#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PEF1	553115	hgsc.bcm.edu	37	1	32100955	32100955	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:32100955C>A	ENST00000373703.4	-	2	215	c.193G>T	c.(193-195)Gga>Tga	p.G65*	PEF1_ENST00000440872.2_Nonsense_Mutation_p.G65*|PEF1_ENST00000492061.1_5'UTR	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	65	9 X 9 AA approximate tandem repeat of [AP]-P-G-G-P-Y-G-G-P-P.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		TTGGGGTGTCCATAGGGCCCT	0.627																																					p.G65X		Atlas-SNP	.											.	PEF1	20	.	0			c.G193T						PASS	.						23.0	25.0	25.0					1																	32100955		2203	4299	6502	SO:0001587	stop_gained	553115	exon2			GGTGTCCATAGGG		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.193G>T	chr1.hg19:g.32100955C>A	ENSP00000362807:p.Gly65*	45.0	0.0	.		51.0	18.0	.	NM_012392		Nonsense_Mutation	SNP	ENST00000373703.4	hg19	CCDS345.1	.	.	.	.	.	.	.	.	.	.	C	34	5.384325	0.95967	.	.	ENSG00000162517	ENST00000373703;ENST00000440872	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	17.2908	0.87156	0.0:1.0:0.0:0.0	.	.	.	.	X	65	.	ENSP00000362807:G65X	G	-	1	0	PEF1	31873542	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	6.128000	0.71650	2.541000	0.85698	0.561000	0.74099	GGA	.	.	.	none		0.627	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011046.1	NM_012392	
DEDD	9191	hgsc.bcm.edu	37	1	161092019	161092019	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:161092019A>C	ENST00000368006.3	-	6	1089	c.875T>G	c.(874-876)cTg>cGg	p.L292R	DEDD_ENST00000490843.2_Missense_Mutation_p.L292R|DEDD_ENST00000392188.1_Missense_Mutation_p.L322R|DEDD_ENST00000458050.2_Missense_Mutation_p.L292R|DEDD_ENST00000489249.1_5'UTR|DEDD_ENST00000368005.1_Missense_Mutation_p.L322R|NIT1_ENST00000368008.1_Intron|DEDD_ENST00000545495.1_Missense_Mutation_p.L292R	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	292					decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ATTTACCAGCAGCTTGATGGC	0.498																																					p.L292R		Atlas-SNP	.											.	DEDD	22	.	0			c.T875G						PASS	.						100.0	93.0	95.0					1																	161092019		2203	4300	6503	SO:0001583	missense	9191	exon5			ACCAGCAGCTTGA	AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.875T>G	chr1.hg19:g.161092019A>C	ENSP00000356985:p.Leu292Arg	95.0	0.0	.		95.0	32.0	.	NM_001039711	D3DVF5|O60737	Missense_Mutation	SNP	ENST00000368006.3	hg19	CCDS1219.1	.	.	.	.	.	.	.	.	.	.	A	19.68	3.871963	0.72180	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.70386	0.3218	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.87578	0.998;0.997;0.996	T	0.74948	-0.3490	9	0.87932	D	0	.	13.2065	0.59800	1.0:0.0:0.0:0.0	.	249;322;292	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	R	292;322;292;292;292;322;249	.	ENSP00000356984:L322R	L	-	2	0	DEDD	159358643	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.135000	0.94478	2.209000	0.71365	0.533000	0.62120	CTG	.	.	.	none		0.498	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080582.1	NM_004216	
RGS1	5996	hgsc.bcm.edu	37	1	192547354	192547354	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:192547354G>C	ENST00000367459.3	+	4	349	c.283G>C	c.(283-285)Ggt>Cgt	p.G95R	RGS1_ENST00000469578.2_Missense_Mutation_p.G95R	NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	95	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				CTTTTTAGCTGGTCAAAATGT	0.343																																					p.G95R		Atlas-SNP	.											.	RGS1	75	.	0			c.G283C						PASS	.						122.0	130.0	127.0					1																	192547354		2203	4300	6503	SO:0001583	missense	5996	exon4			TTAGCTGGTCAAA	AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.283G>C	chr1.hg19:g.192547354G>C	ENSP00000356429:p.Gly95Arg	187.0	0.0	.		151.0	40.0	.	NM_002922	B2RDM9|B4DZY0|Q07918|Q9H1W2	Missense_Mutation	SNP	ENST00000367459.3	hg19	CCDS1375.2	.	.	.	.	.	.	.	.	.	.	G	13.87	2.365805	0.41902	.	.	ENSG00000090104	ENST00000367459	T	0.02944	4.1	5.91	5.91	0.95273	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.25680	0.0625	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.12319	-1.0552	10	0.87932	D	0	.	18.8649	0.92287	0.0:0.0:1.0:0.0	.	95;95	Q08116-2;Q08116	.;RGS1_HUMAN	R	95	ENSP00000356429:G95R	ENSP00000356429:G95R	G	+	1	0	RGS1	190813977	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.640000	0.83355	2.804000	0.96469	0.650000	0.86243	GGT	.	.	.	none		0.343	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086391.1	NM_002922	
PLXNA2	5362	hgsc.bcm.edu	37	1	208215581	208215581	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:208215581C>T	ENST00000367033.3	-	22	4905	c.4148G>A	c.(4147-4149)cGg>cAg	p.R1383Q		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1383					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CACGTTGCCCCGGTCGCGCAT	0.582																																					p.R1383Q		Atlas-SNP	.											.	PLXNA2	178	.	0			c.G4148A						PASS	.						94.0	92.0	92.0					1																	208215581		2203	4300	6503	SO:0001583	missense	5362	exon22			TTGCCCCGGTCGC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4148G>A	chr1.hg19:g.208215581C>T	ENSP00000356000:p.Arg1383Gln	91.0	0.0	.		91.0	30.0	.	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504221	0.96371	.	.	ENSG00000076356	ENST00000367033	T	0.15718	2.4	5.15	5.15	0.70609	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49916	-0.8888	10	0.87932	D	0	.	18.6381	0.91385	0.0:1.0:0.0:0.0	.	1383	O75051	PLXA2_HUMAN	Q	1383	ENSP00000356000:R1383Q	ENSP00000356000:R1383Q	R	-	2	0	PLXNA2	206282204	1.000000	0.71417	0.980000	0.43619	0.826000	0.46750	7.480000	0.81109	2.391000	0.81399	0.455000	0.32223	CGG	.	.	.	none		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
NUP133	55746	hgsc.bcm.edu	37	1	229631732	229631732	+	Silent	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:229631732G>T	ENST00000261396.3	-	7	973	c.882C>A	c.(880-882)atC>atA	p.I294I	NUP133_ENST00000537506.1_Silent_p.I278I	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	294			I -> V (in dbSNP:rs11805194).		carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CCCATTTACTGATGTTTGAAC	0.363																																					p.I294I		Atlas-SNP	.											.	NUP133	111	.	0			c.C882A						PASS	.						105.0	101.0	103.0					1																	229631732		2203	4299	6502	SO:0001819	synonymous_variant	55746	exon7			TTTACTGATGTTT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.882C>A	chr1.hg19:g.229631732G>T		65.0	0.0	.		74.0	31.0	.	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Silent	SNP	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.	.	none		0.363	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
LPIN1	23175	hgsc.bcm.edu	37	2	11913751	11913751	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:11913751T>C	ENST00000256720.2	+	5	695	c.602T>C	c.(601-603)cTt>cCt	p.L201P	LPIN1_ENST00000425416.2_Missense_Mutation_p.L207P|LPIN1_ENST00000449576.2_Missense_Mutation_p.L250P|LPIN1_ENST00000396098.1_Missense_Mutation_p.L207P|LPIN1_ENST00000396099.1_Missense_Mutation_p.L207P	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	201					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TCCAGAACTCTTCCTAATGAT	0.358																																					p.L250P		Atlas-SNP	.											.	LPIN1	99	.	0			c.T749C						PASS	.						81.0	88.0	86.0					2																	11913751		2203	4300	6503	SO:0001583	missense	23175	exon6			GAACTCTTCCTAA	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.602T>C	chr2.hg19:g.11913751T>C	ENSP00000256720:p.Leu201Pro	127.0	0.0	.		113.0	35.0	.	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	hg19	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	T	5.891	0.348519	0.11126	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	T;D;T;T;T	0.89270	-1.47;-2.49;-1.45;-1.47;-1.47	5.6	3.27	0.37495	.	0.457402	0.18485	N	0.139836	T	0.80884	0.4709	L	0.31926	0.97	0.09310	N	0.999998	B;B;B	0.11235	0.002;0.0;0.004	B;B;B	0.11329	0.006;0.002;0.006	T	0.66929	-0.5799	10	0.31617	T	0.26	-5.5606	7.3106	0.26473	0.0:0.2849:0.0:0.7151	.	250;201;207	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	P	250;207;207;207;201	ENSP00000397908:L250P;ENSP00000379405:L207P;ENSP00000379406:L207P;ENSP00000401522:L207P;ENSP00000256720:L201P	ENSP00000256720:L201P	L	+	2	0	LPIN1	11831202	0.012000	0.17670	0.131000	0.22000	0.489000	0.33432	1.405000	0.34635	0.974000	0.38366	0.482000	0.46254	CTT	.	.	.	none		0.358	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
IFIH1	64135	hgsc.bcm.edu	37	2	163167397	163167397	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:163167397A>G	ENST00000263642.2	-	2	895	c.500T>C	c.(499-501)cTa>cCa	p.L167P	IFIH1_ENST00000421365.2_Missense_Mutation_p.L167P	NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	167	CARD 2.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CCTTTTTAGTAGCTCTCTTAC	0.358																																					p.L167P		Atlas-SNP	.											.	IFIH1	102	.	0			c.T500C						PASS	.						81.0	72.0	75.0					2																	163167397		2203	4299	6502	SO:0001583	missense	64135	exon2			TTTAGTAGCTCTC	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.500T>C	chr2.hg19:g.163167397A>G	ENSP00000263642:p.Leu167Pro	55.0	0.0	.		54.0	15.0	.	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	hg19	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318793	0.60524	.	.	ENSG00000115267	ENST00000263642;ENST00000543192;ENST00000421365	T;T	0.63255	-0.03;-0.03	5.81	5.81	0.92471	DEATH-like (2);Caspase Recruitment (1);	0.140170	0.48286	D	0.000192	T	0.79411	0.4441	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81874	-0.0732	10	0.87932	D	0	-10.3294	16.1677	0.81782	1.0:0.0:0.0:0.0	.	167;167	Q9BYX4-2;Q9BYX4	.;IFIH1_HUMAN	P	167	ENSP00000263642:L167P;ENSP00000408450:L167P	ENSP00000263642:L167P	L	-	2	0	IFIH1	162875643	0.991000	0.36638	0.999000	0.59377	0.237000	0.25408	6.182000	0.71995	2.218000	0.71995	0.528000	0.53228	CTA	.	.	.	none		0.358	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
NABP1	64859	hgsc.bcm.edu	37	2	192543405	192543405	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:192543405A>C	ENST00000425611.2	+	1	148	c.65A>C	c.(64-66)aAt>aCt	p.N22T	NABP1_ENST00000410026.2_Intron|NABP1_ENST00000409510.1_Intron	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	22					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)										AAAAACTTAAATGTCGTCTTT	0.562																																					p.N22T		Atlas-SNP	.											.	.	.	.	0			c.A65C						PASS	.						42.0	50.0	47.0					2																	192543405		2203	4300	6503	SO:0001583	missense	64859	exon1			ACTTAAATGTCGT	BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.65A>C	chr2.hg19:g.192543405A>C	ENSP00000403683:p.Asn22Thr	113.0	0.0	.		100.0	32.0	.	NM_001031716	Q658Y8|Q9H5X6	Missense_Mutation	SNP	ENST00000425611.2	hg19	CCDS33352.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527945	0.85706	.	.	ENSG00000173559	ENST00000425611	T	0.28255	1.62	5.51	5.51	0.81932	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.107337	0.64402	D	0.000007	T	0.46927	0.1418	M	0.68728	2.09	0.54753	D	0.999989	D	0.63046	0.992	P	0.59487	0.858	T	0.47522	-0.9111	10	0.56958	D	0.05	.	9.7659	0.40561	0.9219:0.0:0.0781:0.0	.	22	Q96AH0	SOSB2_HUMAN	T	22	ENSP00000403683:N22T	ENSP00000307968:N22T	N	+	2	0	OBFC2A	192251650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.953000	0.70290	2.080000	0.62538	0.533000	0.62120	AAT	.	.	.	none		0.562	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1	NM_022837	
SF3B1	23451	hgsc.bcm.edu	37	2	198274598	198274598	+	Missense_Mutation	SNP	G	G	T	rs1044635		TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:198274598G>T	ENST00000335508.6	-	7	891	c.800C>A	c.(799-801)aCt>aAt	p.T267N		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	267	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCGTCCAGGAGTAGCAGCTCC	0.562			Mis		myelodysplastic syndrome																																p.T267N		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.C800A						PASS	.						170.0	167.0	168.0					2																	198274598		2203	4300	6503	SO:0001583	missense	23451	exon7			CCAGGAGTAGCAG	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.800C>A	chr2.hg19:g.198274598G>T	ENSP00000335321:p.Thr267Asn	197.0	0.0	.		222.0	78.0	.	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179984	0.94846	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	L	0.44542	1.39	0.80722	D	1	D	0.55800	0.973	P	0.47346	0.544	T	0.53954	-0.8365	9	0.27082	T	0.32	.	19.0839	0.93194	0.0:0.0:1.0:0.0	.	267	O75533	SF3B1_HUMAN	N	267	.	ENSP00000335321:T267N	T	-	2	0	SF3B1	197982843	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.750000	0.98875	2.502000	0.84385	0.655000	0.94253	ACT	.	G|1.000;A|0.000	.	alt		0.562	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
DNAJB2	3300	hgsc.bcm.edu	37	2	220150708	220150708	+	3'UTR	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr2:220150708G>T	ENST00000336576.5	+	0	2262				DNAJB2_ENST00000392086.4_Splice_Site	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2						cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTCTCCCCAGATGTGTTCTG	0.647																																					.		Atlas-SNP	.											.	DNAJB2	31	.	0			c.824-1G>T						PASS	.						56.0	63.0	61.0					2																	220150708		2002	4166	6168	SO:0001624	3_prime_UTR_variant	3300	exon10			TCCCCAGATGTGT		CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.*999G>T	chr2.hg19:g.220150708G>T		69.0	0.0	.		67.0	4.0	.	NM_001039550	A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Splice_Site	SNP	ENST00000336576.5	hg19	CCDS2439.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782364	0.70222	.	.	ENSG00000135924	ENST00000392086	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3963	0.87446	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJB2	219858952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.413000	0.59795	2.894000	0.99253	0.655000	0.94253	.	.	.	.	none		0.647	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256823.2		
DDX60	55601	hgsc.bcm.edu	37	4	169172121	169172121	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:169172121C>T	ENST00000393743.3	-	28	4133	c.3842G>A	c.(3841-3843)aGa>aAa	p.R1281K	DDX60_ENST00000505393.1_5'Flank	NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1281	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		ATATCCTTTTCTAAAGAGGAT	0.338																																					p.R1281K		Atlas-SNP	.											.	DDX60	304	.	0			c.G3842A						PASS	.						76.0	79.0	78.0					4																	169172121		2201	4297	6498	SO:0001583	missense	55601	exon28			CCTTTTCTAAAGA	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3842G>A	chr4.hg19:g.169172121C>T	ENSP00000377344:p.Arg1281Lys	53.0	0.0	.		64.0	16.0	.	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	hg19	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096722	0.36952	.	.	ENSG00000137628	ENST00000393743	T	0.26957	1.7	5.4	5.4	0.78164	Helicase, C-terminal (3);	0.075985	0.56097	D	0.000034	T	0.27098	0.0664	L	0.39020	1.185	0.39934	D	0.974326	P	0.36768	0.569	B	0.38880	0.284	T	0.05750	-1.0866	10	0.52906	T	0.07	.	18.7821	0.91937	0.0:1.0:0.0:0.0	.	1281	Q8IY21	DDX60_HUMAN	K	1281	ENSP00000377344:R1281K	ENSP00000377344:R1281K	R	-	2	0	DDX60	169408696	1.000000	0.71417	0.408000	0.26446	0.120000	0.20174	4.958000	0.63660	2.549000	0.85964	0.467000	0.42956	AGA	.	.	.	none		0.338	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
PALLD	23022	hgsc.bcm.edu	37	4	169433375	169433375	+	Silent	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:169433375G>A	ENST00000505667.1	+	2	893	c.720G>A	c.(718-720)agG>agA	p.R240R	PALLD_ENST00000333488.4_Silent_p.R117R|PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000261509.6_Silent_p.R240R			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	240					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTGGGGCCAGGCATTGCTACC	0.597									Pancreatic Cancer, Familial Clustering of																												p.R240R	Esophageal Squamous(109;1482 1532 18347 40239 51172)	Atlas-SNP	.											.	PALLD	179	.	0			c.G720A						PASS	.						89.0	86.0	87.0					4																	169433375		2203	4300	6503	SO:0001819	synonymous_variant	23022	exon2	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	GGCCAGGCATTGC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.720G>A	chr4.hg19:g.169433375G>A		119.0	0.0	.		121.0	5.0	.	NM_001166108	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	hg19	CCDS54818.1																																																																																			.	.	.	none		0.597	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
WWC2	80014	hgsc.bcm.edu	37	4	184166688	184166688	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr4:184166688A>C	ENST00000403733.3	+	6	921	c.722A>C	c.(721-723)gAt>gCt	p.D241A	WWC2_ENST00000504005.1_Intron|WWC2_ENST00000378925.3_Missense_Mutation_p.D143A|WWC2_ENST00000448232.2_Missense_Mutation_p.D241A|WWC2_ENST00000513834.1_Missense_Mutation_p.D241A	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	241					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GAAAAACAAGATCTGATGCAG	0.433																																					p.D241A		Atlas-SNP	.											.	WWC2	78	.	0			c.A722C						PASS	.						50.0	50.0	50.0					4																	184166688		2203	4300	6503	SO:0001583	missense	80014	exon6			AACAAGATCTGAT	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.722A>C	chr4.hg19:g.184166688A>C	ENSP00000384222:p.Asp241Ala	54.0	0.0	.		50.0	14.0	.	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	hg19	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591096	0.86851	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232	T;T;T;T	0.15256	3.17;2.44;3.23;3.03	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.38904	0.1058	M	0.77820	2.39	0.58432	D	0.999999	D	0.67145	0.996	P	0.60609	0.877	T	0.15925	-1.0420	10	0.33940	T	0.23	-24.0084	15.3161	0.74078	1.0:0.0:0.0:0.0	.	241	Q6AWC2	WWC2_HUMAN	A	241;143;241;241	ENSP00000384222:D241A;ENSP00000368205:D143A;ENSP00000425054:D241A;ENSP00000398577:D241A	ENSP00000368205:D143A	D	+	2	0	WWC2	184403682	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.856000	0.92245	2.254000	0.74563	0.533000	0.62120	GAT	.	.	.	none		0.433	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
PDZD2	23037	hgsc.bcm.edu	37	5	32074625	32074625	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:32074625G>T	ENST00000438447.1	+	18	3801	c.3413G>T	c.(3412-3414)aGt>aTt	p.S1138I	PDZD2_ENST00000282493.3_Missense_Mutation_p.S1138I			O15018	PDZD2_HUMAN	PDZ domain containing 2	1138					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						GCCAAGCCCAGTGGCTCACAG	0.587																																					p.S1138I		Atlas-SNP	.											.	PDZD2	306	.	0			c.G3413T						PASS	.						42.0	42.0	42.0					5																	32074625		2203	4300	6503	SO:0001583	missense	23037	exon17			AGCCCAGTGGCTC	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3413G>T	chr5.hg19:g.32074625G>T	ENSP00000402033:p.Ser1138Ile	64.0	0.0	.		49.0	19.0	.	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	hg19	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006840	0.35415	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06933	3.24;3.24	5.21	1.07	0.20283	.	1.010820	0.07935	N	0.978210	T	0.06325	0.0163	L	0.51422	1.61	0.09310	N	1	P;B	0.37864	0.61;0.01	B;B	0.28139	0.086;0.014	T	0.38436	-0.9661	10	0.20519	T	0.43	.	4.0787	0.09916	0.1583:0.1285:0.5814:0.1318	.	964;1138	B4E3P2;O15018	.;PDZD2_HUMAN	I	1138;940;1138	ENSP00000402033:S1138I;ENSP00000282493:S1138I	ENSP00000282493:S1138I	S	+	2	0	PDZD2	32110382	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	1.151000	0.31651	0.543000	0.28864	0.655000	0.94253	AGT	.	.	.	none		0.587	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
FCHO2	115548	hgsc.bcm.edu	37	5	72383545	72383545	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:72383545A>G	ENST00000430046.2	+	25	2491	c.2375A>G	c.(2374-2376)tAt>tGt	p.Y792C	FCHO2_ENST00000341845.6_Missense_Mutation_p.Y792C|FCHO2_ENST00000512348.1_Missense_Mutation_p.Y759C	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	792	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with DAB2, EPS15, EPS15R and ITSN1.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GGCACTGGCTATAGGCTTTCC	0.398																																					p.Y792C		Atlas-SNP	.											.	FCHO2	96	.	0			c.A2375G						PASS	.						128.0	126.0	127.0					5																	72383545		1836	4085	5921	SO:0001583	missense	115548	exon25			CTGGCTATAGGCT	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.2375A>G	chr5.hg19:g.72383545A>G	ENSP00000393776:p.Tyr792Cys	213.0	0.0	.		229.0	61.0	.	NM_138782	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	hg19	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	A	15.49	2.849389	0.51270	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.54675	0.56;0.56;0.56	4.77	4.77	0.60923	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81024	-0.1120	10	0.87932	D	0	-11.6205	14.7503	0.69519	1.0:0.0:0.0:0.0	.	759;792	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	C	792;792;759	ENSP00000393776:Y792C;ENSP00000344034:Y792C;ENSP00000427296:Y759C	ENSP00000344034:Y792C	Y	+	2	0	FCHO2	72419301	1.000000	0.71417	0.960000	0.40013	0.262000	0.26303	8.705000	0.91357	2.124000	0.65301	0.528000	0.53228	TAT	.	.	.	none		0.398	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
VCAN	1462	hgsc.bcm.edu	37	5	82785943	82785943	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr5:82785943A>T	ENST00000265077.3	+	3	662	c.97A>T	c.(97-99)Agg>Tgg	p.R33W	VCAN_ENST00000513984.1_Missense_Mutation_p.R33W|VCAN_ENST00000512590.2_De_novo_Start_InFrame|VCAN_ENST00000342785.4_Missense_Mutation_p.R33W|VCAN_ENST00000343200.5_Missense_Mutation_p.R33W|VCAN_ENST00000502527.2_Missense_Mutation_p.R33W	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	33	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCCACCGGTGAGGGGCTCCCT	0.403																																					p.R33W		Atlas-SNP	.											.	VCAN	498	.	0			c.A97T						PASS	.						51.0	51.0	51.0					5																	82785943		2202	4293	6495	SO:0001583	missense	1462	exon3			CCGGTGAGGGGCT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.97A>T	chr5.hg19:g.82785943A>T	ENSP00000265077:p.Arg33Trp	102.0	0.0	.		115.0	32.0	.	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	hg19	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.672502	0.47781	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000513960;ENST00000513984;ENST00000502527	T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	5.99	2.17	0.27698	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.395914	0.24213	N	0.040512	T	0.72220	0.3433	L	0.50333	1.59	0.21064	N	0.999792	P;P;D;D;D	0.63880	0.804;0.857;0.986;0.993;0.965	P;P;P;D;P	0.66602	0.87;0.641;0.702;0.945;0.838	T	0.62613	-0.6817	10	0.72032	D	0.01	.	8.4359	0.32786	0.6885:0.2476:0.0639:0.0	.	33;33;33;33;33	P13611-3;P13611-4;P13611-2;P13611;Q86W61	.;.;.;CSPG2_HUMAN;.	W	33	ENSP00000265077:R33W;ENSP00000340062:R33W;ENSP00000342768:R33W;ENSP00000426251:R33W;ENSP00000426715:R33W;ENSP00000421362:R33W	ENSP00000265077:R33W	R	+	1	2	VCAN	82821699	0.054000	0.20591	0.027000	0.17364	0.046000	0.14306	1.559000	0.36320	0.134000	0.18681	-0.316000	0.08728	AGG	.	.	.	none		0.403	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VARS2	57176	hgsc.bcm.edu	37	6	30888201	30888201	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:30888201T>C	ENST00000321897.5	+	13	2017	c.1385T>C	c.(1384-1386)cTg>cCg	p.L462P	VARS2_ENST00000416670.2_Missense_Mutation_p.L462P|VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000542001.1_Missense_Mutation_p.L322P|VARS2_ENST00000541562.1_Missense_Mutation_p.L492P			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	462					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						CCCATGGTACTGCCCATCTGC	0.527																																					p.L492P		Atlas-SNP	.											.	VARS2	60	.	0			c.T1475C						PASS	.						41.0	43.0	42.0					6																	30888201		2203	4300	6503	SO:0001583	missense	57176	exon14			TGGTACTGCCCAT	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1385T>C	chr6.hg19:g.30888201T>C	ENSP00000316092:p.Leu462Pro	48.0	0.0	.		61.0	19.0	.	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	hg19	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.777854	0.70107	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	4.26	4.26	0.50523	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.64402	D	0.000002	T	0.56077	0.1961	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.65923	-0.6050	10	0.87932	D	0	-11.1733	11.6463	0.51263	0.0:0.0:0.0:1.0	.	460;492;462	B7ZL25;F5GXJ0;Q5ST30	.;.;SYVM_HUMAN	P	462;462;322;492	ENSP00000316092:L462P;ENSP00000394802:L462P;ENSP00000438200:L322P;ENSP00000441000:L492P	ENSP00000316092:L462P	L	+	2	0	VARS2	30996180	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	7.008000	0.76341	1.708000	0.51301	0.374000	0.22700	CTG	.	.	.	none		0.527	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
ZNF76	7629	hgsc.bcm.edu	37	6	35260658	35260658	+	Splice_Site	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:35260658C>T	ENST00000373953.3	+	11	1432	c.1166C>T	c.(1165-1167)gCc>gTc	p.A389V	ZNF76_ENST00000339411.5_Splice_Site_p.A389V|ZNF76_ENST00000440666.2_Splice_Site_p.A363V	NM_003427.3	NP_003418.2	P36508	ZNF76_HUMAN	zinc finger protein 76	389					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CCTCTCCCAGCCGCCTCTGCA	0.622																																					p.A389V	Esophageal Squamous(52;92 1039 20612 23956 34676)	Atlas-SNP	.											.	ZNF76	37	.	0			c.C1166T						PASS	.						54.0	58.0	57.0					6																	35260658		2203	4300	6503	SO:0001630	splice_region_variant	7629	exon11			TCCCAGCCGCCTC	M91592	CCDS4801.1, CCDS75435.1	6p21.31	2013-01-08	2011-02-25		ENSG00000065029	ENSG00000065029		"""Zinc fingers, C2H2-type"""	13149	protein-coding gene	gene with protein product		194549	"""zinc finger protein 76 (expressed in testis)"""	D6S229E		1427894	Standard	XM_005249364		Approved	Zfp523, ZNF523	uc003oki.1	P36508	OTTHUMG00000014564	ENST00000373953.3:c.1166-1C>T	chr6.hg19:g.35260658C>T		129.0	0.0	.		148.0	45.0	.	NM_003427	Q9BQB2	Missense_Mutation	SNP	ENST00000373953.3	hg19	CCDS4801.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615788	0.46631	.	.	ENSG00000065029	ENST00000373953;ENST00000440666;ENST00000339411	T;T;T	0.10668	2.88;2.88;2.85	4.83	4.83	0.62350	.	0.000000	0.36740	N	0.002424	T	0.01835	0.0058	N	0.08118	0	0.26011	N	0.981989	B;B	0.33135	0.392;0.399	B;B	0.34452	0.115;0.183	T	0.43196	-0.9406	9	.	.	.	.	8.2836	0.31915	0.176:0.6542:0.1698:0.0	.	389;389	P36508-2;P36508	.;ZNF76_HUMAN	V	389;363;389	ENSP00000363064:A389V;ENSP00000392243:A363V;ENSP00000344097:A389V	.	A	+	2	0	ZNF76	35368636	0.001000	0.12720	1.000000	0.80357	0.876000	0.50452	1.026000	0.30103	2.487000	0.83934	0.491000	0.48974	GCC	.	.	.	none		0.622	ZNF76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040279.2	NM_003427	Missense_Mutation
DNAH8	1769	hgsc.bcm.edu	37	6	38709565	38709565	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:38709565A>G	ENST00000359357.3	+	6	798	c.544A>G	c.(544-546)Atg>Gtg	p.M182V	DNAH8_ENST00000449981.2_Missense_Mutation_p.M399V|RN7SL465P_ENST00000468411.2_RNA|DNAH8_ENST00000441566.1_Missense_Mutation_p.M182V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	182					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CTGGAAACGCATGTCAGCCAA	0.398																																					p.M399V		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A1195G						PASS	.						121.0	105.0	110.0					6																	38709565		2203	4300	6503	SO:0001583	missense	1769	exon8			AAACGCATGTCAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.544A>G	chr6.hg19:g.38709565A>G	ENSP00000352312:p.Met182Val	83.0	0.0	.		77.0	27.0	.	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	16.47	3.131132	0.56828	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.56611	0.45;0.45;0.45	5.91	5.91	0.95273	Dynein heavy chain, domain-1 (1);	0.047100	0.85682	D	0.000000	T	0.36276	0.0961	L	0.29908	0.895	0.40827	D	0.983553	B	0.27765	0.188	B	0.36608	0.229	T	0.42965	-0.9420	10	0.66056	D	0.02	.	16.3429	0.83101	1.0:0.0:0.0:0.0	.	182	Q96JB1	DYH8_HUMAN	V	387;387;182;182	ENSP00000333363:M387V;ENSP00000352312:M182V;ENSP00000402294:M182V	ENSP00000333363:M387V	M	+	1	0	DNAH8	38817543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.248000	0.72418	2.256000	0.74724	0.523000	0.50628	ATG	.	.	.	none		0.398	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
BAI3	577	hgsc.bcm.edu	37	6	69943243	69943243	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:69943243C>T	ENST00000370598.1	+	18	3363	c.2542C>T	c.(2542-2544)Cat>Tat	p.H848Y	BAI3_ENST00000238918.8_Missense_Mutation_p.H54Y	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	848	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CGATGCATCCCATACGAAATG	0.473																																					p.H848Y		Atlas-SNP	.											.	BAI3	451	.	0			c.C2542T						PASS	.						203.0	180.0	188.0					6																	69943243		2203	4300	6503	SO:0001583	missense	577	exon18			GCATCCCATACGA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2542C>T	chr6.hg19:g.69943243C>T	ENSP00000359630:p.His848Tyr	266.0	0.0	.		215.0	68.0	.	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946496	0.53186	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	T;T	0.69175	-0.38;-0.38	5.37	5.37	0.77165	GPS domain (3);	0.000000	0.85682	D	0.000000	T	0.75953	0.3920	L	0.54863	1.705	0.80722	D	1	D;D	0.89917	0.982;1.0	P;D	0.87578	0.824;0.998	T	0.77230	-0.2664	10	0.62326	D	0.03	.	19.1872	0.93648	0.0:1.0:0.0:0.0	.	54;848	B7Z356;O60242	.;BAI3_HUMAN	Y	848;54	ENSP00000359630:H848Y;ENSP00000238918:H54Y	ENSP00000238918:H54Y	H	+	1	0	BAI3	69999964	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.889000	0.69766	2.539000	0.85634	0.454000	0.30748	CAT	.	.	.	none		0.473	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
RFX6	222546	hgsc.bcm.edu	37	6	117245902	117245902	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr6:117245902T>A	ENST00000332958.2	+	15	1642	c.1626T>A	c.(1624-1626)aaT>aaA	p.N542K		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	542					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AGTTTAATAATGACAAAGAGC	0.338																																					p.N542K		Atlas-SNP	.											.	RFX6	141	.	0			c.T1626A						PASS	.						100.0	99.0	99.0					6																	117245902		2203	4300	6503	SO:0001583	missense	222546	exon15			TAATAATGACAAA	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1626T>A	chr6.hg19:g.117245902T>A	ENSP00000332208:p.Asn542Lys	97.0	0.0	.		92.0	20.0	.	NM_173560	Q5T6B3	Missense_Mutation	SNP	ENST00000332958.2	hg19	CCDS5113.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521372	0.64747	.	.	ENSG00000185002	ENST00000332958	T	0.57107	0.42	5.32	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	L	0.49640	1.575	0.53688	D	0.999972	D	0.59357	0.985	P	0.53360	0.724	T	0.50508	-0.8820	10	0.56958	D	0.05	-21.9444	10.8185	0.46591	0.0:0.0743:0.0:0.9257	.	542	Q8HWS3	RFX6_HUMAN	K	542	ENSP00000332208:N542K	ENSP00000332208:N542K	N	+	3	2	RFX6	117352595	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.890000	0.39728	2.138000	0.66242	0.533000	0.62120	AAT	.	.	.	none		0.338	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
AEBP1	165	hgsc.bcm.edu	37	7	44152208	44152208	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:44152208G>C	ENST00000223357.3	+	18	2574	c.2269G>C	c.(2269-2271)Gtg>Ctg	p.V757L	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.V332L	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	757	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GAACCCCTTCGTGCTGGGAGC	0.642																																					p.V757L		Atlas-SNP	.											.	AEBP1	102	.	0			c.G2269C						PASS	.						48.0	52.0	51.0					7																	44152208		2203	4299	6502	SO:0001583	missense	165	exon18			CCCTTCGTGCTGG	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2269G>C	chr7.hg19:g.44152208G>C	ENSP00000223357:p.Val757Leu	117.0	0.0	.		151.0	40.0	.	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	hg19	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	G	32	5.147205	0.94603	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.03524	3.9;3.9	5.08	5.08	0.68730	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.20981	0.0505	M	0.83953	2.67	0.80722	D	1	D;P	0.76494	0.999;0.887	D;P	0.81914	0.995;0.796	T	0.00473	-1.1718	10	0.62326	D	0.03	-39.5208	17.5863	0.87982	0.0:0.0:1.0:0.0	.	332;757	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	L	757;332	ENSP00000223357:V757L;ENSP00000398878:V332L	ENSP00000223357:V757L	V	+	1	0	AEBP1	44118733	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.597000	0.74118	2.533000	0.85409	0.491000	0.48974	GTG	.	.	.	none		0.642	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
OGDH	4967	hgsc.bcm.edu	37	7	44714122	44714122	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:44714122G>A	ENST00000222673.5	+	7	943	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	OGDH_ENST00000443864.2_Missense_Mutation_p.G301S|OGDH_ENST00000543843.1_Missense_Mutation_p.G252S|OGDH_ENST00000439616.2_Missense_Mutation_p.G151S|OGDH_ENST00000447398.1_Missense_Mutation_p.G312S|OGDH_ENST00000444676.1_Missense_Mutation_p.G316S|OGDH_ENST00000449767.1_Missense_Mutation_p.G297S|OGDH_ENST00000459672.1_3'UTR	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	301					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	TAGTGAGAATGGCGTGGACTA	0.572																																					p.G301S		Atlas-SNP	.											.	OGDH	145	.	0			c.G901A						PASS	.						136.0	110.0	119.0					7																	44714122		2203	4300	6503	SO:0001583	missense	4967	exon7			GAGAATGGCGTGG	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.901G>A	chr7.hg19:g.44714122G>A	ENSP00000222673:p.Gly301Ser	104.0	0.0	.		126.0	55.0	.	NM_002541	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	hg19	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996894	0.93167	.	.	ENSG00000105953	ENST00000439616;ENST00000443864;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;T;D;D;D;D;D	0.95788	-3.81;2.48;-3.81;-3.81;-3.81;-3.81;-3.81	4.97	4.97	0.65823	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98061	0.9361	M	0.88570	2.965	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.998;0.998;0.998;0.999	D;D;D;D;D;D;D	0.87578	0.995;0.996;0.995;0.996;0.992;0.995;0.998	D	0.99091	1.0840	10	0.87932	D	0	-17.2819	18.1993	0.89833	0.0:0.0:1.0:0.0	.	96;151;297;312;203;301;301	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218;Q96DD3	.;.;.;.;.;ODO1_HUMAN;.	S	151;301;297;312;316;301;252	ENSP00000398576:G151S;ENSP00000388084:G301S;ENSP00000392878:G297S;ENSP00000388183:G312S;ENSP00000414662:G316S;ENSP00000222673:G301S;ENSP00000443821:G252S	ENSP00000222673:G301S	G	+	1	0	OGDH	44680647	1.000000	0.71417	0.169000	0.22859	0.771000	0.43674	9.609000	0.98334	2.462000	0.83206	0.561000	0.74099	GGC	.	.	.	none		0.572	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
VSTM2A	222008	hgsc.bcm.edu	37	7	54617692	54617692	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:54617692C>T	ENST00000407838.3	+	4	869	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C	VSTM2A_ENST00000402026.2_Missense_Mutation_p.R154C|VSTM2A_ENST00000404951.1_Missense_Mutation_p.R155C|VSTM2A_ENST00000498834.1_3'UTR|VSTM2A_ENST00000302287.3_Missense_Mutation_p.R155C|VSTM2A_ENST00000402613.3_Missense_Mutation_p.R155C	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	155						extracellular region (GO:0005576)		p.R155C(1)|p.R154C(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			CAGCCATGCCCGCAGAATGCA	0.577																																					p.R155C		Atlas-SNP	.											VSTM2A,NS,carcinoma,0,2	VSTM2A	53	.	2	Substitution - Missense(2)	endometrium(2)	c.C463T						PASS	.						57.0	54.0	55.0					7																	54617692		2203	4299	6502	SO:0001583	missense	222008	exon4			CATGCCCGCAGAA	BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.463C>T	chr7.hg19:g.54617692C>T	ENSP00000384967:p.Arg155Cys	30.0	0.0	.		32.0	13.0	.	NM_182546	A4D2E9|B5MC94	Missense_Mutation	SNP	ENST00000407838.3	hg19	CCDS5512.2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950503	0.73787	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.50277	0.75;0.78;0.75;0.75;0.78	5.06	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.64080	0.2566	M	0.68952	2.095	0.52501	D	0.999954	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.993	T	0.63440	-0.6637	10	0.51188	T	0.08	-25.8697	11.9552	0.52976	0.334:0.666:0.0:0.0	.	155;155;155	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	C	155;155;155;154;155	ENSP00000303108:R155C;ENSP00000384967:R155C;ENSP00000384701:R155C;ENSP00000385933:R154C;ENSP00000384103:R155C	ENSP00000303108:R155C	R	+	1	0	VSTM2A	54585186	0.357000	0.24938	0.524000	0.27887	0.981000	0.71138	0.571000	0.23669	0.566000	0.29273	0.655000	0.94253	CGC	.	.	.	none		0.577	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318694.1	NM_182546	
C7orf55-LUC7L2	100996928	hgsc.bcm.edu	37	7	139107032	139107032	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr7:139107032T>A	ENST00000354926.4	+	10	1479	c.1125T>A	c.(1123-1125)aaT>aaA	p.N375K	C7orf55-LUC7L2_ENST00000482860.1_3'UTR|C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.N372K|LUC7L2_ENST00000541515.3_Missense_Mutation_p.N441K|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.N374K	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		AGAGTGCTAATGGCAGATCAG	0.478																																					p.N441K		Atlas-SNP	.											.	.	.	.	0			c.T1323A						PASS	.						133.0	136.0	135.0					7																	139107032		1945	4137	6082	SO:0001583	missense	100996928	exon11			TGCTAATGGCAGA		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.1125T>A	chr7.hg19:g.139107032T>A	ENSP00000347005:p.Asn375Lys	170.0	0.0	.		200.0	102.0	.	NM_001244584		Missense_Mutation	SNP	ENST00000354926.4	hg19	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880250	0.51801	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.41400	1.59;1.59;1.59;1.0	6.03	3.72	0.42706	.	0.255682	0.45126	D	0.000400	T	0.33702	0.0872	L	0.58810	1.83	0.42902	D	0.994235	P;P;P;P	0.40731	0.608;0.608;0.728;0.608	B;B;B;B	0.36186	0.109;0.109;0.219;0.109	T	0.46898	-0.9158	9	0.23891	T	0.37	-21.4412	8.941	0.35729	0.0:0.2436:0.0:0.7564	.	441;372;374;375	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	K	372;441;375;375;374	ENSP00000441604:N372K;ENSP00000440222:N441K;ENSP00000347005:N375K;ENSP00000263545:N374K	ENSP00000263545:N374K	N	+	3	2	LUC7L2	138757572	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.312000	0.19397	1.117000	0.41842	0.455000	0.32223	AAT	.	.	.	none		0.478	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
PRSS55	203074	hgsc.bcm.edu	37	8	10390473	10390473	+	Nonsense_Mutation	SNP	G	G	A	rs150767306		TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr8:10390473G>A	ENST00000328655.3	+	4	696	c.656G>A	c.(655-657)tGg>tAg	p.W219*	PRSS55_ENST00000522210.1_Nonsense_Mutation_p.W219*|PRSS51_ENST00000523024.1_RNA	NM_198464.3	NP_940866.2	Q6UWB4	PRS55_HUMAN	protease, serine, 55	219	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)	31						ATCATGGACTGGGAGGAGTGT	0.473																																					p.W219X		Atlas-SNP	.											.	PRSS55	67	.	0			c.G656A						PASS	.						124.0	112.0	116.0					8																	10390473		2203	4300	6503	SO:0001587	stop_gained	203074	exon4			TGGACTGGGAGGA	AY358867	CCDS5976.1, CCDS56523.1	8p23.1	2014-01-21			ENSG00000184647	ENSG00000184647		"""Serine peptidases / Serine peptidases"""	30824	protein-coding gene	gene with protein product		615144				12975309, 18844450	Standard	NM_198464		Approved	T-SP1, UNQ9391, CT153	uc003wta.3	Q6UWB4	OTTHUMG00000129345	ENST00000328655.3:c.656G>A	chr8.hg19:g.10390473G>A	ENSP00000333003:p.Trp219*	109.0	0.0	.		95.0	34.0	.	NM_001197020	E5RJX5	Nonsense_Mutation	SNP	ENST00000328655.3	hg19	CCDS5976.1	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820578	0.71028	.	.	ENSG00000184647	ENST00000328655;ENST00000522210	.	.	.	5.27	4.39	0.52855	.	0.259915	0.20629	N	0.088631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	10.0857	0.42417	0.094:0.0:0.906:0.0	.	.	.	.	X	219	.	ENSP00000333003:W219X	W	+	2	0	PRSS55	10427883	0.948000	0.32251	0.056000	0.19401	0.063000	0.16089	1.788000	0.38714	1.344000	0.45657	0.591000	0.81541	TGG	.	G|1.000;T|0.000	.	alt		0.473	PRSS55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251493.3	NM_198464	
NUGGC	389643	hgsc.bcm.edu	37	8	27888815	27888815	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr8:27888815C>G	ENST00000413272.2	-	15	1995	c.1853G>C	c.(1852-1854)gGg>gCg	p.G618A	NUGGC_ENST00000341513.6_Missense_Mutation_p.G618A	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	618					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										ACTTCTTATCCCAATTTCTGT	0.468																																					p.G618A		Atlas-SNP	.											.	.	.	.	0			c.G1853C						PASS	.						139.0	140.0	140.0					8																	27888815		1863	4103	5966	SO:0001583	missense	389643	exon15			CTTATCCCAATTT	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1853G>C	chr8.hg19:g.27888815C>G	ENSP00000408697:p.Gly618Ala	202.0	0.0	.		192.0	49.0	.	NM_001010906	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	hg19	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.333721	0.24167	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.32753	1.44;1.44	5.23	4.26	0.50523	.	0.580298	0.17797	N	0.161690	T	0.18002	0.0432	L	0.27053	0.805	0.09310	N	1	B	0.27229	0.172	B	0.22386	0.039	T	0.14309	-1.0477	10	0.06625	T	0.88	-16.0958	11.7736	0.51972	0.1875:0.8125:0.0:0.0	.	618	Q68CJ6	SLIP_HUMAN	A	618	ENSP00000408697:G618A;ENSP00000345031:G618A	ENSP00000345031:G618A	G	-	2	0	C8orf80	27944734	0.006000	0.16342	0.846000	0.33378	0.810000	0.45777	1.525000	0.35953	2.441000	0.82636	0.655000	0.94253	GGG	.	.	.	none		0.468	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
NR5A1	2516	hgsc.bcm.edu	37	9	127262609	127262609	+	Silent	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr9:127262609C>A	ENST00000373588.4	-	4	826	c.630G>T	c.(628-630)ccG>ccT	p.P210P		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	210					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GGTAGCCGTACGGCAGCCCAG	0.667																																					p.P210P		Atlas-SNP	.											NR5A1,colon,carcinoma,0,1	NR5A1	32	.	0			c.G630T						PASS	.						5.0	6.0	6.0					9																	127262609		2112	4146	6258	SO:0001819	synonymous_variant	2516	exon4			GCCGTACGGCAGC	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.630G>T	chr9.hg19:g.127262609C>A		6.0	2.0	.		9.0	5.0	.	NM_004959	O15196|Q5T6F5	Silent	SNP	ENST00000373588.4	hg19	CCDS6856.1																																																																																			.	.	.	none		0.667	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
KIF20B	9585	hgsc.bcm.edu	37	10	91498338	91498338	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr10:91498338A>C	ENST00000371728.3	+	20	3805	c.3740A>C	c.(3739-3741)gAa>gCa	p.E1247A	KIF20B_ENST00000394289.2_Missense_Mutation_p.E1247A|KIF20B_ENST00000416354.1_Missense_Mutation_p.E1277A|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.E1207A	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1247	Poly-Glu.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CAATTAAAAGAAGAAGAAGAA	0.279																																					p.E1207A		Atlas-SNP	.											.	KIF20B	191	.	0			c.A3620C						PASS	.						33.0	35.0	34.0					10																	91498338		2006	4193	6199	SO:0001583	missense	9585	exon20			TAAAAGAAGAAGA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3740A>C	chr10.hg19:g.91498338A>C	ENSP00000360793:p.Glu1247Ala	46.0	0.0	.		59.0	23.0	.	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	A	12.72	2.021492	0.35701	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.71341	-0.46;-0.48;-0.56;-0.48	5.82	4.62	0.57501	.	0.125962	0.36167	N	0.002752	T	0.65375	0.2685	M	0.62723	1.935	0.32524	N	0.535885	P;P	0.52316	0.919;0.952	B;B	0.43916	0.253;0.436	T	0.75419	-0.3324	10	0.56958	D	0.05	-24.2326	5.4057	0.16320	0.6693:0.0:0.073:0.2577	.	1247;1207	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	A	1207;1277;1247;1247	ENSP00000260753:E1207A;ENSP00000411545:E1277A;ENSP00000377830:E1247A;ENSP00000360793:E1247A	ENSP00000260753:E1207A	E	+	2	0	KIF20B	91488318	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	4.090000	0.57693	2.222000	0.72286	0.383000	0.25322	GAA	.	.	.	none		0.279	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
TRIM8	81603	hgsc.bcm.edu	37	10	104404881	104404881	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr10:104404881C>T	ENST00000302424.7	+	1	629	c.507C>T	c.(505-507)taC>taT	p.Y169Y	RP11-47A8.5_ENST00000607967.1_lincRNA	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	169					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ACTGCTGCTACTACAGCGGCG	0.662																																					p.Y169Y		Atlas-SNP	.											.	TRIM8	35	.	0			c.C507T						PASS	.						14.0	15.0	15.0					10																	104404881		1665	3276	4941	SO:0001819	synonymous_variant	81603	exon1			CTGCTACTACAGC	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.507C>T	chr10.hg19:g.104404881C>T		42.0	0.0	.		46.0	9.0	.	NM_030912	A6NI31|Q9C028	Silent	SNP	ENST00000302424.7	hg19	CCDS31274.1																																																																																			.	.	.	none		0.662	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
PTPRJ	5795	hgsc.bcm.edu	37	11	48149503	48149503	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:48149503C>T	ENST00000418331.2	+	7	1617	c.1265C>T	c.(1264-1266)cCc>cTc	p.P422L	PTPRJ_ENST00000440289.2_Missense_Mutation_p.P422L	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	422	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCTGTCATCCCCGGACTCCGC	0.552																																					p.P422L		Atlas-SNP	.											.	PTPRJ	225	.	0			c.C1265T						PASS	.						137.0	112.0	121.0					11																	48149503		2201	4298	6499	SO:0001583	missense	5795	exon7			TCATCCCCGGACT	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1265C>T	chr11.hg19:g.48149503C>T	ENSP00000400010:p.Pro422Leu	116.0	0.0	.		124.0	42.0	.	NM_001098503	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	hg19	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.329627	0.24167	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.57752	0.38;0.38	6.17	-3.83	0.04269	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.18635	0.0447	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.004	T	0.18272	-1.0342	9	0.25106	T	0.35	.	6.2032	0.20587	0.0:0.2896:0.327:0.3835	.	422;422	Q12913;Q6P4H4	PTPRJ_HUMAN;.	L	422	ENSP00000400010:P422L;ENSP00000409733:P422L	ENSP00000278456:P422L	P	+	2	0	PTPRJ	48106079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.846000	0.04336	-1.113000	0.02981	-0.751000	0.03497	CCC	.	.	.	none		0.552	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
NAALADL1	10004	hgsc.bcm.edu	37	11	64822081	64822081	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr11:64822081C>T	ENST00000358658.3	-	5	760	c.733G>A	c.(733-735)Gag>Aag	p.E245K	NAALADL1_ENST00000355721.3_Missense_Mutation_p.E204K|NAALADL1_ENST00000355369.2_Missense_Mutation_p.E245K|NAALADL1_ENST00000356632.3_Missense_Mutation_p.E245K|NAALADL1_ENST00000340252.4_Missense_Mutation_p.E245K|NAALADL1_ENST00000339885.2_Missense_Mutation_p.E245K	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GAGCCTCGCTCCACTCCTGAG	0.597											OREG0032001	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									p.E245K		Atlas-SNP	.											.	NAALADL1	58	.	0			c.G733A						PASS	.						56.0	55.0	55.0					11																	64822081		2201	4297	6498	SO:0001583	missense	10004	exon5			CTCGCTCCACTCC	AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595	ENST00000358658.3:c.733G>A	chr11.hg19:g.64822081C>T	ENSP00000351484:p.Glu245Lys	39.0	0.0	.	1079	35.0	8.0	.	NM_005468	C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Missense_Mutation	SNP	ENST00000358658.3	hg19	CCDS31604.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798953	0.90538	.	.	ENSG00000168060	ENST00000358658;ENST00000355369;ENST00000339885;ENST00000453486;ENST00000340252;ENST00000355721;ENST00000356632	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	4.7	3.78	0.43462	.	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	M	0.81802	2.56	0.50632	D	0.999881	P	0.51240	0.943	P	0.57720	0.826	T	0.66842	-0.5821	10	0.87932	D	0	-32.0749	12.6604	0.56811	0.0:0.8326:0.1674:0.0	.	245	Q9UQQ1	NALDL_HUMAN	K	245;245;245;245;245;204;245	ENSP00000351484:E245K;ENSP00000347530:E245K;ENSP00000340111:E245K;ENSP00000344244:E245K;ENSP00000347955:E204K;ENSP00000349045:E245K	ENSP00000340111:E245K	E	-	1	0	NAALADL1	64578657	1.000000	0.71417	0.979000	0.43373	0.757000	0.42996	6.561000	0.73955	1.196000	0.43129	0.655000	0.94253	GAG	.	.	.	none		0.597	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385162.1	NM_005468	
PZP	5858	hgsc.bcm.edu	37	12	9356427	9356427	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr12:9356427T>A	ENST00000261336.2	-	2	232	c.204A>T	c.(202-204)gaA>gaT	p.E68D	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	68					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GGCTCCTGTTTTCCCTGCCAG	0.557																																					p.E68D	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-SNP	.											.	PZP	422	.	0			c.A204T						PASS	.						114.0	104.0	107.0					12																	9356427		2203	4300	6503	SO:0001583	missense	5858	exon2			CCTGTTTTCCCTG	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.204A>T	chr12.hg19:g.9356427T>A	ENSP00000261336:p.Glu68Asp	141.0	0.0	.		154.0	51.0	.	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	hg19	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	0.086	-1.175971	0.01646	.	.	ENSG00000126838	ENST00000261336	T	0.08282	3.11	2.08	-0.306	0.12780	.	1.942830	0.04105	U	0.313539	T	0.10121	0.0248	M	0.70275	2.135	0.09310	N	1	B	0.22683	0.073	B	0.19946	0.027	T	0.42378	-0.9455	10	0.12766	T	0.61	.	4.2572	0.10722	0.0:0.3652:0.0:0.6348	.	68	P20742	PZP_HUMAN	D	68	ENSP00000261336:E68D	ENSP00000261336:E68D	E	-	3	2	PZP	9247694	0.000000	0.05858	0.002000	0.10522	0.396000	0.30629	-1.538000	0.02204	-0.076000	0.12775	0.383000	0.25322	GAA	.	.	.	none		0.557	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
DNAJC22	79962	hgsc.bcm.edu	37	12	49743366	49743366	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr12:49743366T>C	ENST00000549441.2	+	3	1915	c.711T>C	c.(709-711)ctT>ctC	p.L237L	DNAJC22_ENST00000395069.3_Silent_p.L237L			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	237						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						TTGTCCTCCTTCTGCCTTACC	0.532																																					p.L237L		Atlas-SNP	.											.	DNAJC22	29	.	0			c.T711C						PASS	.						162.0	163.0	163.0					12																	49743366		2203	4300	6503	SO:0001819	synonymous_variant	79962	exon2			CCTCCTTCTGCCT	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.711T>C	chr12.hg19:g.49743366T>C		307.0	0.0	.		277.0	87.0	.	NM_024902	B3KP54	Silent	SNP	ENST00000549441.2	hg19	CCDS8785.1																																																																																			.	.	.	none		0.532	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
GPR18	2841	hgsc.bcm.edu	37	13	99908051	99908051	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr13:99908051G>C	ENST00000340807.3	-	3	632	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397470.2_Missense_Mutation_p.L26V|GPR18_ENST00000397473.2_Missense_Mutation_p.L26V			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	26					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	TAGAAGACAAGGGCTGCAATT	0.388																																					p.L26V		Atlas-SNP	.											GPR18,NS,carcinoma,0,1	GPR18	23	.	0			c.C76G						PASS	.						131.0	130.0	131.0					13																	99908051		2203	4300	6503	SO:0001583	missense	2841	exon2			AGACAAGGGCTGC	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.76C>G	chr13.hg19:g.99908051G>C	ENSP00000343428:p.Leu26Val	142.0	0.0	.		140.0	31.0	.	NM_001098200	Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	hg19	CCDS9491.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732792	0.48939	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807;ENST00000416594	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.95	5.08	0.68730	.	0.078514	0.52532	D	0.000062	T	0.20047	0.0482	N	0.08118	0	0.58432	D	0.999996	B	0.30605	0.287	B	0.25987	0.065	T	0.05451	-1.0884	9	.	.	.	-16.1138	16.3083	0.82859	0.0:0.0:0.8666:0.1334	.	26	Q14330	GPR18_HUMAN	V	26	ENSP00000380613:L26V;ENSP00000380610:L26V;ENSP00000343428:L26V;ENSP00000401611:L26V	.	L	-	1	0	GPR18	98706052	1.000000	0.71417	0.847000	0.33407	0.750000	0.42670	5.384000	0.66225	1.475000	0.48197	0.563000	0.77884	CTT	.	.	.	none		0.388	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1		
SLC7A8	23428	hgsc.bcm.edu	37	14	23607203	23607203	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:23607203C>T	ENST00000316902.7	-	7	1668	c.943G>A	c.(943-945)Gcc>Acc	p.A315T	SLC7A8_ENST00000529705.2_Missense_Mutation_p.A210T|SLC7A8_ENST00000453702.1_Missense_Mutation_p.A112T|SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000532568.1_5'Flank|SLC7A8_ENST00000422941.2_Missense_Mutation_p.A91T	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	315					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	ATGATCCAGGCCATGACTCCT	0.567																																					p.A315T		Atlas-SNP	.											.	SLC7A8	54	.	0			c.G943A						PASS	.						112.0	104.0	107.0					14																	23607203		2203	4300	6503	SO:0001583	missense	23428	exon7			TCCAGGCCATGAC	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.943G>A	chr14.hg19:g.23607203C>T	ENSP00000320378:p.Ala315Thr	119.0	0.0	.		113.0	26.0	.	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	hg19	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.222325	0.58560	.	.	ENSG00000092068	ENST00000316902;ENST00000334354;ENST00000453702;ENST00000529705;ENST00000422941;ENST00000206514	D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62	5.44	4.54	0.55810	Amino acid permease domain (1);	0.306262	0.35772	N	0.002981	D	0.87815	0.6272	L	0.48877	1.53	0.49213	D	0.999763	B;B;B	0.28128	0.201;0.118;0.07	B;B;B	0.28305	0.088;0.088;0.038	D	0.86389	0.1734	10	0.72032	D	0.01	.	14.7754	0.69729	0.1459:0.8541:0.0:0.0	.	210;91;315	B4DKT4;B4DTV6;Q9UHI5	.;.;LAT2_HUMAN	T	315;112;112;210;91;112	ENSP00000320378:A315T;ENSP00000391577:A112T;ENSP00000434345:A210T;ENSP00000416398:A91T	ENSP00000206514:A112T	A	-	1	0	SLC7A8	22677043	0.979000	0.34478	1.000000	0.80357	0.997000	0.91878	0.137000	0.15995	1.409000	0.46915	0.563000	0.77884	GCC	.	.	.	none		0.567	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
PPP1R36	145376	hgsc.bcm.edu	37	14	65032084	65032084	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:65032084T>A	ENST00000298705.1	+	5	375	c.279T>A	c.(277-279)gaT>gaA	p.D93E	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	93					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GGTTGACAGATAAAAGACTTG	0.338																																					p.D93E		Atlas-SNP	.											.	.	.	.	0			c.T279A						PASS	.						91.0	80.0	83.0					14																	65032084		2203	4300	6503	SO:0001583	missense	145376	exon5			GACAGATAAAAGA		CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.279T>A	chr14.hg19:g.65032084T>A	ENSP00000298705:p.Asp93Glu	64.0	0.0	.		37.0	13.0	.	NM_172365	Q6NTH6	Missense_Mutation	SNP	ENST00000298705.1	hg19	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	T	8.979	0.974851	0.18736	.	.	ENSG00000165807	ENST00000298705	T	0.31247	1.5	5.79	2.16	0.27623	.	0.198907	0.35320	N	0.003286	T	0.17109	0.0411	L	0.39898	1.24	0.25922	N	0.983102	B	0.24721	0.11	B	0.17433	0.018	T	0.30119	-0.9989	10	0.05959	T	0.93	-17.5714	5.9771	0.19387	0.0:0.0945:0.4215:0.4839	.	93	Q96LQ0	PPR36_HUMAN	E	93	ENSP00000298705:D93E	ENSP00000298705:D93E	D	+	3	2	C14orf50	64101837	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	0.518000	0.22847	0.433000	0.26313	0.533000	0.62120	GAT	.	.	.	none		0.338	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
EIF2S1	1965	hgsc.bcm.edu	37	14	67848335	67848335	+	Silent	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr14:67848335T>C	ENST00000256383.4	+	6	1067	c.606T>C	c.(604-606)taT>taC	p.Y202Y	EIF2S1_ENST00000466499.2_Silent_p.Y202Y	NM_004094.4	NP_004085.1	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa	202					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|protein autophosphorylation (GO:0046777)|regulation of translational initiation in response to stress (GO:0043558)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		GTTATGGTTATGAAGGCATTG	0.343																																					p.Y202Y		Atlas-SNP	.											.	EIF2S1	17	.	0			c.T606C						PASS	.						89.0	93.0	91.0					14																	67848335		2203	4300	6503	SO:0001819	synonymous_variant	1965	exon6			TGGTTATGAAGGC	J02645	CCDS9781.1	14q21.3	2011-01-07	2002-08-29		ENSG00000134001	ENSG00000134001			3265	protein-coding gene	gene with protein product		603907	"""eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kD )"""	EIF2		2948954	Standard	NM_004094		Approved	EIF-2alpha, EIF2A	uc001xjg.3	P05198	OTTHUMG00000029800	ENST00000256383.4:c.606T>C	chr14.hg19:g.67848335T>C		117.0	0.0	.		166.0	58.0	.	NM_004094		Silent	SNP	ENST00000256383.4	hg19	CCDS9781.1	.	.	.	.	.	.	.	.	.	.	T	9.345	1.063966	0.20067	.	.	ENSG00000134001	ENST00000555876	.	.	.	6.0	2.3	0.28687	.	.	.	.	.	T	0.58779	0.2146	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51052	-0.8754	4	.	.	.	-12.7575	9.7872	0.40684	0.0:0.196:0.0:0.804	.	.	.	.	T	159	.	.	M	+	2	0	EIF2S1	66918088	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.756000	0.38390	0.149000	0.19098	0.528000	0.53228	ATG	.	.	.	none		0.343	EIF2S1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074342.3	NM_004094	
TBC1D2B	23102	hgsc.bcm.edu	37	15	78290654	78290654	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr15:78290654G>C	ENST00000300584.3	-	13	2739	c.2740C>G	c.(2740-2742)Cta>Gta	p.L914V	TBC1D2B_ENST00000409931.3_Intron|TBC1D2B_ENST00000492078.1_5'UTR	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	914							Rab GTPase activator activity (GO:0005097)	p.?(2)|p.L914V(1)		breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						ATCTGGCGTAGGGGGAAAGGG	0.612																																					p.L914V		Atlas-SNP	.											TBC1D2B_ENST00000300584,NS,carcinoma,0,3	TBC1D2B	104	.	3	Unknown(2)|Substitution - Missense(1)	prostate(2)|upper_aerodigestive_tract(1)	c.C2740G						PASS	.						35.0	29.0	31.0					15																	78290654		2195	4290	6485	SO:0001583	missense	23102	exon13			GGCGTAGGGGGAA	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2740C>G	chr15.hg19:g.78290654G>C	ENSP00000300584:p.Leu914Val	13.0	0.0	.		15.0	6.0	.	NM_144572	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	ENST00000300584.3	hg19	CCDS45314.1	.	.	.	.	.	.	.	.	.	.	g	11.75	1.733051	0.30684	.	.	ENSG00000167202	ENST00000300584	T	0.09350	2.99	4.48	4.48	0.54585	.	.	.	.	.	T	0.10637	0.0260	L	0.57536	1.79	0.80722	D	1	P	0.40083	0.702	B	0.34418	0.182	T	0.08493	-1.0719	9	0.33141	T	0.24	.	9.9118	0.41411	0.1078:0.0:0.8922:0.0	.	914	Q9UPU7	TBD2B_HUMAN	V	914	ENSP00000300584:L914V	ENSP00000300584:L914V	L	-	1	2	TBC1D2B	76077709	0.933000	0.31639	0.998000	0.56505	0.767000	0.43475	1.433000	0.34947	2.033000	0.60031	0.479000	0.44913	CTA	.	.	.	none		0.612	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
KIAA0556	23247	hgsc.bcm.edu	37	16	27720066	27720066	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr16:27720066T>C	ENST00000261588.4	+	13	1449	c.1430T>C	c.(1429-1431)aTc>aCc	p.I477T	CTD-2049O4.1_ENST00000568831.1_RNA|KIAA0556_ENST00000567894.1_3'UTR|CTD-2049O4.1_ENST00000563052.1_RNA|CTD-2049O4.1_ENST00000564893.1_RNA	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	477						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AAAGATGCCATCTACGTGACC	0.453																																					p.I477T		Atlas-SNP	.											.	KIAA0556	348	.	0			c.T1430C						PASS	.						120.0	105.0	110.0					16																	27720066		2197	4300	6497	SO:0001583	missense	23247	exon13			ATGCCATCTACGT	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.1430T>C	chr16.hg19:g.27720066T>C	ENSP00000261588:p.Ile477Thr	110.0	0.0	.		139.0	28.0	.	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	hg19	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.818111	0.50633	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.13778	2.56	5.49	4.4	0.53042	.	0.797554	0.11412	N	0.566654	T	0.19886	0.0478	M	0.75264	2.295	0.09310	N	0.999996	B	0.21071	0.051	B	0.19391	0.025	T	0.14008	-1.0488	10	0.51188	T	0.08	-4.828	10.5152	0.44885	0.0:0.0775:0.0:0.9225	.	477	O60303	K0556_HUMAN	T	477;384	ENSP00000261588:I477T	ENSP00000261588:I477T	I	+	2	0	KIAA0556	27627567	0.986000	0.35501	0.001000	0.08648	0.582000	0.36321	3.571000	0.53841	0.912000	0.36772	0.379000	0.24179	ATC	.	.	.	none		0.453	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
TOP3A	7156	hgsc.bcm.edu	37	17	18212208	18212208	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:18212208A>G	ENST00000321105.5	-	2	442	c.228T>C	c.(226-228)caT>caC	p.H76H	TOP3A_ENST00000582230.1_5'UTR|TOP3A_ENST00000542570.1_Missense_Mutation_p.I6T	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	76	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GGCCATACAGATGATAATCAA	0.289																																					p.H76H		Atlas-SNP	.											.	TOP3A	85	.	0			c.T228C						PASS	.						36.0	33.0	34.0					17																	18212208		2201	4295	6496	SO:0001819	synonymous_variant	7156	exon2			ATACAGATGATAA	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.228T>C	chr17.hg19:g.18212208A>G		35.0	0.0	.		46.0	15.0	.	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Silent	SNP	ENST00000321105.5	hg19	CCDS11194.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.18|13.18	2.161482|2.161482	0.38119|0.38119	.|.	.|.	ENSG00000177302|ENSG00000177302	ENST00000542570|ENST00000412083	T|.	0.08282|.	3.11|.	5.04|5.04	-5.1|-5.1	0.02911|0.02911	.|.	.|.	.|.	.|.	.|.	T|T	0.50616|0.50616	0.1626|0.1626	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.53258|0.53258	-0.8464|-0.8464	6|4	0.21014|.	T|.	0.42|.	-4.7873|-4.7873	8.3168|8.3168	0.32104|0.32104	0.5159:0.1661:0.3181:0.0|0.5159:0.1661:0.3181:0.0	.|.	.|.	.|.	.|.	T|P	6|56	ENSP00000442336:I6T|.	ENSP00000442336:I6T|.	I|S	-|-	2|1	0|0	TOP3A|TOP3A	18152933|18152933	0.817000|0.817000	0.29147|0.29147	0.469000|0.469000	0.27204|0.27204	0.893000|0.893000	0.52053|0.52053	-0.001000|-0.001000	0.12947|0.12947	-0.503000|-0.503000	0.06586|0.06586	-0.220000|-0.220000	0.12472|0.12472	ATC|TCT	.	.	.	none		0.289	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
EFTUD2	9343	hgsc.bcm.edu	37	17	42945230	42945230	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:42945230G>A	ENST00000426333.2	-	13	1391	c.1094C>T	c.(1093-1095)tCc>tTc	p.S365F	EFTUD2_ENST00000592576.1_Missense_Mutation_p.S355F|EFTUD2_ENST00000591382.1_Missense_Mutation_p.S365F|EFTUD2_ENST00000402521.3_Missense_Mutation_p.S330F	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	365	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				ACTTCTCTGGGAGCTGCTAGT	0.483																																					p.S365F	Ovarian(10;65 485 10258 29980 30707)	Atlas-SNP	.											.	EFTUD2	85	.	0			c.C1094T						PASS	.						48.0	47.0	48.0					17																	42945230		2203	4300	6503	SO:0001583	missense	9343	exon13			CTCTGGGAGCTGC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1094C>T	chr17.hg19:g.42945230G>A	ENSP00000392094:p.Ser365Phe	20.0	0.0	.		29.0	17.0	.	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	hg19	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231134	0.79688	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.76839	-1.05;-1.05	6.17	6.17	0.99709	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.81964	0.4934	L	0.56769	1.78	0.80722	D	1	P;P	0.41710	0.76;0.76	P;P	0.47891	0.56;0.56	T	0.77477	-0.2573	10	0.32370	T	0.25	0.1139	20.8794	0.99867	0.0:0.0:1.0:0.0	.	355;365	B4DMC0;Q15029	.;U5S1_HUMAN	F	365;355;330	ENSP00000392094:S365F;ENSP00000385873:S330F	ENSP00000262414:S355F	S	-	2	0	EFTUD2	40300756	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.406000	0.97321	2.941000	0.99782	0.655000	0.94253	TCC	.	.	.	none		0.483	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
WNT3	7473	hgsc.bcm.edu	37	17	44845986	44845986	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:44845986C>T	ENST00000225512.5	-	4	930	c.768G>A	c.(766-768)gtG>gtA	p.V256V		NM_030753.4	NP_110380.1	P56703	WNT3_HUMAN	wingless-type MMTV integration site family, member 3	256					anterior/posterior axis specification (GO:0009948)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell fate commitment (GO:0045165)|cell morphogenesis (GO:0000902)|cellular response to retinoic acid (GO:0071300)|dorsal/ventral axis specification (GO:0009950)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|gamete generation (GO:0007276)|head morphogenesis (GO:0060323)|limb bud formation (GO:0060174)|mammary gland epithelium development (GO:0061180)|mesoderm formation (GO:0001707)|negative regulation of axon extension involved in axon guidance (GO:0048843)|neuron differentiation (GO:0030182)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of gene expression (GO:0010628)|Spemann organizer formation at the anterior end of the primitive streak (GO:0060064)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GGAGGGTCTCCACCCAGCCTC	0.592																																					p.G256G		Atlas-SNP	.											.	WNT3	34	.	0			c.A768A						PASS	.						85.0	91.0	89.0					17																	44845986		2203	4300	6503	SO:0001819	synonymous_variant	7473	exon4			GGTCTCCACCCAG	AY009397	CCDS11505.1	17q21-q22	2013-02-28				ENSG00000108379		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12782	protein-coding gene	gene with protein product	"""WNT-3 proto-oncogene protein"""	165330		INT4		8244403	Standard	NM_030753		Approved	MGC131950, MGC138321, MGC138323	uc002ikv.3	P56703		ENST00000225512.5:c.768G>A	chr17.hg19:g.44845986C>T		146.0	0.0	.		174.0	79.0	.	NM_030753	Q2M237|Q9H1J9	Silent	SNP	ENST00000225512.5	hg19	CCDS11505.1																																																																																			.	.	.	none		0.592	WNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440427.1	NM_030753	
RNF213	57674	hgsc.bcm.edu	37	17	78321576	78321576	+	Silent	SNP	C	C	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr17:78321576C>T	ENST00000582970.1	+	29	9584	c.9441C>T	c.(9439-9441)cgC>cgT	p.R3147R	RNF213_ENST00000336301.6_Silent_p.R1220R|RNF213_ENST00000508628.2_Silent_p.R3196R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3147					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCAACTTCCGCCTGATTGTCA	0.552																																					p.R3147R		Atlas-SNP	.											.	RNF213	766	.	0			c.C9441T						PASS	.						55.0	53.0	54.0					17																	78321576		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon29			CTTCCGCCTGATT	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9441C>T	chr17.hg19:g.78321576C>T		79.0	0.0	.		88.0	6.0	.	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	hg19	CCDS58606.1																																																																																			.	.	.	none		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
AP3D1	8943	hgsc.bcm.edu	37	19	2151253	2151253	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:2151253G>C	ENST00000345016.5	-	1	312	c.81C>G	c.(79-81)aaC>aaG	p.N27K	AP3D1_ENST00000355272.6_Missense_Mutation_p.N27K|AP3D1_ENST00000350812.6_Missense_Mutation_p.N27K|AP3D1_ENST00000356926.4_Missense_Mutation_p.N27K	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	27					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTCCTTGTGGTTACGGATGC	0.682																																					p.N27K		Atlas-SNP	.											.	AP3D1	81	.	0			c.C81G						PASS	.						29.0	32.0	31.0					19																	2151253		1958	4139	6097	SO:0001583	missense	8943	exon1			CTTGTGGTTACGG	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.81C>G	chr19.hg19:g.2151253G>C	ENSP00000344055:p.Asn27Lys	29.0	0.0	.		34.0	16.0	.	NM_001261826	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	hg19	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717231	0.48622	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.18657	2.2;2.65;2.62;2.21	3.89	2.85	0.33270	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.32436	0.0829	L	0.40543	1.245	0.25610	N	0.986508	B;B;D	0.67145	0.264;0.058;0.996	B;B;D	0.78314	0.033;0.067;0.991	T	0.02860	-1.1101	10	0.52906	T	0.07	-55.1245	9.2068	0.37293	0.1883:0.0:0.8117:0.0	.	27;27;27	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	K	27	ENSP00000349398:N27K;ENSP00000344055:N27K;ENSP00000347416:N27K;ENSP00000342321:N27K	ENSP00000341579:N27K	N	-	3	2	AP3D1	2102253	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.691000	0.37721	0.971000	0.38288	0.436000	0.28706	AAC	.	.	.	none		0.682	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
PSMC4	5704	hgsc.bcm.edu	37	19	40478461	40478461	+	Splice_Site	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:40478461A>G	ENST00000157812.2	+	3	519	c.321A>G	c.(319-321)acA>acG	p.T107T	PSMC4_ENST00000455878.2_Splice_Site_p.T76T	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	107					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GCTCTACCACAGGTGTGCTAA	0.512																																					p.T107T	Colon(105;1478 1543 4034 6132 38638)	Atlas-SNP	.											.	PSMC4	48	.	0			c.A321G						PASS	.						41.0	36.0	38.0					19																	40478461		2203	4300	6503	SO:0001630	splice_region_variant	5704	exon3			TACCACAGGTGTG	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.322+1A>G	chr19.hg19:g.40478461A>G		30.0	0.0	.		46.0	11.0	.	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	hg19	CCDS12547.1																																																																																			.	.	.	none		0.512	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	Silent
MEGF8	1954	hgsc.bcm.edu	37	19	42861598	42861598	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr19:42861598C>G	ENST00000251268.6	+	28	4873	c.4873C>G	c.(4873-4875)Ctt>Gtt	p.L1625V	MEGF8_ENST00000334370.4_Missense_Mutation_p.L1558V	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1625					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGTCACACCCTTACTGCCCG	0.652																																					p.L1625V		Atlas-SNP	.											.	MEGF8	358	.	0			c.C4873G						PASS	.						67.0	68.0	67.0					19																	42861598		2203	4300	6503	SO:0001583	missense	1954	exon28			CACACCCTTACTG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.4873C>G	chr19.hg19:g.42861598C>G	ENSP00000251268:p.Leu1625Val	182.0	0.0	.		163.0	44.0	.	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	hg19		.	.	.	.	.	.	.	.	.	.	C	22.5	4.302490	0.81136	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.64438	-0.1;-0.1	5.21	5.21	0.72293	Galactose oxidase/kelch, beta-propeller (1);Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000038	T	0.74913	0.3779	L	0.50333	1.59	0.80722	D	1	D;D	0.63046	0.992;0.99	P;D	0.72982	0.792;0.979	T	0.76110	-0.3079	10	0.56958	D	0.05	-13.3833	17.5358	0.87830	0.0:1.0:0.0:0.0	.	1625;1558	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	V	1558;1625	ENSP00000334219:L1558V;ENSP00000251268:L1625V	ENSP00000251268:L1625V	L	+	1	0	MEGF8	47553438	1.000000	0.71417	0.980000	0.43619	0.985000	0.73830	4.334000	0.59291	2.453000	0.82957	0.563000	0.77884	CTT	.	.	.	none		0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
NRIP1	8204	hgsc.bcm.edu	37	21	16337670	16337670	+	Silent	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:16337670A>G	ENST00000400202.1	-	3	3556	c.2844T>C	c.(2842-2844)gaT>gaC	p.D948D	NRIP1_ENST00000400199.1_Silent_p.D948D|NRIP1_ENST00000318948.4_Silent_p.D948D|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	948	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GCGGGGACAAATCTCGCACAC	0.428																																					p.D948D		Atlas-SNP	.											.	NRIP1	103	.	0			c.T2844C						PASS	.						82.0	82.0	82.0					21																	16337670		2203	4299	6502	SO:0001819	synonymous_variant	8204	exon4			GGACAAATCTCGC	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2844T>C	chr21.hg19:g.16337670A>G		150.0	0.0	.		157.0	44.0	.	NM_003489	Q8IWE8	Silent	SNP	ENST00000400202.1	hg19	CCDS13568.1																																																																																			.	.	.	none		0.428	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157926.1	NM_003489	
NCAM2	4685	hgsc.bcm.edu	37	21	22658662	22658662	+	Silent	SNP	A	A	T			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:22658662A>T	ENST00000400546.1	+	4	660	c.411A>T	c.(409-411)cgA>cgT	p.R137R	NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000535285.1_Silent_p.R162R|NCAM2_ENST00000284894.7_Intron	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	137	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGGTTTGCCGAGTTAGCAGTT	0.398																																					p.R137R		Atlas-SNP	.											.	NCAM2	220	.	0			c.A411T						PASS	.						119.0	114.0	116.0					21																	22658662		2019	4192	6211	SO:0001819	synonymous_variant	4685	exon4			TTGCCGAGTTAGC		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.411A>T	chr21.hg19:g.22658662A>T		64.0	0.0	.		55.0	15.0	.	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	hg19	CCDS42910.1																																																																																			.	.	.	none		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
SON	6651	hgsc.bcm.edu	37	21	34932382	34932382	+	Intron	SNP	A	A	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr21:34932382A>G	ENST00000356577.4	+	6	7132				SON_ENST00000290239.6_Intron|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.N2286S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCAAGGTACAACTATTTAGCT	0.473																																					p.N2286S		Atlas-SNP	.											.	SON	343	.	0			c.A6857G						PASS	.						149.0	142.0	145.0					21																	34932382		2203	4300	6503	SO:0001627	intron_variant	6651	exon7			GGTACAACTATTT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6657+301A>G	chr21.hg19:g.34932382A>G		200.0	0.0	.		180.0	55.0	.	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	hg19	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.907015	0.33628	.	.	ENSG00000159140	ENST00000300278	T	0.09630	2.96	5.58	5.58	0.84498	.	.	.	.	.	T	0.32071	0.0817	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.03922	-1.0992	8	0.87932	D	0	.	12.1393	0.53989	1.0:0.0:0.0:0.0	.	2286	P18583-3	.	S	2286	ENSP00000300278:N2286S	ENSP00000300278:N2286S	N	+	2	0	SON	33854252	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.247000	0.58750	2.124000	0.65301	0.460000	0.39030	AAC	.	.	.	none		0.473	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
RHBDD3	25807	hgsc.bcm.edu	37	22	29656765	29656765	+	Silent	SNP	C	C	A			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr22:29656765C>A	ENST00000216085.7	-	5	1045	c.621G>T	c.(619-621)ggG>ggT	p.G207G	CTA-984G1.5_ENST00000433125.1_RNA	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	207					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						GGGGCCAGCACCCCGCCAAGG	0.692																																					p.G207G		Atlas-SNP	.											.	RHBDD3	17	.	0			c.G621T						PASS	.						17.0	17.0	17.0					22																	29656765		2198	4291	6489	SO:0001819	synonymous_variant	25807	exon5			CCAGCACCCCGCC	AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.621G>T	chr22.hg19:g.29656765C>A		23.0	0.0	.		29.0	9.0	.	NM_012265	Q6I9X3|Q9UGQ7	Silent	SNP	ENST00000216085.7	hg19	CCDS13850.1																																																																																			.	.	.	none		0.692	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321085.1	NM_012265	
MAP7D3	79649	hgsc.bcm.edu	37	X	135314169	135314169	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chrX:135314169T>C	ENST00000316077.9	-	8	1167	c.947A>G	c.(946-948)aAc>aGc	p.N316S	MAP7D3_ENST00000370661.1_Missense_Mutation_p.N281S|MAP7D3_ENST00000370663.5_Missense_Mutation_p.N298S	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	316					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CATGCTTGTGTTGCAGAATAC	0.567																																					p.N316S		Atlas-SNP	.											.	MAP7D3	102	.	0			c.A947G						PASS	.						167.0	168.0	168.0					X																	135314169		2132	4212	6344	SO:0001583	missense	79649	exon8			CTTGTGTTGCAGA	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.947A>G	chrX.hg19:g.135314169T>C	ENSP00000318086:p.Asn316Ser	209.0	0.0	.		192.0	23.0	.	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	hg19	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	T	4.011	-0.000557	0.07819	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	3.62	-1.54	0.08584	.	.	.	.	.	T	0.07773	0.0195	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.26258	0.09;0.126;0.09;0.145	B;B;B;B	0.26614	0.032;0.039;0.032;0.071	T	0.44467	-0.9326	9	0.13108	T	0.6	0.3015	8.6543	0.34053	0.0:0.6237:0.0:0.3763	.	298;275;316;281	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	S	281;316;298;275	ENSP00000359695:N281S;ENSP00000318086:N316S;ENSP00000359697:N298S;ENSP00000359694:N275S	ENSP00000318086:N316S	N	-	2	0	MAP7D3	135141835	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.087000	0.14958	-0.273000	0.09246	-0.463000	0.05309	AAC	.	.	.	none		0.567	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
ELF3	1999	hgsc.bcm.edu	37	1	201980419	201980420	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7834-01A-11D-2136-08	TCGA-DW-7834-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7f7db203-247b-49e1-a80e-c8be4047bc17	1354f438-e892-40c1-84b6-cd15f786a963	g.chr1:201980419_201980420insG	ENST00000359651.3	+	1	3347_3348	c.155_156insG	c.(154-159)gagggtfs	p.EG52fs	ELF3_ENST00000495848.1_3'UTR|RP11-465N4.4_ENST00000419190.1_RNA|ELF3_ENST00000367284.5_Frame_Shift_Ins_p.EG52fs|ELF3_ENST00000367283.3_Frame_Shift_Ins_p.EG52fs|RP11-510N19.5_ENST00000504773.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )									p.E52G(2)		breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						ATGTCATTGGAGGGTACAGGTG	0.609																																					p.E52fs		Atlas-INDEL	.											ELF3_ENST00000359651,NS,carcinoma,0,2	ELF3	92	.	2	Substitution - Missense(2)	lung(2)	c.155_156insG						PASS	.																																			SO:0001589	frameshift_variant	1999	exon2			.	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.158dupG	chr1.hg19:g.201980422_201980422dupG	ENSP00000352673:p.Glu52fs	135.0	0.0	0		144.0	11.0	0.0763889	NM_004433		Frame_Shift_Ins	INS	ENST00000359651.3	hg19	CCDS1419.1																																																																																			.	.	.	none		0.609	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
