#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NUDC	10726	hgsc.bcm.edu	37	1	27271886	27271886	+	Silent	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:27271886T>C	ENST00000321265.5	+	7	870	c.747T>C	c.(745-747)aaT>aaC	p.N249N	NUDC_ENST00000484772.1_3'UTR	NM_006600.3	NP_006591.1	Q9Y266	NUDC_HUMAN	nudC nuclear distribution protein	249	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)				cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		CACAGATCAATAAGATGGAGT	0.537																																					p.N249N		Atlas-SNP	.											.	NUDC	15	.	0			c.T747C						PASS	.						59.0	53.0	55.0					1																	27271886		2203	4300	6503	SO:0001819	synonymous_variant	10726	exon7			GATCAATAAGATG		CCDS292.1	1p35-p34	2013-08-06	2013-08-06		ENSG00000090273	ENSG00000090273			8045	protein-coding gene	gene with protein product		610325	"""nuclear distribution gene C homolog (A. nidulans)"", ""nuclear distribution C homolog (A. nidulans)"""				Standard	NM_006600		Approved	NudC	uc001bng.2	Q9Y266	OTTHUMG00000004226	ENST00000321265.5:c.747T>C	chr1.hg19:g.27271886T>C		51.0	0.0	.		44.0	19.0	.	NM_006600	Q5QP31|Q5QP35|Q9H0N2|Q9Y2B6	Silent	SNP	ENST00000321265.5	hg19	CCDS292.1																																																																																			.	.	.	none		0.537	NUDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012172.2		
DUSP23	54935	hgsc.bcm.edu	37	1	159752041	159752041	+	Silent	SNP	T	T	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:159752041T>A	ENST00000368107.1	+	2	464	c.366T>A	c.(364-366)atT>atA	p.I122I	DUSP23_ENST00000368109.1_Silent_p.I122I|DUSP23_ENST00000368108.3_Silent_p.I122I			Q9BVJ7	DUS23_HUMAN	dual specificity phosphatase 23	122	Tyrosine-protein phosphatase.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			lung(1)	1	all_hematologic(112;0.0537)					GAGATGCCATTGCTGAAATCC	0.577																																					p.I122I		Atlas-SNP	.											.	DUSP23	9	.	0			c.T366A						PASS	.						119.0	108.0	112.0					1																	159752041		2203	4300	6503	SO:0001819	synonymous_variant	54935	exon3			TGCCATTGCTGAA		CCDS1187.1	1q23.1	2011-06-09			ENSG00000158716	ENSG00000158716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	21480	protein-coding gene	gene with protein product						15147733	Standard	XM_005245289		Approved	FLJ20442, DUSP25	uc001ftz.1	Q9BVJ7	OTTHUMG00000022795	ENST00000368107.1:c.366T>A	chr1.hg19:g.159752041T>A		92.0	0.0	.		80.0	40.0	.	NM_017823	Q9NX48	Silent	SNP	ENST00000368107.1	hg19	CCDS1187.1																																																																																			.	.	.	none		0.577	DUSP23-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085552.1	NM_017823	
TOMM40L	84134	hgsc.bcm.edu	37	1	161197494	161197494	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:161197494G>T	ENST00000367988.3	+	5	614	c.345G>T	c.(343-345)ttG>ttT	p.L115F	TOMM40L_ENST00000474486.1_Intron|TOMM40L_ENST00000545897.1_Intron|NR1I3_ENST00000479324.1_5'Flank|MIR5187_ENST00000583479.1_RNA|TOMM40L_ENST00000367987.1_Missense_Mutation_p.L115F	NM_032174.4	NP_115550.2	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)-like	115					ion transport (GO:0006811)|protein transport (GO:0015031)	mitochondrial outer membrane (GO:0005741)|pore complex (GO:0046930)|protein complex (GO:0043234)	porin activity (GO:0015288)			large_intestine(2)|liver(4)|lung(4)	10	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TGCTCCTCTTGGCAGAGCGGC	0.582											OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L115F		Atlas-SNP	.											.	TOMM40L	19	.	0			c.G345T						PASS	.						60.0	54.0	56.0					1																	161197494		2203	4300	6503	SO:0001583	missense	84134	exon5			CCTCTTGGCAGAG		CCDS1227.1, CCDS65700.1	1q23.3	2008-02-05	2007-01-12		ENSG00000158882	ENSG00000158882			25756	protein-coding gene	gene with protein product			"""translocase of outer mitochondrial membrane 40 homolog-like (yeast)"""				Standard	NM_032174		Approved	FLJ12770, TOMM40B	uc001fzd.3	Q969M1	OTTHUMG00000034345	ENST00000367988.3:c.345G>T	chr1.hg19:g.161197494G>T	ENSP00000356967:p.Leu115Phe	87.0	0.0	.	1814	66.0	35.0	.	NM_032174	B7Z4U0|D3DVG9	Missense_Mutation	SNP	ENST00000367988.3	hg19	CCDS1227.1	.	.	.	.	.	.	.	.	.	.	G	14.57	2.574862	0.45902	.	.	ENSG00000158882	ENST00000367988;ENST00000542686;ENST00000367987	T;T	0.50001	0.76;0.76	5.49	4.52	0.55395	.	0.140087	0.48767	D	0.000176	T	0.20659	0.0497	L	0.29908	0.895	0.43971	D	0.996654	B	0.13145	0.007	B	0.20955	0.032	T	0.04427	-1.0952	9	0.24483	T	0.36	-10.7345	13.4834	0.61351	0.0:0.1581:0.8419:0.0	.	115	Q969M1	TM40L_HUMAN	F	115;62;115	ENSP00000356967:L115F;ENSP00000356966:L115F	ENSP00000356966:L115F	L	+	3	2	TOMM40L	159464118	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.926000	0.28804	2.578000	0.87016	0.655000	0.94253	TTG	.	.	.	none		0.582	TOMM40L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083029.1	NM_032174	
CACNA1S	779	hgsc.bcm.edu	37	1	201013478	201013478	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:201013478G>A	ENST00000362061.3	-	39	5001	c.4775C>T	c.(4774-4776)gCg>gTg	p.A1592V	RP11-168O16.2_ENST00000415359.1_RNA|CACNA1S_ENST00000367338.3_Missense_Mutation_p.A1573V	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1592					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCTCCATCGCAGCCTCCAC	0.622																																					p.A1592V		Atlas-SNP	.											.	CACNA1S	249	.	0			c.C4775T						PASS	.						86.0	72.0	77.0					1																	201013478		2203	4300	6503	SO:0001583	missense	779	exon39			TCCATCGCAGCCT	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.4775C>T	chr1.hg19:g.201013478G>A	ENSP00000355192:p.Ala1592Val	90.0	0.0	.		96.0	43.0	.	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	18.25	3.581852	0.65992	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96334	-3.98;-3.89	4.98	4.98	0.66077	.	0.913156	0.09136	N	0.843670	D	0.94974	0.8374	M	0.69358	2.11	0.46011	D	0.99881	P	0.36909	0.573	B	0.25759	0.063	D	0.91638	0.5324	10	0.38643	T	0.18	.	18.2653	0.90050	0.0:0.0:1.0:0.0	.	1592	Q13698	CAC1S_HUMAN	V	1592;1573	ENSP00000355192:A1592V;ENSP00000356307:A1573V	ENSP00000355192:A1592V	A	-	2	0	CACNA1S	199280101	1.000000	0.71417	0.604000	0.28916	0.956000	0.61745	5.418000	0.66429	2.304000	0.77564	0.555000	0.69702	GCG	.	.	.	none		0.622	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
ERO1LB	56605	hgsc.bcm.edu	37	1	236385229	236385229	+	Silent	SNP	A	A	G			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:236385229A>G	ENST00000354619.5	-	14	1405	c.1204T>C	c.(1204-1206)Tta>Cta	p.L402L		NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	402					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TATACCTGTAATTTTCCCCAT	0.343																																					p.L402L		Atlas-SNP	.											.	ERO1LB	48	.	0			c.T1204C						PASS	.						103.0	101.0	102.0					1																	236385229		2202	4300	6502	SO:0001819	synonymous_variant	56605	exon14			CCTGTAATTTTCC	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.1204T>C	chr1.hg19:g.236385229A>G		78.0	0.0	.		39.0	22.0	.	NM_019891	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Silent	SNP	ENST00000354619.5	hg19	CCDS31064.1																																																																																			.	.	.	none		0.343	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
OR2AK2	391191	hgsc.bcm.edu	37	1	248129596	248129596	+	Silent	SNP	A	A	G			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr1:248129596A>G	ENST00000366480.3	+	1	1062	c.963A>G	c.(961-963)ggA>ggG	p.G321G	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	321						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GACTGTTGGGATATTGGATAT	0.393																																					p.G321G	Melanoma(45;390 1181 23848 28461 41504)	Atlas-SNP	.											.	OR2AK2	90	.	0			c.A963G						PASS	.						99.0	96.0	97.0					1																	248129596		2203	4300	6503	SO:0001819	synonymous_variant	391191	exon1			GTTGGGATATTGG	BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.963A>G	chr1.hg19:g.248129596A>G		113.0	0.0	.		69.0	31.0	.	NM_001004491	B2RND1|Q6IF05	Silent	SNP	ENST00000366480.3	hg19	CCDS31102.1																																																																																			.	.	.	none		0.393	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096858.2	NM_001004491	
LTBP1	4052	hgsc.bcm.edu	37	2	33246142	33246142	+	Silent	SNP	T	T	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr2:33246142T>A	ENST00000404816.2	+	3	1085	c.732T>A	c.(730-732)ccT>ccA	p.P244P	LTBP1_ENST00000354476.3_Silent_p.P244P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	244					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CGTGGGGCCCTCCTGAGCAAG	0.567																																					p.P244P		Atlas-SNP	.											.	LTBP1	317	.	0			c.T732A						PASS	.						109.0	111.0	110.0					2																	33246142		2203	4300	6503	SO:0001819	synonymous_variant	4052	exon3			GGGCCCTCCTGAG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.732T>A	chr2.hg19:g.33246142T>A		219.0	0.0	.		169.0	60.0	.	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	hg19	CCDS33177.2																																																																																			.	.	.	none		0.567	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
LYG2	254773	hgsc.bcm.edu	37	2	99861757	99861757	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr2:99861757C>A	ENST00000409238.1	-	3	369	c.349G>T	c.(349-351)Gac>Tac	p.D117Y	LYG2_ENST00000409679.1_Missense_Mutation_p.D117Y|LYG2_ENST00000423800.1_Missense_Mutation_p.D117Y|LYG2_ENST00000333017.2_Missense_Mutation_p.D117Y			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	117					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						CCCCTGTGGTCCCAGCCGTCT	0.522																																					p.D117Y		Atlas-SNP	.											.	LYG2	26	.	0			c.G349T						PASS	.						102.0	94.0	97.0					2																	99861757		2203	4300	6503	SO:0001583	missense	254773	exon4			TGTGGTCCCAGCC	AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.349G>T	chr2.hg19:g.99861757C>A	ENSP00000386939:p.Asp117Tyr	126.0	0.0	.		102.0	42.0	.	NM_175735	Q496G2|Q53RW0	Missense_Mutation	SNP	ENST00000409238.1	hg19	CCDS2042.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589375	0.66105	.	.	ENSG00000185674	ENST00000409238;ENST00000333017;ENST00000409679;ENST00000423306	.	.	.	5.78	4.91	0.64330	Lytic transglycosylase-like, catalytic (1);Lysozyme-like domain (1);	0.174545	0.40728	N	0.001027	T	0.69450	0.3112	M	0.63428	1.95	0.37969	D	0.933212	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.66847	0.947;0.947;0.947	T	0.73113	-0.4085	8	.	.	.	-2.2835	10.7149	0.46006	0.0:0.9126:0.0:0.0874	.	117;117;117	Q496G2;C9J4J0;Q86SG7	.;.;LYG2_HUMAN	Y	117	.	.	D	-	1	0	LYG2	99228189	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	2.364000	0.44187	1.465000	0.48006	0.555000	0.69702	GAC	.	.	.	none		0.522	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330307.1	NM_175735	
TNS1	7145	hgsc.bcm.edu	37	2	218749811	218749811	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr2:218749811A>T	ENST00000171887.4	-	14	1270	c.818T>A	c.(817-819)aTc>aAc	p.I273N	TNS1_ENST00000419504.1_Missense_Mutation_p.I273N|TNS1_ENST00000430930.1_Missense_Mutation_p.I273N|TNS1_ENST00000310858.6_Missense_Mutation_p.I304N	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	273	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CAGGTCATGGATGGCACAGGT	0.592																																					p.I273N		Atlas-SNP	.											.	TNS1	251	.	0			c.T818A						PASS	.						140.0	113.0	122.0					2																	218749811		2203	4300	6503	SO:0001583	missense	7145	exon14			TCATGGATGGCAC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.818T>A	chr2.hg19:g.218749811A>T	ENSP00000171887:p.Ile273Asn	104.0	0.0	.		88.0	39.0	.	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	hg19	CCDS2407.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.9|22.9	4.347781|4.347781	0.82022|0.82022	.|.	.|.	ENSG00000079308|ENSG00000079308	ENST00000453356|ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858	.|D;D;D;D;D;D	.|0.89270	.|-2.49;-2.49;-2.49;-2.49;-2.49;-2.49	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.358725	.|0.30227	.|N	.|0.010111	D|D	0.94019|0.94019	0.8084|0.8084	M|M	0.79805|0.79805	2.47|2.47	0.47276|0.47276	D|D	0.999373|0.999373	.|D;D;D;D;D;D	.|0.76494	.|0.999;0.995;0.961;0.993;0.999;0.999	.|D;D;P;D;D;D	.|0.71184	.|0.972;0.961;0.828;0.942;0.972;0.972	D|D	0.94788|0.94788	0.7959|0.7959	5|10	.|0.87932	.|D	.|0	.|.	14.2677|14.2677	0.66129|0.66129	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|273;327;304;273;273;273	.|B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55	.|.;.;.;TENS1_HUMAN;.;.	Q|N	48|273;273;273;398;341;304	.|ENSP00000171887:I273N;ENSP00000408724:I273N;ENSP00000406016:I273N;ENSP00000405460:I398N;ENSP00000400383:I341N;ENSP00000308321:I304N	.|ENSP00000171887:I273N	H|I	-|-	3|2	2|0	TNS1|TNS1	218458056|218458056	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.004000|9.004000	0.93583|0.93583	2.021000|2.021000	0.59480|0.59480	0.460000|0.460000	0.39030|0.39030	CAT|ATC	.	.	.	none		0.592	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
RBM5	10181	hgsc.bcm.edu	37	3	50129618	50129618	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr3:50129618T>G	ENST00000347869.3	+	3	335	c.160T>G	c.(160-162)Tac>Gac	p.Y54D	RBM5_ENST00000469838.1_Missense_Mutation_p.Y54D	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	54				DY -> GS (in Ref. 1; AAA99715). {ECO:0000305}.	apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ATATGATGACTACCGAGACTA	0.498																																					p.Y54D		Atlas-SNP	.											.	RBM5	76	.	0			c.T160G						PASS	.						102.0	94.0	97.0					3																	50129618		2203	4300	6503	SO:0001583	missense	10181	exon3			GATGACTACCGAG	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.160T>G	chr3.hg19:g.50129618T>G	ENSP00000343054:p.Tyr54Asp	56.0	0.0	.		64.0	36.0	.	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	hg19	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.310260	0.23821	.	.	ENSG00000003756	ENST00000347869;ENST00000469838;ENST00000404526;ENST00000536082;ENST00000441305;ENST00000437500;ENST00000417905;ENST00000543047;ENST00000539538	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	4.83	3.63	0.41609	.	0.293852	0.33610	N	0.004734	T	0.26122	0.0637	N	0.22421	0.69	0.44523	D	0.997476	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.06499	-1.0823	9	.	.	.	-8.6199	10.5358	0.45002	0.0:0.0795:0.0:0.9204	.	54;54	P52756;E1CJT4	RBM5_HUMAN;.	D	54;54;54;54;54;54;54;53;53	ENSP00000343054:Y54D;ENSP00000419534:Y54D;ENSP00000390711:Y54D;ENSP00000406119:Y54D	.	Y	+	1	0	RBM5	50104622	0.998000	0.40836	1.000000	0.80357	0.820000	0.46376	1.836000	0.39191	2.037000	0.60232	0.450000	0.29827	TAC	.	.	.	none		0.498	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
NPY2R	4887	hgsc.bcm.edu	37	4	156136064	156136064	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr4:156136064T>C	ENST00000329476.3	+	2	1462	c.973T>C	c.(973-975)Tat>Cat	p.Y325H	NPY2R_ENST00000506608.1_Missense_Mutation_p.Y325H	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	325					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TCCCCTTCTCTATGGCTGGAT	0.512																																					p.Y325H		Atlas-SNP	.											.	NPY2R	87	.	0			c.T973C						PASS	.						114.0	96.0	102.0					4																	156136064		2203	4300	6503	SO:0001583	missense	4887	exon2			CTTCTCTATGGCT	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.973T>C	chr4.hg19:g.156136064T>C	ENSP00000332591:p.Tyr325His	153.0	0.0	.		87.0	37.0	.	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	hg19	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.198384	0.79015	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	D;D	0.93247	-3.19;-3.19	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98353	0.9453	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99659	1.0993	10	0.87932	D	0	.	15.2138	0.73247	0.0:0.0:0.0:1.0	.	325	P49146	NPY2R_HUMAN	H	325	ENSP00000332591:Y325H;ENSP00000426366:Y325H	ENSP00000332591:Y325H	Y	+	1	0	NPY2R	156355514	1.000000	0.71417	0.976000	0.42696	0.970000	0.65996	8.040000	0.89188	2.189000	0.69895	0.523000	0.50628	TAT	.	.	.	none		0.512	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
KCNQ5	56479	hgsc.bcm.edu	37	6	73904447	73904447	+	Silent	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr6:73904447C>T	ENST00000370398.1	+	14	2218	c.2109C>T	c.(2107-2109)taC>taT	p.Y703Y	KCNQ5_ENST00000414165.2_Silent_p.Y593Y|KCNQ5_ENST00000342056.2_Silent_p.Y722Y|KCNQ5_ENST00000403813.2_Silent_p.Y694Y|KCNQ5_ENST00000402622.2_Silent_p.Y713Y|KCNQ5_ENST00000355635.3_Silent_p.Y704Y|KCNQ5_ENST00000355194.4_Silent_p.Y703Y	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	703					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	AGACTTTCTACGCGCTTAGCC	0.493																																					p.Y722Y	GBM(142;1375 1859 14391 23261 44706)	Atlas-SNP	.											.	KCNQ5	153	.	0			c.C2166T						PASS	.						132.0	131.0	132.0					6																	73904447		2203	4300	6503	SO:0001819	synonymous_variant	56479	exon15			TTTCTACGCGCTT	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2109C>T	chr6.hg19:g.73904447C>T		205.0	0.0	.		174.0	80.0	.	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	ENST00000370398.1	hg19	CCDS4976.1																																																																																			.	.	.	none		0.493	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
SLC26A4	5172	hgsc.bcm.edu	37	7	107335130	107335130	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr7:107335130C>A	ENST00000265715.3	+	12	1630	c.1406C>A	c.(1405-1407)cCt>cAt	p.P469H	SLC26A4_ENST00000480841.1_3'UTR|SLC26A4_ENST00000541474.1_Missense_Mutation_p.P30H|SLC26A4_ENST00000544569.1_Missense_Mutation_p.P56H|SLC26A4_ENST00000543100.1_Missense_Mutation_p.P38H	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	469					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TGTGACATTCCTCGTCTGTGG	0.428									Pendred syndrome																												p.P469H		Atlas-SNP	.											.	SLC26A4	117	.	0			c.C1406A						PASS	.						174.0	156.0	162.0					7																	107335130		2203	4300	6503	SO:0001583	missense	5172	exon12	Familial Cancer Database	Goiter-Deafness syndrome	ACATTCCTCGTCT	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1406C>A	chr7.hg19:g.107335130C>A	ENSP00000265715:p.Pro469His	107.0	0.0	.		124.0	79.0	.	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	hg19	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657406	0.88154	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.94897	-3.13;-3.55;-3.13;-3.13	5.66	5.66	0.87406	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.97835	0.9289	M	0.89904	3.07	0.58432	D	0.999998	D;D;P	0.89917	1.0;1.0;0.932	D;D;P	0.97110	0.999;1.0;0.599	D	0.97207	0.9868	10	0.42905	T	0.14	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	30;56;469	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	H	469;30;56;38	ENSP00000265715:P469H;ENSP00000439743:P30H;ENSP00000437427:P56H;ENSP00000441209:P38H	ENSP00000265715:P469H	P	+	2	0	SLC26A4	107122366	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.145000	0.77365	2.826000	0.97356	0.655000	0.94253	CCT	.	.	.	none		0.428	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
ADAM32	203102	hgsc.bcm.edu	37	8	39068760	39068760	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr8:39068760C>T	ENST00000379907.4	+	12	1277	c.1150C>T	c.(1150-1152)Caa>Taa	p.Q384*	ADAM32_ENST00000519315.1_Intron|ADAM32_ENST00000437682.2_Intron	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	384						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			GAATAAGCCACAAATGCAAAA	0.393																																					p.Q384X		Atlas-SNP	.											.	ADAM32	70	.	0			c.C1150T						PASS	.						82.0	78.0	79.0					8																	39068760		1816	4089	5905	SO:0001587	stop_gained	203102	exon12			AAGCCACAAATGC	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1150C>T	chr8.hg19:g.39068760C>T	ENSP00000369238:p.Gln384*	24.0	0.0	.		17.0	11.0	.	NM_145004	Q8TC42	Nonsense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618144	0.87359	.	.	ENSG00000197140	ENST00000379907	.	.	.	5.23	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	11.6429	0.51244	0.177:0.823:0.0:0.0	.	.	.	.	X	384	.	ENSP00000369238:Q384X	Q	+	1	0	ADAM32	39187917	0.013000	0.17824	0.987000	0.45799	0.438000	0.31896	0.452000	0.21795	2.585000	0.87301	0.650000	0.86243	CAA	.	.	.	none		0.393	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
CSMD3	114788	hgsc.bcm.edu	37	8	113697852	113697852	+	Silent	SNP	T	T	G			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr8:113697852T>G	ENST00000297405.5	-	15	2509	c.2265A>C	c.(2263-2265)ccA>ccC	p.P755P	CSMD3_ENST00000352409.3_Silent_p.P755P|CSMD3_ENST00000343508.3_Silent_p.P715P|CSMD3_ENST00000455883.2_Silent_p.P651P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	755	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCGGCTCCCTGGATCAGAGA	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P755P		Atlas-SNP	.											.	CSMD3	2325	.	0			c.A2265C						PASS	.						100.0	108.0	105.0					8																	113697852		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon15			GCTCCCTGGATCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2265A>C	chr8.hg19:g.113697852T>G		158.0	0.0	.		106.0	52.0	.	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.	.	none		0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MRC1	4360	hgsc.bcm.edu	37	10	17891759	17891759	+	Silent	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr10:17891759C>T	ENST00000331429.2	+	7	1343	c.1240C>T	c.(1240-1242)Cta>Tta	p.L414L	MRC1L1_ENST00000457317.1_Silent_p.L414L																breast(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TATCTCCCAGCTAGGATATGG	0.438																																					p.L414L		Atlas-SNP	.											.	MRC1	13	.	0			c.C1240T						PASS	.						161.0	174.0	170.0					10																	17891759		2158	4135	6293	SO:0001819	synonymous_variant	4360	exon7			TCCCAGCTAGGAT																												ENST00000331429.2:c.1240C>T	chr10.hg19:g.17891759C>T		318.0	1.0	.		243.0	92.0	.	NM_002438		Silent	SNP	ENST00000331429.2	hg19																																																																																				.	.	.	none		0.438	MRC1L1-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047054.1		
PPP3CB	5532	hgsc.bcm.edu	37	10	75214208	75214208	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr10:75214208T>C	ENST00000360663.5	-	10	1259	c.1148A>G	c.(1147-1149)gAt>gGt	p.D383G	PPP3CB_ENST00000544628.1_Missense_Mutation_p.D11G|PPP3CB_ENST00000394822.2_Missense_Mutation_p.D401G|PPP3CB_ENST00000342558.3_Missense_Mutation_p.D383G|PPP3CB_ENST00000394829.2_Missense_Mutation_p.D383G|PPP3CB_ENST00000545874.1_Missense_Mutation_p.D297G|PPP3CB_ENST00000394828.2_Missense_Mutation_p.D383G			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	383					axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					TAGTTCATCATCAGAGCAAAT	0.313																																					p.D383G		Atlas-SNP	.											.	PPP3CB	68	.	0			c.A1148G						PASS	.						143.0	136.0	138.0					10																	75214208		2203	4298	6501	SO:0001583	missense	5532	exon10			TCATCATCAGAGC	M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.1148A>G	chr10.hg19:g.75214208T>C	ENSP00000353881:p.Asp383Gly	156.0	0.0	.		88.0	28.0	.	NM_001142354	P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	ENST00000360663.5	hg19	CCDS7328.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368061	0.82463	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000394823;ENST00000544628;ENST00000430762;ENST00000342558;ENST00000545874;ENST00000394822	T;T;T;T;T;T;T	0.05786	3.39;3.39;3.39;3.39;3.39;3.39;3.39	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.18923	0.0454	M	0.64676	1.99	0.80722	D	1	D;P;B;P;B	0.54047	0.964;0.586;0.052;0.819;0.022	P;P;B;B;B	0.56127	0.792;0.46;0.029;0.345;0.018	T	0.00057	-1.2173	10	0.56958	D	0.05	.	16.4943	0.84223	0.0:0.0:0.0:1.0	.	401;297;383;383;383	P16298-2;F5H0F8;P16298-3;Q8N1F0;P16298	.;.;.;.;PP2BB_HUMAN	G	383;383;383;46;11;36;383;297;401	ENSP00000353881:D383G;ENSP00000378306:D383G;ENSP00000378305:D383G;ENSP00000437596:D11G;ENSP00000343147:D383G;ENSP00000439876:D297G;ENSP00000378299:D401G	ENSP00000343147:D383G	D	-	2	0	PPP3CB	74884214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.841000	0.86834	2.291000	0.77112	0.533000	0.62120	GAT	.	.	.	none		0.313	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048669.1	NM_021132	
AHNAK	79026	hgsc.bcm.edu	37	11	62298802	62298802	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr11:62298802A>C	ENST00000378024.4	-	5	3361	c.3087T>G	c.(3085-3087)atT>atG	p.I1029M	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1029					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTGGTGCAGAAATGTCCACAT	0.453																																					p.I1029M		Atlas-SNP	.											.	AHNAK	532	.	0			c.T3087G						PASS	.						98.0	95.0	96.0					11																	62298802		2202	4299	6501	SO:0001583	missense	79026	exon5			TGCAGAAATGTCC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3087T>G	chr11.hg19:g.62298802A>C	ENSP00000367263:p.Ile1029Met	141.0	0.0	.		77.0	39.0	.	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	12.64	1.997934	0.35226	.	.	ENSG00000124942	ENST00000378024	T	0.01527	4.8	4.63	3.5	0.40072	.	0.822488	0.10918	N	0.619768	T	0.04497	0.0123	M	0.83953	2.67	0.28015	N	0.934744	P	0.48089	0.905	P	0.45971	0.499	T	0.30504	-0.9976	10	0.33940	T	0.23	-2.6022	5.0819	0.14661	0.7519:0.0:0.0886:0.1594	.	1029	Q09666	AHNK_HUMAN	M	1029	ENSP00000367263:I1029M	ENSP00000367263:I1029M	I	-	3	3	AHNAK	62055378	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	0.982000	0.29539	0.734000	0.32515	0.454000	0.30748	ATT	.	.	.	none		0.453	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
TMEM52B	120939	hgsc.bcm.edu	37	12	10342575	10342575	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr12:10342575T>C	ENST00000381923.2	+	6	792	c.388T>C	c.(388-390)Tcc>Ccc	p.S130P	TMEM52B_ENST00000298530.3_Missense_Mutation_p.S110P|TMEM52B_ENST00000536952.1_Missense_Mutation_p.S130P			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	130						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CCAGCTGCCCTCCTCTTTGGA	0.582																																					p.S110P		Atlas-SNP	.											.	.	.	.	0			c.T328C						PASS	.						66.0	61.0	63.0					12																	10342575		2203	4300	6503	SO:0001583	missense	120939	exon4			CTGCCCTCCTCTT	AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.388T>C	chr12.hg19:g.10342575T>C	ENSP00000371348:p.Ser130Pro	75.0	0.0	.		53.0	30.0	.	NM_153022	Q96NA7	Missense_Mutation	SNP	ENST00000381923.2	hg19		.	.	.	.	.	.	.	.	.	.	T	2.193	-0.384873	0.04966	.	.	ENSG00000165685	ENST00000381923;ENST00000298530;ENST00000536952	T;T;T	0.32272	1.46;1.46;1.46	4.39	-1.11	0.09840	.	0.546525	0.17750	N	0.163267	T	0.17831	0.0428	L	0.43152	1.355	0.09310	N	0.999998	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.002	T	0.14615	-1.0466	10	0.33141	T	0.24	-7.7347	0.9089	0.01290	0.1631:0.3042:0.1683:0.3644	.	130;110	Q4KMG9;Q4KMG9-2	CL059_HUMAN;.	P	130;110;130	ENSP00000371348:S130P;ENSP00000298530:S110P;ENSP00000446102:S130P	ENSP00000298530:S110P	S	+	1	0	C12orf59	10233842	0.000000	0.05858	0.260000	0.24451	0.195000	0.23768	-0.335000	0.07873	-0.279000	0.09167	-0.399000	0.06403	TCC	.	.	.	none		0.582	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000399645.1	NM_153022	
KRT3	3850	hgsc.bcm.edu	37	12	53188038	53188038	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr12:53188038G>C	ENST00000417996.2	-	2	797	c.723C>G	c.(721-723)atC>atG	p.I241M	KRT3_ENST00000309505.3_Missense_Mutation_p.I241M	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	241	Linker 1.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						TTGTGCCTGAGATGGAACTTG	0.547																																					p.I241M		Atlas-SNP	.											.	KRT3	65	.	0			c.C723G						PASS	.						140.0	159.0	152.0					12																	53188038		2190	4299	6489	SO:0001583	missense	3850	exon2			GCCTGAGATGGAA		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.723C>G	chr12.hg19:g.53188038G>C	ENSP00000413479:p.Ile241Met	171.0	0.0	.		139.0	56.0	.	NM_057088	A6NIS2|Q701L8	Missense_Mutation	SNP	ENST00000417996.2	hg19	CCDS44895.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747661	0.30955	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.77358	-1.09;-1.09	4.84	3.03	0.35002	Filament (1);	0.796636	0.10927	N	0.618820	T	0.65015	0.2651	N	0.14661	0.345	0.09310	N	0.999997	D	0.54207	0.965	P	0.44518	0.452	T	0.55010	-0.8207	10	0.59425	D	0.04	.	9.7916	0.40708	0.171:0.0:0.829:0.0	.	241	P12035	K2C3_HUMAN	M	241	ENSP00000413479:I241M;ENSP00000312206:I241M	ENSP00000312206:I241M	I	-	3	3	KRT3	51474305	0.543000	0.26434	0.057000	0.19452	0.311000	0.27955	1.403000	0.34612	0.770000	0.33336	-0.137000	0.14449	ATC	.	.	.	none		0.547	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
EFS	10278	hgsc.bcm.edu	37	14	23830017	23830017	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr14:23830017T>A	ENST00000216733.3	-	2	651	c.44A>T	c.(43-45)gAc>gTc	p.D15V	EFS_ENST00000429593.2_Intron|EFS_ENST00000351354.3_Intron	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	15	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		AGCGGTGTTGTCATACAGTGC	0.647																																					p.D15V		Atlas-SNP	.											.	EFS	37	.	0			c.A44T						PASS	.						23.0	24.0	24.0					14																	23830017		2203	4299	6502	SO:0001583	missense	10278	exon2			GTGTTGTCATACA	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.44A>T	chr14.hg19:g.23830017T>A	ENSP00000216733:p.Asp15Val	51.0	0.0	.		67.0	23.0	.	NM_005864	B2RAJ7|B4DJ56|E9PGU2|O43282	Missense_Mutation	SNP	ENST00000216733.3	hg19	CCDS9595.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776984	0.90195	.	.	ENSG00000100842	ENST00000216733	T	0.57907	0.37	4.99	4.99	0.66335	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88428	0.3033	10	0.87932	D	0	-29.2596	12.9697	0.58505	0.0:0.0:0.0:1.0	.	15	O43281	EFS_HUMAN	V	15	ENSP00000216733:D15V	ENSP00000216733:D15V	D	-	2	0	EFS	22899857	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.888000	0.75622	2.234000	0.73211	0.460000	0.39030	GAC	.	.	.	none		0.647	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		
SYNE2	23224	hgsc.bcm.edu	37	14	64587724	64587724	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr14:64587724C>T	ENST00000344113.4	+	68	13315	c.13103C>T	c.(13102-13104)tCc>tTc	p.S4368F	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000358025.3_Missense_Mutation_p.S4368F|SYNE2_ENST00000554584.1_Missense_Mutation_p.S4383F|SYNE2_ENST00000553455.1_Missense_Mutation_p.S87F|SYNE2_ENST00000357395.3_Missense_Mutation_p.S753F|SYNE2_ENST00000394768.2_Missense_Mutation_p.S753F|SYNE2_ENST00000555002.1_Missense_Mutation_p.S1002F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4368					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAATTGGAATCCATTGTAACT	0.403																																					p.S4368F		Atlas-SNP	.											.	SYNE2	577	.	0			c.C13103T						PASS	.						97.0	89.0	92.0					14																	64587724		2203	4300	6503	SO:0001583	missense	23224	exon68			TGGAATCCATTGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13103C>T	chr14.hg19:g.64587724C>T	ENSP00000341781:p.Ser4368Phe	110.0	0.0	.		45.0	24.0	.	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	7.349	0.622515	0.14193	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000553455	T;T;T;T;T;T	0.58652	0.73;4.03;0.73;0.32;4.08;4.03	5.4	3.57	0.40892	.	0.605748	0.15778	N	0.245095	T	0.49626	0.1568	L	0.57536	1.79	0.09310	N	0.999999	B;B;B	0.14438	0.003;0.006;0.01	B;B;B	0.17722	0.019;0.007;0.015	T	0.48636	-0.9018	10	0.56958	D	0.05	.	4.7178	0.12903	0.0:0.6119:0.1734:0.2147	.	753;4368;4368	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	F	4368;753;4368;4383;4383;1002;753;87	ENSP00000350719:S4368F;ENSP00000349969:S753F;ENSP00000341781:S4368F;ENSP00000452570:S4383F;ENSP00000450831:S1002F;ENSP00000378249:S753F	ENSP00000261678:S4383F	S	+	2	0	SYNE2	63657477	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.304000	0.19228	0.829000	0.34733	0.655000	0.94253	TCC	.	.	.	none		0.403	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SMG1	23049	hgsc.bcm.edu	37	16	18937327	18937327	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr16:18937327C>T	ENST00000446231.2	-	1	449	c.37G>A	c.(37-39)Ggc>Agc	p.G13S	SMG1_ENST00000567737.1_5'UTR|SMG1_ENST00000389467.3_Missense_Mutation_p.G13S|CTD-2288F12.1_ENST00000565782.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	13	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ccgccgccgccgctgcTCAGC	0.736																																					p.G13S		Atlas-SNP	.											.	SMG1	401	.	0			c.G37A						PASS	.						2.0	3.0	3.0					16																	18937327		1046	2801	3847	SO:0001583	missense	23049	exon1			CGCCGCCGCTGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.37G>A	chr16.hg19:g.18937327C>T	ENSP00000402515:p.Gly13Ser	13.0	0.0	.		38.0	5.0	.	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	c	16.19	3.051895	0.55218	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01240	5.12;5.12	4.27	3.31	0.37934	.	0.832224	0.10596	N	0.656220	T	0.00998	0.0033	N	0.14661	0.345	0.31512	N	0.663496	B	0.22346	0.068	B	0.08055	0.003	T	0.29912	-0.9996	10	0.12766	T	0.61	.	6.0417	0.19738	0.0:0.7231:0.0:0.2769	.	13	Q96Q15	SMG1_HUMAN	S	13	ENSP00000402515:G13S;ENSP00000374118:G13S	ENSP00000374118:G13S	G	-	1	0	SMG1	18844828	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.149000	0.42244	0.999000	0.39023	0.455000	0.32223	GGC	.	.	.	none		0.736	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
POLR3E	55718	hgsc.bcm.edu	37	16	22324995	22324995	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr16:22324995C>A	ENST00000299853.5	+	7	586	c.419C>A	c.(418-420)tCc>tAc	p.S140Y	POLR3E_ENST00000418581.2_Missense_Mutation_p.S104Y|POLR3E_ENST00000359210.4_Missense_Mutation_p.S140Y|POLR3E_ENST00000564209.1_Missense_Mutation_p.S140Y	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	140					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		CCCAGCTTCTCCTACCTGGAT	0.632																																					p.S140Y		Atlas-SNP	.											.	POLR3E	62	.	0			c.C419A						PASS	.						49.0	50.0	50.0					16																	22324995		2197	4300	6497	SO:0001583	missense	55718	exon7			GCTTCTCCTACCT	AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.419C>A	chr16.hg19:g.22324995C>A	ENSP00000299853:p.Ser140Tyr	78.0	0.0	.		119.0	75.0	.	NM_001258033	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	ENST00000299853.5	hg19	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	C	34	5.371103	0.95923	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.48201	0.82;0.82;0.82	5.47	5.47	0.80525	.	0.117597	0.64402	D	0.000020	T	0.62865	0.2463	L	0.52011	1.625	0.52501	D	0.99995	D;D;D;D;D;D	0.65815	0.993;0.993;0.993;0.995;0.993;0.991	D;P;D;P;P;P	0.63381	0.914;0.879;0.914;0.807;0.879;0.861	T	0.64939	-0.6289	10	0.87932	D	0	-20.1214	18.0983	0.89498	0.0:1.0:0.0:0.0	.	84;104;140;140;140;140	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	Y	140;140;104	ENSP00000299853:S140Y;ENSP00000352140:S140Y;ENSP00000399254:S104Y	ENSP00000299853:S140Y	S	+	2	0	POLR3E	22232496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.513000	0.67037	2.563000	0.86464	0.561000	0.74099	TCC	.	.	.	none		0.632	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
SNTB2	6645	hgsc.bcm.edu	37	16	69294139	69294139	+	Silent	SNP	G	G	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr16:69294139G>A	ENST00000336278.4	+	3	1019	c.981G>A	c.(979-981)aaG>aaA	p.K327K	SNTB2_ENST00000528525.1_3'UTR	NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	327	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		AAGAGGTGAAGCATATTGCCT	0.522																																					p.K327K	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	Atlas-SNP	.											.	SNTB2	22	.	0			c.G981A						PASS	.						114.0	90.0	98.0					16																	69294139		2198	4300	6498	SO:0001819	synonymous_variant	6645	exon3			GGTGAAGCATATT	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.981G>A	chr16.hg19:g.69294139G>A		72.0	0.0	.		71.0	44.0	.	NM_006750	Q9BY09	Silent	SNP	ENST00000336278.4	hg19	CCDS10873.1																																																																																			.	.	.	none		0.522	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1		
SLC7A5	8140	hgsc.bcm.edu	37	16	87868146	87868146	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr16:87868146C>T	ENST00000261622.4	-	9	1407	c.1342G>A	c.(1342-1344)Gcc>Acc	p.A448T	RP4-536B24.2_ENST00000563687.1_RNA|SLC7A5_ENST00000565644.1_Missense_Mutation_p.A182T	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	448					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	AAGGAGACGGCGATCAGGAAG	0.617																																					p.A448T		Atlas-SNP	.											SLC7A5,colon,carcinoma,0,1	SLC7A5	28	.	0			c.G1342A						PASS	.																																			SO:0001583	missense	8140	exon9			AGACGGCGATCAG	AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.1342G>A	chr16.hg19:g.87868146C>T	ENSP00000261622:p.Ala448Thr	10.0	1.0	.		21.0	10.0	.	NM_003486	Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	ENST00000261622.4	hg19	CCDS10964.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018259	0.75275	.	.	ENSG00000103257	ENST00000261622	D	0.90620	-2.7	5.45	5.45	0.79879	.	0.120057	0.64402	D	0.000017	D	0.86916	0.6048	N	0.20986	0.625	0.44976	D	0.997999	D	0.54601	0.967	P	0.45167	0.472	D	0.88309	0.2955	10	0.52906	T	0.07	.	18.3254	0.90252	0.0:1.0:0.0:0.0	.	448	Q01650	LAT1_HUMAN	T	448	ENSP00000261622:A448T	ENSP00000261622:A448T	A	-	1	0	SLC7A5	86425647	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	2.919000	0.48836	2.578000	0.87016	0.456000	0.33151	GCC	.	.	.	none		0.617	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269110.2	NM_003486	
MYO1C	4641	hgsc.bcm.edu	37	17	1386297	1386297	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:1386297G>C	ENST00000575158.1	-	4	475	c.299C>G	c.(298-300)gCt>gGt	p.A100G	MYO1C_ENST00000573198.1_5'Flank|MYO1C_ENST00000545534.2_Missense_Mutation_p.A111G|MYO1C_ENST00000361007.2_Missense_Mutation_p.A100G|MYO1C_ENST00000359786.5_Missense_Mutation_p.A135G|MYO1C_ENST00000438665.2_Missense_Mutation_p.A116G			Q12965	MYO1E_HUMAN	myosin IC	107	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GATCATCACAGCCTGGTCCCG	0.677																																					p.A135G		Atlas-SNP	.											.	MYO1C	57	.	0			c.C404G						PASS	.						29.0	28.0	29.0					17																	1386297		2203	4300	6503	SO:0001583	missense	4641	exon4			ATCACAGCCTGGT	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.299C>G	chr17.hg19:g.1386297G>C	ENSP00000459174:p.Ala100Gly	38.0	0.0	.		58.0	8.0	.	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	hg19	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.636053	0.67130	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34	5.45	5.45	0.79879	Myosin head, motor domain (3);	0.140578	0.64402	D	0.000005	D	0.86944	0.6055	L	0.58354	1.805	0.39738	D	0.97171	P;B;P	0.36647	0.563;0.43;0.508	B;B;B	0.41894	0.369;0.266;0.253	D	0.88555	0.3119	10	0.87932	D	0	.	13.3051	0.60347	0.0:0.2668:0.7332:0.0	.	111;135;116	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	G	135;116;116;100;111;100	ENSP00000352834:A135G;ENSP00000412197:A116G;ENSP00000354283:A100G;ENSP00000437685:A111G	ENSP00000352834:A135G	A	-	2	0	MYO1C	1333047	1.000000	0.71417	0.959000	0.39883	0.696000	0.40369	4.738000	0.62073	2.548000	0.85928	0.462000	0.41574	GCT	.	.	.	none		0.677	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
NLRP1	22861	hgsc.bcm.edu	37	17	5461735	5461735	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:5461735T>A	ENST00000572272.1	-	4	2280	c.2281A>T	c.(2281-2283)Agc>Tgc	p.S761C	NLRP1_ENST00000269280.4_Missense_Mutation_p.S761C|NLRP1_ENST00000354411.3_Missense_Mutation_p.S761C|NLRP1_ENST00000577119.1_Missense_Mutation_p.S761C|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Missense_Mutation_p.S761C|NLRP1_ENST00000262467.5_Missense_Mutation_p.S761C			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	761					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ACGTGGCGGCTGAATTTAATG	0.498																																					p.S761C		Atlas-SNP	.											.	NLRP1	358	.	0			c.A2281T						PASS	.						96.0	96.0	96.0					17																	5461735		2203	4300	6503	SO:0001583	missense	22861	exon4			GGCGGCTGAATTT	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2281A>T	chr17.hg19:g.5461735T>A	ENSP00000460475:p.Ser761Cys	123.0	0.0	.		116.0	33.0	.	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	hg19	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	T	1.036	-0.680260	0.03353	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	4.02	1.81	0.25067	.	0.336093	0.21989	N	0.066194	T	0.07503	0.0189	N	0.00055	-2.375	0.09310	N	0.999994	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.0;0.0;0.0;0.0;0.0	T	0.39014	-0.9634	10	0.02654	T	1	.	3.4335	0.07437	0.6926:0.0:0.1074:0.2	.	27;761;761;761;761;761	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	C	761;761;761;761;761;27	ENSP00000442029:S761C;ENSP00000262467:S761C;ENSP00000269280:S761C;ENSP00000346390:S761C;ENSP00000324366:S761C	ENSP00000262467:S761C	S	-	1	0	NLRP1	5402459	0.002000	0.14202	0.392000	0.26245	0.340000	0.28889	0.623000	0.24447	0.372000	0.24591	-1.045000	0.02358	AGC	.	.	.	none		0.498	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
SUPT6H	6830	hgsc.bcm.edu	37	17	27005892	27005892	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:27005892G>A	ENST00000314616.6	+	11	1543	c.1260G>A	c.(1258-1260)atG>atA	p.M420I	SUPT6H_ENST00000347486.4_Missense_Mutation_p.M420I	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	420	Interaction with IWS1. {ECO:0000250}.|Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TTGAGAAGATGCAGGCTTATC	0.517																																					p.M420I		Atlas-SNP	.											.	SUPT6H	165	.	0			c.G1260A						PASS	.						135.0	128.0	131.0					17																	27005892		2203	4300	6503	SO:0001583	missense	6830	exon11			GAAGATGCAGGCT	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1260G>A	chr17.hg19:g.27005892G>A	ENSP00000319104:p.Met420Ile	152.0	0.0	.		162.0	99.0	.	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	hg19	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643321	0.87859	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	T;T	0.41400	1.0;1.0	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.62088	1.915	0.80722	D	1	P	0.41929	0.765	P	0.44359	0.447	T	0.35649	-0.9780	10	0.32370	T	0.25	-21.3743	20.428	0.99075	0.0:0.0:1.0:0.0	.	420	Q7KZ85	SPT6H_HUMAN	I	420	ENSP00000319104:M420I;ENSP00000338143:M420I	ENSP00000319104:M420I	M	+	3	0	SUPT6H	24030019	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.283000	0.95860	2.837000	0.97791	0.655000	0.94253	ATG	.	.	.	none		0.517	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240908	39240908	+	Silent	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:39240908T>C	ENST00000391417.4	+	1	450	c.450T>C	c.(448-450)tgT>tgC	p.C150C		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	205	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C150C(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						CCTTGTGCTGTGCCTCCTCTT	0.607																																					p.C150C		Atlas-SNP	.											KRTAP4-7,NS,carcinoma,0,2	KRTAP4-7	49	.	1	Substitution - coding silent(1)	lung(1)	c.T450C						PASS	.						90.0	87.0	88.0					17																	39240908		692	1591	2283	SO:0001819	synonymous_variant	100132476	exon1			GTGCTGTGCCTCC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.450T>C	chr17.hg19:g.39240908T>C		18.0	2.0	.		24.0	5.0	.	NM_033061	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	hg19	CCDS45673.1																																																																																			.	.	.	none		0.607	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
LRRC59	55379	hgsc.bcm.edu	37	17	48462617	48462617	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:48462617T>A	ENST00000225972.7	-	6	773	c.538A>T	c.(538-540)Aag>Tag	p.K180*	Y_RNA_ENST00000384097.1_RNA	NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	180						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.K180E(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TGAGCTTCCTTAGCTCGCTGC	0.527																																					p.K180X		Atlas-SNP	.											LRRC59,NS,carcinoma,0,1	LRRC59	23	.	1	Substitution - Missense(1)	lung(1)	c.A538T						PASS	.						110.0	110.0	110.0					17																	48462617		2203	4300	6503	SO:0001587	stop_gained	55379	exon6			CTTCCTTAGCTCG	AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.538A>T	chr17.hg19:g.48462617T>A	ENSP00000225972:p.Lys180*	206.0	0.0	.		231.0	64.0	.	NM_018509	B2RE83|D3DTX8|Q9P189	Nonsense_Mutation	SNP	ENST00000225972.7	hg19	CCDS11566.1	.	.	.	.	.	.	.	.	.	.	T	39	7.478468	0.98309	.	.	ENSG00000108829	ENST00000225972	.	.	.	5.87	4.73	0.59995	.	0.206543	0.47093	D	0.000244	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0564	0.58982	0.0:0.0:0.1338:0.8661	.	.	.	.	X	180	.	ENSP00000225972:K180X	K	-	1	0	LRRC59	45817616	0.994000	0.37717	0.985000	0.45067	0.993000	0.82548	2.417000	0.44653	2.371000	0.80710	0.533000	0.62120	AAG	.	.	.	none		0.527	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367117.2	NM_018509	
METTL4	64863	hgsc.bcm.edu	37	18	2552727	2552727	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr18:2552727G>A	ENST00000574538.1	-	5	1641	c.866C>T	c.(865-867)cCa>cTa	p.P289L	METTL4_ENST00000319888.6_Missense_Mutation_p.P289L|snoU109_ENST00000459316.1_RNA	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	289					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						GTTCTGCCATGGTGGATCTAT	0.284																																					p.P289L		Atlas-SNP	.											.	METTL4	40	.	0			c.C866T						PASS	.						100.0	95.0	97.0					18																	2552727		2201	4297	6498	SO:0001583	missense	64863	exon5			TGCCATGGTGGAT		CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.866C>T	chr18.hg19:g.2552727G>A	ENSP00000458290:p.Pro289Leu	44.0	0.0	.		22.0	13.0	.	NM_022840	B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	ENST00000574538.1	hg19	CCDS11826.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542180	0.65198	.	.	ENSG00000101574	ENST00000319888	D	0.88741	-2.42	5.44	5.44	0.79542	DNA methylase, N-6 adenine-specific, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96491	0.8855	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97268	0.9909	10	0.87932	D	0	-10.0395	19.6271	0.95682	0.0:0.0:1.0:0.0	.	289;289	A8K1T6;Q8N3J2	.;METL4_HUMAN	L	289	ENSP00000320349:P289L	ENSP00000320349:P289L	P	-	2	0	METTL4	2542727	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.974000	0.88039	2.712000	0.92718	0.650000	0.86243	CCA	.	.	.	none		0.284	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254326.3	NM_022840	
DUS3L	56931	hgsc.bcm.edu	37	19	5789679	5789679	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr19:5789679C>A	ENST00000309061.7	-	3	535	c.439G>T	c.(439-441)Gtg>Ttg	p.V147L	DUS3L_ENST00000320699.8_Intron|DUS3L_ENST00000590681.1_5'UTR	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	147							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						TAGCGCCCCACGTCGTGCAGA	0.677																																					p.V147L		Atlas-SNP	.											.	DUS3L	42	.	0			c.G439T						PASS	.						12.0	18.0	16.0					19																	5789679		2120	4219	6339	SO:0001583	missense	56931	exon3			GCCCCACGTCGTG		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.439G>T	chr19.hg19:g.5789679C>A	ENSP00000311977:p.Val147Leu	24.0	0.0	.		28.0	9.0	.	NM_020175	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	hg19	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	C	0.236	-1.017044	0.02078	.	.	ENSG00000141994	ENST00000309061	T	0.15603	2.41	4.51	-0.951	0.10369	Zinc finger, CCCH-type (1);	0.454534	0.20607	N	0.089046	T	0.08088	0.0202	N	0.19112	0.55	0.20074	N	0.999939	B	0.09022	0.002	B	0.11329	0.006	T	0.40979	-0.9534	10	0.10636	T	0.68	2.778	8.3861	0.32501	0.0:0.4616:0.4471:0.0913	.	147	Q96G46	DUS3L_HUMAN	L	147	ENSP00000311977:V147L	ENSP00000311977:V147L	V	-	1	0	DUS3L	5740679	0.042000	0.20092	0.001000	0.08648	0.013000	0.08279	0.424000	0.21330	0.063000	0.16370	0.561000	0.74099	GTG	.	.	.	none		0.677	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
ZNF559	84527	hgsc.bcm.edu	37	19	9452847	9452848	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr19:9452847_9452848CT>AA	ENST00000393883.2	+	6	1368_1369	c.720_721CT>AA	c.(718-723)ttCTat>ttAAat	p.240_241FY>LN	CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF559_ENST00000587557.1_Missense_Mutation_p.304_305FY>LN|ZNF177_ENST00000605471.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF559_ENST00000586255.1_Intron|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.240_241FY>LN|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000538743.1_Missense_Mutation_p.160_161FY>LN|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000592896.1_3'UTR|ZNF177_ENST00000602738.1_Intron	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						GAGAAAAATTCTATGAATGTAA	0.361																																					p.F304L|p.Y305N		Atlas-SNP	.											.	ZNF559	77	.	0			c.C912A|c.T913A						PASS	.																																			SO:0001583	missense	84527	exon6			AAAATTCTATGAA|AAATTCTATGAAT	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	Exception_encountered	chr19.hg19:g.9452847_9452848delinsAA	ENSP00000377461:p.F240_Y241delinsLN	126.0|127.0	0.0	.		54.0|53.0	26.0|25.0	.	NM_001202406	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	hg19	CCDS12211.1																																																																																			.	.	.	none		0.361	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
ZNF844	284391	hgsc.bcm.edu	37	19	12187475	12187475	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr19:12187475C>G	ENST00000439326.3	+	4	1715	c.1540C>G	c.(1540-1542)Cat>Gat	p.H514D	ZNF844_ENST00000441304.2_3'UTR	NM_001136501.1	NP_001129973.1	Q08AG5	ZN844_HUMAN	zinc finger protein 844	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H514D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(1)|prostate(1)	10						AAAGCCTTCACATCTGCCTCA	0.408																																					p.H514D		Atlas-SNP	.											ZNF844,NS,carcinoma,0,6	ZNF844	69	.	1	Substitution - Missense(1)	endometrium(1)	c.C1540G						PASS	.						87.0	81.0	83.0					19																	12187475		692	1591	2283	SO:0001583	missense	284391	exon4			CCTTCACATCTGC	AL832297	CCDS45985.1	19p13.2	2013-01-08			ENSG00000223547	ENSG00000223547		"""Zinc fingers, C2H2-type"", ""-"""	25932	protein-coding gene	gene with protein product							Standard	NM_001136501		Approved	FLJ14959	uc002mtb.2	Q08AG5	OTTHUMG00000156405	ENST00000439326.3:c.1540C>G	chr19.hg19:g.12187475C>G	ENSP00000392024:p.His514Asp	54.0	1.0	.		39.0	4.0	.	NM_001136501	Q5JPI8	Missense_Mutation	SNP	ENST00000439326.3	hg19	CCDS45985.1	.	.	.	.	.	.	.	.	.	.	c	0.059	-1.227642	0.01518	.	.	ENSG00000223547	ENST00000439326;ENST00000541708	T	0.06371	3.31	2.45	-4.91	0.03085	.	.	.	.	.	T	0.02649	0.0080	N	0.04387	-0.21	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44019	-0.9355	9	0.25106	T	0.35	.	9.0916	0.36614	0.0:0.4133:0.4132:0.1735	.	514	Q08AG5	ZN844_HUMAN	D	514	ENSP00000392024:H514D	ENSP00000392024:H514D	H	+	1	0	ZNF844	12048475	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.066000	0.00302	-2.826000	0.00341	-1.839000	0.00587	CAT	.	.	.	none		0.408	ZNF844-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344086.2		
ACTN4	81	hgsc.bcm.edu	37	19	39219691	39219691	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr19:39219691T>C	ENST00000252699.2	+	20	2550	c.2474T>C	c.(2473-2475)cTt>cCt	p.L825P	ACTN4_ENST00000497637.1_3'UTR|ACTN4_ENST00000424234.2_Missense_Mutation_p.L435P|ACTN4_ENST00000390009.3_Missense_Mutation_p.L606P	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	825	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Mediates interaction with MICALL2. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CATAGCGGCCTTGTGACCTTC	0.607																																					p.L825P	Colon(168;199 1940 10254 46213 46384)	Atlas-SNP	.											.	ACTN4	69	.	0			c.T2474C						PASS	.						132.0	102.0	112.0					19																	39219691		2203	4300	6503	SO:0001583	missense	81	exon20			GCGGCCTTGTGAC	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2474T>C	chr19.hg19:g.39219691T>C	ENSP00000252699:p.Leu825Pro	140.0	0.0	.		221.0	101.0	.	NM_004924	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	hg19	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	T	14.29	2.491189	0.44249	.	.	ENSG00000130402	ENST00000252699;ENST00000424234;ENST00000390009;ENST00000440400	T;T;T;T	0.78924	-0.07;-0.07;-0.07;-1.22	3.62	3.62	0.41486	EF-hand-like domain (1);	0.328967	0.28327	N	0.015757	T	0.64416	0.2596	N	0.22421	0.69	0.58432	D	0.999999	B	0.23316	0.083	B	0.23716	0.048	T	0.62483	-0.6845	10	0.40728	T	0.16	.	11.6505	0.51286	0.0:0.0:0.0:1.0	.	825	O43707	ACTN4_HUMAN	P	825;435;606;256	ENSP00000252699:L825P;ENSP00000411187:L435P;ENSP00000439497:L606P;ENSP00000398393:L256P	ENSP00000252699:L825P	L	+	2	0	ACTN4	43911531	0.930000	0.31532	0.999000	0.59377	0.976000	0.68499	3.892000	0.56235	1.656000	0.50722	0.459000	0.35465	CTT	.	.	.	none		0.607	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
ZNF649	65251	hgsc.bcm.edu	37	19	52394736	52394736	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr19:52394736T>C	ENST00000354957.3	-	5	937	c.653A>G	c.(652-654)aAg>aGg	p.K218R	ZNF649_ENST00000600738.1_Splice_Site_p.K218R|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GAGCCTGTACTTCTTGTAGAA	0.483																																					p.K218R		Atlas-SNP	.											ZNF649,NS,carcinoma,0,2	ZNF649	72	.	0			c.A653G						PASS	.						119.0	114.0	116.0					19																	52394736		2203	4300	6503	SO:0001583	missense	65251	exon5			CTGTACTTCTTGT	BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.653A>G	chr19.hg19:g.52394736T>C	ENSP00000347043:p.Lys218Arg	158.0	0.0	.		71.0	3.0	.	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	ENST00000354957.3	hg19	CCDS12843.1	.	.	.	.	.	.	.	.	.	.	T	10.18	1.278977	0.23307	.	.	ENSG00000198093	ENST00000354957	T	0.15834	2.39	2.61	0.223	0.15292	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09818	0.0241	N	0.21583	0.68	0.09310	N	1	B	0.23185	0.081	B	0.15484	0.013	T	0.33059	-0.9883	9	0.31617	T	0.26	.	6.6154	0.22774	0.0:0.2836:0.0:0.7164	.	218	Q9BS31	ZN649_HUMAN	R	218	ENSP00000347043:K218R	ENSP00000347043:K218R	K	-	2	0	ZNF649	57086548	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.478000	0.06575	0.157000	0.19338	0.327000	0.21459	AAG	.	.	.	none		0.483	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
GAB4	128954	hgsc.bcm.edu	37	22	17444670	17444670	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr22:17444670G>C	ENST00000400588.1	-	9	1633	c.1526C>G	c.(1525-1527)cCg>cGg	p.P509R		NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	509										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GCTCCTCGGCGGGGCTGAACT	0.612																																					p.P509R		Atlas-SNP	.											.	GAB4	95	.	0			c.C1526G						PASS	.						47.0	54.0	52.0					22																	17444670		1991	4192	6183	SO:0001583	missense	128954	exon9			CTCGGCGGGGCTG	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1526C>G	chr22.hg19:g.17444670G>C	ENSP00000383431:p.Pro509Arg	71.0	0.0	.		65.0	22.0	.	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	hg19	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	G	0.264	-0.997244	0.02145	.	.	ENSG00000215568	ENST00000400588	T	0.21543	2.0	2.3	-0.182	0.13287	.	0.250153	0.41097	D	0.000958	T	0.09862	0.0242	L	0.38175	1.15	0.09310	N	0.999994	P	0.39157	0.662	B	0.34138	0.176	T	0.34551	-0.9824	10	0.08179	T	0.78	.	4.6103	0.12399	0.13:0.0:0.5111:0.3589	.	509	Q2WGN9	GAB4_HUMAN	R	509	ENSP00000383431:P509R	ENSP00000383431:P509R	P	-	2	0	GAB4	15824670	1.000000	0.71417	0.085000	0.20634	0.002000	0.02628	4.484000	0.60271	-0.257000	0.09459	-1.465000	0.01017	CCG	.	.	.	none		0.612	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
SEC14L2	23541	hgsc.bcm.edu	37	22	30805245	30805245	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr22:30805245A>C	ENST00000312932.9	+	6	753	c.493A>C	c.(493-495)Aag>Cag	p.K165Q	SEC14L2_ENST00000405717.3_Missense_Mutation_p.K165Q|SEC14L2_ENST00000403484.1_Missense_Mutation_p.K91Q|SEC14L2_ENST00000402592.3_Missense_Mutation_p.K82Q|RP4-539M6.19_ENST00000439838.1_5'Flank|SEC14L2_ENST00000459728.1_3'UTR	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	165	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	GCATCTCTGGAAGCCTGCTGT	0.592																																					p.K165Q		Atlas-SNP	.											.	SEC14L2	24	.	0			c.A493C						PASS	.						58.0	63.0	61.0					22																	30805245		2203	4300	6503	SO:0001583	missense	23541	exon6			CTCTGGAAGCCTG	AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.493A>C	chr22.hg19:g.30805245A>C	ENSP00000316203:p.Lys165Gln	76.0	0.0	.		60.0	32.0	.	NM_012429	B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Missense_Mutation	SNP	ENST00000312932.9	hg19	CCDS13876.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716174	0.89205	.	.	ENSG00000100003	ENST00000312932;ENST00000428195;ENST00000403484;ENST00000405717;ENST00000402592	T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05	4.79	4.79	0.61399	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.85682	D	0.000000	D	0.86406	0.5925	M	0.72353	2.195	0.80722	D	1	D;P;D;P	0.89917	1.0;0.933;0.996;0.88	D;P;D;B	0.74674	0.984;0.711;0.949;0.383	D	0.88014	0.2764	10	0.72032	D	0.01	-0.6938	14.1425	0.65329	1.0:0.0:0.0:0.0	.	82;91;165;165	F5H3U4;B3KRD8;O76054;O76054-4	.;.;S14L2_HUMAN;.	Q	165;111;91;165;82	ENSP00000316203:K165Q;ENSP00000387781:K111Q;ENSP00000383993:K91Q;ENSP00000385186:K165Q;ENSP00000383882:K82Q	ENSP00000316203:K165Q	K	+	1	0	SEC14L2	29135245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.622000	0.90953	2.018000	0.59344	0.533000	0.62120	AAG	.	.	.	none		0.592	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321018.4	NM_012429	
ARSE	415	hgsc.bcm.edu	37	X	2867409	2867409	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chrX:2867409G>A	ENST00000381134.3	-	6	856	c.790C>T	c.(790-792)Cag>Tag	p.Q264*	ARSE_ENST00000545496.1_Nonsense_Mutation_p.Q289*|ARSE_ENST00000540563.1_Nonsense_Mutation_p.Q219*	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	264					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CACATGGGCTGCTCCGTGATG	0.527																																					p.Q264X		Atlas-SNP	.											.	ARSE	43	.	0			c.C790T						PASS	.						92.0	73.0	79.0					X																	2867409		2203	4300	6503	SO:0001587	stop_gained	415	exon6			TGGGCTGCTCCGT	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.790C>T	chrX.hg19:g.2867409G>A	ENSP00000370526:p.Gln264*	70.0	0.0	.		42.0	38.0	.	NM_000047	Q53FT2|Q53FU8	Nonsense_Mutation	SNP	ENST00000381134.3	hg19	CCDS14122.1	.	.	.	.	.	.	.	.	.	.	g	21.9	4.216506	0.79352	.	.	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	.	.	.	3.54	3.54	0.40534	.	0.139687	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.5415	0.67999	0.0:0.0:1.0:0.0	.	.	.	.	X	219;289;264	.	ENSP00000370526:Q264X	Q	-	1	0	ARSE	2877409	1.000000	0.71417	0.267000	0.24556	0.056000	0.15407	5.631000	0.67812	1.395000	0.46643	0.591000	0.81541	CAG	.	.	.	none		0.527	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
ALS2	57679	hgsc.bcm.edu	37	2	202606404	202606404	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr2:202606404delA	ENST00000264276.6	-	11	2716	c.2344delT	c.(2344-2346)tatfs	p.Y782fs	ALS2_ENST00000457679.2_Frame_Shift_Del_p.Y94fs	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	782	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TGCTCTGTATAACTATCCAAG	0.463																																					p.Y782fs		Atlas-Indel,Pindel	.											.	ALS2	172	.	0			c.2345delA						PASS	.						63.0	60.0	61.0					2																	202606404		1893	4121	6014	SO:0001589	frameshift_variant	57679	exon11			.	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.2344delT	chr2.hg19:g.202606404delA	ENSP00000264276:p.Tyr782fs	78.0	0.0	0		39.0	17.0	0.435897	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Frame_Shift_Del	DEL	ENST00000264276.6	hg19	CCDS42800.1																																																																																			.	.	.	none		0.463	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
FOXN1	8456	hgsc.bcm.edu	37	17	26864406	26864406	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr17:26864406delC	ENST00000226247.2	+	8	1928	c.1899delC	c.(1897-1899)ggcfs	p.G633fs	FOXN1_ENST00000579795.1_Frame_Shift_Del_p.G633fs	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	633					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					CCCCTGCAGGCCCCTCTGTGT	0.677																																					p.G633fs		Atlas-Indel,Pindel	.											.	FOXN1	51	.	0			c.1898delG						PASS	.						23.0	27.0	26.0					17																	26864406		2203	4298	6501	SO:0001589	frameshift_variant	8456	exon8			.	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.1899delC	chr17.hg19:g.26864406delC	ENSP00000226247:p.Gly633fs	65.0	0.0	0		100.0	24.0	0.24	NM_003593	B2R9Q7|O15352	Frame_Shift_Del	DEL	ENST00000226247.2	hg19	CCDS11232.1																																																																																			.	.	.	none		0.677	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
CSMD3	114788	hgsc.bcm.edu	37	8	113697849	113697849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr8:113697849delC	ENST00000297405.5	-	15	2512	c.2268delG	c.(2266-2268)gggfs	p.G756fs	CSMD3_ENST00000352409.3_Frame_Shift_Del_p.G756fs|CSMD3_ENST00000343508.3_Frame_Shift_Del_p.G716fs|CSMD3_ENST00000455883.2_Frame_Shift_Del_p.G652fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	756	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTATCCGGCTCCCTGGATCAG	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S757fs		Atlas-INDEL	.											.	CSMD3	2325	.	0			c.2269delA						PASS	.						100.0	107.0	105.0					8																	113697849		2203	4300	6503	SO:0001589	frameshift_variant	114788	exon15			.	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2268delG	chr8.hg19:g.113697849delC	ENSP00000297405:p.Gly756fs	148.0	0.0	0		104.0	51.0	0.490385	NM_198123	Q96PZ3	Frame_Shift_Del	DEL	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.	.	none		0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
NOLC1	9221	hgsc.bcm.edu	37	10	103916834	103916834	+	Intron	DEL	A	A	-			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr10:103916834delA	ENST00000605788.1	+	2	411				NOLC1_ENST00000405356.1_Intron|NOLC1_ENST00000603742.1_Intron|NOLC1_ENST00000488254.2_Intron	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1						cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		TGGCTCAAGTAAGCCTTTCCT	0.443																																					.		Atlas-Indel,Pindel	.											.	NOLC1	61	.	0			c.176+2A>-						PASS	.						238.0	230.0	233.0					10																	103916834		2203	4300	6503	SO:0001627	intron_variant	9221	exon2			.	Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.176+3A>-	chr10.hg19:g.103916834delA		275.0	0.0	0		155.0	62.0	0.4	NM_004741	Q15030|Q5VV70|Q9BUV3	Splice_Site	DEL	ENST00000605788.1	hg19	CCDS7530.1																																																																																			.	.	.	none		0.443	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
CSMD3	114788	hgsc.bcm.edu	37	8	113697851	113697852	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr8:113697851_113697852delCT	ENST00000297405.5	-	15	2509_2510	c.2265_2266delAG	c.(2263-2268)ccagggfs	p.G756fs	CSMD3_ENST00000352409.3_Frame_Shift_Del_p.G756fs|CSMD3_ENST00000343508.3_Frame_Shift_Del_p.G716fs|CSMD3_ENST00000455883.2_Frame_Shift_Del_p.G652fs	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	756	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATCCGGCTCCCTGGATCAGAGA	0.416										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.756_756del		Pindel	.											CSMD3_ENST00000343508,right_upper_lobe,carcinoma,+1,1	CSMD3	2325	.	0			c.2266_2267del						PASS	.																																			SO:0001589	frameshift_variant	114788	exon15			.	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2265_2266delAG	chr8.hg19:g.113697851_113697852delCT	ENSP00000297405:p.Gly756fs	155.0	0.0	.		107.0	36.0	0.336	NM_198123	Q96PZ3	Frame_Shift_Del	DEL	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.	.	none		0.416	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ZNF395	55893	hgsc.bcm.edu	37	8	28210808	28210809	+	Frame_Shift_Ins	INS	-	-	G	rs145352684	byFrequency	TCGA-DW-7836-01A-11D-2136-08	TCGA-DW-7836-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1cca814c-40fe-426c-b494-86a634031f4c	22c58020-f91d-4657-99ae-53bd869ee210	g.chr8:28210808_28210809insG	ENST00000344423.5	-	5	831_832	c.700_701insC	c.(700-702)cacfs	p.H234fs	ZNF395_ENST00000523095.1_Frame_Shift_Ins_p.H234fs|ZNF395_ENST00000523202.1_Frame_Shift_Ins_p.H234fs	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H234fs*43(1)|p.H234fs*19(1)|p.H234P(1)		cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGCCTGGGGGTGGGGGGGCGAG	0.609																																					p.H234fs		Pindel	.											ZNF395,rectum,carcinoma,0,2	ZNF395	54	.	3	Substitution - Missense(1)|Deletion - Frameshift(1)|Insertion - Frameshift(1)	large_intestine(3)	c.701_702insC						PASS	.																																			SO:0001589	frameshift_variant	55893	exon5			.	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.701dupC	chr8.hg19:g.28210815_28210815dupG	ENSP00000340494:p.His234fs	42.0	0.0	.		52.0	16.0	0.308	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Frame_Shift_Ins	INS	ENST00000344423.5	hg19	CCDS6067.1																																																																																			.	.	.	none		0.609	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
