#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77528824	77528824	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:77528824T>G	ENST00000477717.1	+	5	1179	c.944T>G	c.(943-945)tTt>tGt	p.F315C		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	315					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						AATATTCACTTTTTTCAACCA	0.438																																					p.F315C		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.T944G						PASS	.						116.0	110.0	112.0					1																	77528824		2203	4300	6503	SO:0001583	missense	81849	exon5			TTCACTTTTTTCA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.944T>G	chr1.hg19:g.77528824T>G	ENSP00000417583:p.Phe315Cys	139.0	0.0	.		153.0	49.0	.	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	hg19	CCDS673.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359557	0.82353	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.58358	0.34	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73210	0.3558	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79562	-0.1752	10	0.87932	D	0	-36.7448	16.3789	0.83431	0.0:0.0:0.0:1.0	.	315	Q9BVH7	SIA7E_HUMAN	C	315;225	ENSP00000417583:F315C	ENSP00000406658:F225C	F	+	2	0	ST6GALNAC5	77301412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.649000	0.83500	2.267000	0.75376	0.533000	0.62120	TTT	.	.	.	none		0.438	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77528835	77528835	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:77528835G>A	ENST00000477717.1	+	5	1190	c.955G>A	c.(955-957)Gac>Aac	p.D319N		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	319					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						TTTTCAACCAGACTGGAAACC	0.438																																					p.D319N		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.G955A						PASS	.						113.0	106.0	109.0					1																	77528835		2203	4300	6503	SO:0001583	missense	81849	exon5			CAACCAGACTGGA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.955G>A	chr1.hg19:g.77528835G>A	ENSP00000417583:p.Asp319Asn	136.0	0.0	.		153.0	46.0	.	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	hg19	CCDS673.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733083	0.48939	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.30714	1.52	5.93	2.92	0.33932	.	0.140018	0.64402	N	0.000006	T	0.12475	0.0303	L	0.49350	1.555	0.50467	D	0.999873	B	0.18166	0.026	B	0.16289	0.015	T	0.05022	-1.0911	10	0.23302	T	0.38	-15.1218	11.5508	0.50719	0.0636:0.2339:0.7025:0.0	.	319	Q9BVH7	SIA7E_HUMAN	N	319;229	ENSP00000417583:D319N	ENSP00000406658:D229N	D	+	1	0	ST6GALNAC5	77301423	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.553000	0.60753	0.830000	0.34757	0.655000	0.94253	GAC	.	.	.	none		0.438	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
EGLN1	54583	hgsc.bcm.edu	37	1	231556782	231556782	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:231556782C>A	ENST00000366641.3	-	1	4008	c.853G>T	c.(853-855)Ggg>Tgg	p.G285W	EGLN1_ENST00000476717.1_5'Flank	NM_022051.2	NP_071334.1			egl-9 family hypoxia-inducible factor 1											breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	16		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)				CCCAGCTTCCCGTTACAGTGG	0.607																																					p.G285W		Atlas-SNP	.											.	EGLN1	38	.	0			c.G853T						PASS	.						118.0	114.0	115.0					1																	231556782		2203	4300	6503	SO:0001583	missense	54583	exon1			GCTTCCCGTTACA	AJ310543	CCDS1595.1	1q42.1	2013-08-21	2013-08-21	2001-08-24	ENSG00000135766	ENSG00000135766		"""Zinc fingers, MYND-type"""	1232	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 2"""	606425	"""EGL nine (C.elegans) homolog 1"", ""egl nine homolog 1 (C. elegans)"""	C1orf12		11056053	Standard	NM_022051		Approved	SM-20, PHD2, ZMYND6, HIFPH2	uc001huv.2	Q9GZT9	OTTHUMG00000038027	ENST00000366641.3:c.853G>T	chr1.hg19:g.231556782C>A	ENSP00000355601:p.Gly285Trp	181.0	0.0	.		158.0	7.0	.	NM_022051		Missense_Mutation	SNP	ENST00000366641.3	hg19	CCDS1595.1	.	.	.	.	.	.	.	.	.	.	C	35	5.558127	0.96514	.	.	ENSG00000135766	ENST00000366641	D	0.87103	-2.21	4.76	4.76	0.60689	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.93690	0.7984	M	0.85041	2.73	0.80722	D	1	D	0.71674	0.998	D	0.64410	0.925	D	0.94830	0.7995	10	0.87932	D	0	-8.1275	18.1409	0.89639	0.0:1.0:0.0:0.0	.	285	Q9GZT9	EGLN1_HUMAN	W	285	ENSP00000355601:G285W	ENSP00000355601:G285W	G	-	1	0	EGLN1	229623405	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.924000	0.70054	2.304000	0.77564	0.563000	0.77884	GGG	.	.	.	none		0.607	EGLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092879.1	NM_022051	
IFT172	26160	hgsc.bcm.edu	37	2	27685657	27685657	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:27685657C>A	ENST00000260570.3	-	20	2129	c.2026G>T	c.(2026-2028)Gga>Tga	p.G676*		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	676					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					GTTCCTTCTCCGCCCTGTGGG	0.448																																					p.G676X		Atlas-SNP	.											.	IFT172	119	.	0			c.G2026T						PASS	.						94.0	99.0	97.0					2																	27685657		2203	4300	6503	SO:0001587	stop_gained	26160	exon20			CTTCTCCGCCCTG	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2026G>T	chr2.hg19:g.27685657C>A	ENSP00000260570:p.Gly676*	142.0	0.0	.		118.0	6.0	.	NM_015662	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Nonsense_Mutation	SNP	ENST00000260570.3	hg19	CCDS1755.1	.	.	.	.	.	.	.	.	.	.	C	40	8.188732	0.98696	.	.	ENSG00000138002	ENST00000260570	.	.	.	5.54	5.54	0.83059	.	0.099543	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-12.2619	18.0587	0.89370	0.0:1.0:0.0:0.0	.	.	.	.	X	676	.	ENSP00000260570:G676X	G	-	1	0	IFT172	27539161	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.355000	0.79434	2.601000	0.87937	0.655000	0.94253	GGA	.	.	.	none		0.448	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250213.2	NM_015662	
CLASP1	23332	hgsc.bcm.edu	37	2	122206659	122206659	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr2:122206659C>T	ENST00000263710.4	-	17	1950	c.1561G>A	c.(1561-1563)Gca>Aca	p.A521T	CLASP1_ENST00000541859.1_Missense_Mutation_p.A290T|CLASP1_ENST00000409078.3_Missense_Mutation_p.A521T|CLASP1_ENST00000541377.1_Missense_Mutation_p.A521T|CLASP1_ENST00000455322.2_Missense_Mutation_p.A521T|CLASP1_ENST00000397587.3_Missense_Mutation_p.A521T|CLASP1_ENST00000545861.1_Missense_Mutation_p.A289T	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	521					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					AAGTGCTCTGCTTCTCTGCTG	0.493																																					p.A521T		Atlas-SNP	.											.	CLASP1	135	.	0			c.G1561A						PASS	.						100.0	99.0	99.0					2																	122206659		1961	4153	6114	SO:0001583	missense	23332	exon17			GCTCTGCTTCTCT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1561G>A	chr2.hg19:g.122206659C>T	ENSP00000263710:p.Ala521Thr	39.0	0.0	.		39.0	12.0	.	NM_001207051	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.877189	0.97055	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08;-0.08;-0.08	6.04	6.04	0.98038	Armadillo-like helical (1);Armadillo-type fold (2);CLASP N-terminal domain (1);	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.88377	2.95	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.91635	0.997;0.995;0.998;0.999	D	0.85446	0.1158	10	0.87932	D	0	-19.0221	20.5948	0.99439	0.0:1.0:0.0:0.0	.	521;521;521;521	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	T	521;521;521;521;290;521;289	ENSP00000263710:A521T;ENSP00000389372:A521T;ENSP00000380717:A521T;ENSP00000441625:A521T;ENSP00000441770:A290T;ENSP00000386442:A521T;ENSP00000438620:A289T	ENSP00000263710:A521T	A	-	1	0	CLASP1	121923129	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	GCA	.	.	.	none		0.493	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
CCDC174	51244	hgsc.bcm.edu	37	3	14695999	14695999	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr3:14695999G>C	ENST00000383794.3	+	2	182	c.109G>C	c.(109-111)Gat>Cat	p.D37H	CCDC174_ENST00000303688.7_Missense_Mutation_p.D37H	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	37						cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACTTCTAAAAGATTCTGGAGT	0.299																																					p.D37H		Atlas-SNP	.											.	.	.	.	0			c.G109C						PASS	.						26.0	26.0	26.0					3																	14695999		1779	4049	5828	SO:0001583	missense	51244	exon2			CTAAAAGATTCTG	AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.109G>C	chr3.hg19:g.14695999G>C	ENSP00000373304:p.Asp37His	30.0	0.0	.		38.0	17.0	.	NM_016474	Q96CS5	Missense_Mutation	SNP	ENST00000383794.3	hg19	CCDS2620.2	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862642	0.51482	.	.	ENSG00000154781	ENST00000383794;ENST00000303688	T;T	0.46063	0.88;0.89	5.58	4.7	0.59300	.	0.057430	0.64402	D	0.000001	T	0.61048	0.2316	M	0.70275	2.135	0.46981	D	0.999278	D	0.89917	1.0	D	0.71184	0.972	T	0.63005	-0.6733	10	0.59425	D	0.04	-12.7651	12.8107	0.57637	0.08:0.0:0.92:0.0	.	37	Q6PII3	CC019_HUMAN	H	37	ENSP00000373304:D37H;ENSP00000302344:D37H	ENSP00000302344:D37H	D	+	1	0	C3orf19	14671003	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.367000	0.73099	2.620000	0.88729	0.491000	0.48974	GAT	.	.	.	none		0.299	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252077.2	NM_016474	
DPH3	285381	hgsc.bcm.edu	37	3	16302327	16302327	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr3:16302327C>G	ENST00000488423.1	-	3	288	c.193G>C	c.(193-195)Gtg>Ctg	p.V65L	DPH3_ENST00000285082.4_5'UTR|DPH3_ENST00000383775.4_Missense_Mutation_p.V40L	NM_206831.2	NP_996662.1	Q96FX2	DPH3_HUMAN	diphthamide biosynthesis 3	65					negative regulation of protein secretion (GO:0050709)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of binding (GO:0051099)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(2)	2						TCTCCACACACAAACTGATCC	0.388																																					p.V65L		Atlas-SNP	.											.	DPH3	7	.	0			c.G193C						PASS	.						98.0	87.0	91.0					3																	16302327		2203	4300	6503	SO:0001583	missense	285381	exon3			CACACACAAACTG	BC010181	CCDS2629.1, CCDS43058.1	3p25.1	2013-06-19	2013-06-19	2006-10-25	ENSG00000154813	ENSG00000154813			27717	protein-coding gene	gene with protein product	"""DPH3A, KTI11 homolog A (S. cerevisiae)"""	608959	"""zinc finger, CSL-type containing 2"", ""DPH3 homolog (KTI11, S. cerevisiae)"", ""DPH3, KTI11 homolog (S. cerevisiae)"""	ZCSL2		14527407, 14980502, 15485916, 16648478	Standard	NM_001047434		Approved	DESR1, DELGIP1, MGC20197, KTI11, DELGIP, DPH3A	uc003cau.3	Q96FX2	OTTHUMG00000129866	ENST00000488423.1:c.193G>C	chr3.hg19:g.16302327C>G	ENSP00000419599:p.Val65Leu	49.0	0.0	.		68.0	4.0	.	NM_206831		Missense_Mutation	SNP	ENST00000488423.1	hg19	CCDS2629.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311440	0.23821	.	.	ENSG00000154813	ENST00000488423;ENST00000383775	.	.	.	5.73	3.22	0.36961	.	0.175580	0.64402	D	0.000016	T	0.16128	0.0388	.	.	.	0.24129	N	0.995778	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30563	-0.9974	8	0.07990	T	0.79	-32.8775	7.2848	0.26333	0.0:0.2036:0.0:0.7964	.	40;65	Q96FX2-2;Q96FX2	.;DPH3_HUMAN	L	65;40	.	ENSP00000373285:V40L	V	-	1	0	DPH3	16277331	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	1.606000	0.36826	0.362000	0.24319	0.491000	0.48974	GTG	.	.	.	none		0.388	DPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252108.2	NM_206831	
SLC22A13	9390	hgsc.bcm.edu	37	3	38317479	38317479	+	Missense_Mutation	SNP	C	C	A	rs117371763	byFrequency	TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr3:38317479C>A	ENST00000311856.4	+	7	1178	c.1129C>A	c.(1129-1131)Cgc>Agc	p.R377S	SLC22A13_ENST00000450935.2_3'UTR	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	377					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		GGTGCCTGCCCGCTGTTCCAG	0.567																																					p.R377S		Atlas-SNP	.											.	SLC22A13	42	.	0			c.C1129A						PASS	.						80.0	68.0	72.0					3																	38317479		2203	4300	6503	SO:0001583	missense	9390	exon7			CCTGCCCGCTGTT	AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.1129C>A	chr3.hg19:g.38317479C>A	ENSP00000310241:p.Arg377Ser	55.0	0.0	.		75.0	5.0	.	NM_004256	B2RCV9|Q8IYG1	Missense_Mutation	SNP	ENST00000311856.4	hg19	CCDS2676.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101702	0.76983	.	.	ENSG00000172940	ENST00000311856	T	0.72942	-0.7	5.16	3.37	0.38596	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.048082	0.85682	D	0.000000	T	0.76579	0.4007	L	0.59967	1.855	0.80722	D	1	D;P	0.61697	0.99;0.946	D;P	0.64776	0.929;0.726	T	0.71642	-0.4531	10	0.21540	T	0.41	.	10.7573	0.46245	0.0:0.846:0.0:0.154	.	377;377	Q9Y226-2;Q9Y226	.;S22AD_HUMAN	S	377	ENSP00000310241:R377S	ENSP00000310241:R377S	R	+	1	0	SLC22A13	38292483	0.991000	0.36638	0.943000	0.38184	0.893000	0.52053	2.927000	0.48900	0.696000	0.31696	0.655000	0.94253	CGC	.	C|0.999;T|0.001	.	alt		0.567	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253746.2	NM_004256	
PCDH7	5099	hgsc.bcm.edu	37	4	30724425	30724425	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr4:30724425A>G	ENST00000361762.2	+	1	2389	c.1381A>G	c.(1381-1383)Acc>Gcc	p.T461A	PCDH7_ENST00000543491.1_Missense_Mutation_p.T461A	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	461	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T414P(1)|p.T461P(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GGTCACCTGCACCGTGGTGGG	0.642																																					p.T461A		Atlas-SNP	.											PCDH7_ENST00000361762,NS,carcinoma,0,1	PCDH7	215	.	2	Substitution - Missense(2)	lung(2)	c.A1381G						PASS	.						74.0	56.0	62.0					4																	30724425		2203	4300	6503	SO:0001583	missense	5099	exon1			ACCTGCACCGTGG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1381A>G	chr4.hg19:g.30724425A>G	ENSP00000355243:p.Thr461Ala	62.0	1.0	.		62.0	3.0	.	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.21|14.21	2.465990|2.465990	0.43839|0.43839	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.48836	.|0.8;0.8	5.16|5.16	5.16|5.16	0.70880|0.70880	.|Cadherin (4);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.47002|0.47002	0.1422|0.1422	L|L	0.28694|0.28694	0.88|0.88	0.47819|0.47819	D|D	0.999523|0.999523	.|B;B;B	.|0.32653	.|0.328;0.328;0.379	.|B;B;P	.|0.44447	.|0.321;0.321;0.45	T|T	0.44174|0.44174	-0.9345|-0.9345	5|9	.|0.35671	.|T	.|0.21	.|.	15.1585|15.1585	0.72761|0.72761	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|461;414;461	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	R|A	150|461;461;414	.|ENSP00000355243:T461A;ENSP00000441802:T461A	.|ENSP00000330302:T414A	H|T	+|+	2|1	0|0	PCDH7|PCDH7	30333523|30333523	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.956000|5.956000	0.70315|0.70315	2.164000|2.164000	0.68074|0.68074	0.533000|0.533000	0.62120|0.62120	CAC|ACC	.	.	.	none		0.642	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
DDX60L	91351	hgsc.bcm.edu	37	4	169337906	169337906	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr4:169337906G>A	ENST00000511577.1	-	20	2900	c.2653C>T	c.(2653-2655)Ctc>Ttc	p.L885F	DDX60L_ENST00000260184.7_Missense_Mutation_p.L885F|DDX60L_ENST00000505890.1_Missense_Mutation_p.L885F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	885	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		ACAAGGAGGAGCTCCCAAAAT	0.343																																					p.L885F		Atlas-SNP	.											.	DDX60L	116	.	0			c.C2653T						PASS	.						107.0	102.0	104.0					4																	169337906		1833	4116	5949	SO:0001583	missense	91351	exon20			GGAGGAGCTCCCA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.2653C>T	chr4.hg19:g.169337906G>A	ENSP00000422423:p.Leu885Phe	82.0	0.0	.		111.0	33.0	.	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.04	2.714600	0.48622	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.74526	-0.85;-0.85;1.2;1.2	3.42	3.42	0.39159	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.183055	0.25361	U	0.031226	T	0.69124	0.3076	L	0.49640	1.575	0.25638	N	0.986238	P;P;P	0.45283	0.855;0.769;0.855	B;B;B	0.41510	0.359;0.288;0.359	T	0.66164	-0.5992	10	0.66056	D	0.02	.	13.027	0.58821	0.0:0.0:1.0:0.0	.	885;885;885	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	885;885;885;581	ENSP00000260184:L885F;ENSP00000422423:L885F;ENSP00000422202:L885F;ENSP00000421026:L581F	ENSP00000260184:L885F	L	-	1	0	DDX60L	169574481	1.000000	0.71417	0.896000	0.35187	0.943000	0.58893	5.558000	0.67319	1.619000	0.50296	0.461000	0.40582	CTC	.	.	.	none		0.343	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
MAP3K1	4214	hgsc.bcm.edu	37	5	56177037	56177037	+	Silent	SNP	T	T	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr5:56177037T>A	ENST00000399503.3	+	13	2307	c.2307T>A	c.(2305-2307)ccT>ccA	p.P769P		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	769					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGGAATTTCCTGCTGAATTTT	0.348																																					p.P769P		Atlas-SNP	.											.	MAP3K1	355	.	0			c.T2307A						PASS	.						164.0	147.0	152.0					5																	56177037		1836	4079	5915	SO:0001819	synonymous_variant	4214	exon13			ATTTCCTGCTGAA	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2307T>A	chr5.hg19:g.56177037T>A		48.0	0.0	.		76.0	25.0	.	NM_005921		Silent	SNP	ENST00000399503.3	hg19	CCDS43318.1																																																																																			.	.	.	none		0.348	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
PPP1R9A	55607	hgsc.bcm.edu	37	7	94827675	94827675	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr7:94827675G>T	ENST00000433881.1	+	6	2301	c.1769G>T	c.(1768-1770)cGg>cTg	p.R590L	PPP1R9A_ENST00000456331.2_Missense_Mutation_p.R590L|PPP1R9A_ENST00000340694.4_Missense_Mutation_p.R590L|AC002429.5_ENST00000417881.2_RNA|PPP1R9A_ENST00000289495.5_Missense_Mutation_p.R590L|PPP1R9A_ENST00000424654.1_Missense_Mutation_p.R590L|PPP1R9A_ENST00000433360.1_Missense_Mutation_p.R590L			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	590	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			GTTATTGGGCGGGAAAAACCA	0.453										HNSCC(28;0.073)																											p.R590L		Atlas-SNP	.											.	PPP1R9A	264	.	0			c.G1769T						PASS	.						75.0	75.0	75.0					7																	94827675		2203	4300	6503	SO:0001583	missense	55607	exon6			TTGGGCGGGAAAA	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.1769G>T	chr7.hg19:g.94827675G>T	ENSP00000398870:p.Arg590Leu	81.0	0.0	.		152.0	12.0	.	NM_017650	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Missense_Mutation	SNP	ENST00000433881.1	hg19	CCDS34683.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759811	0.69763	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.61	5.61	0.85477	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	D	0.83603	0.5290	H	0.97758	4.07	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.987;0.997	D	0.88812	0.3292	10	0.87932	D	0	.	20.0173	0.97481	0.0:0.0:1.0:0.0	.	590;590;590;590;590	B7ZLX4;F8W7J9;E9PDX1;E9PCK6;Q9ULJ8	.;.;.;.;NEB1_HUMAN	L	590	ENSP00000405514:R590L;ENSP00000344524:R590L;ENSP00000411342:R590L;ENSP00000398870:R590L;ENSP00000289495:R590L;ENSP00000402893:R590L	ENSP00000289495:R590L	R	+	2	0	PPP1R9A	94665611	1.000000	0.71417	0.992000	0.48379	0.038000	0.13279	9.718000	0.98758	2.814000	0.96858	0.591000	0.81541	CGG	.	.	.	none		0.453	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
DUS4L	11062	hgsc.bcm.edu	37	7	107216872	107216872	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr7:107216872T>A	ENST00000265720.3	+	7	903	c.541T>A	c.(541-543)Tca>Aca	p.S181T	DUS4L_ENST00000402620.1_Missense_Mutation_p.S60T	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	181							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AACAGGAGTTTCATGGATTAC	0.353																																					p.S181T		Atlas-SNP	.											.	DUS4L	27	.	0			c.T541A						PASS	.						81.0	76.0	78.0					7																	107216872		2203	4300	6503	SO:0001583	missense	11062	exon7			GGAGTTTCATGGA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.541T>A	chr7.hg19:g.107216872T>A	ENSP00000265720:p.Ser181Thr	69.0	0.0	.		114.0	30.0	.	NM_001270419	B4DLX0|Q2NKK1	Missense_Mutation	SNP	ENST00000265720.3	hg19	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	T	8.361	0.833117	0.16820	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.22539	1.95;1.95	6.01	3.59	0.41128	Aldolase-type TIM barrel (1);	0.166724	0.56097	D	0.000035	T	0.18130	0.0435	L	0.48935	1.535	0.51233	D	0.99991	B;B	0.16396	0.017;0.017	B;B	0.25291	0.059;0.059	T	0.05468	-1.0883	10	0.26408	T	0.33	.	8.1312	0.31029	0.1207:0.0651:0.0:0.8142	.	181;181	A4D0R5;O95620	.;DUS4L_HUMAN	T	181;60	ENSP00000265720:S181T;ENSP00000385274:S60T	ENSP00000265720:S181T	S	+	1	0	DUS4L	107004108	1.000000	0.71417	0.680000	0.29994	0.052000	0.14988	5.909000	0.69923	0.489000	0.27749	-0.297000	0.09499	TCA	.	.	.	none		0.353	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
TRIM24	8805	hgsc.bcm.edu	37	7	138145434	138145434	+	Silent	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr7:138145434G>A	ENST00000343526.4	+	1	356	c.141G>A	c.(139-141)gcG>gcA	p.A47A	TRIM24_ENST00000415680.2_Silent_p.A47A			O15164	TIF1A_HUMAN	tripartite motif containing 24	47					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						GCGGCGAGGCGGCCCGGCTCA	0.746																																					p.A47A	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	Atlas-SNP	.											.	TRIM24	131	.	0			c.G141A						PASS	.						5.0	7.0	6.0					7																	138145434		1615	3579	5194	SO:0001819	synonymous_variant	8805	exon1			CGAGGCGGCCCGG	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.141G>A	chr7.hg19:g.138145434G>A		23.0	0.0	.		29.0	12.0	.	NM_003852	A4D1R7|A4D1R8|O95854	Silent	SNP	ENST00000343526.4	hg19	CCDS5847.1																																																																																			.	.	.	none		0.746	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341814.1	NM_015905	
CLU	1191	hgsc.bcm.edu	37	8	27457323	27457323	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:27457323C>G	ENST00000316403.10	-	7	1543	c.1138G>C	c.(1138-1140)Gac>Cac	p.D380H	CLU_ENST00000405140.3_Missense_Mutation_p.D380H|CLU_ENST00000560366.1_Missense_Mutation_p.D432H|CLU_ENST00000546343.1_Missense_Mutation_p.D391H|CLU_ENST00000523500.1_Missense_Mutation_p.D380H			P10909	CLUS_HUMAN	clusterin	380					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		TAGTACTGGTCTTCGCCTTGC	0.602																																					p.D380H		Atlas-SNP	.											.	CLU	54	.	0			c.G1138C						PASS	.						71.0	57.0	62.0					8																	27457323		2203	4300	6503	SO:0001583	missense	1191	exon7			ACTGGTCTTCGCC	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.1138G>C	chr8.hg19:g.27457323C>G	ENSP00000315130:p.Asp380His	33.0	0.0	.		27.0	10.0	.	NM_001831	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Missense_Mutation	SNP	ENST00000316403.10	hg19	CCDS47832.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.93|17.93|17.93	3.509052|3.509052|3.509052	0.64410|0.64410|0.64410	.|.|.	.|.|.	ENSG00000120885|ENSG00000120885|ENSG00000120885	ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012|ENST00000521770|ENST00000522098	T;T;T|.|.	0.23754|.|.	1.89;1.89;1.89|.|.	5.62|5.62|5.62	3.57|3.57|3.57	0.40892|0.40892|0.40892	Clusterin, C-terminal (1);|.|.	0.252635|.|.	0.44688|.|.	D|.|.	0.000435|.|.	T|T|T	0.55768|0.55768|0.55768	0.1941|0.1941|0.1941	M|M|M	0.81942|0.81942|0.81942	2.565|2.565|2.565	0.19300|0.19300|0.19300	N|N|N	0.999975|0.999975|0.999975	D;D;D;D|.|.	0.89917|.|.	1.0;1.0;1.0;0.99|.|.	D;D;D;D|.|.	0.91635|.|.	0.995;0.999;0.999;0.912|.|.	T|T|T	0.51988|0.51988|0.51988	-0.8635|-0.8635|-0.8635	10|5|5	0.87932|.|.	D|.|.	0|.|.	-20.387|-20.387|-20.387	5.2925|5.2925|5.2925	0.15735|0.15735|0.15735	0.0:0.6574:0.0:0.3426|0.0:0.6574:0.0:0.3426|0.0:0.6574:0.0:0.3426	.|.|.	245;432;391;380|.|.	E7ETA7;P10909-2;P10909-5;P10909|.|.	.;.;.;CLUS_HUMAN|.|.	H|N|T	432;391;380;380;205;245|70|242	ENSP00000446413:D391H;ENSP00000385419:D380H;ENSP00000429620:D380H|.|.	ENSP00000315130:D432H|.|.	D|K|R	-|-|-	1|3|2	0|2|0	CLU|CLU|CLU	27513240|27513240|27513240	0.048000|0.048000|0.048000	0.20356|0.20356|0.20356	0.005000|0.005000|0.005000	0.12908|0.12908|0.12908	0.275000|0.275000|0.275000	0.26752|0.26752|0.26752	1.118000|1.118000|1.118000	0.31246|0.31246|0.31246	1.363000|1.363000|1.363000	0.46019|0.46019|0.46019	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAC|AAG|AGA	.	.	.	none		0.602	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219953.3	NM_001831	
KAT6A	7994	hgsc.bcm.edu	37	8	41791942	41791942	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr8:41791942T>G	ENST00000396930.3	-	18	4339	c.3796A>C	c.(3796-3798)Aag>Cag	p.K1266Q	KAT6A_ENST00000265713.2_Missense_Mutation_p.K1266Q|KAT6A_ENST00000406337.1_Missense_Mutation_p.K1266Q	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1266					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										tcAGGCTCCTTGGTTTCGGTC	0.582																																					p.K1266Q		Atlas-SNP	.											.	.	.	.	0			c.A3796C						PASS	.						70.0	57.0	61.0					8																	41791942		2203	4300	6503	SO:0001583	missense	7994	exon18			GCTCCTTGGTTTC	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.3796A>C	chr8.hg19:g.41791942T>G	ENSP00000380136:p.Lys1266Gln	28.0	0.0	.		12.0	4.0	.	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	5.700	0.313720	0.10789	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.59772	0.24;0.24;0.24	5.95	5.95	0.96441	.	0.067727	0.64402	D	0.000010	T	0.59582	0.2204	L	0.27053	0.805	0.33409	D	0.578344	D	0.71674	0.998	P	0.59115	0.852	T	0.63382	-0.6650	10	0.18710	T	0.47	-26.6212	16.4159	0.83738	0.0:0.0:0.0:1.0	.	1266	Q92794	KAT6A_HUMAN	Q	1266	ENSP00000265713:K1266Q;ENSP00000385888:K1266Q;ENSP00000380136:K1266Q	ENSP00000265713:K1266Q	K	-	1	0	KAT6A	41911099	0.647000	0.27304	0.108000	0.21378	0.021000	0.10359	1.215000	0.32431	2.279000	0.76181	0.533000	0.62120	AAG	.	.	.	none		0.582	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
TRPM3	80036	hgsc.bcm.edu	37	9	73213442	73213442	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr9:73213442C>A	ENST00000377111.2	-	20	3148	c.2905G>T	c.(2905-2907)Ggg>Tgg	p.G969W	TRPM3_ENST00000377105.1_Missense_Mutation_p.G828W|TRPM3_ENST00000377106.1_Missense_Mutation_p.G841W|TRPM3_ENST00000408909.2_Missense_Mutation_p.G828W|TRPM3_ENST00000377110.3_Missense_Mutation_p.G969W|TRPM3_ENST00000358082.3_Missense_Mutation_p.G831W|TRPM3_ENST00000357533.2_Missense_Mutation_p.G973W|TRPM3_ENST00000396280.5_Missense_Mutation_p.G818W|TRPM3_ENST00000396285.1_Missense_Mutation_p.G816W|TRPM3_ENST00000423814.3_Missense_Mutation_p.G996W|TRPM3_ENST00000360823.2_Missense_Mutation_p.G831W|TRPM3_ENST00000396292.4_Missense_Mutation_p.G841W	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	994					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.G973W(1)|p.G841W(1)|p.G969W(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						ATGACCCTCCCGTCACTCCTG	0.498																																					p.G969W		Atlas-SNP	.											TRPM3_ENST00000423814,colon,carcinoma,0,3	TRPM3	700	.	3	Substitution - Missense(3)	lung(3)	c.G2905T						PASS	.						138.0	125.0	129.0					9																	73213442		2203	4300	6503	SO:0001583	missense	80036	exon20			CCCTCCCGTCACT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2905G>T	chr9.hg19:g.73213442C>A	ENSP00000366315:p.Gly969Trp	161.0	1.0	.		169.0	8.0	.	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.478419|4.478419	0.84747|0.84747	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	T;T;T;T;T;T;T;T;T;T;T|.	0.74842|.	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86752|0.86752	0.6008|0.6008	M|M	0.93720|0.93720	3.45|3.45	0.58432|0.58432	D|D	0.999994|0.999994	D;P;D;D;D;D;D;D|.	0.89917|.	1.0;0.813;1.0;1.0;0.999;0.999;1.0;0.994|.	D;B;D;D;D;D;D;D|.	0.97110|.	0.987;0.415;1.0;1.0;0.997;0.993;1.0;0.989|.	D|D	0.90516|0.90516	0.4485|0.4485	10|5	0.87932|.	D|.	0|.	-17.254|-17.254	18.3586|18.3586	0.90367|0.90367	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	969;969;959;973;831;828;941;816|.	Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.;.;.;.;.;.;.;.|.	W|L	969;969;841;831;828;973;828;816;841;831;996|817	ENSP00000366315:G969W;ENSP00000366314:G969W;ENSP00000366310:G841W;ENSP00000354066:G831W;ENSP00000366309:G828W;ENSP00000350140:G973W;ENSP00000386127:G828W;ENSP00000379581:G816W;ENSP00000379587:G841W;ENSP00000350791:G831W;ENSP00000389542:G996W|.	ENSP00000350140:G973W|.	G|R	-|-	1|2	0|0	TRPM3|TRPM3	72403262|72403262	1.000000|1.000000	0.71417|0.71417	0.935000|0.935000	0.37517|0.37517	0.958000|0.958000	0.62258|0.62258	7.479000|7.479000	0.81095|0.81095	2.405000|2.405000	0.81733|0.81733	0.573000|0.573000	0.79308|0.79308	GGG|CGG	.	.	.	none		0.498	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
PRPF18	8559	hgsc.bcm.edu	37	10	13658431	13658431	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr10:13658431A>G	ENST00000378572.3	+	9	986	c.826A>G	c.(826-828)Aat>Gat	p.N276D		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	276					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GGCCATTGGAAATGCGCCTTG	0.413																																					p.N276D		Atlas-SNP	.											.	PRPF18	32	.	0			c.A826G						PASS	.						152.0	141.0	145.0					10																	13658431		2203	4300	6503	SO:0001583	missense	8559	exon9			ATTGGAAATGCGC	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.826A>G	chr10.hg19:g.13658431A>G	ENSP00000367835:p.Asn276Asp	153.0	0.0	.		159.0	46.0	.	NM_003675	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	hg19	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790746	0.90367	.	.	ENSG00000165630	ENST00000378572;ENST00000298451	.	.	.	5.3	5.3	0.74995	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.86356	0.5913	H	0.94886	3.595	0.80722	D	1	D	0.65815	0.995	D	0.75020	0.985	D	0.90319	0.4343	9	0.87932	D	0	-32.2513	15.2507	0.73542	1.0:0.0:0.0:0.0	.	276	Q99633	PRP18_HUMAN	D	276;38	.	ENSP00000298451:N38D	N	+	1	0	PRPF18	13698437	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.320000	0.96346	2.006000	0.58801	0.528000	0.53228	AAT	.	.	.	none		0.413	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
CYP26A1	1592	hgsc.bcm.edu	37	10	94834144	94834144	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr10:94834144G>T	ENST00000224356.4	+	2	314	c.269G>T	c.(268-270)cGg>cTg	p.R90L	CYP26A1_ENST00000394139.1_Missense_Mutation_p.R21L|CYP26A1_ENST00000371531.1_Missense_Mutation_p.R21L	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	90					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.R21L(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CCCACCGTACGGGTGATGGGC	0.632																																					p.R90L		Atlas-SNP	.											.	CYP26A1	59	.	1	Substitution - Missense(1)	lung(1)	c.G269T						PASS	.						88.0	93.0	91.0					10																	94834144		2203	4300	6503	SO:0001583	missense	1592	exon2			CCGTACGGGTGAT	AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.269G>T	chr10.hg19:g.94834144G>T	ENSP00000224356:p.Arg90Leu	285.0	0.0	.		219.0	10.0	.	NM_000783	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	ENST00000224356.4	hg19	CCDS7426.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461853	0.84425	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.65916	-0.18;-0.18;-0.18	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.68201	0.2975	L	0.45228	1.405	0.80722	D	1	P	0.43412	0.806	P	0.53649	0.731	T	0.61792	-0.6990	10	0.25751	T	0.34	-20.5899	18.8725	0.92320	0.0:0.0:1.0:0.0	.	90	O43174	CP26A_HUMAN	L	21;90;21	ENSP00000360586:R21L;ENSP00000224356:R90L;ENSP00000377695:R21L	ENSP00000224356:R90L	R	+	2	0	CYP26A1	94824134	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	9.187000	0.94912	2.711000	0.92665	0.561000	0.74099	CGG	.	.	.	none		0.632	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049408.3		
ARHGEF17	9828	hgsc.bcm.edu	37	11	73066676	73066676	+	Silent	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:73066676C>G	ENST00000263674.3	+	4	3902	c.3552C>G	c.(3550-3552)gcC>gcG	p.A1184A	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1184	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CGAGGCCTGCCTTTCTCAAGT	0.557																																					p.A1184A		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.C3552G						PASS	.						92.0	88.0	90.0					11																	73066676		2200	4293	6493	SO:0001819	synonymous_variant	9828	exon4			GCCTGCCTTTCTC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.3552C>G	chr11.hg19:g.73066676C>G		58.0	0.0	.		77.0	29.0	.	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	ENST00000263674.3	hg19	CCDS8221.1																																																																																			.	.	.	none		0.557	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
FAT3	120114	hgsc.bcm.edu	37	11	92568207	92568207	+	Missense_Mutation	SNP	C	C	G	rs376234071		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr11:92568207C>G	ENST00000298047.6	+	14	10060	c.10043C>G	c.(10042-10044)gCg>gGg	p.A3348G	FAT3_ENST00000409404.2_Missense_Mutation_p.A3348G|FAT3_ENST00000525166.1_Missense_Mutation_p.A3198G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3348	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A3348V(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GTCTACAGTGCGGTTATCAGT	0.517										TCGA Ovarian(4;0.039)																											p.A3348G		Atlas-SNP	.											FAT3_ENST00000409404,caecum,carcinoma,0,6	FAT3	1822	.	2	Substitution - Missense(2)	endometrium(2)	c.C10043G						PASS	.						53.0	53.0	53.0					11																	92568207		1941	4149	6090	SO:0001583	missense	120114	exon14			ACAGTGCGGTTAT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10043C>G	chr11.hg19:g.92568207C>G	ENSP00000298047:p.Ala3348Gly	45.0	0.0	.		41.0	2.0	.	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	C	17.79	3.475779	0.63737	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.54479	0.57;0.57;0.57	5.46	5.46	0.80206	.	.	.	.	.	T	0.66636	0.2809	L	0.46819	1.47	0.80722	D	1	D	0.71674	0.998	D	0.64410	0.925	T	0.66296	-0.5959	9	0.51188	T	0.08	.	19.3231	0.94250	0.0:1.0:0.0:0.0	.	3348	Q8TDW7-3	.	G	3348;3348;3198	ENSP00000298047:A3348G;ENSP00000387040:A3348G;ENSP00000432586:A3198G	ENSP00000298047:A3348G	A	+	2	0	FAT3	92207855	0.998000	0.40836	0.060000	0.19600	0.269000	0.26545	4.891000	0.63185	2.539000	0.85634	0.655000	0.94253	GCG	.	.	.	alt		0.517	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
R3HDM2	22864	hgsc.bcm.edu	37	12	57652719	57652719	+	Missense_Mutation	SNP	C	C	A	rs199873508		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr12:57652719C>A	ENST00000347140.3	-	20	2603	c.2213G>T	c.(2212-2214)cGg>cTg	p.R738L	R3HDM2_ENST00000546843.1_5'UTR|R3HDM2_ENST00000403821.2_Missense_Mutation_p.R772L|R3HDM2_ENST00000402412.1_Missense_Mutation_p.R752L|R3HDM2_ENST00000441731.2_Missense_Mutation_p.R433L|R3HDM2_ENST00000358907.2_Missense_Mutation_p.R738L|R3HDM2_ENST00000413953.2_Missense_Mutation_p.R465L|RP11-123K3.4_ENST00000548184.1_3'UTR			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	738						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CTTCTGCCCCCGCTGGTCCAT	0.567																																					p.R738L		Atlas-SNP	.											.	R3HDM2	125	.	0			c.G2213T						PASS	.						81.0	75.0	77.0					12																	57652719		2203	4300	6503	SO:0001583	missense	22864	exon18			TGCCCCCGCTGGT	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.2213G>T	chr12.hg19:g.57652719C>A	ENSP00000317903:p.Arg738Leu	189.0	0.0	.		193.0	8.0	.	NM_014925	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	ENST00000347140.3	hg19	CCDS8937.2	.	.	.	.	.	.	.	.	.	.	C	33	5.206223	0.95033	.	.	ENSG00000179912	ENST00000413953;ENST00000393811;ENST00000347140;ENST00000402412;ENST00000358907;ENST00000441731;ENST00000429355;ENST00000403821;ENST00000548161	T;T;T;T;T;T;T;T	0.69561	-0.24;-0.41;0.45;0.5;0.45;-0.34;0.27;0.51	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.79616	0.4476	L	0.58810	1.83	0.51012	D	0.999908	D;D;D;D	0.69078	0.997;0.997;0.993;0.996	D;D;D;D	0.79108	0.987;0.987;0.982;0.992	T	0.79443	-0.1801	10	0.56958	D	0.05	-20.7023	18.0941	0.89483	0.0:1.0:0.0:0.0	.	772;752;738;465	B5MCG9;B5MCU0;Q9Y2K5;E9PAL1	.;.;R3HD2_HUMAN;.	L	465;465;738;752;738;433;503;772;127	ENSP00000409146:R465L;ENSP00000377400:R465L;ENSP00000317903:R738L;ENSP00000385839:R752L;ENSP00000351784:R738L;ENSP00000408536:R433L;ENSP00000394676:R503L;ENSP00000385169:R772L	ENSP00000317903:R738L	R	-	2	0	R3HDM2	55938986	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	5.027000	0.64109	2.885000	0.99019	0.655000	0.94253	CGG	.	C|0.999;T|0.001	.	alt		0.567	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326570.2	NM_014925	
CENPJ	55835	hgsc.bcm.edu	37	13	25466977	25466977	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr13:25466977C>A	ENST00000381884.4	-	10	3205	c.3020G>T	c.(3019-3021)cGg>cTg	p.R1007L	CENPJ_ENST00000545981.1_Missense_Mutation_p.R1007L	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1007					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CAAATCTTCCCGTAAATCTGC	0.348																																					p.R1007L		Atlas-SNP	.											.	CENPJ	116	.	0			c.G3020T						PASS	.						141.0	138.0	139.0					13																	25466977		2203	4300	6503	SO:0001583	missense	55835	exon10			TCTTCCCGTAAAT	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3020G>T	chr13.hg19:g.25466977C>A	ENSP00000371308:p.Arg1007Leu	146.0	0.0	.		146.0	6.0	.	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	hg19	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753145	0.49362	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.35973	1.28;1.86	5.22	2.78	0.32641	.	0.113214	0.64402	D	0.000008	T	0.23330	0.0564	N	0.19112	0.55	0.32091	N	0.591866	B;B	0.25563	0.129;0.0	B;B	0.25614	0.062;0.0	T	0.18618	-1.0331	10	0.66056	D	0.02	.	9.9179	0.41446	0.0:0.1055:0.0:0.8945	.	88;1007	Q5T6R6;Q9HC77	.;CENPJ_HUMAN	L	1007	ENSP00000371308:R1007L;ENSP00000441090:R1007L	ENSP00000371308:R1007L	R	-	2	0	CENPJ	24364977	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.540000	0.60664	0.381000	0.24851	-0.263000	0.10527	CGG	.	.	.	none		0.348	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
KCNH5	27133	hgsc.bcm.edu	37	14	63483656	63483656	+	Silent	SNP	C	C	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr14:63483656C>G	ENST00000322893.7	-	2	358	c.90G>C	c.(88-90)ctG>ctC	p.L30L	KCNH5_ENST00000394968.1_5'UTR|KCNH5_ENST00000394964.2_5'UTR|KCNH5_ENST00000420622.2_Silent_p.L30L	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	30	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GGGCATTTCCCAGTAAGAAAC	0.363																																					p.L30L		Atlas-SNP	.											.	KCNH5	320	.	0			c.G90C						PASS	.						85.0	80.0	82.0					14																	63483656		2203	4299	6502	SO:0001819	synonymous_variant	27133	exon2			ATTTCCCAGTAAG	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.90G>C	chr14.hg19:g.63483656C>G		99.0	0.0	.		121.0	5.0	.	NM_172375	C9JP98	Silent	SNP	ENST00000322893.7	hg19	CCDS9756.1																																																																																			.	.	.	none		0.363	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
OR4N4	283694	hgsc.bcm.edu	37	15	22383017	22383017	+	Missense_Mutation	SNP	G	G	C	rs150038016	byFrequency	TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr15:22383017G>C	ENST00000328795.4	+	1	636	c.545G>C	c.(544-546)cGa>cCa	p.R182P	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGTGATGTCCGACAGGTCATC	0.527																																					p.R182P		Atlas-SNP	.											OR4N4,NS,carcinoma,+1,1	OR4N4	108	.	0			c.G545C						PASS	.						96.0	79.0	84.0					15																	22383017		2189	4257	6446	SO:0001583	missense	283694	exon1			ATGTCCGACAGGT	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.545G>C	chr15.hg19:g.22383017G>C	ENSP00000332500:p.Arg182Pro	155.0	2.0	.		182.0	8.0	.	NM_001005241	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	hg19	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.362066	0.00214	.	.	ENSG00000183706	ENST00000328795	T	0.00026	8.94	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	N	0.000173	T	0.00039	0.0001	N	0.00014	-2.915	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30563	-0.9974	10	0.09084	T	0.74	-0.3003	6.2571	0.20879	0.2138:0.5784:0.2077:0.0	.	182	Q8N0Y3	OR4N4_HUMAN	P	182	ENSP00000332500:R182P	ENSP00000332500:R182P	R	+	2	0	OR4N4	19884381	0.000000	0.05858	0.995000	0.50966	0.462000	0.32619	-0.407000	0.07178	0.750000	0.32877	-0.499000	0.04595	CGA	.	G|0.999;A|0.001	.	alt		0.527	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
RAB11A	8766	hgsc.bcm.edu	37	15	66180113	66180113	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr15:66180113G>C	ENST00000261890.2	+	5	714	c.586G>C	c.(586-588)Gtt>Ctt	p.V196L	RAB11A_ENST00000569896.1_3'UTR|RAB11A_ENST00000564910.1_Missense_Mutation_p.V126L|RAB11A_ENST00000565075.1_Missense_Mutation_p.V178L	NM_001206836.1|NM_004663.4	NP_001193765.1|NP_004654.1	P62491	RB11A_HUMAN	RAB11A, member RAS oncogene family	196					cytokinesis (GO:0000910)|establishment of protein localization to membrane (GO:0090150)|exosomal secretion (GO:1990182)|GTP catabolic process (GO:0006184)|melanosome transport (GO:0032402)|multivesicular body assembly (GO:0036258)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|positive regulation of axon extension (GO:0045773)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of multivesicular body size (GO:0010796)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	axon (GO:0030424)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|syntaxin binding (GO:0019905)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5						CAACAATGTGGTTCCTATTCA	0.428																																					p.V196L		Atlas-SNP	.											.	RAB11A	14	.	0			c.G586C						PASS	.						137.0	123.0	128.0					15																	66180113		2201	4299	6500	SO:0001583	missense	8766	exon5			AATGTGGTTCCTA	X56740	CCDS10212.1, CCDS58373.1	15q22.31	2008-05-14			ENSG00000103769	ENSG00000103769		"""RAB, member RAS oncogene"""	9760	protein-coding gene	gene with protein product		605570				1704119, 9662449	Standard	NM_004663		Approved	YL8	uc002apk.3	P62491	OTTHUMG00000133162	ENST00000261890.2:c.586G>C	chr15.hg19:g.66180113G>C	ENSP00000261890:p.Val196Leu	122.0	0.0	.		130.0	15.0	.	NM_004663	B2R4B6|B4DT13|P24410|Q5TZN9|Q9JLX1	Missense_Mutation	SNP	ENST00000261890.2	hg19	CCDS10212.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.783421	0.49891	.	.	ENSG00000103769	ENST00000261890	T	0.63744	-0.06	5.45	5.45	0.79879	.	0.056657	0.64402	D	0.000001	T	0.45316	0.1336	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29397	-1.0013	10	0.29301	T	0.29	.	19.3	0.94140	0.0:0.0:1.0:0.0	.	196	P62491	RB11A_HUMAN	L	196	ENSP00000261890:V196L	ENSP00000261890:V196L	V	+	1	0	RAB11A	63967167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.547000	0.85894	0.655000	0.94253	GTT	.	.	.	none		0.428	RAB11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256864.1		
RSPRY1	89970	hgsc.bcm.edu	37	16	57265132	57265132	+	Missense_Mutation	SNP	A	A	G	rs368309991		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr16:57265132A>G	ENST00000537866.1	+	13	2303	c.1430A>G	c.(1429-1431)aAt>aGt	p.N477S	RSPRY1_ENST00000394420.4_Missense_Mutation_p.N477S|RSPRY1_ENST00000563073.1_3'UTR			Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	477	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular region (GO:0005576)	zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|urinary_tract(3)	27						TGTGAGTTCAATTTTGGAGCA	0.333																																					p.N477S		Atlas-SNP	.											.	RSPRY1	49	.	0			c.A1430G						PASS	.	A	SER/ASN	1,4395	2.1+/-5.4	0,1,2197	108.0	104.0	105.0		1430	5.8	1.0	16		105	0,8600		0,0,4300	no	missense	RSPRY1	NM_133368.1	46	0,1,6497	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	477/577	57265132	1,12995	2198	4300	6498	SO:0001583	missense	89970	exon13			AGTTCAATTTTGG	AB075852	CCDS10775.1	16q13	2014-02-12			ENSG00000159579	ENSG00000159579		"""RING-type (C3HC4) zinc fingers"""	29420	protein-coding gene	gene with protein product						11853319	Standard	NM_133368		Approved	KIAA1972	uc002elb.3	Q96DX4	OTTHUMG00000133462	ENST00000537866.1:c.1430A>G	chr16.hg19:g.57265132A>G	ENSP00000443176:p.Asn477Ser	72.0	0.0	.		89.0	27.0	.	NM_133368	Q6UX21|Q8ND53	Missense_Mutation	SNP	ENST00000537866.1	hg19	CCDS10775.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.863491	0.91511	2.27E-4	0.0	ENSG00000159579	ENST00000394420;ENST00000537866	T;T	0.75704	-0.96;-0.96	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.89777	0.6813	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92360	0.5896	10	0.87932	D	0	.	16.1167	0.81309	1.0:0.0:0.0:0.0	.	477	Q96DX4	RSPRY_HUMAN	S	477	ENSP00000377942:N477S;ENSP00000443176:N477S	ENSP00000377942:N477S	N	+	2	0	RSPRY1	55822633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.204000	0.70986	0.528000	0.53228	AAT	.	.	.	weak		0.333	RSPRY1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432953.1	NM_133368	
FAM57A	79850	hgsc.bcm.edu	37	17	643752	643752	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:643752G>T	ENST00000308278.8	+	4	652	c.416G>T	c.(415-417)cGg>cTg	p.R139L	FAM57A_ENST00000572018.1_Intron|FAM57A_ENST00000301324.8_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	139	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		CAGAGGCTCCGGGGAGACCTT	0.512																																					p.R139L		Atlas-SNP	.											.	FAM57A	17	.	0			c.G416T						PASS	.						103.0	100.0	101.0					17																	643752		2203	4300	6503	SO:0001583	missense	79850	exon4			GGCTCCGGGGAGA	AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.416G>T	chr17.hg19:g.643752G>T	ENSP00000312017:p.Arg139Leu	141.0	0.0	.		188.0	8.0	.	NM_024792	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Missense_Mutation	SNP	ENST00000308278.8	hg19	CCDS10996.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780072	0.90195	.	.	ENSG00000167695	ENST00000308278;ENST00000451373	.	.	.	6.17	6.17	0.99709	TRAM/LAG1/CLN8 homology domain (3);	0.043459	0.85682	D	0.000000	D	0.83949	0.5365	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79320	-0.1852	9	0.11182	T	0.66	-23.056	19.8676	0.96824	0.0:0.0:1.0:0.0	.	139	Q8TBR7	FA57A_HUMAN	L	139;212	.	ENSP00000312017:R139L	R	+	2	0	FAM57A	590502	1.000000	0.71417	0.989000	0.46669	0.242000	0.25591	9.718000	0.98758	2.941000	0.99782	0.655000	0.94253	CGG	.	.	.	none		0.512	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437155.2	NM_024792	
PER1	5187	hgsc.bcm.edu	37	17	8045244	8045244	+	Missense_Mutation	SNP	C	C	A	rs373929413		TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:8045244C>A	ENST00000317276.4	-	22	3716	c.3479G>T	c.(3478-3480)cGg>cTg	p.R1160L	PER1_ENST00000581082.1_Missense_Mutation_p.R1137L|PER1_ENST00000578089.1_5'Flank	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1160	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.R1160L(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GAGCCGCTCCCGATCCTGCTT	0.632			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.R1160L		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	1	Substitution - Missense(1)	lung(1)	c.G3479T						PASS	.						50.0	54.0	53.0					17																	8045244		2203	4300	6503	SO:0001583	missense	5187	exon22			CGCTCCCGATCCT	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3479G>T	chr17.hg19:g.8045244C>A	ENSP00000314420:p.Arg1160Leu	118.0	0.0	.		142.0	6.0	.	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	C	32	5.155795	0.94686	.	.	ENSG00000179094	ENST00000317276	T	0.14022	2.54	5.67	4.64	0.57946	Period circadian-like, C-terminal (1);	0.066928	0.64402	D	0.000009	T	0.16085	0.0387	L	0.28649	0.875	0.80722	D	1	D;P	0.58268	0.982;0.951	P;B	0.51516	0.672;0.429	T	0.01013	-1.1481	10	0.33141	T	0.24	-21.4261	13.1256	0.59354	0.1607:0.8393:0.0:0.0	.	1151;1160	A2I2P6;O15534	.;PER1_HUMAN	L	1160	ENSP00000314420:R1160L	ENSP00000314420:R1160L	R	-	2	0	PER1	7985969	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.309000	0.43699	2.697000	0.92050	0.655000	0.94253	CGG	.	.	.	alt		0.632	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
NCOR1	9611	hgsc.bcm.edu	37	17	15935762	15935762	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:15935762G>C	ENST00000268712.3	-	46	7428	c.7171C>G	c.(7171-7173)Cgg>Ggg	p.R2391G	NCOR1_ENST00000395851.1_Missense_Mutation_p.R2288G|NCOR1_ENST00000395857.3_Missense_Mutation_p.R975G	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2391	Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.R2391W(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGAGCATCCGCATAGTCAGA	0.468																																					p.R2391G		Atlas-SNP	.											NCOR1,colon,carcinoma,+1,1	NCOR1	240	.	1	Substitution - Missense(1)	prostate(1)	c.C7171G						PASS	.						117.0	106.0	110.0					17																	15935762		2203	4300	6503	SO:0001583	missense	9611	exon46			GCATCCGCATAGT	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.7171C>G	chr17.hg19:g.15935762G>C	ENSP00000268712:p.Arg2391Gly	139.0	0.0	.		214.0	41.0	.	NM_006311	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596051	0.46318	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.61040	0.14;0.75;0.25	5.96	3.9	0.45041	.	0.048575	0.85682	D	0.000000	T	0.53367	0.1792	L	0.60455	1.87	0.58432	D	0.999992	B;B;B;B;B	0.29341	0.036;0.013;0.242;0.132;0.06	B;B;B;B;B	0.31614	0.022;0.01;0.133;0.089;0.05	T	0.52990	-0.8501	10	0.56958	D	0.05	-9.7742	10.6076	0.45402	0.0:0.1166:0.4874:0.3961	.	2294;2391;2288;910;404	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	G	2391;2288;2294;975	ENSP00000268712:R2391G;ENSP00000379192:R2288G;ENSP00000379198:R975G	ENSP00000268712:R2391G	R	-	1	2	NCOR1	15876487	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.109000	0.50345	0.780000	0.33566	-0.181000	0.13052	CGG	.	.	.	none		0.468	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
RND2	8153	hgsc.bcm.edu	37	17	41180521	41180521	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:41180521G>A	ENST00000587250.2	+	5	615	c.508G>A	c.(508-510)Gtc>Atc	p.V170I	RND2_ENST00000544533.1_Missense_Mutation_p.V171I|CTD-3199J23.4_ENST00000225973.5_lincRNA			P52198	RND2_HUMAN	Rho family GTPase 2	170					GTP catabolic process (GO:0006184)|positive regulation of collateral sprouting (GO:0048672)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|skin(1)	2		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGAGCGCAGCGTCAGGGATGT	0.622																																					p.V170I		Atlas-SNP	.											.	RND2	10	.	0			c.G508A						PASS	.						67.0	63.0	65.0					17																	41180521		2203	4300	6503	SO:0001583	missense	8153	exon5			CGCAGCGTCAGGG	X95456	CCDS11452.1	17q21.31	2012-10-02	2005-01-24	2005-01-24	ENSG00000108830	ENSG00000108830			18315	protein-coding gene	gene with protein product		601555	"""ras homolog gene family, member N"""	ARHN			Standard	XM_005257706		Approved	Rho7, RhoN	uc002icn.3	P52198	OTTHUMG00000180817	ENST00000587250.2:c.508G>A	chr17.hg19:g.41180521G>A	ENSP00000466680:p.Val170Ile	112.0	0.0	.		113.0	30.0	.	NM_005440	A8K2D4|O00690|O00734|Q5U0P6|Q99535	Missense_Mutation	SNP	ENST00000587250.2	hg19	CCDS11452.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941209	0.92526	.	.	ENSG00000108830	ENST00000544533;ENST00000225973	T	0.80653	-1.4	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81621	0.4861	L	0.36672	1.1	0.80722	D	1	P	0.41643	0.758	P	0.48704	0.587	T	0.82420	-0.0466	10	0.66056	D	0.02	.	19.2909	0.94098	0.0:0.0:1.0:0.0	.	170	P52198	RND2_HUMAN	I	171;170	ENSP00000439328:V171I	ENSP00000225973:V170I	V	+	1	0	RND2	38434047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.623000	0.98386	2.894000	0.99253	0.655000	0.94253	GTC	.	.	.	none		0.622	RND2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453111.2	NM_005440	
EVPL	2125	hgsc.bcm.edu	37	17	74005355	74005355	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr17:74005355T>G	ENST00000301607.3	-	22	4184	c.3931A>C	c.(3931-3933)Aag>Cag	p.K1311Q	EVPL_ENST00000586740.1_Missense_Mutation_p.K1333Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1311	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTCACCGTCTTGGTCTCCACC	0.682																																					p.K1311Q		Atlas-SNP	.											.	EVPL	155	.	0			c.A3931C						PASS	.						105.0	114.0	111.0					17																	74005355		2202	4300	6502	SO:0001583	missense	2125	exon22			CCGTCTTGGTCTC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3931A>C	chr17.hg19:g.74005355T>G	ENSP00000301607:p.Lys1311Gln	451.0	0.0	.		432.0	94.0	.	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	hg19	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755797	0.31046	.	.	ENSG00000167880	ENST00000301607	T	0.56611	0.45	5.41	4.32	0.51571	.	0.092795	0.64402	D	0.000001	T	0.53384	0.1793	M	0.75777	2.31	0.37299	D	0.908594	P;B	0.39759	0.687;0.142	B;B	0.37731	0.257;0.048	T	0.63479	-0.6628	10	0.72032	D	0.01	-43.3057	12.5545	0.56246	0.0:0.0:0.1392:0.8608	.	1333;1311	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	1311	ENSP00000301607:K1311Q	ENSP00000301607:K1311Q	K	-	1	0	EVPL	71516950	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	2.654000	0.46699	0.875000	0.35847	0.459000	0.35465	AAG	.	.	.	none		0.682	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
GPR32	2854	hgsc.bcm.edu	37	19	51274070	51274070	+	Silent	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr19:51274070T>C	ENST00000270590.4	+	1	350	c.213T>C	c.(211-213)cgT>cgC	p.R71R		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	71					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CTGTCTTCCGTATGGCACGCA	0.572																																					p.R71R	Esophageal Squamous(113;152 1581 5732 15840 44398)	Atlas-SNP	.											.	GPR32	68	.	0			c.T213C						PASS	.						225.0	169.0	188.0					19																	51274070		2203	4300	6503	SO:0001819	synonymous_variant	2854	exon1			CTTCCGTATGGCA	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.213T>C	chr19.hg19:g.51274070T>C		101.0	0.0	.		74.0	4.0	.	NM_001506	Q502U7|Q6NWS5	Silent	SNP	ENST00000270590.4	hg19	CCDS12801.1																																																																																			.	.	.	none		0.572	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
NLRP5	126206	hgsc.bcm.edu	37	19	56539072	56539072	+	Silent	SNP	C	C	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr19:56539072C>T	ENST00000390649.3	+	7	1473	c.1473C>T	c.(1471-1473)gtC>gtT	p.V491V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	491	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGGAGAGCGTCGCCCCCTTCA	0.632																																					p.V491V		Atlas-SNP	.											.	NLRP5	217	.	0			c.C1473T						PASS	.						31.0	34.0	33.0					19																	56539072		2140	4237	6377	SO:0001819	synonymous_variant	126206	exon7			GAGCGTCGCCCCC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1473C>T	chr19.hg19:g.56539072C>T		49.0	0.0	.		56.0	25.0	.	NM_153447	A8MTY4|Q86W29	Silent	SNP	ENST00000390649.3	hg19	CCDS12938.1																																																																																			.	.	.	none		0.632	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33591257	33591257	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr20:33591257G>T	ENST00000252015.2	-	18	2301	c.2212C>A	c.(2212-2214)Cag>Aag	p.Q738K	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.Q699K|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.Q730K|TRPC4AP_ENST00000539834.1_Missense_Mutation_p.Q340K			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	738					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGGTAGTGCTGCTGCCAGAAG	0.632																																					p.Q738K		Atlas-SNP	.											.	TRPC4AP	64	.	0			c.C2212A						PASS	.						59.0	59.0	59.0					20																	33591257		2203	4300	6503	SO:0001583	missense	26133	exon18			AGTGCTGCTGCCA	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.2212C>A	chr20.hg19:g.33591257G>T	ENSP00000252015:p.Gln738Lys	129.0	0.0	.		126.0	36.0	.	NM_015638	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	hg19	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	6.251	0.414503	0.11870	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	4.65	4.65	0.58169	.	0.189321	0.48767	D	0.000179	T	0.51517	0.1679	L	0.36672	1.1	0.50632	D	0.999882	B;B;B	0.20164	0.042;0.042;0.042	B;B;B	0.16289	0.015;0.015;0.015	T	0.47586	-0.9106	9	0.12766	T	0.61	.	17.7234	0.88358	0.0:0.0:1.0:0.0	.	699;730;738	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	K	738;730;340;699;723	.	ENSP00000252015:Q738K	Q	-	1	0	TRPC4AP	33054918	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.652000	0.83633	2.398000	0.81561	0.462000	0.41574	CAG	.	.	.	none		0.632	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
KCNQ2	3785	hgsc.bcm.edu	37	20	62078166	62078166	+	Silent	SNP	G	G	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr20:62078166G>C	ENST00000359125.2	-	2	495	c.321C>G	c.(319-321)ctC>ctG	p.L107L	KCNQ2_ENST00000344462.4_Silent_p.L107L|RP11-358D14.2_ENST00000436263.1_RNA|KCNQ2_ENST00000359689.1_Silent_p.L107L|KCNQ2_ENST00000344425.5_Silent_p.L107L|KCNQ2_ENST00000354587.3_Silent_p.L107L|KCNQ2_ENST00000360480.3_Silent_p.L107L|KCNQ2_ENST00000357249.2_Silent_p.L107L|KCNQ2_ENST00000370224.1_Silent_p.L107L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	107					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CAGACAGCACGAGGCAGGAGA	0.632																																					p.L107L		Atlas-SNP	.											.	KCNQ2	201	.	0			c.C321G						PASS	.						85.0	80.0	82.0					20																	62078166		2203	4300	6503	SO:0001819	synonymous_variant	3785	exon2			CAGCACGAGGCAG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.321C>G	chr20.hg19:g.62078166G>C		202.0	0.0	.		172.0	51.0	.	NM_172106	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	hg19	CCDS13520.1																																																																																			.	.	.	none		0.632	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20195138	20195138	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chrX:20195138T>C	ENST00000379565.3	-	11	1117	c.910A>G	c.(910-912)Aag>Gag	p.K304E	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.K276E|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.K276E|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.K275E	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	304	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	GGATTTCGCTTGAAAAGCATT	0.318																																					p.K304E		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.A910G						PASS	.						60.0	62.0	61.0					X																	20195138		2203	4300	6503	SO:0001583	missense	6197	exon11			TTCGCTTGAAAAG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.910A>G	chrX.hg19:g.20195138T>C	ENSP00000368884:p.Lys304Glu	39.0	0.0	.		68.0	4.0	.	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237629	0.58886	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39091	0.1065	N	0.01817	-0.705	0.80722	D	1	B;B;P;B	0.52842	0.17;0.165;0.956;0.198	B;B;P;B	0.59546	0.134;0.034;0.859;0.084	T	0.55418	-0.8144	10	0.37606	T	0.19	.	14.8754	0.70491	0.0:0.0:0.0:1.0	.	276;275;276;304	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	E	304;276;275;276	ENSP00000368884:K304E;ENSP00000440220:K276E;ENSP00000368865:K275E;ENSP00000444837:K276E	ENSP00000368865:K275E	K	-	1	0	RPS6KA3	20105059	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.215000	0.72206	1.894000	0.54839	0.417000	0.27973	AAG	.	.	.	none		0.318	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
DNAJC16	23341	hgsc.bcm.edu	37	1	15890499	15890500	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr1:15890499_15890500delGA	ENST00000375847.3	+	10	1578_1579	c.1414_1415delGA	c.(1414-1416)gagfs	p.E472fs	DNAJC16_ENST00000375849.1_Frame_Shift_Del_p.E472fs|RP4-680D5.8_ENST00000606186.1_RNA|DNAJC16_ENST00000483270.1_3'UTR|DNAJC16_ENST00000375838.1_Frame_Shift_Del_p.E472fs	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	472					cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		GATTGGGAGTGAGAGTGACAAA	0.465																																					p.471_472del		Atlas-INDEL	.											.	DNAJC16	59	.	0			c.1413_1414del						PASS	.																																			SO:0001589	frameshift_variant	23341	exon10			.	AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.1414_1415delGA	chr1.hg19:g.15890501_15890502delGA	ENSP00000365007:p.Glu472fs	308.0	0.0	0		306.0	86.0	0.281046	NM_015291	Q68D57|Q86X32|Q8N5P4	Frame_Shift_Del	DEL	ENST00000375847.3	hg19	CCDS30606.1																																																																																			.	.	.	none		0.465	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006764.1	NM_015291	
CUBN	8029	hgsc.bcm.edu	37	10	16957909	16957910	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DW-7837-01A-11D-2136-08	TCGA-DW-7837-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec9b4fb0-c3b1-4a2b-a3e7-393b27f961da	5a082628-cf8e-4550-812a-28faf2a1735e	g.chr10:16957909_16957910insA	ENST00000377833.4	-	46	7185_7186	c.7120_7121insT	c.(7120-7122)tatfs	p.Y2374fs		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2374	CUB 17. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGGTGAGATAGTGTCCAGAG	0.436																																					p.Y2374fs		Atlas-INDEL	.											.	CUBN	515	.	0			c.7121_7122insT						PASS	.																																			SO:0001589	frameshift_variant	8029	exon46			.	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7121dupT	chr10.hg19:g.16957910_16957910dupA	ENSP00000367064:p.Tyr2374fs	128.0	0.0	0		141.0	51.0	0.361702	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Frame_Shift_Ins	INS	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.	.	none		0.436	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
