY2	337	.	0			c.G3016A						PASS	.						107.0	95.0	99.0					5																	7820695		2203	4300	6503	SO:0001583	missense	108	exon24			GGACCTGTGATAG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3016G>A	chr5.hg19:g.7820695G>A	ENSP00000342952:p.Val1006Met	54.0	0.0	.		63.0	33.0	.	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632738	0.87660	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.48522	0.81;0.81	5.19	5.19	0.71726	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.81437	0.4822	H	0.98178	4.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88857	0.3323	10	0.87932	D	0	.	18.7434	0.91782	0.0:0.0:1.0:0.0	.	826;1006	B7Z2C1;Q08462	.;ADCY2_HUMAN	M	1006;839;826	ENSP00000342952:V1006M;ENSP00000444803:V826M	ENSP00000342952:V1006M	V	+	1	0	ADCY2	7873695	1.000000	0.71417	0.968000	0.41197	0.900000	0.52787	9.565000	0.98154	2.430000	0.82344	0.655000	0.94253	GTG	.	.	.	none		0.428	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
RPS14	6208	hgsc.bcm.edu	37	5	149827271	149827271	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr5:149827271T>C	ENST00000401695.3	-	2	72	c.26A>G	c.(25-27)aAg>aGg	p.K9R	RPS14_ENST00000407193.1_Missense_Mutation_p.K9R|RPS14_ENST00000312037.5_Missense_Mutation_p.K9R			P62263	RS14_HUMAN	ribosomal protein S14	9					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|maturation of SSU-rRNA (GO:0030490)|mRNA metabolic process (GO:0016071)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|ribosomal small subunit assembly (GO:0000028)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)|translation regulator activity (GO:0045182)			central_nervous_system(1)|lung(1)|skin(1)	3		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTTCCTTCTTTTCCTTCCC	0.443																																					p.K9R		Atlas-SNP	.											.	RPS14	11	.	0			c.A26G						PASS	.						125.0	111.0	116.0					5																	149827271		2203	4300	6503	SO:0001583	missense	6208	exon2			TCCTTCTTTTCCT		CCDS4307.1	5q31-q33	2012-10-02			ENSG00000164587	ENSG00000164587		"""S ribosomal proteins"""	10387	protein-coding gene	gene with protein product	"""emetine resistance"", ""40S ribosomal protein S14"""	130620				3785212, 1549121	Standard	XM_006714790		Approved	EMTB, S14	uc003lsj.3	P62263	OTTHUMG00000130080	ENST00000401695.3:c.26A>G	chr5.hg19:g.149827271T>C	ENSP00000385958:p.Lys9Arg	143.0	0.0	.		148.0	67.0	.	NM_001025071	B2R5G5|D3DQG5|P06366|Q5BJI0	Missense_Mutation	SNP	ENST00000401695.3	hg19	CCDS4307.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142739	0.57044	.	.	ENSG00000164587	ENST00000401695;ENST00000407193;ENST00000521466;ENST00000312037	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	N	0.22421	0.69	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.28332	-1.0047	9	0.23891	T	0.37	.	15.1102	0.72349	0.0:0.0:0.0:1.0	.	9	P62263	RS14_HUMAN	R	9	.	ENSP00000311028:K9R	K	-	2	0	RPS14	149807464	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.649000	0.83500	2.023000	0.59567	0.455000	0.32223	AAG	.	.	.	none		0.443	RPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252373.1	NM_001025071	
PRPF4B	8899	hgsc.bcm.edu	37	6	4047415	4047415	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr6:4047415C>G	ENST00000337659.6	+	7	1968	c.1868C>G	c.(1867-1869)tCt>tGt	p.S623C	PRPF4B_ENST00000538861.1_Missense_Mutation_p.S609C	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	623					mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TAAGGTTCATCTCAGAAGAAG	0.284																																					p.S623C		Atlas-SNP	.											.	PRPF4B	140	.	0			c.C1868G						PASS	.						154.0	146.0	148.0					6																	4047415		2202	4298	6500	SO:0001583	missense	8899	exon7			GTTCATCTCAGAA	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1868C>G	chr6.hg19:g.4047415C>G	ENSP00000337194:p.Ser623Cys	128.0	0.0	.		195.0	67.0	.	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	hg19	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572647	0.65765	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.68479	-0.33;-0.32	5.51	4.63	0.57726	.	0.380183	0.25372	N	0.031153	T	0.31167	0.0788	N	0.14661	0.345	0.34271	D	0.681056	B	0.20164	0.042	B	0.21917	0.037	T	0.19582	-1.0301	10	0.51188	T	0.08	.	9.3135	0.37919	0.1456:0.7823:0.0:0.0721	.	623	Q13523	PRP4B_HUMAN	C	623;609	ENSP00000337194:S623C;ENSP00000439331:S609C	ENSP00000337194:S623C	S	+	2	0	PRPF4B	3992414	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.825000	0.48096	1.424000	0.47217	0.650000	0.86243	TCT	.	.	.	none		0.284	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
KCND2	3751	hgsc.bcm.edu	37	7	119915491	119915491	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr7:119915491G>T	ENST00000331113.4	+	1	1770	c.805G>T	c.(805-807)Gcc>Tcc	p.A269S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	269					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CGACGTGGTGGCCATCCTGCC	0.512																																					p.A269S		Atlas-SNP	.											.	KCND2	194	.	0			c.G805T						PASS	.						172.0	142.0	152.0					7																	119915491		2203	4300	6503	SO:0001583	missense	3751	exon1			GTGGTGGCCATCC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.805G>T	chr7.hg19:g.119915491G>T	ENSP00000333496:p.Ala269Ser	82.0	0.0	.		102.0	28.0	.	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	hg19	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348475	0.82132	.	.	ENSG00000184408	ENST00000331113	D	0.98493	-4.96	5.27	5.27	0.74061	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	N	0.16166	0.38	0.80722	D	1	P	0.46578	0.88	P	0.57620	0.824	D	0.96477	0.9353	9	.	.	.	.	19.2668	0.93990	0.0:0.0:1.0:0.0	.	269	Q9NZV8	KCND2_HUMAN	S	269	ENSP00000333496:A269S	.	A	+	1	0	KCND2	119702727	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.636000	0.89361	0.557000	0.71058	GCC	.	.	.	none		0.512	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
CDKN2B	1030	hgsc.bcm.edu	37	9	22006244	22006244	+	Silent	SNP	G	G	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr9:22006244G>A	ENST00000276925.6	-	2	568	c.159C>T	c.(157-159)gtC>gtT	p.V53V	CDKN2B-AS1_ENST00000582072.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B_ENST00000380142.4_3'UTR|CDKN2B-AS1_ENST00000584637.1_RNA	NM_004936.3|NM_078487.2	NP_004927.2|NP_511042.1	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	53					aging (GO:0007568)|cell cycle arrest (GO:0007050)|cellular response to extracellular stimulus (GO:0031668)|cellular response to nutrient (GO:0031670)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|liver development (GO:0001889)|megakaryocyte differentiation (GO:0030219)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to cytokine (GO:0034097)|response to organic cyclic compound (GO:0014070)|spleen development (GO:0048536)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0(1)|p.0?(1)		lung(2)	2		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		CCATCATCATGACCTGCCAGA	0.647																																					p.V53V		Atlas-SNP	.											.	CDKN2B	12	.	2	Whole gene deletion(2)	lung(2)	c.C159T						PASS	.						14.0	17.0	16.0					9																	22006244		2175	4259	6434	SO:0001819	synonymous_variant	1030	exon2			CATCATGACCTGC	AB060808	CCDS6512.1, CCDS6513.1	9p21	2008-07-21			ENSG00000147883	ENSG00000147883			1788	protein-coding gene	gene with protein product		600431				8078588	Standard	NM_004936		Approved	P15, MTS2, INK4B, TP15, CDK4I, p15INK4b	uc003zpo.3	P42772	OTTHUMG00000019691	ENST00000276925.6:c.159C>T	chr9.hg19:g.22006244G>A		49.0	0.0	.		22.0	8.0	.	NM_004936	O15125|Q6FI09	Silent	SNP	ENST00000276925.6	hg19	CCDS6512.1																																																																																			.	.	.	none		0.647	CDKN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051932.2	NM_004936	
NIPSNAP3B	55335	hgsc.bcm.edu	37	9	107531256	107531256	+	Silent	SNP	T	T	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr9:107531256T>A	ENST00000374762.3	+	3	455	c.384T>A	c.(382-384)atT>atA	p.I128I	NIPSNAP3B_ENST00000461177.1_3'UTR	NM_018376.2	NP_060846.2	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B (C. elegans)	128										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	11						AGACGGAAATTACTTACCTGA	0.383																																					p.I128I		Atlas-SNP	.											.	NIPSNAP3B	22	.	0			c.T384A						PASS	.						79.0	76.0	77.0					9																	107531256		2203	4300	6503	SO:0001819	synonymous_variant	55335	exon3			GGAAATTACTTAC	BC017914	CCDS6761.1	9q31.3	2003-11-27			ENSG00000165028	ENSG00000165028			23641	protein-coding gene	gene with protein product		608872				12477932	Standard	NM_018376		Approved	FLJ11275	uc004bci.3	Q9BS92	OTTHUMG00000020414	ENST00000374762.3:c.384T>A	chr9.hg19:g.107531256T>A		95.0	0.0	.		77.0	38.0	.	NM_018376	Q5VX30|Q9NUM2	Silent	SNP	ENST00000374762.3	hg19	CCDS6761.1																																																																																			.	.	.	none		0.383	NIPSNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053486.1	NM_018376	
CNTRL	11064	hgsc.bcm.edu	37	9	123888062	123888062	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr9:123888062C>A	ENST00000373855.1	+	14	2133	c.1873C>A	c.(1873-1875)Ctg>Atg	p.L625M	CNTRL_ENST00000373847.1_Missense_Mutation_p.L73M|CNTRL_ENST00000238341.5_Missense_Mutation_p.L625M|CNTRL_ENST00000373850.1_Missense_Mutation_p.L73M			Q7Z7A1	CNTRL_HUMAN	centriolin	625					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GCAAGAATACCTGGGGACCAT	0.458																																					p.L625M		Atlas-SNP	.											.	CNTRL	161	.	0			c.C1873A						PASS	.						120.0	123.0	122.0					9																	123888062		2203	4300	6503	SO:0001583	missense	11064	exon12			GAATACCTGGGGA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1873C>A	chr9.hg19:g.123888062C>A	ENSP00000362962:p.Leu625Met	146.0	0.0	.		124.0	5.0	.	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	hg19	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944003	0.73672	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.65549	0.25;0.25;-0.16;0.05	5.59	4.69	0.59074	.	.	.	.	.	T	0.69214	0.3086	L	0.34521	1.04	0.37252	D	0.906593	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.997	T	0.74237	-0.3730	9	0.51188	T	0.08	.	13.301	0.60326	0.0:0.9245:0.0:0.0755	.	625;625;625	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	M	625;625;625;107;73;73	ENSP00000362962:L625M;ENSP00000238341:L625M;ENSP00000362956:L73M;ENSP00000362953:L73M	ENSP00000238341:L625M	L	+	1	2	CNTRL	122927883	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.004000	0.40854	1.349000	0.45751	0.650000	0.86243	CTG	.	.	.	none		0.458	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
OR4A16	81327	hgsc.bcm.edu	37	11	55110797	55110797	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr11:55110797C>T	ENST00000314721.2	+	1	171	c.121C>T	c.(121-123)Ctc>Ttc	p.L41F		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						GGTGGGAAACCTCCTCATTTG	0.428																																					p.L41F		Atlas-SNP	.											OR4A16,right_upper_lobe,carcinoma,0,1	OR4A16	120	.	0			c.C121T						PASS	.						122.0	115.0	117.0					11																	55110797		2201	4296	6497	SO:0001583	missense	81327	exon1			GGAAACCTCCTCA	AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.121C>T	chr11.hg19:g.55110797C>T	ENSP00000325128:p.Leu41Phe	202.0	0.0	.		180.0	64.0	.	NM_001005274	Q6IFL3	Missense_Mutation	SNP	ENST00000314721.2	hg19	CCDS31499.1	.	.	.	.	.	.	.	.	.	.	c	7.100	0.573809	0.13623	.	.	ENSG00000181961	ENST00000314721	T	0.00438	7.42	2.41	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00637	0.0021	L	0.55017	1.72	0.09310	N	0.999999	D	0.57899	0.981	D	0.63597	0.916	T	0.56938	-0.7896	9	0.37606	T	0.19	.	6.7077	0.23260	0.0:0.8361:0.0:0.1639	.	41	Q8NH70	O4A16_HUMAN	F	41	ENSP00000325128:L41F	ENSP00000325128:L41F	L	+	1	0	OR4A16	54867373	0.000000	0.05858	0.772000	0.31596	0.023000	0.10783	-0.898000	0.04105	1.353000	0.45828	0.185000	0.17295	CTC	.	.	.	none		0.428	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391160.1	NM_001005274	
ETS1	2113	hgsc.bcm.edu	37	11	128360461	128360461	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr11:128360461A>T	ENST00000319397.6	-	2	402	c.93T>A	c.(91-93)tgT>tgA	p.C31*	ETS1_ENST00000345075.4_Nonsense_Mutation_p.C31*|ETS1_ENST00000531611.1_Nonsense_Mutation_p.C31*|ETS1_ENST00000535549.1_Intron|ETS1_ENST00000392668.4_Nonsense_Mutation_p.C75*|ETS1_ENST00000526145.2_Nonsense_Mutation_p.C31*	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	31					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GGACATCTGCACATTCCATAT	0.363																																					p.C75X		Atlas-SNP	.											.	ETS1	123	.	0			c.T225A						PASS	.						110.0	104.0	106.0					11																	128360461		2201	4297	6498	SO:0001587	stop_gained	2113	exon4			ATCTGCACATTCC		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.93T>A	chr11.hg19:g.128360461A>T	ENSP00000324578:p.Cys31*	76.0	0.0	.		68.0	26.0	.	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Nonsense_Mutation	SNP	ENST00000319397.6	hg19	CCDS8475.1	.	.	.	.	.	.	.	.	.	.	A	38	6.929848	0.97944	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	.	.	.	5.65	2.0	0.26442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	9.4666	0.38817	0.796:0.0:0.204:0.0	.	.	.	.	X	31;75;31;31;31	.	ENSP00000324578:C31X	C	-	3	2	ETS1	127865671	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.583000	0.36579	0.084000	0.17077	-0.376000	0.06991	TGT	.	.	.	none		0.363	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238	
SLC6A13	6540	hgsc.bcm.edu	37	12	335609	335609	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr12:335609A>G	ENST00000343164.4	-	9	1059	c.1007T>C	c.(1006-1008)cTg>cCg	p.L336P	SLC6A13_ENST00000539668.1_5'Flank|SLC6A13_ENST00000445055.2_Missense_Mutation_p.L244P	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	336					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CATGAAGCCCAGGATGGAGAA	0.622																																					p.L336P		Atlas-SNP	.											.	SLC6A13	62	.	0			c.T1007C						PASS	.						64.0	58.0	60.0					12																	335609		2203	4300	6503	SO:0001583	missense	6540	exon9			AAGCCCAGGATGG	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1007T>C	chr12.hg19:g.335609A>G	ENSP00000339260:p.Leu336Pro	58.0	0.0	.		77.0	46.0	.	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	hg19	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.496459	0.85069	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	D;D	0.83075	-1.68;-1.68	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.95462	0.8526	H	0.99634	4.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.996	D	0.97664	1.0162	10	0.87932	D	0	.	15.3028	0.73966	1.0:0.0:0.0:0.0	.	244;315;336	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	P	244;315;336	ENSP00000407104:L244P;ENSP00000339260:L336P	ENSP00000318097:L315P	L	-	2	0	SLC6A13	205870	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.260000	0.95568	2.010000	0.58986	0.402000	0.26972	CTG	.	.	.	none		0.622	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
TAS2R20	259295	hgsc.bcm.edu	37	12	11150353	11150353	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr12:11150353A>T	ENST00000538986.1	-	1	121	c.122T>A	c.(121-123)aTc>aAc	p.I41N	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	41					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						AGCTGAGGAGATCTTTTGTCT	0.378																																					p.I41N		Atlas-SNP	.											.	TAS2R20	17	.	0			c.T122A						PASS	.						42.0	47.0	45.0					12																	11150353		2203	4300	6503	SO:0001583	missense	259295	exon1			GAGGAGATCTTTT	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.122T>A	chr12.hg19:g.11150353A>T	ENSP00000441624:p.Ile41Asn	75.0	0.0	.		100.0	63.0	.	NM_176889	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	hg19	CCDS8639.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.174148	0.38413	.	.	ENSG00000255837	ENST00000538986	T	0.00966	5.49	2.77	2.77	0.32553	.	2.834990	0.02303	U	0.071363	T	0.10252	0.0251	H	0.95437	3.67	0.09310	N	1	D	0.67145	0.996	D	0.75020	0.985	T	0.13469	-1.0508	10	0.87932	D	0	.	8.9683	0.35890	1.0:0.0:0.0:0.0	.	41	P59543	T2R20_HUMAN	N	41	ENSP00000441624:I41N	ENSP00000441624:I41N	I	-	2	0	TAS2R20	11041620	0.002000	0.14202	0.015000	0.15790	0.002000	0.02628	1.473000	0.35387	1.279000	0.44446	0.482000	0.46254	ATC	.	.	.	none		0.378	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
TBC1D15	64786	hgsc.bcm.edu	37	12	72288466	72288466	+	Splice_Site	SNP	A	A	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr12:72288466A>T	ENST00000550746.1	+	8	773	c.709A>T	c.(709-711)Aaa>Taa	p.K237*	TBC1D15_ENST00000393309.3_5'UTR|TBC1D15_ENST00000319106.8_Splice_Site_p.K228*|TBC1D15_ENST00000485960.2_Splice_Site_p.K220*	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	237					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TACTGCATAGAAAATTAAAAA	0.323																																					p.K237X		Atlas-SNP	.											.	TBC1D15	99	.	0			c.A709T						PASS	.						39.0	42.0	41.0					12																	72288466		2199	4297	6496	SO:0001630	splice_region_variant	64786	exon8			GCATAGAAAATTA	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.709-1A>T	chr12.hg19:g.72288466A>T		90.0	0.0	.		97.0	51.0	.	NM_022771	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Nonsense_Mutation	SNP	ENST00000550746.1	hg19	CCDS31858.1	.	.	.	.	.	.	.	.	.	.	A	37	6.212367	0.97380	.	.	ENSG00000121749	ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.4381	15.2064	0.73183	1.0:0.0:0.0:0.0	.	.	.	.	X	237;121;228;220	.	.	K	+	1	0	TBC1D15	70574733	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.336000	0.96533	1.999000	0.58509	0.473000	0.43528	AAA	.	.	.	none		0.323	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351266.2	NM_022771	Nonsense_Mutation
GALNT4	8693	hgsc.bcm.edu	37	12	89918277	89918277	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr12:89918277A>C	ENST00000529983.2	-	1	306	c.50T>G	c.(49-51)tTt>tGt	p.F17C	POC1B-GALNT4_ENST00000547474.1_Intron|GALNT4_ENST00000413530.1_Intron|POC1B_ENST00000313546.3_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000549035.1_Intron|RP11-734K2.4_ENST00000605233.1_RNA|POC1B_ENST00000541909.1_Intron|POC1B_ENST00000393179.4_Intron|POC1B-GALNT4_ENST00000548729.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	17					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						CACTGTTAAAAACGCCAGCAG	0.617											OREG0022018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F17C		Atlas-SNP	.											.	GALNT4	38	.	0			c.T50G						PASS	.						27.0	30.0	29.0					12																	89918277		1943	4137	6080	SO:0001583	missense	8693	exon1			GTTAAAAACGCCA	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.50T>G	chr12.hg19:g.89918277A>C	ENSP00000436604:p.Phe17Cys	59.0	0.0	.	1271	56.0	24.0	.	NM_003774	B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	hg19	CCDS53817.1	.	.	.	.	.	.	.	.	.	.	A	12.83	2.054156	0.36277	.	.	ENSG00000257594	ENST00000529983	T	0.54071	0.59	5.68	1.85	0.25348	.	.	.	.	.	T	0.30135	0.0755	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16630	-1.0396	8	.	.	.	.	6.3543	0.21393	0.7004:0.1382:0.1614:0.0	.	17	Q8N4A0	GALT4_HUMAN	C	17	ENSP00000436604:F17C	.	F	-	2	0	GALNT4	88442408	0.499000	0.26083	0.374000	0.26016	0.715000	0.41141	3.427000	0.52785	0.991000	0.38814	0.482000	0.46254	TTT	.	.	.	none		0.617	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774	
SLC7A1	6541	hgsc.bcm.edu	37	13	30091728	30091728	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr13:30091728T>C	ENST00000380752.5	-	10	1878	c.1492A>G	c.(1492-1494)Att>Gtt	p.I498V	SLC7A1_ENST00000473577.1_5'UTR	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	498					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CTGGTTGAAATGTTCACAATT	0.498																																					p.I498V		Atlas-SNP	.											.	SLC7A1	64	.	0			c.A1492G						PASS	.						158.0	156.0	156.0					13																	30091728		2203	4300	6503	SO:0001583	missense	6541	exon10			TTGAAATGTTCAC	AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1492A>G	chr13.hg19:g.30091728T>C	ENSP00000370128:p.Ile498Val	293.0	0.0	.		323.0	93.0	.	NM_003045	Q5JR50	Missense_Mutation	SNP	ENST00000380752.5	hg19	CCDS9333.1	.	.	.	.	.	.	.	.	.	.	T	2.607	-0.291568	0.05568	.	.	ENSG00000139514	ENST00000380752	D	0.85861	-2.04	5.24	-1.65	0.08291	.	0.538057	0.20369	N	0.093684	T	0.69459	0.3113	N	0.17312	0.475	0.41573	D	0.988693	B	0.02656	0.0	B	0.04013	0.001	T	0.52859	-0.8519	10	0.17369	T	0.5	.	12.2085	0.54365	0.0:0.4844:0.0:0.5156	.	498	P30825	CTR1_HUMAN	V	498	ENSP00000370128:I498V	ENSP00000370128:I498V	I	-	1	0	SLC7A1	28989728	0.018000	0.18449	0.984000	0.44739	0.561000	0.35649	-0.909000	0.04058	-0.145000	0.11294	-0.264000	0.10439	ATT	.	.	.	none		0.498	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044337.2	NM_003045	
TRIP4	9325	hgsc.bcm.edu	37	15	64702017	64702017	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr15:64702017T>C	ENST00000261884.3	+	7	1093	c.1033T>C	c.(1033-1035)Tat>Cat	p.Y345H		NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	345					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						ACTAGCAGAGTATCATAGCAG	0.428																																					p.Y345H		Atlas-SNP	.											.	TRIP4	43	.	0			c.T1033C						PASS	.						77.0	77.0	77.0					15																	64702017		2203	4300	6503	SO:0001583	missense	9325	exon7			GCAGAGTATCATA	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.1033T>C	chr15.hg19:g.64702017T>C	ENSP00000261884:p.Tyr345His	83.0	0.0	.		75.0	25.0	.	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	hg19	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.668883	0.67814	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.77705	0.4170	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.74805	-0.3540	9	0.17369	T	0.5	-24.5764	16.1616	0.81721	0.0:0.0:0.0:1.0	.	345	Q15650	TRIP4_HUMAN	H	345	.	ENSP00000261884:Y345H	Y	+	1	0	TRIP4	62489070	1.000000	0.71417	0.980000	0.43619	0.327000	0.28475	7.628000	0.83189	2.221000	0.72209	0.454000	0.30748	TAT	.	.	.	none		0.428	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
ADCY9	115	hgsc.bcm.edu	37	16	4165346	4165346	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr16:4165346T>G	ENST00000294016.3	-	2	636	c.98A>C	c.(97-99)aAc>aCc	p.N33T		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	33					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTGCTTGGGGTTGATCTTGAC	0.637																																					p.N33T		Atlas-SNP	.											.	ADCY9	151	.	0			c.A98C						PASS	.						91.0	66.0	75.0					16																	4165346		2197	4300	6497	SO:0001583	missense	115	exon2			TTGGGGTTGATCT	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.98A>C	chr16.hg19:g.4165346T>G	ENSP00000294016:p.Asn33Thr	23.0	0.0	.		29.0	12.0	.	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	hg19	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	T	7.635	0.679628	0.14907	.	.	ENSG00000162104	ENST00000294016	T	0.27402	1.67	4.98	3.87	0.44632	.	0.478928	0.24490	N	0.038068	T	0.23094	0.0558	L	0.34521	1.04	0.37612	D	0.920957	B	0.23442	0.085	B	0.16289	0.015	T	0.07501	-1.0769	10	0.49607	T	0.09	.	11.1518	0.48464	0.0:0.0:0.1549:0.8451	.	33	O60503	ADCY9_HUMAN	T	33	ENSP00000294016:N33T	ENSP00000294016:N33T	N	-	2	0	ADCY9	4105347	1.000000	0.71417	0.997000	0.53966	0.064000	0.16182	4.786000	0.62425	0.728000	0.32382	-0.477000	0.04895	AAC	.	.	.	none		0.637	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
SUPT6H	6830	hgsc.bcm.edu	37	17	27002076	27002076	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr17:27002076T>C	ENST00000314616.6	+	5	717	c.434T>C	c.(433-435)aTt>aCt	p.I145T	SUPT6H_ENST00000347486.4_Missense_Mutation_p.I145T|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	145	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AAAGAAGCTATTGCGGAAGAA	0.527																																					p.I145T		Atlas-SNP	.											.	SUPT6H	165	.	0			c.T434C						PASS	.						86.0	80.0	82.0					17																	27002076		2203	4300	6503	SO:0001583	missense	6830	exon5			AAGCTATTGCGGA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.434T>C	chr17.hg19:g.27002076T>C	ENSP00000319104:p.Ile145Thr	49.0	0.0	.		82.0	25.0	.	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	hg19	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.186987	0.57909	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.75889	0.3911	M	0.79693	2.465	0.80722	D	1	P	0.50156	0.932	P	0.58520	0.84	T	0.73655	-0.3914	9	0.17832	T	0.49	-10.4269	15.9812	0.80111	0.0:0.0:0.0:1.0	.	145	Q7KZ85	SPT6H_HUMAN	T	145	.	ENSP00000319104:I145T	I	+	2	0	SUPT6H	24026203	1.000000	0.71417	0.995000	0.50966	0.833000	0.47200	7.328000	0.79160	2.178000	0.69098	0.533000	0.62120	ATT	.	.	.	none		0.527	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
SF3A2	8175	hgsc.bcm.edu	37	19	2248401	2248401	+	Silent	SNP	G	G	A	rs375562170	byFrequency	TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr19:2248401G>A	ENST00000221494.5	+	9	1669	c.1251G>A	c.(1249-1251)tcG>tcA	p.S417S	AMH_ENST00000221496.4_5'Flank|MIR4321_ENST00000592276.1_RNA	NM_007165.4	NP_009096.2	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2, 66kDa	417	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCATCCGTCGGCTCCTGGGG	0.711													G|||	6	0.00119808	0.0045	0.0	5008	,	,		7987	0.0		0.0	False		,,,				2504	0.0				p.S417S		Atlas-SNP	.											.	SF3A2	22	.	0			c.G1251A						PASS	.	G		29,3801		0,29,1886	5.0	6.0	6.0		1251	-3.8	0.1	19		6	0,8044		0,0,4022	no	coding-synonymous	SF3A2	NM_007165.4		0,29,5908	AA,AG,GG		0.0,0.7572,0.2442		417/465	2248401	29,11845	1915	4022	5937	SO:0001819	synonymous_variant	8175	exon9			TCCGTCGGCTCCT	L21990	CCDS12084.1	19p13.3	2012-10-02	2002-08-29		ENSG00000104897	ENSG00000104897			10766	protein-coding gene	gene with protein product		600796	"""splicing factor 3a, subunit 2, 66kD"""			8211113, 8541848	Standard	NM_007165		Approved	SF3a66, SAP62, PRPF11, Prp11	uc002lvg.3	Q15428	OTTHUMG00000180414	ENST00000221494.5:c.1251G>A	chr19.hg19:g.2248401G>A		1.0	0.0	.		9.0	4.0	.	NM_007165	B2RBU1|D6W605|O75245	Silent	SNP	ENST00000221494.5	hg19	CCDS12084.1																																																																																			.	.	.	weak		0.711	SF3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451268.3		
NDUFB7	4713	hgsc.bcm.edu	37	19	14677078	14677078	+	Splice_Site	SNP	C	C	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr19:14677078C>A	ENST00000215565.2	-	3	343		c.e3-1			NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CATCACATAGCTGGGGGAAAA	0.667																																					.		Atlas-SNP	.											.	NDUFB7	14	.	0			c.282-1G>T						PASS	.						38.0	42.0	40.0					19																	14677078		2202	4300	6502	SO:0001630	splice_region_variant	4713	exon4			ACATAGCTGGGGG		CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.282-1G>T	chr19.hg19:g.14677078C>A		97.0	0.0	.		78.0	35.0	.	NM_004146	Q6ICN9|Q9UI16	Splice_Site	SNP	ENST00000215565.2	hg19	CCDS12314.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190561	0.58017	.	.	ENSG00000099795	ENST00000215565	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4537	0.84003	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NDUFB7	14538078	1.000000	0.71417	0.999000	0.59377	0.454000	0.32378	7.184000	0.77705	2.493000	0.84123	0.460000	0.39030	.	.	.	.	none		0.667	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466025.1	NM_004146	Intron
SRSF6	6431	hgsc.bcm.edu	37	20	42087023	42087023	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr20:42087023G>A	ENST00000244020.3	+	2	236	c.130G>A	c.(130-132)Gac>Aac	p.D44N		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	44	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)	p.D44N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						GGAGTTCGAGGACTCCCGCGA	0.716																																					p.D44N		Atlas-SNP	.											SRSF6_ENST00000244020,NS,carcinoma,0,1	SRSF6	37	.	1	Substitution - Missense(1)	lung(1)	c.G130A						PASS	.						8.0	7.0	8.0					20																	42087023		2096	4170	6266	SO:0001583	missense	6431	exon2			TTCGAGGACTCCC	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.130G>A	chr20.hg19:g.42087023G>A	ENSP00000244020:p.Asp44Asn	14.0	0.0	.		17.0	9.0	.	NM_006275	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	hg19	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	g	26.3	4.719681	0.89205	.	.	ENSG00000124193	ENST00000244020	T	0.75050	-0.9	3.59	3.59	0.41128	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.054648	0.64402	D	0.000001	T	0.79581	0.4470	L	0.43598	1.365	0.80722	D	1	D;D	0.65815	0.995;0.986	D;P	0.63597	0.916;0.838	T	0.82418	-0.0467	10	0.87932	D	0	.	14.2003	0.65699	0.0:0.0:1.0:0.0	.	44;44	Q13247;A8K588	SRSF6_HUMAN;.	N	44	ENSP00000244020:D44N	ENSP00000244020:D44N	D	+	1	0	SRSF6	41520437	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	8.758000	0.91663	1.838000	0.53458	0.552000	0.68991	GAC	.	.	.	none		0.716	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
SEC14L4	284904	hgsc.bcm.edu	37	22	30891293	30891293	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr22:30891293C>T	ENST00000255858.7	-	5	454	c.371G>A	c.(370-372)cGc>cAc	p.R124H	RP4-539M6.14_ENST00000442126.1_RNA|SEC14L4_ENST00000381982.3_Missense_Mutation_p.R124H|SEC14L4_ENST00000392772.2_Missense_Mutation_p.R70H|SEC14L4_ENST00000540456.1_Missense_Mutation_p.R109H|RP4-539M6.14_ENST00000610156.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	124	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.		R -> G (in dbSNP:rs9606739).			integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	GACTTTGATGCGCTTCCGGAT	0.572																																					p.R124H		Atlas-SNP	.											.	SEC14L4	43	.	0			c.G371A						PASS	.						72.0	62.0	65.0					22																	30891293		2203	4300	6503	SO:0001583	missense	284904	exon5			TTGATGCGCTTCC	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.371G>A	chr22.hg19:g.30891293C>T	ENSP00000255858:p.Arg124His	52.0	0.0	.		40.0	17.0	.	NM_001161368	A5D6W7|A6NCV4	Missense_Mutation	SNP	ENST00000255858.7	hg19	CCDS13878.1	.	.	.	.	.	.	.	.	.	.	c	18.44	3.623875	0.66901	.	.	ENSG00000133488	ENST00000255858;ENST00000540456;ENST00000392772;ENST00000381982	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	4.9	2.77	0.32553	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.077270	0.52532	D	0.000077	T	0.65954	0.2741	N	0.16790	0.44	0.80722	D	1	D;D;D	0.65815	0.991;0.995;0.985	P;P;P	0.61397	0.871;0.888;0.75	T	0.60796	-0.7192	10	0.14252	T	0.57	-11.5328	5.6156	0.17430	0.0:0.6061:0.0:0.3939	.	70;109;124	B3KSF0;G3V1L4;Q9UDX3	.;.;S14L4_HUMAN	H	124;109;70;124	ENSP00000255858:R124H;ENSP00000440848:R109H;ENSP00000376525:R70H;ENSP00000371412:R124H	ENSP00000255858:R124H	R	-	2	0	SEC14L4	29221293	0.996000	0.38824	0.131000	0.22000	0.495000	0.33615	2.090000	0.41682	1.169000	0.42739	0.655000	0.94253	CGC	.	.	.	none		0.572	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
YWHAH	7533	hgsc.bcm.edu	37	22	32352660	32352660	+	Silent	SNP	C	C	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr22:32352660C>T	ENST00000248975.5	+	2	895	c.622C>T	c.(622-624)Ctg>Ttg	p.L208L	YWHAH_ENST00000471374.1_3'UTR|YWHAH_ENST00000397492.1_3'UTR	NM_003405.3	NP_003396.1	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta	208					apoptotic process (GO:0006915)|glucocorticoid catabolic process (GO:0006713)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular protein transport (GO:0006886)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane depolarization during action potential (GO:0086010)|membrane organization (GO:0061024)|negative regulation of dendrite morphogenesis (GO:0050774)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of sodium ion transport (GO:0002028)|regulation of synaptic plasticity (GO:0048167)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|glucocorticoid receptor binding (GO:0035259)|insulin-like growth factor receptor binding (GO:0005159)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|large_intestine(1)|upper_aerodigestive_tract(1)	4						CATAGCTGAGCTGGACACACT	0.527																																					p.L208L	Ovarian(98;460 2060 9263 44007)	Atlas-SNP	.											.	YWHAH	14	.	0			c.C622T						PASS	.						72.0	55.0	61.0					22																	32352660		2203	4300	6503	SO:0001819	synonymous_variant	7533	exon2			GCTGAGCTGGACA	X78138	CCDS13901.1	22q12.1-q13.1	2013-12-03	2013-12-03		ENSG00000128245	ENSG00000128245			12853	protein-coding gene	gene with protein product	"""14-3-3 eta"""	113508	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide"""	YWHA1			Standard	NM_003405		Approved		uc003alz.3	Q04917	OTTHUMG00000030833	ENST00000248975.5:c.622C>T	chr22.hg19:g.32352660C>T		43.0	0.0	.		34.0	18.0	.	NM_003405		Silent	SNP	ENST00000248975.5	hg19	CCDS13901.1																																																																																			.	.	.	none		0.527	YWHAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075721.2	NM_003405	
WNK3	65267	hgsc.bcm.edu	37	X	54319393	54319393	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chrX:54319393A>T	ENST00000375159.2	-	9	1964	c.1965T>A	c.(1963-1965)caT>caA	p.H655Q	WNK3_ENST00000354646.2_Missense_Mutation_p.H655Q|WNK3_ENST00000375169.3_Missense_Mutation_p.H655Q			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	655					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						GTCCAAGGACATGTACAGGTA	0.418																																					p.H655Q		Atlas-SNP	.											.	WNK3	218	.	0			c.T1965A						PASS	.						100.0	87.0	92.0					X																	54319393		2203	4300	6503	SO:0001583	missense	65267	exon10			AAGGACATGTACA	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1965T>A	chrX.hg19:g.54319393A>T	ENSP00000364301:p.His655Gln	46.0	0.0	.		28.0	21.0	.	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	hg19	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	A	1.564	-0.535847	0.04082	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.42131	0.98;0.98;0.98	5.21	2.73	0.32206	.	0.631512	0.14072	N	0.343324	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B;B	0.12013	0.0;0.005	B;B	0.10450	0.003;0.005	T	0.22312	-1.0220	10	0.22109	T	0.4	-0.9144	4.0626	0.09846	0.7167:0.0:0.1006:0.1826	.	655;655	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	Q	655	ENSP00000364312:H655Q;ENSP00000346667:H655Q;ENSP00000364301:H655Q	ENSP00000346667:H655Q	H	-	3	2	WNK3	54336118	0.769000	0.28531	0.170000	0.22879	0.756000	0.42949	1.264000	0.33015	0.220000	0.20860	0.451000	0.29950	CAT	.	.	.	none		0.418	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
CMBL	134147	hgsc.bcm.edu	37	5	10288604	10288609	+	In_Frame_Del	DEL	AAGGCT	AAGGCT	-			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	AAGGCT	AAGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr5:10288604_10288609delAAGGCT	ENST00000296658.3	-	3	668_673	c.248_253delAGCCTT	c.(247-255)gagccttgg>ggg	p.83_85EPW>G	CMBL_ENST00000510532.1_5'UTR	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	83						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						GAGGGGTCCCAAGGCTCTTGCCCTAC	0.456																																					p.83_85del		Atlas-INDEL	.											.	CMBL	24	.	0			c.249_254del						PASS	.																																			SO:0001651	inframe_deletion	134147	exon3			.		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.248_253delAGCCTT	chr5.hg19:g.10288604_10288609delAAGGCT	ENSP00000296658:p.Glu83_Trp85delinsGly	131.0	0.0	0		101.0	32.0	0.316832	NM_138809	D3DTC7|Q8TED6	In_Frame_Del	DEL	ENST00000296658.3	hg19	CCDS3878.1																																																																																			.	.	.	none		0.456	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
OR4K1	79544	hgsc.bcm.edu	37	14	20404312	20404313	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr14:20404312_20404313delAC	ENST00000285600.4	+	1	546_547	c.487_488delAC	c.(487-489)acafs	p.T163fs		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CTTGGCTTTTACAGTGGACCTG	0.465																																					p.162_163del		Atlas-INDEL	.											.	OR4K1	108	.	0			c.486_487del						PASS	.																																			SO:0001589	frameshift_variant	79544	exon1			.		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.487_488delAC	chr14.hg19:g.20404312_20404313delAC	ENSP00000285600:p.Thr163fs	105.0	0.0	0		114.0	48.0	0.421053	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Frame_Shift_Del	DEL	ENST00000285600.4	hg19	CCDS32025.1																																																																																			.	.	.	none		0.465	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
ZNF681	148213	hgsc.bcm.edu	37	19	23927477	23927484	+	Frame_Shift_Del	DEL	TTAAAGGC	TTAAAGGC	-			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	TTAAAGGC	TTAAAGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr19:23927477_23927484delTTAAAGGC	ENST00000402377.3	-	4	1009_1016	c.868_875delGCCTTTAA	c.(868-876)gcctttaatfs	p.AFN290fs	ZNF681_ENST00000395385.3_Frame_Shift_Del_p.AFN221fs	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TAAGGACTGATTAAAGGCTTTGTCACAT	0.375																																					p.290_292del		Atlas-INDEL	.											.	ZNF681	76	.	0			c.869_876del						PASS	.																																			SO:0001589	frameshift_variant	148213	exon4			.	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.868_875delGCCTTTAA	chr19.hg19:g.23927477_23927484delTTAAAGGC	ENSP00000384000:p.Ala290fs	165.0	0.0	0		108.0	28.0	0.259259	NM_138286	B3KVF7	Frame_Shift_Del	DEL	ENST00000402377.3	hg19	CCDS12414.2																																																																																			.	.	.	none		0.375	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
CPEB4	80315	hgsc.bcm.edu	37	5	173317605	173317605	+	Frame_Shift_Del	DEL	G	G	-	rs372054497		TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr5:173317605delG	ENST00000265085.5	+	1	2323	c.869delG	c.(868-870)agtfs	p.S290fs	CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000334035.5_Frame_Shift_Del_p.S290fs|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000519835.1_Frame_Shift_Del_p.S290fs|CPEB4_ENST00000520867.1_Frame_Shift_Del_p.S290fs	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	290					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGCTACCAGAGTCCGTCACCA	0.572																																					p.S290fs		Atlas-INDEL	.											.	CPEB4	54	.	0			c.868delA						PASS	.						148.0	161.0	157.0					5																	173317605		2203	4300	6503	SO:0001589	frameshift_variant	80315	exon1			.	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.869delG	chr5.hg19:g.173317605delG	ENSP00000265085:p.Ser290fs	376.0	0.0	0		277.0	108.0	0.389892	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Frame_Shift_Del	DEL	ENST00000265085.5	hg19	CCDS4390.1																																																																																			.	.	.	none		0.572	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
C10orf95	79946	hgsc.bcm.edu	37	10	104211148	104211149	+	Frame_Shift_Ins	INS	-	-	C	rs144830667		TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr10:104211148_104211149insC	ENST00000239125.1	-	1	151_152	c.77_78insG	c.(76-78)ggafs	p.G26fs	RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000492465.2_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	26										liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		CTCACTTGTCTCCTTCAGCCTT	0.639																																					p.G26fs		Atlas-INDEL	.											.	C10orf95	5	.	0			c.78_79insG						PASS	.																																			SO:0001589	frameshift_variant	79946	exon1			.	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.78dupG	chr10.hg19:g.104211150_104211150dupC	ENSP00000239125:p.Gly26fs	55.0	0.0	0		42.0	18.0	0.428571	NM_024886	A0AVQ7	Frame_Shift_Ins	INS	ENST00000239125.1	hg19	CCDS7534.1																																																																																			.	.	.	none		0.639	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
GAPDH	2597	hgsc.bcm.edu	37	12	6646478	6646485	+	Frame_Shift_Del	DEL	TGCCTCCT	TGCCTCCT	-			TCGA-DW-5561-01A-01D-1589-08	TCGA-DW-5561-10A-01D-1589-08	TGCCTCCT	TGCCTCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7722e078-7471-43c1-85f8-2a36938fe489	2c3eb624-d770-4d82-b225-1b58054242b7	g.chr12:6646478_6646485delTGCCTCCT	ENST00000229239.5	+	7	1113_1120	c.447_454delTGCCTCCT	c.(445-456)aatgcctcctgcfs	p.NASC149fs	GAPDH_ENST00000396856.1_Frame_Shift_Del_p.NASC74fs|RP5-940J5.9_ENST00000602946.1_RNA|GAPDH_ENST00000396861.1_Frame_Shift_Del_p.NASC149fs|GAPDH_ENST00000396859.1_Frame_Shift_Del_p.NASC149fs|GAPDH_ENST00000396858.1_Frame_Shift_Del_p.NASC107fs	NM_002046.4	NP_002037.2	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	149					carbohydrate metabolic process (GO:0005975)|cellular response to interferon-gamma (GO:0071346)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of translation (GO:0017148)|neuron apoptotic process (GO:0051402)|peptidyl-cysteine S-trans-nitrosylation (GO:0035606)|protein stabilization (GO:0050821)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GAIT complex (GO:0097452)|lipid particle (GO:0005811)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|identical protein binding (GO:0042802)|microtubule binding (GO:0008017)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|peptidyl-cysteine S-nitrosylase activity (GO:0035605)			central_nervous_system(1)|cervix(1)|endometrium(1)|lung(4)	7						TTTGCAGCAATGCCTCCTGCACCACCAA	0.596																																					p.149_151del		Atlas-INDEL	.											.	GAPDH	20	.	0			c.446_453del						PASS	.																																			SO:0001589	frameshift_variant	2597	exon7			.	AF261085	CCDS8549.1, CCDS58201.1	12p13.31	2012-10-02		2005-05-06	ENSG00000111640	ENSG00000111640	1.2.1.12		4141	protein-coding gene	gene with protein product		138400		GAPD		3170585	Standard	NM_002046		Approved		uc001qop.2	P04406	OTTHUMG00000137379	ENST00000229239.5:c.447_454delTGCCTCCT	chr12.hg19:g.6646478_6646485delTGCCTCCT	ENSP00000229239:p.Asn149fs	37.0	0.0	0		43.0	10.0	0.232558	NM_002046	E7EUT4|P00354|Q53X65	Frame_Shift_Del	DEL	ENST00000229239.5	hg19	CCDS8549.1																																																																																			.	.	.	none		0.596	GAPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268059.1	NM_002046	
