#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CR1L	1379	hgsc.bcm.edu	37	1	207818592	207818592	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr1:207818592T>G	ENST00000508064.2	+	1	74	c.14T>G	c.(13-15)gTc>gGc	p.V5G		NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	5						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GCGCCTCCCGTCCGTCTCGAG	0.657																																					p.V5G		Atlas-SNP	.											.	CR1L	97	.	0			c.T14G						PASS	.						62.0	68.0	66.0					1																	207818592		2203	4300	6503	SO:0001583	missense	1379	exon1			CTCCCGTCCGTCT	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.14T>G	chr1.hg19:g.207818592T>G	ENSP00000421736:p.Val5Gly	172.0	0.0	.		117.0	59.0	.	NM_175710	Q32MC9|Q8NEU7	Missense_Mutation	SNP	ENST00000508064.2	hg19	CCDS44310.1	.	.	.	.	.	.	.	.	.	.	T	10.27	1.304420	0.23736	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	T	0.32023	1.47	2.95	-5.9	0.02275	.	.	.	.	.	T	0.04952	0.0133	N	0.00436	-1.5	0.09310	N	1	P	0.41475	0.751	B	0.36989	0.238	T	0.23404	-1.0189	9	0.16420	T	0.52	.	0.9185	0.01310	0.2027:0.1365:0.2268:0.434	.	5	Q2VPA4	CR1L_HUMAN	G	5	ENSP00000421736:V5G	ENSP00000437875:V5G	V	+	2	0	CR1L	205885215	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.381000	0.01065	-1.286000	0.02384	-1.304000	0.01323	GTC	.	.	.	none		0.657	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	
C1orf35	79169	hgsc.bcm.edu	37	1	228290925	228290925	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr1:228290925A>C	ENST00000272139.4	-	1	238	c.4T>G	c.(4-6)Ttc>Gtc	p.F2V	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	2							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				CTGGAGCCGAACATGGCGCCG	0.682																																					p.F2V		Atlas-SNP	.											.	C1orf35	17	.	0			c.T4G						PASS	.						30.0	31.0	31.0					1																	228290925		2201	4299	6500	SO:0001583	missense	79169	exon1			AGCCGAACATGGC	AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.4T>G	chr1.hg19:g.228290925A>C	ENSP00000272139:p.Phe2Val	62.0	0.0	.		48.0	28.0	.	NM_024319	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Missense_Mutation	SNP	ENST00000272139.4	hg19	CCDS1566.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.510193	0.64522	.	.	ENSG00000143793	ENST00000272139	.	.	.	3.88	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.61009	0.2313	M	0.62723	1.935	0.53005	D	0.999965	D	0.58268	0.982	P	0.52554	0.702	T	0.61207	-0.7109	9	0.66056	D	0.02	-15.7163	8.1877	0.31348	0.8997:0.0:0.1003:0.0	.	2	Q9BU76	MMTA2_HUMAN	V	2	.	ENSP00000272139:F2V	F	-	1	0	C1orf35	226357548	1.000000	0.71417	0.996000	0.52242	0.219000	0.24729	6.640000	0.74319	0.548000	0.28955	0.254000	0.18369	TTC	.	.	.	none		0.682	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	
ALMS1	7840	hgsc.bcm.edu	37	2	73827935	73827935	+	Silent	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr2:73827935T>C	ENST00000264448.6	+	18	11907	c.11796T>C	c.(11794-11796)cgT>cgC	p.R3932R	ALMS1_ENST00000409009.1_Silent_p.R3890R	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3932					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AAGAAAAACGTGAAGAGAAAA	0.408																																					p.R3932R		Atlas-SNP	.											.	ALMS1	384	.	0			c.T11796C						PASS	.						91.0	92.0	91.0					2																	73827935		2203	4300	6503	SO:0001819	synonymous_variant	7840	exon18			AAAACGTGAAGAG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11796T>C	chr2.hg19:g.73827935T>C		76.0	0.0	.		51.0	28.0	.	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.	.	none		0.408	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SPAG16	79582	hgsc.bcm.edu	37	2	214161997	214161997	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr2:214161997C>G	ENST00000331683.5	+	3	290	c.195C>G	c.(193-195)gaC>gaG	p.D65E	SPAG16_ENST00000414961.2_3'UTR|SPAG16_ENST00000432529.2_Missense_Mutation_p.D65E|SPAG16_ENST00000447990.1_Missense_Mutation_p.D65E|SPAG16_ENST00000413312.1_Missense_Mutation_p.D34E|SPAG16_ENST00000272898.7_Missense_Mutation_p.D65E|SPAG16_ENST00000374309.3_Missense_Mutation_p.T11R	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	65					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TACCAGATGACAATTTTAGCA	0.358																																					p.D65E		Atlas-SNP	.											.	SPAG16	134	.	0			c.C195G						PASS	.						79.0	82.0	81.0					2																	214161997		2203	4300	6503	SO:0001583	missense	79582	exon3			AGATGACAATTTT	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.195C>G	chr2.hg19:g.214161997C>G	ENSP00000332592:p.Asp65Glu	61.0	0.0	.		99.0	36.0	.	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	hg19	CCDS2396.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.42|12.42	1.932017|1.932017	0.34096|0.34096	.|.	.|.	ENSG00000144451|ENSG00000144451	ENST00000331683;ENST00000432529;ENST00000413312;ENST00000272898;ENST00000447990|ENST00000374309	T|T	0.57752|0.58210	0.38|0.35	5.7|5.7	1.2|1.2	0.21068|0.21068	.|.	0.071260|.	0.51477|.	D|.	0.000088|.	T|T	0.40322|0.40322	0.1112|0.1112	L|L	0.41632|0.41632	1.29|1.29	0.23309|0.23309	N|N	0.997933|0.997933	P;P;B;P;B|B;B	0.43287|0.12013	0.75;0.802;0.036;0.734;0.06|0.001;0.005	B;B;B;B;B|B;B	0.43478|0.17433	0.168;0.137;0.014;0.421;0.082|0.002;0.018	T|T	0.37709|0.37709	-0.9694|-0.9694	10|9	0.52906|0.87932	T|D	0.07|0	.|.	5.0287|5.0287	0.14398|0.14398	0.0:0.4882:0.1541:0.3577|0.0:0.4882:0.1541:0.3577	.|.	34;5;65;65;65|11;2	Q8N0X2-3;Q4G1A2;Q8N0X2;E7EWV3;Q8N0X2-4|B4DYB5;Q8N0X2-2	.;.;SPG16_HUMAN;.;.|.;.	E|R	65;65;34;65;65|11	ENSP00000332592:D65E|ENSP00000363428:T11R	ENSP00000272898:D65E|ENSP00000363428:T11R	D|T	+|+	3|2	2|0	SPAG16|SPAG16	213870242|213870242	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.625000|0.625000	0.37756|0.37756	0.625000|0.625000	0.24477|0.24477	0.022000|0.022000	0.15160|0.15160	-1.151000|-1.151000	0.01829|0.01829	GAC|ACA	.	.	.	none		0.358	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
XRN1	54464	hgsc.bcm.edu	37	3	142141567	142141567	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr3:142141567A>T	ENST00000264951.4	-	8	941	c.824T>A	c.(823-825)aTt>aAt	p.I275N	RNU1-100P_ENST00000365255.1_RNA|XRN1_ENST00000544157.1_Missense_Mutation_p.I65N|XRN1_ENST00000392981.2_Missense_Mutation_p.I275N|XRN1_ENST00000463916.1_Missense_Mutation_p.I275N	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	275					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TATCCTTTCAATATCATATTT	0.323																																					p.I275N		Atlas-SNP	.											.	XRN1	138	.	0			c.T824A						PASS	.						70.0	77.0	75.0					3																	142141567		2202	4299	6501	SO:0001583	missense	54464	exon8			CTTTCAATATCAT	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.824T>A	chr3.hg19:g.142141567A>T	ENSP00000264951:p.Ile275Asn	88.0	0.0	.		66.0	28.0	.	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	hg19	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.466391	0.84425	.	.	ENSG00000114127	ENST00000264951;ENST00000392981;ENST00000463916;ENST00000544157;ENST00000477237	T;T	0.34472	1.36;1.36	5.69	5.69	0.88448	.	0.163395	0.56097	D	0.000029	T	0.60301	0.2258	M	0.77103	2.36	0.54753	D	0.999985	D;P;D;D;P	0.56968	0.978;0.879;0.963;0.96;0.932	D;P;P;P;P	0.65323	0.934;0.754;0.615;0.782;0.492	T	0.63033	-0.6727	10	0.51188	T	0.08	-19.9739	15.9662	0.79974	1.0:0.0:0.0:0.0	.	65;275;136;275;275	B4E2K3;Q8IZH2-3;B3KW17;Q8IZH2-2;Q8IZH2	.;.;.;.;XRN1_HUMAN	N	275;275;275;65;136	ENSP00000264951:I275N;ENSP00000376707:I275N	ENSP00000264951:I275N	I	-	2	0	XRN1	143624257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.930000	0.92872	2.171000	0.68590	0.528000	0.53228	ATT	.	.	.	none		0.323	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
SLBP	7884	hgsc.bcm.edu	37	4	1701385	1701385	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr4:1701385C>G	ENST00000489418.1	-	5	751	c.385G>C	c.(385-387)Gag>Cag	p.E129Q	SLBP_ENST00000318386.4_Missense_Mutation_p.E136Q|SLBP_ENST00000488267.1_Missense_Mutation_p.E94Q|SLBP_ENST00000429429.2_Missense_Mutation_p.E90Q	NM_006527.2	NP_006518.1	Q14493	SLBP_HUMAN	stem-loop binding protein	129	RNA-binding.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA transport (GO:0051028)|nuclear cell cycle DNA replication (GO:0033260)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	histone pre-mRNA DCP binding (GO:0071208)|histone pre-mRNA stem-loop binding (GO:0071207)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|lung(2)	5		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			TCATCTGTCTCAAAGTCAGCC	0.398																																					p.E129Q		Atlas-SNP	.											.	SLBP	12	.	0			c.G385C						PASS	.						126.0	117.0	120.0					4																	1701385		2203	4300	6503	SO:0001583	missense	7884	exon5			CTGTCTCAAAGTC	Z71188	CCDS3350.1	4p16.3	2008-02-11	2008-02-11		ENSG00000163950	ENSG00000163950			10904	protein-coding gene	gene with protein product	"""histone binding protein"""	602422	"""stem-loop (histone) binding protein"""			9049306, 1338771	Standard	NM_006527		Approved	HBP	uc003gdi.1	Q14493	OTTHUMG00000089349	ENST00000489418.1:c.385G>C	chr4.hg19:g.1701385C>G	ENSP00000417686:p.Glu129Gln	138.0	0.0	.		114.0	56.0	.	NM_006527	B3KRJ5	Missense_Mutation	SNP	ENST00000489418.1	hg19	CCDS3350.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	29.7|29.7|29.7	5.030846|5.030846|5.030846	0.93575|0.93575|0.93575	.|.|.	.|.|.	ENSG00000163950|ENSG00000163950|ENSG00000163950	ENST00000429429;ENST00000489418;ENST00000460392;ENST00000318386;ENST00000488267|ENST00000483348|ENST00000480936	.|.|.	.|.|.	.|.|.	5.08|5.08|5.08	5.08|5.08|5.08	0.68730|0.68730|0.68730	.|.|.	0.103824|.|.	0.64402|.|.	D|.|.	0.000005|.|.	D|D|.	0.84781|0.84781|.	0.5548|0.5548|.	M|M|M	0.89534|0.89534|0.89534	3.04|3.04|3.04	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;P;D;D;D|.|.	0.89917|.|.	1.0;0.915;0.985;0.985;0.985|.|.	D;P;P;P;P|.|.	0.91635|.|.	0.999;0.653;0.804;0.804;0.804|.|.	D|D|.	0.87783|0.87783|.	0.2613|0.2613|.	9|5|.	0.72032|.|.	D|.|.	0.01|.|.	-9.2509|-9.2509|-9.2509	18.53|18.53|18.53	0.90987|0.90987|0.90987	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	94;136;90;109;129|.|.	E7EUV9;F8W8D3;B3KRJ5;C9IY53;Q14493|.|.	.;.;.;.;SLBP_HUMAN|.|.	Q|F|S	90;129;109;136;94|83|136	.|.|.	ENSP00000316490:E136Q|.|.	E|L|X	-|-|-	1|3|2	0|2|2	SLBP|SLBP|SLBP	1671183|1671183|1671183	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.949000|0.949000|0.949000	0.38748|0.38748|0.38748	0.969000|0.969000|0.969000	0.65631|0.65631|0.65631	7.142000|7.142000|7.142000	0.77339|0.77339|0.77339	2.382000|2.382000|2.382000	0.81193|0.81193|0.81193	0.644000|0.644000|0.644000	0.83932|0.83932|0.83932	GAG|TTG|TGA	.	.	.	none		0.398	SLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203176.1	NM_006527	
BOD1L1	259282	hgsc.bcm.edu	37	4	13604361	13604361	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr4:13604361C>T	ENST00000040738.5	-	10	4298	c.4163G>A	c.(4162-4164)aGt>aAt	p.S1388N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1388						nucleus (GO:0005634)	DNA binding (GO:0003677)										CGTTAACTTACTTCCAAGAGG	0.418																																					p.S1388N		Atlas-SNP	.											.	.	.	.	0			c.G4163A						PASS	.						139.0	134.0	135.0					4																	13604361		2203	4300	6503	SO:0001583	missense	259282	exon10			AACTTACTTCCAA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.4163G>A	chr4.hg19:g.13604361C>T	ENSP00000040738:p.Ser1388Asn	127.0	0.0	.		125.0	63.0	.	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	hg19	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	C	8.574	0.880637	0.17467	.	.	ENSG00000038219	ENST00000040738	T	0.06768	3.26	5.02	0.266	0.15617	.	0.228445	0.31577	N	0.007419	T	0.04952	0.0133	N	0.24115	0.695	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.34775	-0.9815	10	0.38643	T	0.18	0.0109	6.4855	0.22087	0.0:0.5089:0.1283:0.3629	.	1388	Q8NFC6	BOD1L_HUMAN	N	1388	ENSP00000040738:S1388N	ENSP00000040738:S1388N	S	-	2	0	BOD1L	13213459	0.008000	0.16893	0.000000	0.03702	0.002000	0.02628	0.472000	0.22116	0.111000	0.17947	-0.136000	0.14681	AGT	.	.	.	none		0.418	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
GRIA1	2890	hgsc.bcm.edu	37	5	153078528	153078528	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr5:153078528C>G	ENST00000285900.5	+	10	1690	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	GRIA1_ENST00000521843.2_Missense_Mutation_p.H380Q|GRIA1_ENST00000448073.4_Missense_Mutation_p.H459Q|GRIA1_ENST00000518142.1_Missense_Mutation_p.H369Q|GRIA1_ENST00000518783.1_Missense_Mutation_p.H459Q|GRIA1_ENST00000340592.5_Missense_Mutation_p.H449Q	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	449					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TTGCCAAGCACGTGGGCTACT	0.537																																					p.H459Q		Atlas-SNP	.											.	GRIA1	321	.	0			c.C1377G						PASS	.						110.0	98.0	102.0					5																	153078528		2203	4300	6503	SO:0001583	missense	2890	exon10			CAAGCACGTGGGC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1347C>G	chr5.hg19:g.153078528C>G	ENSP00000285900:p.His449Gln	104.0	0.0	.		74.0	33.0	.	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955998	0.53293	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.37584	1.8;1.8;1.19;1.8;1.8;1.8;1.19	5.44	-4.24	0.03777	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	L	0.55103	1.725	0.58432	D	0.999994	D;D;B;D;D;D	0.56521	0.976;0.976;0.012;0.976;0.971;0.962	P;P;B;P;P;P	0.59761	0.82;0.863;0.018;0.82;0.726;0.849	T	0.44997	-0.9291	10	0.44086	T	0.13	.	15.008	0.71527	0.0:0.6256:0.0:0.3744	.	459;459;369;459;449;449	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	Q	449;449;369;403;449;380;380;459;459	ENSP00000285900:H449Q;ENSP00000427920:H369Q;ENSP00000339343:H449Q;ENSP00000427864:H380Q;ENSP00000442108:H380Q;ENSP00000428994:H459Q;ENSP00000415569:H459Q	ENSP00000285900:H449Q	H	+	3	2	GRIA1	153058721	0.000000	0.05858	0.981000	0.43875	0.975000	0.68041	-1.954000	0.01525	-0.842000	0.04195	-0.794000	0.03295	CAC	.	.	.	none		0.537	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
PTK7	5754	hgsc.bcm.edu	37	6	43044271	43044271	+	Silent	SNP	T	T	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr6:43044271T>G	ENST00000230419.4	+	1	266	c.45T>G	c.(43-45)ccT>ccG	p.P15P	PTK7_ENST00000349241.2_Silent_p.P15P|PTK7_ENST00000481273.1_5'Flank|PTK7_ENST00000352931.2_Silent_p.P15P|PTK7_ENST00000471863.1_Silent_p.P15P|PTK7_ENST00000345201.2_Silent_p.P15P|RP11-387M24.5_ENST00000606123.1_RNA|PTK7_ENST00000476760.1_Silent_p.P15P	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	15					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GCCGGTTGCCTCTGCTCAGCG	0.716																																					p.P15P		Atlas-SNP	.											.	PTK7	101	.	0			c.T45G						PASS	.						7.0	10.0	9.0					6																	43044271		2101	4167	6268	SO:0001819	synonymous_variant	5754	exon1			GTTGCCTCTGCTC	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.45T>G	chr6.hg19:g.43044271T>G		34.0	0.0	.		25.0	18.0	.	NM_152882	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	hg19	CCDS4884.1																																																																																			.	.	.	none		0.716	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
SP8	221833	hgsc.bcm.edu	37	7	20824956	20824956	+	Silent	SNP	C	C	G	rs201180283		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr7:20824956C>G	ENST00000361443.4	-	3	663	c.426G>C	c.(424-426)ggG>ggC	p.G142G	SP8_ENST00000418710.2_Silent_p.G160G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	142					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgcccccgccgccgc	0.741																																					p.G160G		Atlas-SNP	.											.	SP8	43	.	0			c.G480C						PASS	.						2.0	2.0	2.0					7																	20824956		542	1367	1909	SO:0001819	synonymous_variant	221833	exon2			GCCGCCCCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.426G>C	chr7.hg19:g.20824956C>G		9.0	0.0	.		12.0	4.0	.	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	hg19	CCDS5372.1																																																																																			.	.	.	weak		0.741	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
HNRNPA2B1	3181	hgsc.bcm.edu	37	7	26235509	26235509	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr7:26235509C>T	ENST00000354667.4	-	8	883	c.715G>A	c.(715-717)Gga>Aga	p.G239R	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.G227R	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	239	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						TCCCCAAATCCACGTCCACTG	0.378			T	ETV1	prostate																																p.G239R		Atlas-SNP	.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	HNRNPA2B1	70	.	0			c.G715A						PASS	.						110.0	94.0	100.0					7																	26235509		2203	4300	6503	SO:0001583	missense	3181	exon8			CAAATCCACGTCC	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.715G>A	chr7.hg19:g.26235509C>T	ENSP00000346694:p.Gly239Arg	99.0	0.0	.		74.0	33.0	.	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	hg19	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379588	0.61845	.	.	ENSG00000122566	ENST00000354667;ENST00000356674	D;D	0.86627	-2.15;-2.15	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000002	D	0.89015	0.6595	M	0.65677	2.01	0.40149	D	0.976921	D;D	0.56968	0.978;0.963	P;B	0.48524	0.58;0.376	D	0.86218	0.1629	10	0.20046	T	0.44	.	20.327	0.98704	0.0:1.0:0.0:0.0	.	227;239	P22626-2;P22626	.;ROA2_HUMAN	R	239;227	ENSP00000346694:G239R;ENSP00000349101:G227R	ENSP00000346694:G239R	G	-	1	0	HNRNPA2B1	26202034	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.505000	0.60421	2.794000	0.96219	0.650000	0.86243	GGA	.	.	.	none		0.378	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
MGAM	8972	hgsc.bcm.edu	37	7	141731533	141731533	+	Silent	SNP	T	T	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr7:141731533T>G	ENST00000549489.2	+	13	1619	c.1524T>G	c.(1522-1524)gtT>gtG	p.V508V	MGAM_ENST00000475668.2_Silent_p.V508V	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	508	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACTGTGCTGTTTGGTGGACAA	0.363																																					p.V508V		Atlas-SNP	.											.	MGAM	767	.	0			c.T1524G						PASS	.						169.0	157.0	161.0					7																	141731533		1835	4091	5926	SO:0001819	synonymous_variant	8972	exon13			TGCTGTTTGGTGG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.1524T>G	chr7.hg19:g.141731533T>G		109.0	0.0	.		149.0	70.0	.	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	hg19	CCDS47727.1																																																																																			.	.	.	none		0.363	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
TAS2R41	259287	hgsc.bcm.edu	37	7	143175477	143175477	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr7:143175477A>T	ENST00000408916.1	+	1	512	c.512A>T	c.(511-513)aAg>aTg	p.K171M	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	171					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					ATGACCTACAAGTGGAATACA	0.358																																					p.K171M		Atlas-SNP	.											.	TAS2R41	43	.	0			c.A512T						PASS	.						65.0	63.0	63.0					7																	143175477		1827	4093	5920	SO:0001583	missense	259287	exon1			CCTACAAGTGGAA	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.512A>T	chr7.hg19:g.143175477A>T	ENSP00000386201:p.Lys171Met	76.0	0.0	.		50.0	20.0	.	NM_176883	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	hg19	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	A	2.606	-0.291927	0.05568	.	.	ENSG00000221855	ENST00000408916	T	0.00824	5.65	5.79	3.37	0.38596	.	2.257240	0.02520	U	0.092493	T	0.01454	0.0047	L	0.49571	1.57	0.09310	N	1	B	0.32573	0.376	B	0.26202	0.067	T	0.48115	-0.9063	10	0.41790	T	0.15	.	6.5138	0.22236	0.6261:0.2953:0.0786:0.0	.	171	P59536	T2R41_HUMAN	M	171	ENSP00000386201:K171M	ENSP00000386201:K171M	K	+	2	0	TAS2R41	142885599	0.000000	0.05858	0.119000	0.21687	0.009000	0.06853	0.535000	0.23114	1.000000	0.39049	0.533000	0.62120	AAG	.	.	.	none		0.358	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
DENND4C	55667	hgsc.bcm.edu	37	9	19316719	19316719	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr9:19316719A>T	ENST00000380432.2	+	8	1014	c.981A>T	c.(979-981)caA>caT	p.Q327H	DENND4C_ENST00000602925.1_Missense_Mutation_p.Q563H|DENND4C_ENST00000434457.2_Missense_Mutation_p.Q563H			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	327	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TGGAAATTCAAGAGGCATTTT	0.403																																					p.Q563H		Atlas-SNP	.											.	DENND4C	120	.	0			c.A1689T						PASS	.						121.0	135.0	130.0					9																	19316719		2203	4300	6503	SO:0001583	missense	55667	exon12			AATTCAAGAGGCA	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.981A>T	chr9.hg19:g.19316719A>T	ENSP00000369797:p.Gln327His	237.0	0.0	.		212.0	95.0	.	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	hg19		.	.	.	.	.	.	.	.	.	.	A	16.63	3.176330	0.57692	.	.	ENSG00000137145	ENST00000380437	.	.	.	4.98	-1.92	0.07618	dDENN (3);	0.051808	0.85682	D	0.000000	T	0.75547	0.3864	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75616	-0.3256	9	0.87932	D	0	-12.7766	11.8182	0.52224	0.5022:0.0:0.4978:0.0	.	327	Q5VZ89	DEN4C_HUMAN	H	327	.	ENSP00000369802:Q327H	Q	+	3	2	DENND4C	19306719	0.437000	0.25593	0.989000	0.46669	0.789000	0.44602	-0.194000	0.09559	-0.503000	0.06586	-0.561000	0.04177	CAA	.	.	.	none		0.403	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
DENND1A	57706	hgsc.bcm.edu	37	9	126214605	126214605	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr9:126214605T>C	ENST00000373624.2	-	17	1450	c.1249A>G	c.(1249-1251)Aat>Gat	p.N417D	DENND1A_ENST00000394215.2_Missense_Mutation_p.N387D|DENND1A_ENST00000394219.3_Missense_Mutation_p.N385D|DENND1A_ENST00000542603.1_Missense_Mutation_p.N159D|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000373620.3_Missense_Mutation_p.N417D|DENND1A_ENST00000373618.1_Missense_Mutation_p.N385D	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	417					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						TTTACAGTATTCAGAATTGCT	0.413																																					p.N417D		Atlas-SNP	.											.	DENND1A	112	.	0			c.A1249G						PASS	.						173.0	152.0	159.0					9																	126214605		2203	4300	6503	SO:0001583	missense	57706	exon17			CAGTATTCAGAAT	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1249A>G	chr9.hg19:g.126214605T>C	ENSP00000362727:p.Asn417Asp	112.0	0.0	.		79.0	5.0	.	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	hg19	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369121	0.82463	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T;T	0.25085	3.28;1.82;3.18;3.32;3.17;3.19	5.47	5.47	0.80525	.	0.093202	0.64402	D	0.000001	T	0.54775	0.1879	M	0.83012	2.62	0.54753	D	0.99998	D;D;D;D;D;D;D	0.76494	0.975;0.975;0.984;0.999;0.984;0.958;0.996	P;P;P;D;P;P;P	0.77557	0.883;0.883;0.84;0.99;0.879;0.767;0.877	T	0.60722	-0.7207	10	0.59425	D	0.04	-17.7065	15.5608	0.76244	0.0:0.0:0.0:1.0	.	385;375;385;387;417;417;237	Q8TEH3-6;Q8TEH3-7;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3;Q9HCG4	.;.;.;.;.;DEN1A_HUMAN;.	D	417;159;385;417;387;385	ENSP00000362727:N417D;ENSP00000437457:N159D;ENSP00000377766:N385D;ENSP00000362722:N417D;ENSP00000377763:N387D;ENSP00000362720:N385D	ENSP00000362720:N385D	N	-	1	0	DENND1A	125254426	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.570000	0.67398	2.076000	0.62316	0.459000	0.35465	AAT	.	.	.	none		0.413	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
CUBN	8029	hgsc.bcm.edu	37	10	16943441	16943441	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr10:16943441T>C	ENST00000377833.4	-	52	8145	c.8080A>G	c.(8080-8082)Ata>Gta	p.I2694V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2694	CUB 20. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGTCACCTATCTGTATTCCG	0.443																																					p.I2694V		Atlas-SNP	.											.	CUBN	515	.	0			c.A8080G						PASS	.						130.0	105.0	114.0					10																	16943441		2203	4300	6503	SO:0001583	missense	8029	exon52			CACCTATCTGTAT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8080A>G	chr10.hg19:g.16943441T>C	ENSP00000367064:p.Ile2694Val	88.0	0.0	.		92.0	53.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	6.883	0.532398	0.13127	.	.	ENSG00000107611	ENST00000377833	T	0.17528	2.27	5.63	0.664	0.17890	CUB (5);	0.936616	0.08810	N	0.890473	T	0.08313	0.0207	N	0.17594	0.5	0.32205	N	0.577314	B	0.18310	0.027	B	0.21708	0.036	T	0.42085	-0.9472	10	0.22109	T	0.4	.	0.1187	0.00063	0.2416:0.2042:0.2266:0.3276	.	2694	O60494	CUBN_HUMAN	V	2694	ENSP00000367064:I2694V	ENSP00000367064:I2694V	I	-	1	0	CUBN	16983447	0.835000	0.29415	0.056000	0.19401	0.756000	0.42949	1.368000	0.34216	-0.064000	0.13043	0.477000	0.44152	ATA	.	.	.	none		0.443	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
NRG3	10718	hgsc.bcm.edu	37	10	83635770	83635770	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr10:83635770C>A	ENST00000404547.1	+	1	674	c.674C>A	c.(673-675)cCt>cAt	p.P225H	NRG3_ENST00000372142.2_5'Flank|NRG3_ENST00000556918.1_5'Flank|NRG3_ENST00000372141.2_Missense_Mutation_p.P225H|NRG3_ENST00000404576.2_5'Flank			P56975	NRG3_HUMAN	neuregulin 3	225	Ser/Thr-rich.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CCCTCCTGGCCTACTGCGGCA	0.617																																					p.P225H		Atlas-SNP	.											.	NRG3	301	.	0			c.C674A						PASS	.						101.0	80.0	87.0					10																	83635770		2203	4300	6503	SO:0001583	missense	10718	exon1			CCTGGCCTACTGC	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.674C>A	chr10.hg19:g.83635770C>A	ENSP00000384796:p.Pro225His	77.0	0.0	.		58.0	28.0	.	NM_001165972	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	hg19	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.273875	0.59649	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287	T;T	0.33438	1.41;1.43	3.89	3.89	0.44902	.	0.000000	0.45361	D	0.000364	T	0.44074	0.1276	L	0.40543	1.245	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66847	0.947;0.947	T	0.44050	-0.9353	10	0.87932	D	0	-21.024	13.7841	0.63099	0.0:1.0:0.0:0.0	.	225;225	B9EGV5;P56975-4	.;.	H	225	ENSP00000361214:P225H;ENSP00000384796:P225H	ENSP00000361214:P225H	P	+	2	0	NRG3	83625750	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.474000	0.66781	2.186000	0.69663	0.549000	0.68633	CCT	.	.	.	none		0.617	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
EPS8L2	64787	hgsc.bcm.edu	37	11	723296	723296	+	Nonsense_Mutation	SNP	C	C	A	rs142895363		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr11:723296C>A	ENST00000533256.1	+	16	1772	c.1397C>A	c.(1396-1398)tCa>tAa	p.S466*	EPS8L2_ENST00000526198.1_Nonsense_Mutation_p.S482*|EPS8L2_ENST00000318562.8_Nonsense_Mutation_p.S466*|EPS8L2_ENST00000530636.1_Nonsense_Mutation_p.S466*|AP006621.9_ENST00000527021.2_RNA			Q9H6S3	ES8L2_HUMAN	EPS8-like 2	466					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGCCCCACTTCAGAGCCCACC	0.602											OREG0020659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S466X		Atlas-SNP	.											.	EPS8L2	42	.	0			c.C1397A						PASS	.						85.0	84.0	85.0					11																	723296		2203	4300	6503	SO:0001587	stop_gained	64787	exon15			CCACTTCAGAGCC	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.1397C>A	chr11.hg19:g.723296C>A	ENSP00000435585:p.Ser466*	184.0	0.0	.	590	134.0	59.0	.	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Nonsense_Mutation	SNP	ENST00000533256.1	hg19	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	c	34	5.392509	0.96009	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	.	.	.	2.79	1.87	0.25490	.	3.938280	0.01227	U	0.008254	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.7601	7.8157	0.29258	0.0:0.868:0.0:0.132	.	.	.	.	X	466;466;466;482	.	ENSP00000320828:S466X	S	+	2	0	EPS8L2	713296	0.002000	0.14202	0.005000	0.12908	0.020000	0.10135	0.499000	0.22546	0.538000	0.28769	-0.642000	0.03964	TCA	.	C|0.999;T|0.001	.	alt		0.602	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	
TRIM51	84767	hgsc.bcm.edu	37	11	55658774	55658774	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr11:55658774A>G	ENST00000449290.2	+	7	1117	c.1025A>G	c.(1024-1026)tAt>tGt	p.Y342C	TRIM51_ENST00000244891.3_Missense_Mutation_p.Y199C	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	342	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										GGCAAATATTATTGGGAGGTT	0.423																																					p.Y342C		Atlas-SNP	.											.	.	.	.	0			c.A1025G						PASS	.						82.0	88.0	86.0					11																	55658774		2101	4042	6143	SO:0001583	missense	84767	exon7			AATATTATTGGGA	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.1025A>G	chr11.hg19:g.55658774A>G	ENSP00000395086:p.Tyr342Cys	80.0	0.0	.		125.0	56.0	.	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	hg19		.	.	.	.	.	.	.	.	.	.	.	14.48	2.548928	0.45383	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.74947	-0.89;-0.89	1.36	1.36	0.22044	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.85561	0.5725	M	0.89715	3.055	0.27185	N	0.960562	D	0.89917	1.0	D	0.97110	1.0	T	0.73235	-0.4047	9	0.87932	D	0	.	5.1325	0.14917	1.0:0.0:0.0:0.0	.	342	Q9BSJ1	SPRY5_HUMAN	C	342;199	ENSP00000395086:Y342C;ENSP00000244891:Y199C	ENSP00000244891:Y199C	Y	+	2	0	SPRYD5	55415350	1.000000	0.71417	0.075000	0.20258	0.398000	0.30690	3.446000	0.52928	0.540000	0.28808	0.136000	0.15936	TAT	.	.	.	none		0.423	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
B3GNT1	11041	hgsc.bcm.edu	37	11	66114291	66114291	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr11:66114291T>A	ENST00000311181.4	-	1	872	c.726A>T	c.(724-726)gaA>gaT	p.E242D	BRMS1_ENST00000425825.2_5'Flank|BRMS1_ENST00000359957.3_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	242					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						GATCCAGCATTTCCCGCAGGC	0.612																																					p.E242D		Atlas-SNP	.											.	B3GNT1	28	.	0			c.A726T						PASS	.						75.0	79.0	78.0					11																	66114291		2200	4295	6495	SO:0001583	missense	11041	exon1			CAGCATTTCCCGC	AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.726A>T	chr11.hg19:g.66114291T>A	ENSP00000309096:p.Glu242Asp	240.0	0.0	.		169.0	82.0	.	NM_006876	Q4TTN0	Missense_Mutation	SNP	ENST00000311181.4	hg19	CCDS8136.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.322423	0.23994	.	.	ENSG00000174684	ENST00000311181;ENST00000538757	T	0.22539	1.95	5.29	0.868	0.19090	.	0.396932	0.27876	N	0.017483	T	0.08044	0.0201	N	0.10837	0.055	0.28440	N	0.916866	B	0.13145	0.007	B	0.15052	0.012	T	0.31420	-0.9944	10	0.15066	T	0.55	-16.142	4.6684	0.12676	0.0:0.3853:0.1676:0.4471	.	242	O43505	B3GN1_HUMAN	D	242;13	ENSP00000309096:E242D	ENSP00000309096:E242D	E	-	3	2	B3GNT1	65870867	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	0.024000	0.13555	0.256000	0.21614	0.379000	0.24179	GAA	.	.	.	none		0.612	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392959.1	NM_006876	
PICALM	8301	hgsc.bcm.edu	37	11	85722090	85722090	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr11:85722090A>G	ENST00000393346.3	-	7	896	c.748T>C	c.(748-750)Ttc>Ctc	p.F250L	PICALM_ENST00000526033.1_Missense_Mutation_p.F250L|PICALM_ENST00000532317.1_Missense_Mutation_p.F250L|PICALM_ENST00000356360.5_Missense_Mutation_p.F250L|PICALM_ENST00000528398.1_Missense_Mutation_p.F199L			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	250	Interaction with FAM64A.				axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				ACTTTGAGGAACTCTGAGATT	0.343			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.F250L		Atlas-SNP	.		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	PICALM	82	.	0			c.T748C						PASS	.						128.0	112.0	118.0					11																	85722090		2202	4298	6500	SO:0001583	missense	8301	exon7			TGAGGAACTCTGA	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.748T>C	chr11.hg19:g.85722090A>G	ENSP00000377015:p.Phe250Leu	18.0	0.0	.		30.0	18.0	.	NM_007166	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	ENST00000393346.3	hg19	CCDS8272.1	.	.	.	.	.	.	.	.	.	.	A	34	5.324333	0.95708	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.48	5.48	0.80851	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.76248	0.3961	M	0.87617	2.895	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.991;1.0	D;D;D;D	0.97110	0.994;1.0;0.981;1.0	T	0.80236	-0.1466	9	.	.	.	-19.6257	15.8605	0.79017	1.0:0.0:0.0:0.0	.	199;250;250;250	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	L	250;250;250;250;199;250	ENSP00000436958:F250L;ENSP00000433846:F250L;ENSP00000377015:F250L;ENSP00000434884:F199L;ENSP00000348718:F250L	.	F	-	1	0	PICALM	85399738	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.197000	0.70478	0.533000	0.62120	TTC	.	.	.	none		0.343	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392224.1	NM_007166	
FAT3	120114	hgsc.bcm.edu	37	11	92590392	92590392	+	Missense_Mutation	SNP	C	C	T	rs368909373		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr11:92590392C>T	ENST00000298047.6	+	19	11395	c.11378C>T	c.(11377-11379)cCg>cTg	p.P3793L	FAT3_ENST00000409404.2_Missense_Mutation_p.P3793L|FAT3_ENST00000525166.1_Missense_Mutation_p.P3643L|FAT3_ENST00000533797.1_Missense_Mutation_p.P128L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3793					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGACTGTGTCCGGGGTCCAAC	0.527										TCGA Ovarian(4;0.039)																											p.P3793L		Atlas-SNP	.											.	FAT3	1822	.	0			c.C11378T						PASS	.	C	LEU/PRO	2,4000		0,2,1999	103.0	106.0	105.0		11378	5.9	0.9	11		105	0,8334		0,0,4167	no	missense	FAT3	NM_001008781.2	98	0,2,6166	TT,TC,CC		0.0,0.05,0.0162	benign	3793/4558	92590392	2,12334	2001	4167	6168	SO:0001583	missense	120114	exon19			TGTGTCCGGGGTC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11378C>T	chr11.hg19:g.92590392C>T	ENSP00000298047:p.Pro3793Leu	168.0	0.0	.		113.0	51.0	.	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	C	20.7	4.040675	0.75732	5.0E-4	0.0	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.95	5.95	0.96441	.	.	.	.	.	T	0.34832	0.0911	L	0.53249	1.67	0.80722	D	1	D;B	0.59357	0.985;0.399	B;B	0.41271	0.352;0.04	T	0.13045	-1.0524	9	0.51188	T	0.08	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	3793;3793	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	L	3793;3793;3643;128	ENSP00000298047:P3793L;ENSP00000387040:P3793L;ENSP00000432586:P3643L;ENSP00000436399:P128L	ENSP00000298047:P3793L	P	+	2	0	FAT3	92230040	0.995000	0.38212	0.922000	0.36590	0.908000	0.53690	6.655000	0.74392	2.824000	0.97209	0.655000	0.94253	CCG	.	.	.	weak		0.527	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
PPFIBP1	8496	hgsc.bcm.edu	37	12	27787953	27787953	+	Silent	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr12:27787953T>C	ENST00000318304.8	+	4	458	c.175T>C	c.(175-177)Tta>Cta	p.L59L	PPFIBP1_ENST00000545334.1_Silent_p.L59L|PPFIBP1_ENST00000228425.6_Silent_p.L59L|PPFIBP1_ENST00000542629.1_Silent_p.L59L|PPFIBP1_ENST00000537927.1_Intron|PPFIBP1_ENST00000535047.1_Silent_p.L59L	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	59					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					GCGTGGATTGTTAGAGATGAT	0.458																																					p.L59L		Atlas-SNP	.											.	PPFIBP1	153	.	0			c.T175C						PASS	.						108.0	110.0	110.0					12																	27787953		2203	4300	6503	SO:0001819	synonymous_variant	8496	exon4			GGATTGTTAGAGA	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.175T>C	chr12.hg19:g.27787953T>C		112.0	0.0	.		103.0	46.0	.	NM_003622	O75336|Q86X70|Q9NY03|Q9ULJ0	Silent	SNP	ENST00000318304.8	hg19	CCDS55812.1																																																																																			.	.	.	none		0.458	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
ARF3	377	hgsc.bcm.edu	37	12	49333834	49333834	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr12:49333834C>G	ENST00000256682.4	-	3	539	c.205G>C	c.(205-207)Ggt>Cgt	p.G69R	ARF3_ENST00000541959.1_Missense_Mutation_p.G69R|AC073610.5_ENST00000537495.1_5'Flank|ARF3_ENST00000541967.1_5'Flank|RP11-302B13.5_ENST00000398092.4_Missense_Mutation_p.G69R|ARF3_ENST00000447318.2_Intron	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3	69					GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						TCCTGGCCACCCACATCCCAC	0.502																																					p.G69R	Pancreas(189;1862 2134 4419 30933 49364)	Atlas-SNP	.											.	ARF3	11	.	0			c.G205C						PASS	.						198.0	158.0	171.0					12																	49333834		2203	4300	6503	SO:0001583	missense	377	exon3			GGCCACCCACATC	M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.205G>C	chr12.hg19:g.49333834C>G	ENSP00000256682:p.Gly69Arg	182.0	0.0	.		101.0	41.0	.	NM_001659	A8K6G8|B7ZB63|P16587	Missense_Mutation	SNP	ENST00000256682.4	hg19	CCDS8774.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243385	0.58995	.	.	ENSG00000134287	ENST00000398092;ENST00000256682;ENST00000541959;ENST00000541236	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	4.72	3.82	0.43975	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	H	0.99887	4.895	0.80722	D	1	D	0.67145	0.996	D	0.70716	0.97	D	0.97028	0.9748	10	0.87932	D	0	.	13.5059	0.61483	0.1577:0.8423:0.0:0.0	.	69	P61204	ARF3_HUMAN	R	69	ENSP00000438507:G69R;ENSP00000256682:G69R;ENSP00000438510:G69R;ENSP00000438063:G69R	ENSP00000256682:G69R	G	-	1	0	ARF3	47620101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	1.096000	0.41439	0.462000	0.41574	GGT	.	.	.	none		0.502	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258242.2	NM_001659	
MBD6	114785	hgsc.bcm.edu	37	12	57920964	57920964	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr12:57920964C>T	ENST00000355673.3	+	7	2392	c.2036C>T	c.(2035-2037)gCg>gTg	p.A679V	MBD6_ENST00000431731.2_Missense_Mutation_p.A679V	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	679	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						TTAAATTCTGCGCTGCTGGCT	0.597																																					p.A679V		Atlas-SNP	.											.	MBD6	99	.	0			c.C2036T						PASS	.						11.0	12.0	12.0					12																	57920964		2195	4290	6485	SO:0001583	missense	114785	exon7			ATTCTGCGCTGCT	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2036C>T	chr12.hg19:g.57920964C>T	ENSP00000347896:p.Ala679Val	35.0	0.0	.		18.0	13.0	.	NM_052897	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	ENST00000355673.3	hg19	CCDS8944.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.737980	0.49045	.	.	ENSG00000166987	ENST00000355673;ENST00000431731;ENST00000300263	.	.	.	5.2	4.32	0.51571	.	0.738053	0.11966	N	0.512271	T	0.26011	0.0634	N	0.08118	0	0.41634	D	0.989031	P;P	0.45428	0.858;0.675	B;B	0.32928	0.109;0.155	T	0.14643	-1.0465	9	0.66056	D	0.02	-3.2719	12.8722	0.57970	0.0:0.9201:0.0:0.0799	.	679;679	Q6P0P0;Q96DN6	.;MBD6_HUMAN	V	679;679;143	.	ENSP00000300263:A143V	A	+	2	0	MBD6	56207231	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.754000	0.47532	1.350000	0.45770	0.561000	0.74099	GCG	.	.	.	none		0.597	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407250.1		
MED13L	23389	hgsc.bcm.edu	37	12	116429670	116429670	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr12:116429670G>C	ENST00000281928.3	-	17	3295	c.3089C>G	c.(3088-3090)gCc>gGc	p.A1030G		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1030						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		ACTATTGCTGGCTGGGGCAGC	0.572																																					p.A1030G		Atlas-SNP	.											.	MED13L	193	.	0			c.C3089G						PASS	.						63.0	55.0	58.0					12																	116429670		2203	4300	6503	SO:0001583	missense	23389	exon17			TTGCTGGCTGGGG	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3089C>G	chr12.hg19:g.116429670G>C	ENSP00000281928:p.Ala1030Gly	79.0	0.0	.		77.0	35.0	.	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	hg19	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582626	0.46006	.	.	ENSG00000123066	ENST00000281928	T	0.75260	-0.92	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.75019	0.3793	L	0.36672	1.1	0.49915	D	0.999835	D	0.58268	0.982	P	0.49999	0.628	T	0.75639	-0.3248	10	0.51188	T	0.08	.	19.6873	0.95984	0.0:0.0:1.0:0.0	.	1030	Q71F56	MD13L_HUMAN	G	1030	ENSP00000281928:A1030G	ENSP00000281928:A1030G	A	-	2	0	MED13L	114914053	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.549000	0.67261	2.890000	0.99128	0.585000	0.79938	GCC	.	.	.	none		0.572	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
STARD13	90627	hgsc.bcm.edu	37	13	33700266	33700266	+	Missense_Mutation	SNP	T	T	G	rs143789881		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr13:33700266T>G	ENST00000336934.5	-	7	2150	c.2034A>C	c.(2032-2034)caA>caC	p.Q678H	STARD13_ENST00000255486.4_Missense_Mutation_p.Q670H|STARD13_ENST00000399365.3_Missense_Mutation_p.Q560H	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	678	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GCTGAATACTTTGAGGCAGGG	0.542																																					p.Q678H		Atlas-SNP	.											.	STARD13	100	.	0			c.A2034C						PASS	.						174.0	146.0	156.0					13																	33700266		2203	4300	6503	SO:0001583	missense	90627	exon7			AATACTTTGAGGC	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.2034A>C	chr13.hg19:g.33700266T>G	ENSP00000338785:p.Gln678His	210.0	0.0	.		185.0	91.0	.	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	hg19	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.399557	0.42512	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.18502	2.21;2.21;2.21	6.17	2.43	0.29744	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.120228	0.64402	D	0.000011	T	0.25827	0.0629	L	0.51914	1.62	0.80722	D	1	D;B;B	0.53745	0.962;0.048;0.129	P;B;B	0.58928	0.848;0.193;0.084	T	0.00970	-1.1496	10	0.40728	T	0.16	.	7.0057	0.24836	0.112:0.6413:0.0:0.2467	.	643;678;670	Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;STA13_HUMAN;.	H	560;670;678;670	ENSP00000382300:Q560H;ENSP00000255486:Q670H;ENSP00000338785:Q678H	ENSP00000255486:Q670H	Q	-	3	2	STARD13	32598266	0.993000	0.37304	0.981000	0.43875	0.797000	0.45037	0.424000	0.21330	0.174000	0.19809	-1.082000	0.02213	CAA	.	T|1.000;C|0.000	.	alt		0.542	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
SLC38A6	145389	hgsc.bcm.edu	37	14	61449295	61449295	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr14:61449295A>C	ENST00000267488.4	+	2	291	c.175A>C	c.(175-177)Atg>Ctg	p.M59L	SLC38A6_ENST00000456840.2_Missense_Mutation_p.M36L|SLC38A6_ENST00000554304.1_3'UTR|SLC38A6_ENST00000354886.2_Missense_Mutation_p.M59L|TRMT5_ENST00000261249.6_5'Flank|RP11-193F5.1_ENST00000553946.1_RNA	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	59					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		GAATGCCATCATGGGAAGTGG	0.368																																					p.M59L		Atlas-SNP	.											.	SLC38A6	87	.	0			c.A175C						PASS	.						209.0	187.0	195.0					14																	61449295		2203	4300	6503	SO:0001583	missense	145389	exon2			GCCATCATGGGAA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000267488.4:c.175A>C	chr14.hg19:g.61449295A>C	ENSP00000267488:p.Met59Leu	110.0	0.0	.		102.0	48.0	.	NM_153811	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000267488.4	hg19	CCDS9751.1	.	.	.	.	.	.	.	.	.	.	A	18.58	3.655540	0.67586	.	.	ENSG00000139974	ENST00000354886;ENST00000267488;ENST00000451406;ENST00000456840;ENST00000526105	T;T;T;T;T	0.02121	4.44;4.44;4.44;4.44;4.44	5.63	5.63	0.86233	.	0.149549	0.85682	D	0.000000	T	0.02929	0.0087	L	0.35542	1.07	0.54753	D	0.999988	B;B;B	0.14012	0.009;0.004;0.006	B;B;B	0.15052	0.005;0.01;0.012	T	0.55398	-0.8147	10	0.35671	T	0.21	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	36;59;59	E7ETF2;Q8IZM9-2;Q8IZM9	.;.;S38A6_HUMAN	L	59;59;54;36;5	ENSP00000346959:M59L;ENSP00000267488:M59L;ENSP00000395851:M54L;ENSP00000413863:M36L;ENSP00000451244:M5L	ENSP00000267488:M59L	M	+	1	0	SLC38A6	60519048	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.794000	0.75135	2.263000	0.75096	0.533000	0.62120	ATG	.	.	.	none		0.368	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1		
ADAD2	161931	hgsc.bcm.edu	37	16	84228944	84228944	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr16:84228944T>A	ENST00000315906.5	+	5	828	c.776T>A	c.(775-777)cTg>cAg	p.L259Q	RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.L341Q|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	259					RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ATCTACAAGCTGGTGGCTCTG	0.677																																					p.L341Q		Atlas-SNP	.											.	ADAD2	46	.	0			c.T1022A						PASS	.						13.0	15.0	15.0					16																	84228944		2167	4266	6433	SO:0001583	missense	161931	exon6			ACAAGCTGGTGGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.776T>A	chr16.hg19:g.84228944T>A	ENSP00000325153:p.Leu259Gln	59.0	0.0	.		28.0	11.0	.	NM_139174	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	hg19	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937894	0.52972	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.19938	2.11;2.12	5.22	5.22	0.72569	.	0.300709	0.27618	N	0.018561	T	0.39462	0.1079	L	0.49126	1.545	0.38021	D	0.934833	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.40059	-0.9583	10	0.87932	D	0	-12.5673	11.7794	0.52003	0.0:0.0:0.0:1.0	.	259;341	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	Q	259;341	ENSP00000325153:L259Q;ENSP00000268624:L341Q	ENSP00000268624:L341Q	L	+	2	0	ADAD2	82786445	1.000000	0.71417	0.881000	0.34555	0.081000	0.17604	5.029000	0.64121	2.088000	0.63022	0.528000	0.53228	CTG	.	.	.	none		0.677	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
SREBF1	6720	hgsc.bcm.edu	37	17	17721579	17721579	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr17:17721579T>C	ENST00000261646.5	-	6	1362	c.1178A>G	c.(1177-1179)aAa>aGa	p.K393R	SREBF1_ENST00000355815.4_Missense_Mutation_p.K423R|SREBF1_ENST00000395757.1_Missense_Mutation_p.K139R|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000435530.2_Missense_Mutation_p.K393R|SREBF1_ENST00000338854.5_Missense_Mutation_p.K393R	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	393	Interaction with LMNA. {ECO:0000250}.|Leucine-zipper.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CTCACTGCTTTTGTGGACAGC	0.567																																					p.K423R		Atlas-SNP	.											.	SREBF1	47	.	0			c.A1268G						PASS	.						126.0	105.0	112.0					17																	17721579		2203	4300	6503	SO:0001583	missense	6720	exon7			CTGCTTTTGTGGA	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1178A>G	chr17.hg19:g.17721579T>C	ENSP00000261646:p.Lys393Arg	124.0	0.0	.		102.0	27.0	.	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	hg19	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472206	0.84533	.	.	ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530	T;T;T;T;T	0.80738	0.37;0.4;0.4;0.88;-1.41	5.13	2.6	0.31112	Helix-loop-helix DNA-binding (2);	0.049203	0.85682	N	0.000000	D	0.83496	0.5267	L	0.50333	1.59	0.58432	D	0.999998	D;B;D;D	0.89917	0.998;0.402;1.0;1.0	D;B;D;D	0.91635	0.993;0.235;0.997;0.999	T	0.79674	-0.1705	10	0.51188	T	0.08	-4.0837	6.0908	0.19993	0.0:0.1068:0.1545:0.7388	.	393;369;393;423	B0I4X3;B0I4X4;P36956;P36956-4	.;.;SRBP1_HUMAN;.	R	393;423;393;139;230;319;393	ENSP00000345822:K393R;ENSP00000348069:K423R;ENSP00000261646:K393R;ENSP00000379106:K139R;ENSP00000413389:K393R	ENSP00000261646:K393R	K	-	2	0	SREBF1	17662304	0.997000	0.39634	0.970000	0.41538	0.899000	0.52679	2.228000	0.42981	0.187000	0.20147	0.459000	0.35465	AAA	.	.	.	none		0.567	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
ERBB2	2064	hgsc.bcm.edu	37	17	37880219	37880220	+	Missense_Mutation	DNP	TT	TT	CC	rs121913470|rs121913469		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr17:37880219_37880220TT>CC	ENST00000269571.5	+	19	2422_2423	c.2263_2264TT>CC	c.(2263-2265)TTg>CCg	p.L755P	ERBB2_ENST00000541774.1_Missense_Mutation_p.L740P|ERBB2_ENST00000445658.2_Missense_Mutation_p.L479P|ERBB2_ENST00000584601.1_Missense_Mutation_p.L725P|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725P|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725P|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755P			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CATCAAAGTGTTGAGGGAAAAC	0.53	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L755L|p.L755S		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,NS,carcinoma,-1,1|ERBB2,NS,carcinoma,0,20	ERBB2	429	.	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)	c.T2263C|c.T2264C						PASS	.																																			SO:0001583	missense	2064	exon19			AAAGTGTTGAGGG|AAGTGTTGAGGGA	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		Exception_encountered	chr17.hg19:g.37880219_37880220delinsCC	ENSP00000269571:p.Leu755Pro	89.0|88.0	0.0	.		74.0|71.0	48.0|45.0	.	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent|Missense_Mutation	SNP	ENST00000269571.5	hg19	CCDS32642.1																																																																																			.	.	.	alt|weak		0.530	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
MUC16	94025	hgsc.bcm.edu	37	19	9075468	9075468	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr19:9075468G>C	ENST00000397910.4	-	3	12181	c.11978C>G	c.(11977-11979)tCt>tGt	p.S3993C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3995	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTTGACATAGAAACTATTGC	0.488																																					p.S3993C		Atlas-SNP	.											MUC16_ENST00000397910,colon,carcinoma,0,2	MUC16	4315	.	0			c.C11978G						PASS	.						85.0	82.0	83.0					19																	9075468		2075	4186	6261	SO:0001583	missense	94025	exon3			GACATAGAAACTA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11978C>G	chr19.hg19:g.9075468G>C	ENSP00000381008:p.Ser3993Cys	43.0	0.0	.		46.0	2.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.284	-0.363940	0.05103	.	.	ENSG00000181143	ENST00000397910	T	0.39592	1.07	2.18	-1.2	0.09554	.	.	.	.	.	T	0.50257	0.1605	L	0.50333	1.59	.	.	.	D	0.89917	1.0	D	0.79108	0.992	T	0.55412	-0.8145	8	0.87932	D	0	.	4.9481	0.14000	0.5113:0.0:0.4887:0.0	.	3993	B5ME49	.	C	3993	ENSP00000381008:S3993C	ENSP00000381008:S3993C	S	-	2	0	MUC16	8936468	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.113000	0.10774	-0.220000	0.09988	0.313000	0.20887	TCT	.	.	.	none		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DMPK	1760	hgsc.bcm.edu	37	19	46281110	46281110	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr19:46281110C>T	ENST00000291270.4	-	7	822	c.697G>A	c.(697-699)Ggc>Agc	p.G233S	DMPK_ENST00000354227.5_Missense_Mutation_p.G233S|DMPK_ENST00000458663.2_Missense_Mutation_p.G233S|DMPK_ENST00000447742.2_Missense_Mutation_p.G233S|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000343373.4_Missense_Mutation_p.G243S|DMPK_ENST00000600757.1_Missense_Mutation_p.G243S	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		TCTGGGGTGCCCACAGCCACC	0.692																																					p.G243S	Esophageal Squamous(35;307 869 9153 24033 28903)	Atlas-SNP	.											.	DMPK	74	.	0			c.G727A						PASS	.						34.0	38.0	37.0					19																	46281110		2200	4292	6492	SO:0001583	missense	1760	exon6			GGGTGCCCACAGC	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.697G>A	chr19.hg19:g.46281110C>T	ENSP00000291270:p.Gly233Ser	166.0	0.0	.		98.0	43.0	.	NM_001081563	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	ENST00000291270.4	hg19	CCDS12674.1	.	.	.	.	.	.	.	.	.	.	c	35	5.523740	0.96431	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	4.77	4.77	0.60923	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43747	D	0.000533	T	0.80929	0.4718	H	0.95982	3.75	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;1.0;1.0;1.0;1.0	D	0.87078	0.2164	10	0.87932	D	0	.	15.3285	0.74186	0.0:1.0:0.0:0.0	.	233;233;259;233;233;233;280;243	Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;DMPK_HUMAN;.;.	S	233;259;233;233;233;243;243;233	ENSP00000401753:G233S;ENSP00000291270:G233S;ENSP00000413417:G233S;ENSP00000345997:G243S;ENSP00000346168:G233S	ENSP00000291270:G233S	G	-	1	0	DMPK	50972950	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.606000	0.82863	2.455000	0.83008	0.655000	0.94253	GGC	.	.	.	none		0.692	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460572.1	NM_004409	
NLRP2	55655	hgsc.bcm.edu	37	19	55494859	55494859	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr19:55494859C>T	ENST00000543010.1	+	6	1936	c.1793C>T	c.(1792-1794)aCg>aTg	p.T598M	NLRP2_ENST00000448584.2_Missense_Mutation_p.T598M|NLRP2_ENST00000538819.1_Missense_Mutation_p.T574M|NLRP2_ENST00000263437.6_Missense_Mutation_p.T595M|NLRP2_ENST00000537859.1_Missense_Mutation_p.T576M|NLRP2_ENST00000427260.2_Missense_Mutation_p.T575M|NLRP2_ENST00000391721.4_Missense_Mutation_p.T574M|NLRP2_ENST00000339757.7_Missense_Mutation_p.T576M	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	598					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GGACATTCAACGGTGACAGAC	0.537																																					p.T598M		Atlas-SNP	.											.	NLRP2	161	.	0			c.C1793T						PASS	.						107.0	92.0	97.0					19																	55494859		2203	4300	6503	SO:0001583	missense	55655	exon6			ATTCAACGGTGAC	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1793C>T	chr19.hg19:g.55494859C>T	ENSP00000445135:p.Thr598Met	95.0	0.0	.		84.0	39.0	.	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	hg19	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048824	0.36181	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.74842	-0.87;-0.78;-0.8;-0.87;-0.8;-0.88;-0.78;-0.87	1.94	-0.27	0.12926	.	.	.	.	.	T	0.72095	0.3418	L	0.40543	1.245	0.09310	N	1	D;D;D;D;D	0.63880	0.993;0.993;0.988;0.993;0.988	P;P;P;P;P	0.58391	0.749;0.838;0.693;0.838;0.693	T	0.59894	-0.7368	9	0.48119	T	0.1	.	4.2569	0.10721	0.0:0.6265:0.0:0.3735	.	575;576;595;574;598	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	M	598;574;576;598;576;575;574;595	ENSP00000445135:T598M;ENSP00000375601:T574M;ENSP00000344074:T576M;ENSP00000409370:T598M;ENSP00000440601:T576M;ENSP00000402474:T575M;ENSP00000441133:T574M;ENSP00000263437:T595M	ENSP00000263437:T595M	T	+	2	0	NLRP2	60186671	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.276000	0.08514	-0.000000	0.14550	0.561000	0.74099	ACG	.	.	.	none		0.537	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
SNX5	27131	hgsc.bcm.edu	37	20	17933351	17933351	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr20:17933351C>G	ENST00000377768.3	-	6	705	c.393G>C	c.(391-393)gaG>gaC	p.E131D	SNX5_ENST00000377759.4_Missense_Mutation_p.E131D|SNX5_ENST00000483485.1_5'UTR	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5	131	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						CAGCGAGATACTCACTGAAAA	0.453																																					p.E131D		Atlas-SNP	.											.	SNX5	38	.	0			c.G393C						PASS	.						53.0	47.0	49.0					20																	17933351		2203	4300	6503	SO:0001583	missense	27131	exon5			GAGATACTCACTG	AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953	ENST00000377768.3:c.393G>C	chr20.hg19:g.17933351C>G	ENSP00000366998:p.Glu131Asp	37.0	0.0	.		33.0	15.0	.	NM_014426	B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	Missense_Mutation	SNP	ENST00000377768.3	hg19	CCDS13130.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763778	0.49574	.	.	ENSG00000089006	ENST00000377768;ENST00000377759;ENST00000431277;ENST00000419004	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.66	-7.72	0.01250	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	M	0.68593	2.085	0.52099	D	0.999949	B;P	0.44006	0.435;0.824	B;P	0.48141	0.366;0.568	T	0.60311	-0.7288	10	0.38643	T	0.18	.	16.5172	0.84304	0.0:0.2582:0.0:0.7418	.	152;131	B7Z476;Q9Y5X3	.;SNX5_HUMAN	D	131;131;94;96	ENSP00000366998:E131D;ENSP00000366988:E131D;ENSP00000404448:E94D;ENSP00000406731:E96D	ENSP00000366988:E131D	E	-	3	2	SNX5	17881351	0.985000	0.35326	0.546000	0.28166	0.781000	0.44180	0.195000	0.17155	-1.620000	0.01564	-1.124000	0.02001	GAG	.	.	.	none		0.453	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078137.4		
NUDT10	170685	hgsc.bcm.edu	37	X	51075840	51075840	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chrX:51075840C>T	ENST00000376006.3	+	2	243	c.23C>T	c.(22-24)aCa>aTa	p.T8I	NUDT10_ENST00000356450.2_Missense_Mutation_p.T8I	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					CCCAACCAGACACGGACCTAC	0.677																																					p.T8I	NSCLC(90;1817 2035 37909 38249)	Atlas-SNP	.											.	NUDT10	28	.	0			c.C23T						PASS	.						48.0	36.0	40.0					X																	51075840		2203	4300	6503	SO:0001583	missense	170685	exon2			ACCAGACACGGAC	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.23C>T	chrX.hg19:g.51075840C>T	ENSP00000365174:p.Thr8Ile	94.0	0.0	.		68.0	12.0	.	NM_153183	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000376006.3	hg19	CCDS35278.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619529	0.46736	.	.	ENSG00000122824	ENST00000376006;ENST00000356450	T;T	0.41758	0.99;0.99	2.61	2.61	0.31194	NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	L	0.40543	1.245	0.38831	D	0.955848	B	0.06786	0.001	B	0.08055	0.003	T	0.39440	-0.9614	9	0.33141	T	0.24	-26.7854	10.5501	0.45083	0.0:1.0:0.0:0.0	.	8	Q8NFP7	NUD10_HUMAN	I	8	ENSP00000365174:T8I;ENSP00000348831:T8I	ENSP00000348831:T8I	T	+	2	0	NUDT10	51092580	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	4.938000	0.63519	1.602000	0.50124	0.429000	0.28392	ACA	.	.	.	none		0.677	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
NUDT11	55190	hgsc.bcm.edu	37	X	51239274	51239274	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chrX:51239274G>A	ENST00000375992.3	-	1	174	c.23C>T	c.(22-24)aCg>aTg	p.T8M		NM_018159.3	NP_060629.2	Q96G61	NUD11_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 11	8					inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	9	Ovarian(276;0.236)					GTAGGTCCGCGTCTGGTTGGG	0.682										HNSCC(48;0.14)																											p.T8M	GBM(38;198 791 1498 11752 13599)	Atlas-SNP	.											.	NUDT11	22	.	0			c.C23T						PASS	.						20.0	17.0	18.0					X																	51239274		2199	4298	6497	SO:0001583	missense	55190	exon1			GTCCGCGTCTGGT	AK001490	CCDS43952.1	Xp11.22-p11.1	2014-05-20			ENSG00000196368	ENSG00000196368		"""Nudix motif containing"""	18011	protein-coding gene	gene with protein product						12105228	Standard	NM_018159		Approved	DIPP3b, FLJ10628, hDIPP3beta	uc010njt.3	Q96G61	OTTHUMG00000021531	ENST00000375992.3:c.23C>T	chrX.hg19:g.51239274G>A	ENSP00000365160:p.Thr8Met	41.0	0.0	.		26.0	12.0	.	NM_018159	Q9NVN0	Missense_Mutation	SNP	ENST00000375992.3	hg19	CCDS43952.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134884	0.56828	.	.	ENSG00000196368	ENST00000375992	T	0.40756	1.02	3.0	2.01	0.26516	NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.36635	0.0974	M	0.70275	2.135	0.36766	D	0.883520	P	0.43750	0.816	B	0.37692	0.256	T	0.55270	-0.8167	9	0.48119	T	0.1	-26.7854	8.2508	0.31717	0.0:0.0:0.7647:0.2353	.	8	Q96G61	NUD11_HUMAN	M	8	ENSP00000365160:T8M	ENSP00000365160:T8M	T	-	2	0	NUDT11	51256014	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.357000	0.90088	1.514000	0.48869	0.544000	0.68410	ACG	.	.	.	none		0.682	NUDT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056579.1		
RGAG4	340526	hgsc.bcm.edu	37	X	71351213	71351213	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chrX:71351213T>C	ENST00000545866.1	-	1	545	c.178A>G	c.(178-180)Ata>Gta	p.I60V	RGAG4_ENST00000609883.1_Missense_Mutation_p.I60V|NHSL2_ENST00000540800.1_Intron|NHSL2_ENST00000510661.1_5'Flank|NHSL2_ENST00000373677.1_5'Flank|NHSL2_ENST00000535692.1_5'Flank	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	60										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					ACGGGCACTATGGGTACTGGC	0.617													T|||	3	0.000794702	0.0	0.0043	3775	,	,		8298	0.0		0.0	False		,,,				2504	0.0				p.I60V		Atlas-SNP	.											.	RGAG4	63	.	0			c.A178G						PASS	.						49.0	52.0	52.0					X																	71351213		1948	4125	6073	SO:0001583	missense	340526	exon1			GCACTATGGGTAC	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.178A>G	chrX.hg19:g.71351213T>C	ENSP00000441366:p.Ile60Val	190.0	0.0	.		118.0	53.0	.	NM_001024455	A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	ENST00000545866.1	hg19	CCDS55446.1	.	.	.	.	.	.	.	.	.	.	T	0.155	-1.087731	0.01873	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.12774	2.65;2.65	3.58	-1.73	0.08081	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43130	-0.9410	8	.	.	.	.	4.2089	0.10502	0.2097:0.5432:0.0:0.2471	.	60	Q5HYW3	RGAG4_HUMAN	V	60	ENSP00000441366:I60V;ENSP00000418667:I60V	.	I	-	1	0	RGAG4	71267938	0.096000	0.21769	0.004000	0.12327	0.666000	0.39218	-0.475000	0.06599	-0.475000	0.06852	-0.438000	0.05819	ATA	.	.	.	none		0.617	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057171.1	NM_001024455	
HOMER2	9455	hgsc.bcm.edu	37	15	83518619	83518620	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr15:83518619_83518620insT	ENST00000304231.8	-	9	1104_1105	c.912_913insA	c.(910-915)aaagtgfs	p.V305fs	HOMER2_ENST00000399166.2_Frame_Shift_Ins_p.V239fs|HOMER2_ENST00000426485.1_Frame_Shift_Ins_p.V250fs|HOMER2_ENST00000450735.2_Frame_Shift_Ins_p.V294fs	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	305					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						AAGGAACGCACTTTGTCTTCCA	0.505											OREG0023389	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V305fs		Atlas-INDEL	.											.	HOMER2	63	.	0			c.913_914insA						PASS	.																																			SO:0001589	frameshift_variant	9455	exon9			.	AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.913dupA	chr15.hg19:g.83518622_83518622dupT	ENSP00000305632:p.Val305fs	152.0	0.0	0	1222	112.0	53.0	0.473214	NM_199330	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Frame_Shift_Ins	INS	ENST00000304231.8	hg19	CCDS45334.1																																																																																			.	.	.	none		0.505	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418689.1		
WFDC10A	140832	hgsc.bcm.edu	37	20	44258534	44258534	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr20:44258534delA	ENST00000372643.3	+	1	370	c.82delA	c.(82-84)aggfs	p.R28fs	WFDC9_ENST00000326000.1_Intron	NM_080753.2	NP_542791.1	Q9H1F0	WF10A_HUMAN	WAP four-disulfide core domain 10A	28						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)	2		Myeloproliferative disorder(115;0.0122)				TGACAAGAAGAGGATGCAGAG	0.577											OREG0025983	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K27fs		Atlas-INDEL	.											.	WFDC10A	7	.	0			c.81delG						PASS	.						165.0	130.0	142.0					20																	44258534		2203	4300	6503	SO:0001589	frameshift_variant	140832	exon1			.	AL031671	CCDS13363.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000180305	ENSG00000180305		"""WAP four-disulfide core domain containing"""	16139	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 146"""	C20orf146		12206714	Standard	NM_080753		Approved	dJ688G8.3, WAP10	uc002xoz.3	Q9H1F0	OTTHUMG00000046331	ENST00000372643.3:c.82delA	chr20.hg19:g.44258534delA	ENSP00000361726:p.Arg28fs	53.0	0.0	0	922	49.0	20.0	0.408163	NM_080753	A2RRE9|Q5TGZ7	Frame_Shift_Del	DEL	ENST00000372643.3	hg19	CCDS13363.1																																																																																			.	.	.	none		0.577	WFDC10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106944.2		
TNRC6A	27327	hgsc.bcm.edu	37	16	24802526	24802526	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr16:24802526delG	ENST00000395799.3	+	6	2692	c.2563delG	c.(2563-2565)gatfs	p.D855fs	TNRC6A_ENST00000315183.7_Frame_Shift_Del_p.D855fs	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	855	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		TTCTGCCAGTGATAACTGGGG	0.478																																					p.S854fs		Atlas-INDEL	.											.	TNRC6A	171	.	0			c.2562delT						PASS	.						80.0	79.0	79.0					16																	24802526		2197	4300	6497	SO:0001589	frameshift_variant	27327	exon6			.	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2563delG	chr16.hg19:g.24802526delG	ENSP00000379144:p.Asp855fs	73.0	0.0	0		67.0	28.0	0.41791	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Frame_Shift_Del	DEL	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.	.	none		0.478	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
SAMD9	54809	hgsc.bcm.edu	37	7	92734994	92734994	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr7:92734994delT	ENST00000379958.2	-	3	686	c.417delA	c.(415-417)aaafs	p.K139fs		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	139						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGAGCTCAACTTTTAGTGACT	0.358																																					p.V140fs		Atlas-INDEL	.											.	SAMD9	239	.	0			c.418delG						PASS	.						124.0	134.0	130.0					7																	92734994		2203	4300	6503	SO:0001589	frameshift_variant	54809	exon2			.	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.417delA	chr7.hg19:g.92734994delT	ENSP00000369292:p.Lys139fs	102.0	0.0	0		113.0	50.0	0.442478	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Frame_Shift_Del	DEL	ENST00000379958.2	hg19	CCDS34680.1																																																																																			.	.	.	none		0.358	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
LRRC14	9684	hgsc.bcm.edu	37	8	145746824	145746825	+	Frame_Shift_Del	DEL	AT	AT	-	rs571447719		TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr8:145746824_145746825delAT	ENST00000292524.1	+	4	1590_1591	c.1444_1445delAT	c.(1444-1446)atcfs	p.I482fs	LRRC14_ENST00000529022.1_Frame_Shift_Del_p.I482fs	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	482										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GACCACGGACATCTACGGGCGA	0.589																																					p.481_482del		Atlas-INDEL	.											.	LRRC14	25	.	0			c.1443_1444del						PASS	.																																			SO:0001589	frameshift_variant	9684	exon5			.	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.1444_1445delAT	chr8.hg19:g.145746824_145746825delAT	ENSP00000292524:p.Ile482fs	88.0	0.0	0		47.0	23.0	0.489362	NM_001272036	A8K0A8|D3DWM8	Frame_Shift_Del	DEL	ENST00000292524.1	hg19	CCDS6432.1																																																																																			.	.	.	none		0.589	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
COL11A1	1301	hgsc.bcm.edu	37	1	103400626	103400626	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DW-7839-01A-11D-2136-08	TCGA-DW-7839-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d305b7d5-cbb1-41bf-8b2b-1cc2ba653c20	59a27c03-2a9d-4978-81e0-94d09e0e5d43	g.chr1:103400626delG	ENST00000370096.3	-	45	3794	c.3482delC	c.(3481-3483)cctfs	p.P1161fs	COL11A1_ENST00000358392.2_Frame_Shift_Del_p.P1173fs|COL11A1_ENST00000512756.1_Frame_Shift_Del_p.P1045fs|COL11A1_ENST00000353414.4_Frame_Shift_Del_p.P1122fs	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1161	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGCAATTCCAGGGGCACCAAC	0.448																																					p.P1173fs		Atlas-INDEL	.											.	COL11A1	972	.	0			c.3519delT						PASS	.						37.0	39.0	38.0					1																	103400626		2203	4300	6503	SO:0001589	frameshift_variant	1301	exon45			.	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3482delC	chr1.hg19:g.103400626delG	ENSP00000359114:p.Pro1161fs	43.0	0.0	0		48.0	18.0	0.375	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Frame_Shift_Del	DEL	ENST00000370096.3	hg19	CCDS778.1																																																																																			.	.	.	none		0.448	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
