#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP74	85452	hgsc.bcm.edu	37	1	1887063	1887063	+	IGR	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:1887063C>T								TMEM52 (36351 upstream) : C1orf222 (32499 downstream)																							CCCCTCAGCCCCCTGGAATGC	0.597																																					p.G748E		Atlas-SNP	.											KIAA1751,NS,carcinoma,0,1	KIAA1751	92	.	0			c.G2243A						PASS	.						61.0	67.0	65.0					1																	1887063		1913	4097	6010	SO:0001628	intergenic_variant	85452	exon18			TCAGCCCCCTGGA																													chr1.hg19:g.1887063C>T		149.0	0.0	.		149.0	38.0	.	NM_001080484		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	C	11.65	1.701128	0.30142	.	.	ENSG00000142609	ENST00000270720	.	.	.	1.45	-0.582	0.11709	.	0.105878	0.36665	N	0.002476	T	0.14657	0.0354	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.11329	0.006	T	0.11494	-1.0585	9	0.87932	D	0	.	3.7893	0.08713	0.0:0.5066:0.0:0.4934	.	748	Q9C0B2	K1751_HUMAN	E	748	.	ENSP00000270720:G748E	G	-	2	0	C1orf222	1876923	0.000000	0.05858	0.001000	0.08648	0.193000	0.23685	0.050000	0.14120	-0.199000	0.10317	0.462000	0.41574	GGG	.	.	.	none	0	0.597								
CAMTA1	23261	hgsc.bcm.edu	37	1	7721912	7721912	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:7721912G>C	ENST00000303635.7	+	8	998	c.791G>C	c.(790-792)tGc>tCc	p.C264S	CAMTA1_ENST00000439411.2_Missense_Mutation_p.C264S	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AACTGCCTCTGCACCGGCAGC	0.687			T	WWTR1	epitheliod hemangioendothelioma																																p.C264S		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.G791C						PASS	.						26.0	25.0	26.0					1																	7721912		2199	4298	6497	SO:0001583	missense	23261	exon8			GCCTCTGCACCGG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.791G>C	chr1.hg19:g.7721912G>C	ENSP00000306522:p.Cys264Ser	34.0	0.0	.		23.0	9.0	.	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	hg19	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	g	18.00	3.526318	0.64860	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.52526	0.66;0.66	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	L	0.58101	1.795	0.80722	D	1	B	0.32573	0.376	B	0.27380	0.079	T	0.38112	-0.9676	10	0.10902	T	0.67	-19.7455	18.2029	0.89844	0.0:0.0:1.0:0.0	.	264	Q9Y6Y1	CMTA1_HUMAN	S	264	ENSP00000306522:C264S;ENSP00000402561:C264S	ENSP00000306522:C264S	C	+	2	0	CAMTA1	7644499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.654000	0.98509	2.382000	0.81193	0.543000	0.68304	TGC	.	.	.	none		0.687	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
RERE	473	hgsc.bcm.edu	37	1	8424145	8424145	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:8424145T>A	ENST00000337907.3	-	16	2345	c.1711A>T	c.(1711-1713)Agc>Tgc	p.S571C	RERE_ENST00000377464.1_Missense_Mutation_p.S303C|RERE_ENST00000476556.1_Missense_Mutation_p.S17C|RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.S571C|RERE_ENST00000460659.1_5'Flank	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	571					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTCCTCATGCTATGCTTCCCA	0.602																																					p.S571C		Atlas-SNP	.											.	RERE	129	.	0			c.A1711T						PASS	.						76.0	65.0	69.0					1																	8424145		2203	4300	6503	SO:0001583	missense	473	exon16			TCATGCTATGCTT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1711A>T	chr1.hg19:g.8424145T>A	ENSP00000338629:p.Ser571Cys	84.0	0.0	.		100.0	42.0	.	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	hg19	CCDS95.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182080	0.78677	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T	0.06768	3.26;3.26;3.26	5.17	5.17	0.71159	.	.	.	.	.	T	0.26122	0.0637	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.00498	-1.1704	9	0.59425	D	0.04	-23.1488	14.3401	0.66619	0.0:0.0:0.0:1.0	.	303;571	B1AKN3;Q9P2R6	.;RERE_HUMAN	C	571;303;17;571	ENSP00000338629:S571C;ENSP00000366684:S303C;ENSP00000383700:S571C	ENSP00000338629:S571C	S	-	1	0	RERE	8346732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.520000	0.81821	2.171000	0.68590	0.459000	0.35465	AGC	.	.	.	none		0.602	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
HMGCL	3155	hgsc.bcm.edu	37	1	24147039	24147039	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:24147039A>C	ENST00000374490.3	-	2	148	c.105T>G	c.(103-105)atT>atG	p.I35M	HMGCL_ENST00000509389.1_5'UTR|HMGCL_ENST00000436439.2_Missense_Mutation_p.I35M|HMGCL_ENST00000374483.4_Missense_Mutation_p.I10M	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	35					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		CAACTTCCACAATTTTCACCC	0.403																																					p.I35M		Atlas-SNP	.											.	HMGCL	22	.	0			c.T105G						PASS	.						159.0	141.0	147.0					1																	24147039		2203	4300	6503	SO:0001583	missense	3155	exon2			TTCCACAATTTTC	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.105T>G	chr1.hg19:g.24147039A>C	ENSP00000363614:p.Ile35Met	133.0	0.0	.		149.0	53.0	.	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	hg19	CCDS243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.82|14.82	2.650811|2.650811	0.47362|0.47362	.|.	.|.	ENSG00000117305|ENSG00000117305	ENST00000374490;ENST00000436439;ENST00000374483;ENST00000543166|ENST00000235958	D;D;D|.	0.98862|.	-5.19;-5.1;-5.19|.	5.27|5.27	0.302|0.302	0.15786|0.15786	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (1);|.	0.147080|.	0.64402|.	D|.	0.000011|.	T|T	0.30448|0.30448	0.0765|0.0765	N|N	0.08118|0.08118	0|0	0.41038|0.41038	D|D	0.985205|0.985205	P;B;B;B|.	0.37141|.	0.584;0.08;0.08;0.08|.	B;B;B;B|.	0.40741|.	0.338;0.339;0.232;0.339|.	T|T	0.04440|0.04440	-1.0951|-1.0951	10|5	0.66056|.	D|.	0.02|.	-0.2207|-0.2207	8.6087|8.6087	0.33789|0.33789	0.566:0.0:0.434:0.0|0.566:0.0:0.434:0.0	.|.	35;35;10;35|.	B4DUP4;Q6IBC0;B1AK13;P35914|.	.;.;.;HMGCL_HUMAN|.	M|W	35;35;10;10|31	ENSP00000363614:I35M;ENSP00000389281:I35M;ENSP00000363607:I10M|.	ENSP00000363607:I10M|.	I|L	-|-	3|2	3|0	HMGCL|HMGCL	24019626|24019626	0.519000|0.519000	0.26242|0.26242	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	-0.299000|-0.299000	0.08254|0.08254	0.132000|0.132000	0.18615|0.18615	-0.385000|-0.385000	0.06624|0.06624	ATT|TTG	.	.	.	none		0.403	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
PHACTR4	65979	hgsc.bcm.edu	37	1	28785697	28785697	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:28785697T>C	ENST00000373839.3	+	3	379	c.118T>C	c.(118-120)Ttt>Ctt	p.F40L	PHACTR4_ENST00000373836.3_Missense_Mutation_p.F50L|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	40					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		GTTCTCAGGCTTTGGCAAGAT	0.448																																					p.F50L		Atlas-SNP	.											.	PHACTR4	64	.	0			c.T148C						PASS	.						87.0	84.0	85.0					1																	28785697		1904	4119	6023	SO:0001583	missense	65979	exon2			TCAGGCTTTGGCA	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.118T>C	chr1.hg19:g.28785697T>C	ENSP00000362945:p.Phe40Leu	93.0	0.0	.		84.0	28.0	.	NM_023923	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	hg19	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.706660	0.48412	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.12465	2.68;2.69	5.28	5.28	0.74379	.	0.185233	0.48767	N	0.000178	T	0.06234	0.0161	N	0.04132	-0.27	0.36529	D	0.870593	B;B;B	0.14012	0.005;0.003;0.009	B;B;B	0.16722	0.009;0.004;0.016	T	0.13469	-1.0508	10	0.02654	T	1	-1.0711	14.6855	0.69047	0.0:0.0:0.0:1.0	.	50;40;24	Q8IZ21-2;Q8IZ21;Q8IZ21-3	.;PHAR4_HUMAN;.	L	40;50;39	ENSP00000362945:F40L;ENSP00000362942:F50L	ENSP00000362942:F50L	F	+	1	0	PHACTR4	28658284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.667000	0.37471	2.128000	0.65567	0.528000	0.53228	TTT	.	.	.	none		0.448	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
PUM1	9698	hgsc.bcm.edu	37	1	31406096	31406096	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:31406096A>T	ENST00000257075.5	-	22	3616	c.3523T>A	c.(3523-3525)Tta>Ata	p.L1175I	PUM1_ENST00000373747.3_Missense_Mutation_p.L1178I|PUM1_ENST00000440538.2_Missense_Mutation_p.L1151I|PUM1_ENST00000423018.2_Missense_Mutation_p.L1033I|PUM1_ENST00000424085.2_Missense_Mutation_p.L933I|PUM1_ENST00000373742.2_Missense_Mutation_p.L1116I|PUM1_ENST00000426105.2_Missense_Mutation_p.L1177I|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000373741.4_Missense_Mutation_p.L1213I	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	1175					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ATGGGCCCTAAGTCAACACCG	0.552																																					p.L1177I		Atlas-SNP	.											.	PUM1	107	.	0			c.T3529A						PASS	.						187.0	165.0	173.0					1																	31406096		2203	4300	6503	SO:0001583	missense	9698	exon22			GCCCTAAGTCAAC	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3523T>A	chr1.hg19:g.31406096A>T	ENSP00000257075:p.Leu1175Ile	178.0	0.0	.		162.0	63.0	.	NM_001020658	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	hg19	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.95|17.95	3.512828|3.512828	0.64522|0.64522	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000525843;ENST00000498419|ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	.|T;T;T;T;T;T;T;T	.|0.20332	.|2.14;2.08;2.34;2.34;2.42;2.33;2.44;2.1	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.34658|0.34658	0.0905|0.0905	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	.|D;B;B;B;B;P;B;D	.|0.67145	.|0.991;0.125;0.259;0.33;0.374;0.58;0.374;0.996	.|D;B;B;B;B;B;B;D	.|0.65773	.|0.938;0.076;0.076;0.159;0.168;0.183;0.168;0.913	T|T	0.14172|0.14172	-1.0482|-1.0482	6|10	.|0.51188	.|T	.|0.08	-3.3845|-3.3845	5.2679|5.2679	0.15609|0.15609	0.7814:0.0:0.2186:0.0|0.7814:0.0:0.2186:0.0	.|.	.|1116;1033;1213;1151;1175;1177;1178;1177	.|B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.|.;.;.;.;PUM1_HUMAN;.;.;.	H|I	1113;888|933;1175;1178;915;1177;1151;1213;1033;1116	.|ENSP00000400141:L933I;ENSP00000257075:L1175I;ENSP00000362852:L1178I;ENSP00000391723:L1177I;ENSP00000401777:L1151I;ENSP00000362846:L1213I;ENSP00000399440:L1033I;ENSP00000362847:L1116I	.|ENSP00000257075:L1175I	L|L	-|-	2|1	0|2	PUM1|PUM1	31178683|31178683	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.430000|1.430000	0.34914|0.34914	2.095000|2.095000	0.63458|0.63458	0.454000|0.454000	0.30748|0.30748	CTT|TTA	.	.	.	none		0.552	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
RBM15	64783	hgsc.bcm.edu	37	1	110883658	110883658	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:110883658C>G	ENST00000369784.3	+	1	2531	c.1631C>G	c.(1630-1632)aCt>aGt	p.T544S	RBM15_ENST00000602849.1_Missense_Mutation_p.T544S|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.T544S	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	544					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCCCTTGACTCATTATGAG	0.547			T	MKL1	acute megakaryocytic leukemia																																p.T544S		Atlas-SNP	.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15	93	.	0			c.C1631G						PASS	.						74.0	71.0	72.0					1																	110883658		2203	4300	6503	SO:0001583	missense	64783	exon1			CCTTGACTCATTA	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1631C>G	chr1.hg19:g.110883658C>G	ENSP00000358799:p.Thr544Ser	107.0	0.0	.		143.0	57.0	.	NM_022768	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	hg19	CCDS822.1	.	.	.	.	.	.	.	.	.	.	C	6.069	0.381059	0.11466	.	.	ENSG00000162775	ENST00000369784	T	0.15952	2.38	4.44	4.44	0.53790	.	0.000000	0.44688	D	0.000431	T	0.03915	0.0110	N	0.22421	0.69	0.27060	N	0.963566	B;B	0.24426	0.103;0.063	B;B	0.22386	0.039;0.017	T	0.31251	-0.9950	10	0.10636	T	0.68	-8.2962	13.8608	0.63559	0.0:0.8463:0.1537:0.0	.	544;544	Q96T37-3;Q96T37	.;RBM15_HUMAN	S	544	ENSP00000358799:T544S	ENSP00000358799:T544S	T	+	2	0	RBM15	110685181	0.985000	0.35326	1.000000	0.80357	0.993000	0.82548	2.270000	0.43355	2.306000	0.77630	0.655000	0.94253	ACT	.	.	.	none		0.547	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
ADCY10	55811	hgsc.bcm.edu	37	1	167870956	167870956	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:167870956T>A	ENST00000367851.4	-	5	564	c.380A>T	c.(379-381)cAt>cTt	p.H127L	ADCY10_ENST00000545172.1_Intron|ADCY10_ENST00000367848.1_Missense_Mutation_p.H35L	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	127	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAACAATCCATGGATCTCCAG	0.478																																					p.H127L		Atlas-SNP	.											.	ADCY10	175	.	0			c.A380T						PASS	.						170.0	167.0	168.0					1																	167870956		2203	4300	6503	SO:0001583	missense	55811	exon5			AATCCATGGATCT	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.380A>T	chr1.hg19:g.167870956T>A	ENSP00000356825:p.His127Leu	198.0	0.0	.		237.0	83.0	.	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	hg19	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.859754	0.71834	.	.	ENSG00000143199	ENST00000367851;ENST00000367848	T;T	0.78003	-1.14;1.49	5.76	5.76	0.90799	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.177315	0.39985	N	0.001214	T	0.67468	0.2896	L	0.27053	0.805	0.35716	D	0.816771	D;D	0.61697	0.988;0.99	P;P	0.62491	0.844;0.903	T	0.66666	-0.5866	9	0.11794	T	0.64	-17.7472	12.4728	0.55797	0.0:0.0:0.0:1.0	.	35;127	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	L	127;35	ENSP00000356825:H127L;ENSP00000356822:H35L	ENSP00000356822:H35L	H	-	2	0	ADCY10	166137580	1.000000	0.71417	0.922000	0.36590	0.701000	0.40568	4.710000	0.61873	2.193000	0.70182	0.450000	0.29827	CAT	.	.	.	none		0.478	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
IKBKE	9641	hgsc.bcm.edu	37	1	206651658	206651658	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:206651658A>G	ENST00000367120.3	+	9	1341	c.968A>G	c.(967-969)cAc>cGc	p.H323R	IKBKE_ENST00000537984.1_Missense_Mutation_p.H238R	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	323					immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					GTCCTGCACCACATCTATATC	0.572																																					p.H323R		Atlas-SNP	.											.	IKBKE	77	.	0			c.A968G						PASS	.						201.0	170.0	181.0					1																	206651658		2203	4300	6503	SO:0001583	missense	9641	exon9			TGCACCACATCTA	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.968A>G	chr1.hg19:g.206651658A>G	ENSP00000356087:p.His323Arg	247.0	0.0	.		241.0	66.0	.	NM_001193322	D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	ENST00000367120.3	hg19	CCDS30996.1	.	.	.	.	.	.	.	.	.	.	a	6.092	0.385235	0.11524	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.62105	0.05;0.2	5.31	2.99	0.34606	.	0.288882	0.40818	N	0.001016	T	0.39226	0.1070	N	0.17474	0.49	0.23351	N	0.997852	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.18871	-1.0323	10	0.11182	T	0.66	-5.285	8.6511	0.34035	0.7589:0.0:0.2411:0.0	.	238;323	Q3B754;Q14164	.;IKKE_HUMAN	R	323;238	ENSP00000356087:H323R;ENSP00000444529:H238R	ENSP00000356087:H323R	H	+	2	0	IKBKE	204718281	0.715000	0.27946	0.538000	0.28064	0.720000	0.41350	1.322000	0.33689	0.345000	0.23873	0.454000	0.30748	CAC	.	.	.	none		0.572	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		
SYT14	255928	hgsc.bcm.edu	37	1	210267875	210267875	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr1:210267875T>C	ENST00000472886.1	+	5	665	c.651T>C	c.(649-651)agT>agC	p.S217S	SYT14_ENST00000534859.1_Silent_p.S217S|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000367019.1_Silent_p.S217S|SYT14_ENST00000367015.1_Silent_p.S179S|SYT14_ENST00000399639.2_Silent_p.S217S|SYT14_ENST00000537238.1_Silent_p.S179S|SYT14_ENST00000422431.1_Silent_p.S262S			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	217					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AAATAGAAAGTTTTCATAATA	0.393																																					p.S262S		Atlas-SNP	.											.	SYT14	89	.	0			c.T786C						PASS	.						82.0	81.0	81.0					1																	210267875		2203	4300	6503	SO:0001819	synonymous_variant	255928	exon6			AGAAAGTTTTCAT	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.651T>C	chr1.hg19:g.210267875T>C		71.0	0.0	.		66.0	26.0	.	NM_001146264	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Silent	SNP	ENST00000472886.1	hg19	CCDS31014.1																																																																																			.	.	.	none		0.393	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
SLC30A6	55676	hgsc.bcm.edu	37	2	32422810	32422810	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:32422810T>A	ENST00000282587.5	+	10	617	c.580T>A	c.(580-582)Ttc>Atc	p.F194I	SLC30A6_ENST00000406369.1_Missense_Mutation_p.F120I|SLC30A6_ENST00000538303.1_Missense_Mutation_p.F165I|SLC30A6_ENST00000357055.3_5'UTR|SLC30A6_ENST00000379343.2_Missense_Mutation_p.F234I|SLC30A6_ENST00000435660.1_Missense_Mutation_p.F194I	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	194					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TAGCAGTATCTTCCTTCCCCG	0.348																																					p.F234I		Atlas-SNP	.											.	SLC30A6	37	.	0			c.T700A						PASS	.						195.0	185.0	188.0					2																	32422810		2203	4300	6503	SO:0001583	missense	55676	exon11			AGTATCTTCCTTC	AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.580T>A	chr2.hg19:g.32422810T>A	ENSP00000282587:p.Phe194Ile	144.0	0.0	.		151.0	58.0	.	NM_001193513	A5YM45|B7Z901|Q8N5C9|Q96NC3	Missense_Mutation	SNP	ENST00000282587.5	hg19	CCDS1780.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.093791	0.76870	.	.	ENSG00000152683	ENST00000379343;ENST00000440718;ENST00000282587;ENST00000435660;ENST00000538303;ENST00000406369	T;T;T;T;T;T	0.62105	0.07;0.05;0.07;0.07;0.07;0.07	6.07	6.07	0.98685	.	0.101567	0.64402	D	0.000002	T	0.57051	0.2027	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.34399	0.367;0.452;0.202;0.31	B;B;B;B	0.40702	0.338;0.164;0.205;0.113	T	0.53457	-0.8436	10	0.23302	T	0.38	-14.6144	15.6102	0.76710	0.0:0.0:0.0:1.0	.	165;194;234;194	B7Z901;Q6NXT4-3;Q6NXT4-2;Q6NXT4	.;.;.;ZNT6_HUMAN	I	234;165;194;194;165;120	ENSP00000368648:F234I;ENSP00000393946:F165I;ENSP00000282587:F194I;ENSP00000399005:F194I;ENSP00000440678:F165I;ENSP00000384041:F120I	ENSP00000282587:F194I	F	+	1	0	SLC30A6	32276314	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.462000	0.66707	2.330000	0.79161	0.528000	0.53228	TTC	.	.	.	none		0.348	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250254.2		
MTIF2	4528	hgsc.bcm.edu	37	2	55470636	55470636	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:55470636A>G	ENST00000263629.4	-	12	1795	c.1480T>C	c.(1480-1482)Ttt>Ctt	p.F494L	MTIF2_ENST00000394600.3_Missense_Mutation_p.F494L|MTIF2_ENST00000403721.1_Missense_Mutation_p.F494L	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	494					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CTTTCTAAAAACCGTAGAATT	0.338																																					p.F494L		Atlas-SNP	.											.	MTIF2	64	.	0			c.T1480C						PASS	.						146.0	146.0	146.0					2																	55470636		2203	4300	6503	SO:0001583	missense	4528	exon12			CTAAAAACCGTAG	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1480T>C	chr2.hg19:g.55470636A>G	ENSP00000263629:p.Phe494Leu	145.0	0.0	.		145.0	48.0	.	NM_002453	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	hg19	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.584682	0.28268	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823	T;T;T;T	0.56275	0.47;0.47;0.47;1.05	5.6	5.6	0.85130	Translation initiation factor IF- 2, domain 3 (1);	0.270733	0.37577	N	0.002040	T	0.41766	0.1173	L	0.38175	1.15	0.42010	D	0.990935	B	0.02656	0.0	B	0.01281	0.0	T	0.33394	-0.9870	10	0.09084	T	0.74	-2.2567	15.7861	0.78304	1.0:0.0:0.0:0.0	.	494	P46199	IF2M_HUMAN	L	494;494;494;172	ENSP00000384481:F494L;ENSP00000263629:F494L;ENSP00000378099:F494L;ENSP00000403492:F172L	ENSP00000263629:F494L	F	-	1	0	MTIF2	55324140	1.000000	0.71417	0.207000	0.23584	0.007000	0.05969	6.152000	0.71812	2.136000	0.66102	0.533000	0.62120	TTT	.	.	.	none		0.338	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
USP34	9736	hgsc.bcm.edu	37	2	61493234	61493234	+	Silent	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:61493234C>T	ENST00000398571.2	-	42	5578	c.5502G>A	c.(5500-5502)aaG>aaA	p.K1834K		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1834					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTGATTTGCACTTTGGCTGTT	0.408																																					p.K1834K		Atlas-SNP	.											.	USP34	334	.	0			c.G5502A						PASS	.						123.0	111.0	115.0					2																	61493234		1848	4096	5944	SO:0001819	synonymous_variant	9736	exon42			TTTGCACTTTGGC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5502G>A	chr2.hg19:g.61493234C>T		67.0	0.0	.		82.0	33.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.	.	none		0.408	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
RAB3GAP1	22930	hgsc.bcm.edu	37	2	135891507	135891507	+	Missense_Mutation	SNP	A	A	G	rs578182809		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:135891507A>G	ENST00000264158.8	+	15	1446	c.1403A>G	c.(1402-1404)aAt>aGt	p.N468S	SNORA40_ENST00000385573.1_RNA|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.N468S|RAB3GAP1_ENST00000487003.1_3'UTR|ZRANB3_ENST00000412849.1_5'Flank|RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.N424S	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	468					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TGTATGATCAATTTTTACCAT	0.383													A|||	1	0.000199681	0.0008	0.0	5008	,	,		16221	0.0		0.0	False		,,,				2504	0.0				p.N468S		Atlas-SNP	.											RAB3GAP1,NS,carcinoma,0,1	RAB3GAP1	87	.	0			c.A1403G						PASS	.						134.0	133.0	133.0					2																	135891507		2203	4300	6503	SO:0001583	missense	22930	exon15			TGATCAATTTTTA	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.1403A>G	chr2.hg19:g.135891507A>G	ENSP00000264158:p.Asn468Ser	157.0	0.0	.		128.0	46.0	.	NM_001172435	A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	ENST00000264158.8	hg19	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421038	0.83559	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.48522	0.81;0.81;0.81	4.95	4.95	0.65309	.	0.043485	0.85682	D	0.000000	T	0.58337	0.2115	L	0.50333	1.59	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;P	0.63283	0.913;0.883	T	0.53570	-0.8420	10	0.22109	T	0.4	-20.1443	14.9142	0.70781	1.0:0.0:0.0:0.0	.	468;468	C9J837;Q15042	.;RB3GP_HUMAN	S	468;424;468	ENSP00000264158:N468S;ENSP00000444306:N424S;ENSP00000411418:N468S	ENSP00000264158:N468S	N	+	2	0	RAB3GAP1	135607977	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.127000	0.94417	1.992000	0.58205	0.482000	0.46254	AAT	.	.	.	none		0.383	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
ABTB1	80325	hgsc.bcm.edu	37	3	127396051	127396051	+	Silent	SNP	C	C	A	rs368024563		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:127396051C>A	ENST00000232744.8	+	8	770	c.684C>A	c.(682-684)atC>atA	p.I228I	ABTB1_ENST00000468137.1_Silent_p.I86I|ABTB1_ENST00000453791.2_Silent_p.I86I|ABTB1_ENST00000393363.3_Silent_p.I86I					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						TGCTGACCATCGAGCCCCCAC	0.682																																					p.I228I		Atlas-SNP	.											.	ABTB1	36	.	0			c.C684A						PASS	.						36.0	32.0	33.0					3																	127396051		2201	4297	6498	SO:0001819	synonymous_variant	80325	exon8			GACCATCGAGCCC	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.684C>A	chr3.hg19:g.127396051C>A		23.0	0.0	.		19.0	8.0	.	NM_172027		Silent	SNP	ENST00000232744.8	hg19	CCDS3045.1																																																																																			.	.	.	alt		0.682	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
LSG1	55341	hgsc.bcm.edu	37	3	194379786	194379786	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:194379786T>G	ENST00000265245.5	-	7	973	c.659A>C	c.(658-660)gAg>gCg	p.E220A		NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	220	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		ACTCCGCTGCTCAGCAGTCAG	0.458																																					p.E220A		Atlas-SNP	.											.	LSG1	38	.	0			c.A659C						PASS	.						160.0	168.0	165.0					3																	194379786		2203	4300	6503	SO:0001583	missense	55341	exon7			CGCTGCTCAGCAG		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.659A>C	chr3.hg19:g.194379786T>G	ENSP00000265245:p.Glu220Ala	263.0	0.0	.		265.0	96.0	.	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	hg19	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586546	0.66105	.	.	ENSG00000041802	ENST00000265245	D	0.91631	-2.88	6.17	2.65	0.31530	.	0.224693	0.45867	D	0.000326	D	0.88028	0.6327	L	0.35288	1.05	0.58432	D	0.999998	P	0.41498	0.752	P	0.46208	0.507	D	0.83890	0.0284	10	0.26408	T	0.33	.	9.937	0.41556	0.0:0.1846:0.0:0.8154	.	220	Q9H089	LSG1_HUMAN	A	220	ENSP00000265245:E220A	ENSP00000265245:E220A	E	-	2	0	LSG1	195861075	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	3.985000	0.56930	1.160000	0.42584	0.533000	0.62120	GAG	.	.	.	none		0.458	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
TFRC	7037	hgsc.bcm.edu	37	3	195782165	195782166	+	Missense_Mutation	DNP	TC	TC	AG			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr3:195782165_195782166TC>AG	ENST00000360110.4	-	17	1853_1854	c.1684_1685GA>CT	c.(1684-1686)GAt>CTt	p.D562L	TFRC_ENST00000535031.1_Missense_Mutation_p.D280L|TFRC_ENST00000420415.1_Missense_Mutation_p.D481L|TFRC_ENST00000465288.1_5'Flank|TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000392396.3_Missense_Mutation_p.D562L	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	562					cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	ATAAGGATAATCTGTGTCCTGC	0.5			T	BCL6	NHL																																p.D562V|p.D562H		Atlas-SNP	.		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	.	TFRC	54	.	0			c.A1685T|c.G1684C						PASS	.																																			SO:0001583	missense	7037	exon17			GGATAATCTGTGT|GATAATCTGTGTC	X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.1684_1685delinsAG	chr3.hg19:g.195782165_195782166delinsAG	ENSP00000353224:p.Asp562Leu	77.0|76.0	0.0	.		68.0|67.0	26.0|25.0	.	NM_001128148	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Missense_Mutation	SNP	ENST00000360110.4	hg19	CCDS3312.1																																																																																			.	.	.	none		0.500	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341346.1		
CEP135	9662	hgsc.bcm.edu	37	4	56874494	56874494	+	Splice_Site	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:56874494A>G	ENST00000257287.4	+	18	2406	c.2282A>G	c.(2281-2283)gAa>gGa	p.E761G		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	761					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					TTTCTATAGGAAAAAGCTGTT	0.289																																					p.E761G		Atlas-SNP	.											.	CEP135	115	.	0			c.A2282G						PASS	.						60.0	64.0	63.0					4																	56874494		2201	4299	6500	SO:0001630	splice_region_variant	9662	exon18			TATAGGAAAAAGC	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2281-1A>G	chr4.hg19:g.56874494A>G		91.0	0.0	.		84.0	5.0	.	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463771	0.43736	.	.	ENSG00000174799	ENST00000257287	T	0.35048	1.33	5.48	5.48	0.80851	.	0.043970	0.85682	D	0.000000	T	0.50137	0.1598	M	0.78049	2.395	0.54753	D	0.999988	D	0.56287	0.975	P	0.51385	0.668	T	0.55341	-0.8156	10	0.54805	T	0.06	.	12.2418	0.54546	1.0:0.0:0.0:0.0	.	761	Q66GS9	CP135_HUMAN	G	761	ENSP00000257287:E761G	ENSP00000257287:E761G	E	+	2	0	CEP135	56569251	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	5.412000	0.66392	2.182000	0.69389	0.528000	0.53228	GAA	.	.	.	none		0.289	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	Missense_Mutation
RCHY1	25898	hgsc.bcm.edu	37	4	76415883	76415883	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:76415883A>C	ENST00000324439.5	-	8	963	c.565T>G	c.(565-567)Tct>Gct	p.S189A	RCHY1_ENST00000380840.2_Missense_Mutation_p.S149A|RCHY1_ENST00000514021.1_5'Flank|RCHY1_ENST00000512706.1_Missense_Mutation_p.S167A|RCHY1_ENST00000513257.1_Missense_Mutation_p.S180A|RCHY1_ENST00000451788.1_Missense_Mutation_p.L188R	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	189					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TCTAAAGCAGAGTGCATACAT	0.373																																					p.S189A		Atlas-SNP	.											.	RCHY1	17	.	0			c.T565G						PASS	.						133.0	113.0	120.0					4																	76415883		2203	4300	6503	SO:0001583	missense	25898	exon8			AAGCAGAGTGCAT	AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.565T>G	chr4.hg19:g.76415883A>C	ENSP00000321239:p.Ser189Ala	62.0	0.0	.		80.0	26.0	.	NM_015436	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Missense_Mutation	SNP	ENST00000324439.5	hg19	CCDS3567.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.67|14.67	2.604259|2.604259	0.46423|0.46423	.|.	.|.	ENSG00000163743|ENSG00000163743	ENST00000451788|ENST00000324439;ENST00000380840;ENST00000512706;ENST00000513257;ENST00000507014	.|T;T;T	.|0.35048	.|1.38;1.33;1.38	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Zinc finger, RING/FYVE/PHD-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.60235|0.60235	0.2253|0.2253	.|.	.|.	.|.	0.32406|0.32406	N|N	0.551239|0.551239	.|D;D;D;D	.|0.89917	.|0.996;0.997;0.996;1.0	.|D;D;D;D	.|0.79108	.|0.987;0.992;0.987;0.987	T|T	0.71721|0.71721	-0.4507|-0.4507	5|9	0.22706|0.66056	T|D	0.39|0.02	-9.2258|-9.2258	14.2238|14.2238	0.65845|0.65845	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|140;167;180;189	.|E7EMC8;E7ETW5;Q96PM5-2;Q96PM5	.|.;.;.;ZN363_HUMAN	R|A	188|189;149;167;180;140	.|ENSP00000321239:S189A;ENSP00000370220:S149A;ENSP00000423976:S167A	ENSP00000401041:L188R|ENSP00000321239:S189A	L|S	-|-	2|1	0|0	RCHY1|RCHY1	76634907|76634907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	7.352000|7.352000	0.79404|0.79404	2.239000|2.239000	0.73571|0.73571	0.528000|0.528000	0.53228|0.53228	CTC|TCT	.	.	.	none		0.373	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252411.2	NM_015436	
BMP2K	55589	hgsc.bcm.edu	37	4	79786783	79786783	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:79786783T>C	ENST00000335016.5	+	10	1306	c.1140T>C	c.(1138-1140)acT>acC	p.T380T	BMP2K_ENST00000502871.1_Silent_p.T380T	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	380					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						ACTCTGCTACTACTGCCACTC	0.418																																					p.T380T		Atlas-SNP	.											.	BMP2K	169	.	0			c.T1140C						PASS	.						122.0	110.0	114.0					4																	79786783		2203	4300	6503	SO:0001819	synonymous_variant	55589	exon10			TGCTACTACTGCC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1140T>C	chr4.hg19:g.79786783T>C		104.0	0.0	.		104.0	44.0	.	NM_017593	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	hg19	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	T	7.526	0.657778	0.14645	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.26	-0.259	0.12971	.	.	.	.	.	T	0.56156	0.1966	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50800	-0.8785	4	.	.	.	-3.7779	9.9454	0.41604	0.0:0.4316:0.0:0.5684	.	.	.	.	H	73	.	.	Y	+	1	0	BMP2K	80005807	0.986000	0.35501	0.891000	0.34965	0.665000	0.39181	0.684000	0.25364	0.047000	0.15862	-0.290000	0.09829	TAC	.	.	.	none		0.418	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
CENPE	1062	hgsc.bcm.edu	37	4	104081805	104081805	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:104081805C>T	ENST00000265148.3	-	21	2352	c.2263G>A	c.(2263-2265)Gaa>Aaa	p.E755K	CENPE_ENST00000380026.3_Missense_Mutation_p.E730K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	755					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTTCTACTTCAGAAGGTAAA	0.318																																					p.E755K		Atlas-SNP	.											.	CENPE	253	.	0			c.G2263A						PASS	.						65.0	69.0	67.0					4																	104081805		2201	4291	6492	SO:0001583	missense	1062	exon21			CTACTTCAGAAGG	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2263G>A	chr4.hg19:g.104081805C>T	ENSP00000265148:p.Glu755Lys	90.0	0.0	.		85.0	39.0	.	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761920	0.49468	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.71817	3.8;-0.6;3.8	4.58	4.58	0.56647	.	.	.	.	.	T	0.77631	0.4159	L	0.54323	1.7	0.51767	D	0.999931	D;D	0.76494	0.974;0.999	P;D	0.65987	0.726;0.94	T	0.78155	-0.2314	9	0.54805	T	0.06	.	10.406	0.44256	0.0:0.8981:0.0:0.1019	.	730;755	Q02224-3;Q02224	.;CENPE_HUMAN	K	755;755;730;755	ENSP00000265148:E755K;ENSP00000369365:E730K;ENSP00000423981:E755K	ENSP00000265148:E755K	E	-	1	0	CENPE	104301254	0.998000	0.40836	0.762000	0.31397	0.169000	0.22640	2.456000	0.44997	2.254000	0.74563	0.650000	0.86243	GAA	.	.	.	none		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LRBA	987	hgsc.bcm.edu	37	4	151821345	151821345	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:151821345G>T	ENST00000357115.3	-	14	2023	c.1780C>A	c.(1780-1782)Ctg>Atg	p.L594M	LRBA_ENST00000535741.1_Missense_Mutation_p.L594M|LRBA_ENST00000507224.1_Missense_Mutation_p.L594M|LRBA_ENST00000510413.1_Missense_Mutation_p.L594M	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	594						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TCCGTGGACAGATAAGTATAG	0.413																																					p.L594M		Atlas-SNP	.											.	LRBA	253	.	0			c.C1780A						PASS	.						108.0	100.0	103.0					4																	151821345		2203	4300	6503	SO:0001583	missense	987	exon14			TGGACAGATAAGT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1780C>A	chr4.hg19:g.151821345G>T	ENSP00000349629:p.Leu594Met	77.0	0.0	.		68.0	24.0	.	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255995	0.59321	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.59	2.91	0.33838	Armadillo-type fold (1);	0.000000	0.52532	D	0.000071	T	0.22589	0.0545	L	0.58669	1.825	0.44380	D	0.997282	P;P;P	0.46277	0.802;0.776;0.875	B;B;B	0.40825	0.122;0.282;0.341	T	0.02352	-1.1172	10	0.54805	T	0.06	.	5.799	0.18403	0.3233:0.0:0.5523:0.1244	.	594;594;594	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	M	594	ENSP00000446299:L594M;ENSP00000421552:L594M;ENSP00000349629:L594M;ENSP00000422180:L594M	ENSP00000349629:L594M	L	-	1	2	LRBA	152040795	1.000000	0.71417	0.984000	0.44739	0.998000	0.95712	1.337000	0.33862	0.714000	0.32081	0.655000	0.94253	CTG	.	.	.	none		0.413	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
WWC2	80014	hgsc.bcm.edu	37	4	184182067	184182067	+	Missense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr4:184182067T>A	ENST00000403733.3	+	11	1490	c.1291T>A	c.(1291-1293)Tct>Act	p.S431T	WWC2_ENST00000504005.1_Missense_Mutation_p.S113T|WWC2_ENST00000513834.1_Missense_Mutation_p.S431T|WWC2_ENST00000448232.2_Missense_Mutation_p.S431T|WWC2_ENST00000378925.3_Missense_Mutation_p.S333T	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	431	Ser-rich.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TTTCAGCCTCTCTGCCAGCAC	0.507																																					p.S431T		Atlas-SNP	.											.	WWC2	78	.	0			c.T1291A						PASS	.						29.0	29.0	29.0					4																	184182067		2203	4300	6503	SO:0001583	missense	80014	exon11			AGCCTCTCTGCCA	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1291T>A	chr4.hg19:g.184182067T>A	ENSP00000384222:p.Ser431Thr	27.0	0.0	.		36.0	18.0	.	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	hg19	CCDS34109.2	.	.	.	.	.	.	.	.	.	.	T	24.6	4.551586	0.86127	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000002	T	0.65207	0.2669	M	0.80183	2.485	0.58432	D	0.999996	D	0.69078	0.997	D	0.75020	0.985	T	0.68864	-0.5296	10	0.49607	T	0.09	-16.2476	14.628	0.68635	0.0:0.0:0.0:1.0	.	431	Q6AWC2	WWC2_HUMAN	T	431;333;431;431;113	ENSP00000384222:S431T;ENSP00000368205:S333T;ENSP00000425054:S431T;ENSP00000398577:S431T;ENSP00000427569:S113T	ENSP00000368205:S333T	S	+	1	0	WWC2	184419061	1.000000	0.71417	0.993000	0.49108	0.935000	0.57460	7.833000	0.86765	2.046000	0.60703	0.528000	0.53228	TCT	.	.	.	none		0.507	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
ICE1	23379	hgsc.bcm.edu	37	5	5461992	5461992	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:5461992A>T	ENST00000296564.7	+	13	2767	c.2545A>T	c.(2545-2547)Acc>Tcc	p.T849S		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		849					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAATTCAAGACCACTGCATC	0.413																																					p.T849S		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A2545T						PASS	.						92.0	87.0	89.0					5																	5461992		1888	4110	5998	SO:0001583	missense	23379	exon13			TTCAAGACCACTG																												ENST00000296564.7:c.2545A>T	chr5.hg19:g.5461992A>T	ENSP00000296564:p.Thr849Ser	109.0	0.0	.		96.0	41.0	.	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	a	5.614	0.297970	0.10622	.	.	ENSG00000164151	ENST00000296564	T	0.09445	2.98	4.94	0.61	0.17580	.	0.400941	0.21055	N	0.080924	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.20780	0.048	B	0.14023	0.01	T	0.43750	-0.9372	10	0.20046	T	0.44	-7.0261	7.5819	0.27970	0.1086:0.5191:0.3723:0.0	.	849	Q9Y2F5	K0947_HUMAN	S	849	ENSP00000296564:T849S	ENSP00000296564:T849S	T	+	1	0	KIAA0947	5514992	0.000000	0.05858	0.000000	0.03702	0.233000	0.25261	0.042000	0.13949	-0.216000	0.10048	0.378000	0.23410	ACC	.	.	.	none		0.413	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
ITGA1	3672	hgsc.bcm.edu	37	5	52211309	52211309	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:52211309G>T	ENST00000282588.6	+	15	2331	c.1873G>T	c.(1873-1875)Ggg>Tgg	p.G625W		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	625					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TCCATCAGGTGGGGATGGTAA	0.388																																					p.G625W		Atlas-SNP	.											.	ITGA1	112	.	0			c.G1873T						PASS	.						146.0	147.0	147.0					5																	52211309		2203	4300	6503	SO:0001583	missense	3672	exon15			TCAGGTGGGGATG	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.1873G>T	chr5.hg19:g.52211309G>T	ENSP00000282588:p.Gly625Trp	171.0	0.0	.		157.0	62.0	.	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672050	0.88348	.	.	ENSG00000213949	ENST00000282588	T	0.56103	0.48	5.53	5.53	0.82687	.	0.053424	0.85682	D	0.000000	T	0.69557	0.3124	L	0.56769	1.78	0.80722	D	1	D	0.71674	0.998	D	0.68192	0.956	T	0.65693	-0.6106	10	0.38643	T	0.18	.	19.8228	0.96604	0.0:0.0:1.0:0.0	.	625	P56199	ITA1_HUMAN	W	625	ENSP00000282588:G625W	ENSP00000282588:G625W	G	+	1	0	ITGA1	52247066	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.066000	0.93949	2.759000	0.94783	0.650000	0.86243	GGG	.	.	.	none		0.388	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
LHFPL2	10184	hgsc.bcm.edu	37	5	77784725	77784725	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:77784725G>A	ENST00000515007.2	-	3	992	c.682C>T	c.(682-684)Ctt>Ttt	p.L228F	LHFPL2_ENST00000380345.2_Missense_Mutation_p.L228F			Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	228						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	6		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		CCAAACTAAAGGAGGCAGATC	0.408																																					p.L228F		Atlas-SNP	.											.	LHFPL2	9	.	0			c.C682T						PASS	.						128.0	127.0	127.0					5																	77784725		2203	4300	6503	SO:0001583	missense	10184	exon5			ACTAAAGGAGGCA	D86961	CCDS4042.1	5q13	2008-02-05			ENSG00000145685	ENSG00000145685			6588	protein-coding gene	gene with protein product		609718				10329012	Standard	NM_005779		Approved	KIAA0206	uc003kfo.3	Q6ZUX7	OTTHUMG00000107579	ENST00000515007.2:c.682C>T	chr5.hg19:g.77784725G>A	ENSP00000425906:p.Leu228Phe	135.0	0.0	.		124.0	52.0	.	NM_005779	B2RMQ6|Q7Z5P0|Q92605	Missense_Mutation	SNP	ENST00000515007.2	hg19	CCDS4042.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026712	0.93518	.	.	ENSG00000145685	ENST00000380345;ENST00000515007	T;T	0.78924	-1.22;-1.22	5.94	5.94	0.96194	.	0.055945	0.64402	D	0.000001	D	0.84115	0.5401	M	0.72118	2.19	0.80722	D	1	P	0.50272	0.933	P	0.51193	0.662	D	0.85187	0.1007	10	0.72032	D	0.01	.	19.3618	0.94442	0.0:0.0:1.0:0.0	.	228	Q6ZUX7	LHPL2_HUMAN	F	228	ENSP00000369702:L228F;ENSP00000425906:L228F	ENSP00000369702:L228F	L	-	1	0	LHFPL2	77820481	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.476000	0.97823	2.820000	0.97059	0.650000	0.86243	CTT	.	.	.	none		0.408	LHFPL2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369098.2	NM_005779	
PCDHB14	56122	hgsc.bcm.edu	37	5	140605207	140605207	+	Silent	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr5:140605207G>C	ENST00000239449.4	+	1	2130	c.2130G>C	c.(2128-2130)gcG>gcC	p.A710A	PCDHB14_ENST00000515856.2_Silent_p.A557A	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	710					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTGGCGGTGCGGCTGT	0.701																																					p.A710A	Ovarian(141;50 1831 27899 33809 37648)	Atlas-SNP	.											.	PCDHB14	132	.	0			c.G2130C						PASS	.						68.0	84.0	79.0					5																	140605207		2184	4245	6429	SO:0001819	synonymous_variant	56122	exon1			CGTGGCGGTGCGG	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2130G>C	chr5.hg19:g.140605207G>C		391.0	0.0	.		333.0	109.0	.	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	ENST00000239449.4	hg19	CCDS4256.1																																																																																			.	.	.	none		0.701	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
SLC22A7	10864	hgsc.bcm.edu	37	6	43267444	43267444	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:43267444T>C	ENST00000372585.5	+	4	678	c.583T>C	c.(583-585)Tat>Cat	p.Y195H	SLC22A7_ENST00000372589.3_Missense_Mutation_p.Y193H|SLC22A7_ENST00000372574.3_Missense_Mutation_p.Y193H|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	195					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CTCCGTCAGCTATGTAATGTT	0.602																																					p.Y195H		Atlas-SNP	.											.	SLC22A7	69	.	0			c.T583C						PASS	.						91.0	89.0	89.0					6																	43267444		2203	4300	6503	SO:0001583	missense	10864	exon3			GTCAGCTATGTAA	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.583T>C	chr6.hg19:g.43267444T>C	ENSP00000361666:p.Tyr195His	166.0	0.0	.		178.0	68.0	.	NM_153320	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	hg19	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	T	26.8	4.776980	0.90195	.	.	ENSG00000137204	ENST00000451757;ENST00000449231;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35	5.56	5.56	0.83823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.068530	0.64402	D	0.000011	T	0.73273	0.3566	M	0.92077	3.27	0.45295	D	0.998297	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.99;0.986	T	0.80795	-0.1223	10	0.72032	D	0.01	.	13.2267	0.59919	0.0:0.0:0.0:1.0	.	195;193;193	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	H	64;254;193;195;193	ENSP00000416052:Y64H;ENSP00000411818:Y254H;ENSP00000361670:Y193H;ENSP00000361666:Y195H;ENSP00000361655:Y193H	ENSP00000361655:Y193H	Y	+	1	0	SLC22A7	43375422	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	4.783000	0.62403	2.109000	0.64355	0.379000	0.24179	TAT	.	.	.	none		0.602	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
EPHA7	2045	hgsc.bcm.edu	37	6	93969151	93969151	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:93969151C>A	ENST00000369303.4	-	10	2029	c.1845G>T	c.(1843-1845)gaG>gaT	p.E615D		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	615					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TATTTGGGTCCTCATAGGTTT	0.428																																					p.E615D		Atlas-SNP	.											.	EPHA7	251	.	0			c.G1845T						PASS	.						221.0	199.0	206.0					6																	93969151		2203	4300	6503	SO:0001583	missense	2045	exon10			TGGGTCCTCATAG	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1845G>T	chr6.hg19:g.93969151C>A	ENSP00000358309:p.Glu615Asp	172.0	0.0	.		168.0	72.0	.	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	hg19	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622257	0.28889	.	.	ENSG00000135333	ENST00000369303	T	0.22336	1.96	5.9	5.9	0.94986	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.37320	0.0999	M	0.91972	3.26	0.80722	D	1	B;B;B	0.33755	0.424;0.002;0.001	P;B;B	0.46419	0.516;0.002;0.001	T	0.26538	-1.0100	10	0.59425	D	0.04	.	14.4356	0.67279	0.0:0.93:0.0:0.07	.	611;610;615	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	D	615	ENSP00000358309:E615D	ENSP00000358309:E615D	E	-	3	2	EPHA7	94025872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.753000	0.38359	2.786000	0.95864	0.563000	0.77884	GAG	.	.	.	none		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
OSTM1	28962	hgsc.bcm.edu	37	6	108395713	108395713	+	Missense_Mutation	SNP	G	G	C	rs201176284	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:108395713G>C	ENST00000193322.3	-	1	228	c.143C>G	c.(142-144)tCg>tGg	p.S48W		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	48					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CTGCTGCTCCGACAGGAGGTC	0.711													G|||	5	0.000998403	0.0038	0.0	5008	,	,		12709	0.0		0.0	False		,,,				2504	0.0				p.S48W	Melanoma(162;1427 1909 3096 17430 21396)	Atlas-SNP	.											.	OSTM1	22	.	0			c.C143G						PASS	.	G	TRP/SER	12,4304		0,12,2146	7.0	7.0	7.0		143	4.1	1.0	6		7	0,8426		0,0,4213	yes	missense	OSTM1	NM_014028.3	177	0,12,6359	CC,CG,GG		0.0,0.278,0.0942	probably-damaging	48/335	108395713	12,12730	2158	4213	6371	SO:0001583	missense	28962	exon1			TGCTCCGACAGGA	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.143C>G	chr6.hg19:g.108395713G>C	ENSP00000193322:p.Ser48Trp	3.0	0.0	.		12.0	4.0	.	NM_014028	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	hg19	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828523	0.71258	0.00278	0.0	ENSG00000081087	ENST00000193322	T	0.55234	0.53	4.96	4.08	0.47627	.	0.095194	0.43110	D	0.000605	T	0.37865	0.1019	M	0.70595	2.14	0.44627	D	0.9976	B	0.16166	0.016	B	0.14023	0.01	T	0.48281	-0.9049	10	0.87932	D	0	-17.7201	12.5335	0.56128	0.0:0.1806:0.8194:0.0	.	48	Q86WC4	OSTM1_HUMAN	W	48	ENSP00000193322:S48W	ENSP00000193322:S48W	S	-	2	0	OSTM1	108502406	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.376000	0.66178	1.199000	0.43173	0.655000	0.94253	TCG	.	.	.	weak		0.711	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
MAP3K4	4216	hgsc.bcm.edu	37	6	161470014	161470014	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:161470014C>A	ENST00000392142.4	+	3	858	c.710C>A	c.(709-711)tCa>tAa	p.S237*	MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.S237*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.S237*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.S237*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	237					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.S237L(2)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AAGCTTACCTCAGTCTCAAAG	0.433																																					p.S237X		Atlas-SNP	.											MAP3K4_ENST00000392142,NS,carcinoma,0,2	MAP3K4	364	.	2	Substitution - Missense(2)	cervix(2)	c.C710A						PASS	.						41.0	41.0	41.0					6																	161470014		2203	4300	6503	SO:0001587	stop_gained	4216	exon3			TTACCTCAGTCTC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.710C>A	chr6.hg19:g.161470014C>A	ENSP00000375986:p.Ser237*	49.0	0.0	.		54.0	23.0	.	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	C	38	6.894608	0.97916	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	6.14	6.14	0.99180	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.6238	20.819	0.99723	0.0:1.0:0.0:0.0	.	.	.	.	X	237	.	ENSP00000297332:S237X	S	+	2	0	MAP3K4	161390004	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.454000	0.80714	2.927000	0.99377	0.637000	0.83480	TCA	.	.	.	none		0.433	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
HEATR2	54919	hgsc.bcm.edu	37	7	803456	803456	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:803456T>G	ENST00000297440.6	+	8	1648	c.1628T>G	c.(1627-1629)aTg>aGg	p.M543R	HEATR2_ENST00000313147.5_Missense_Mutation_p.M543R	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	543						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CAGGAGACGATGGACTCACTG	0.607																																					p.M543R		Atlas-SNP	.											.	HEATR2	62	.	0			c.T1628G						PASS	.						132.0	110.0	117.0					7																	803456		2202	4300	6502	SO:0001583	missense	54919	exon8			AGACGATGGACTC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1628T>G	chr7.hg19:g.803456T>G	ENSP00000297440:p.Met543Arg	137.0	0.0	.		261.0	44.0	.	NM_017802	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	hg19	CCDS34580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.28|14.28	2.488084|2.488084	0.44249|0.44249	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000440747|ENST00000297440;ENST00000313147;ENST00000537862	.|T;T	.|0.67523	.|-0.27;-0.27	5.03|5.03	5.03|5.03	0.67393|0.67393	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.303789	.|0.36893	.|N	.|0.002346	T|T	0.70055|0.70055	0.3180|0.3180	M|M	0.68317|0.68317	2.08|2.08	0.09310|0.09310	N|N	0.999993|0.999993	.|P;P	.|0.45715	.|0.788;0.865	.|B;P	.|0.45610	.|0.272;0.487	T|T	0.68070|0.68070	-0.5506|-0.5506	5|10	.|0.72032	.|D	.|0.01	-30.0578|-30.0578	15.0356|15.0356	0.71744|0.71744	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|543;289	.|Q86Y56;F5H8D4	.|HEAT2_HUMAN;.	E|R	344|543;543;289	.|ENSP00000297440:M543R;ENSP00000321451:M543R	.|ENSP00000297440:M543R	D|M	+|+	3|2	2|0	HEATR2|HEATR2	769982|769982	0.998000|0.998000	0.40836|0.40836	0.021000|0.021000	0.16686|0.16686	0.005000|0.005000	0.04900|0.04900	2.733000|2.733000	0.47360|0.47360	2.008000|2.008000	0.58898|0.58898	0.459000|0.459000	0.35465|0.35465	GAT|ATG	.	.	.	none		0.607	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
PKD1L1	168507	hgsc.bcm.edu	37	7	47870900	47870900	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:47870900G>C	ENST00000289672.2	-	42	6438	c.6388C>G	c.(6388-6390)Cag>Gag	p.Q2130E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2130					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CACCAAGGCTGAAGGGCCCTT	0.562																																					p.Q2130E		Atlas-SNP	.											.	PKD1L1	328	.	0			c.C6388G						PASS	.						93.0	83.0	86.0					7																	47870900		2203	4300	6503	SO:0001583	missense	168507	exon42			AAGGCTGAAGGGC	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6388C>G	chr7.hg19:g.47870900G>C	ENSP00000289672:p.Gln2130Glu	105.0	0.0	.		211.0	48.0	.	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	8.099	0.776205	0.16051	.	.	ENSG00000158683	ENST00000289672	T	0.18960	2.18	5.1	2.25	0.28309	.	1.969070	0.02438	N	0.084314	T	0.13157	0.0319	N	0.22421	0.69	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.23655	-1.0182	10	0.06625	T	0.88	1.9044	4.372	0.11253	0.1915:0.0:0.629:0.1795	.	2130	Q8TDX9	PK1L1_HUMAN	E	2130	ENSP00000289672:Q2130E	ENSP00000289672:Q2130E	Q	-	1	0	PKD1L1	47837425	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.141000	0.16076	0.166000	0.19597	0.563000	0.77884	CAG	.	.	.	none		0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
COL1A2	1278	hgsc.bcm.edu	37	7	94057039	94057039	+	Missense_Mutation	SNP	G	G	T	rs145541630		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:94057039G>T	ENST00000297268.6	+	49	3839	c.3368G>T	c.(3367-3369)cGc>cTc	p.R1123L		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1123				Missing (in Ref. 17; CAA23761). {ECO:0000305}.	blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GACCAGCCTCGCTCAGCACCT	0.547										HNSCC(75;0.22)																											p.R1123L		Atlas-SNP	.											.	COL1A2	240	.	0			c.G3368T						PASS	.						98.0	97.0	98.0					7																	94057039		2203	4300	6503	SO:0001583	missense	1278	exon49			AGCCTCGCTCAGC	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3368G>T	chr7.hg19:g.94057039G>T	ENSP00000297268:p.Arg1123Leu	113.0	0.0	.		261.0	53.0	.	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	hg19	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.401592	0.62288	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.89552	-2.53	5.71	5.71	0.89125	.	0.000000	0.56097	D	0.000040	D	0.88757	0.6523	N	0.14661	0.345	0.34308	D	0.68511	D	0.60160	0.987	D	0.67725	0.953	D	0.90766	0.4668	10	0.41790	T	0.15	.	15.7376	0.77859	0.0:0.0:1.0:0.0	.	1123	P08123	CO1A2_HUMAN	L	1123;1124	ENSP00000297268:R1123L	ENSP00000297268:R1123L	R	+	2	0	COL1A2	93894975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.489000	0.60309	2.873000	0.98535	0.561000	0.74099	CGC	.	G|1.000;A|0.000	.	alt		0.547	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
GPR37	2861	hgsc.bcm.edu	37	7	124404923	124404923	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:124404923G>C	ENST00000303921.2	-	1	758	c.108C>G	c.(106-108)aaC>aaG	p.N36K		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	36					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GACAAGTTTCGTTTCTGGACG	0.652																																					p.N36K		Atlas-SNP	.											.	GPR37	89	.	0			c.C108G						PASS	.						23.0	24.0	24.0					7																	124404923		2203	4300	6503	SO:0001583	missense	2861	exon1			AGTTTCGTTTCTG		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.108C>G	chr7.hg19:g.124404923G>C	ENSP00000306449:p.Asn36Lys	46.0	0.0	.		86.0	61.0	.	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	hg19	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	6.209	0.406650	0.11754	.	.	ENSG00000170775	ENST00000303921	T	0.08896	3.04	5.31	-0.565	0.11771	.	0.220305	0.48286	N	0.000186	T	0.04861	0.0131	L	0.27053	0.805	0.09310	N	0.999998	B	0.09022	0.002	B	0.06405	0.002	T	0.30001	-0.9993	10	0.49607	T	0.09	-16.1704	4.5608	0.12160	0.2984:0.3038:0.3978:0.0	.	36	O15354	GPR37_HUMAN	K	36	ENSP00000306449:N36K	ENSP00000306449:N36K	N	-	3	2	GPR37	124192159	0.000000	0.05858	0.005000	0.12908	0.024000	0.10985	0.501000	0.22578	-0.292000	0.08999	0.655000	0.94253	AAC	.	.	.	none		0.652	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
KMT2C	58508	hgsc.bcm.edu	37	7	151962168	151962168	+	Missense_Mutation	SNP	C	C	G	rs138908625	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:151962168C>G	ENST00000262189.6	-	8	1357	c.1139G>C	c.(1138-1140)cGt>cCt	p.R380P	KMT2C_ENST00000355193.2_Missense_Mutation_p.R380P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	380					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R380L(4)									CCAACCTGCACGTTTTAATGG	0.443																																					p.R380P		Atlas-SNP	.											MLL3_ENST00000355193,extremity,malignant_melanoma,0,4	MLL3	1564	.	4	Substitution - Missense(4)	skin(4)	c.G1139C						PASS	.						410.0	369.0	383.0					7																	151962168		2203	4300	6503	SO:0001583	missense	58508	exon8			CCTGCACGTTTTA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1139G>C	chr7.hg19:g.151962168C>G	ENSP00000262189:p.Arg380Pro	771.0	0.0	.		901.0	146.0	.	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	13.77	2.337586	0.41398	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.98849	-5.18;-5.18	4.65	4.65	0.58169	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, PHD-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38548	U	0.001645	D	0.98701	0.9564	L	0.52759	1.655	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.99905	1.1175	10	0.66056	D	0.02	.	17.9157	0.88950	0.0:1.0:0.0:0.0	.	380	Q8NEZ4	MLL3_HUMAN	P	380	ENSP00000262189:R380P;ENSP00000347325:R380P	ENSP00000262189:R380P	R	-	2	0	MLL3	151593101	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	6.039000	0.70972	2.271000	0.75665	0.557000	0.71058	CGT	.	C|0.500;A|0.500	.	alt		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
SETX	23064	hgsc.bcm.edu	37	9	135156906	135156906	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr9:135156906T>C	ENST00000224140.5	-	20	6784	c.6602A>G	c.(6601-6603)aAg>aGg	p.K2201R	SETX_ENST00000393220.1_Missense_Mutation_p.K2201R|SETX_ENST00000372169.2_Missense_Mutation_p.K2201R	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	2201					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TAGGATGAGCTTATTGCAGCG	0.418																																					p.K2201R		Atlas-SNP	.											.	SETX	234	.	0			c.A6602G						PASS	.						127.0	117.0	121.0					9																	135156906		2203	4300	6503	SO:0001583	missense	23064	exon20			ATGAGCTTATTGC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6602A>G	chr9.hg19:g.135156906T>C	ENSP00000224140:p.Lys2201Arg	130.0	0.0	.		118.0	53.0	.	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	hg19	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263460	0.59431	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	5.56	5.56	0.83823	.	0.148494	0.47455	D	0.000240	D	0.85141	0.5629	N	0.25825	0.765	0.37682	D	0.923524	B;D;D	0.69078	0.123;0.99;0.997	B;D;D	0.77557	0.42;0.956;0.99	D	0.86395	0.1738	10	0.36615	T	0.2	.	14.907	0.70727	0.0:0.0:0.0:1.0	.	2201;2201;2201	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	R	2201;443;2201;2201	ENSP00000224140:K2201R;ENSP00000409143:K443R;ENSP00000361242:K2201R;ENSP00000376913:K2201R	ENSP00000224140:K2201R	K	-	2	0	SETX	134146727	1.000000	0.71417	1.000000	0.80357	0.457000	0.32468	3.550000	0.53691	2.123000	0.65237	0.528000	0.53228	AAG	.	.	.	none		0.418	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
SUV39H2	79723	hgsc.bcm.edu	37	10	14939337	14939338	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:14939337_14939338AC>TT	ENST00000354919.6	+	3	670_671	c.670_671AC>TT	c.(670-672)ACt>TTt	p.T224F	SUV39H2_ENST00000313519.5_Missense_Mutation_p.T164F|SUV39H2_ENST00000378325.3_Intron	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	224	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						CCCACCTGGTACTCCCATCTAT	0.396																																					p.T224S|p.T224I		Atlas-SNP	.											.	SUV39H2	72	.	0			c.A670T|c.C671T						PASS	.																																			SO:0001583	missense	79723	exon3			CCTGGTACTCCCA|CTGGTACTCCCAT	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	Exception_encountered	chr10.hg19:g.14939337_14939338delinsTT	ENSP00000346997:p.Thr224Phe	138.0	0.0	.		132.0|131.0	47.0|49.0	.	NM_001193424	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	hg19	CCDS53494.1																																																																																			.	.	.	none		0.396	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
KIAA1217	56243	hgsc.bcm.edu	37	10	24835172	24835172	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:24835172T>C	ENST00000376454.3	+	21	5781	c.5751T>C	c.(5749-5751)caT>caC	p.H1917H	KIAA1217_ENST00000376451.2_3'UTR|KIAA1217_ENST00000376452.3_Silent_p.H1348H|KIAA1217_ENST00000376462.1_Silent_p.H1238H|KIAA1217_ENST00000458595.1_Silent_p.H1323H|KIAA1217_ENST00000396445.1_3'UTR	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1917					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGACCATCCATACTCCCAGCC	0.532																																					p.H1917H		Atlas-SNP	.											.	KIAA1217	235	.	0			c.T5751C						PASS	.						76.0	70.0	72.0					10																	24835172		2203	4300	6503	SO:0001819	synonymous_variant	56243	exon21			CATCCATACTCCC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5751T>C	chr10.hg19:g.24835172T>C		111.0	0.0	.		99.0	51.0	.	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	hg19	CCDS31165.1																																																																																			.	.	.	none		0.532	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
ARMC4	55130	hgsc.bcm.edu	37	10	28270470	28270470	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:28270470T>C	ENST00000305242.5	-	7	953	c.861A>G	c.(859-861)aaA>aaG	p.K287K	ARMC4_ENST00000239715.3_Silent_p.K144K|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000537576.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	287					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						AAATTGAACCTTTTCTCTCAT	0.294																																					p.K287K		Atlas-SNP	.											.	ARMC4	177	.	0			c.A861G						PASS	.						99.0	104.0	102.0					10																	28270470		2202	4296	6498	SO:0001819	synonymous_variant	55130	exon7			TGAACCTTTTCTC	AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.861A>G	chr10.hg19:g.28270470T>C		170.0	0.0	.		127.0	8.0	.	NM_018076	A8K906|B7Z7I1|Q9H0C0	Silent	SNP	ENST00000305242.5	hg19	CCDS7157.1																																																																																			.	.	.	none		0.294	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
CUL2	8453	hgsc.bcm.edu	37	10	35324145	35324145	+	Silent	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:35324145G>T	ENST00000374748.1	-	11	1270	c.957C>A	c.(955-957)atC>atA	p.I319I	CUL2_ENST00000374751.3_Silent_p.I319I|CUL2_ENST00000602371.1_Silent_p.I262I|CUL2_ENST00000374749.3_Silent_p.I319I|CUL2_ENST00000537177.1_Silent_p.I338I|CUL2_ENST00000374746.1_Silent_p.I319I|CUL2_ENST00000374742.1_Silent_p.I319I			Q13617	CUL2_HUMAN	cullin 2	319					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						CCTCATCATGGATGTGGTTTT	0.473																																					p.I338I		Atlas-SNP	.											.	CUL2	63	.	0			c.C1014A						PASS	.						155.0	126.0	136.0					10																	35324145		2203	4300	6503	SO:0001819	synonymous_variant	8453	exon10			ATCATGGATGTGG	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.957C>A	chr10.hg19:g.35324145G>T		59.0	0.0	.		63.0	21.0	.	NM_001198778	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Silent	SNP	ENST00000374748.1	hg19	CCDS7179.1																																																																																			.	.	.	none		0.473	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
ALOX5	240	hgsc.bcm.edu	37	10	45869784	45869784	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:45869784C>A	ENST00000374391.2	+	1	110	c.57C>A	c.(55-57)gaC>gaA	p.D19E	ALOX5_ENST00000542434.1_Missense_Mutation_p.D19E	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	19	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CCGGCACTGACGACTACATCT	0.701																																					p.D19E		Atlas-SNP	.											.	ALOX5	88	.	0			c.C57A						PASS	.						28.0	19.0	22.0					10																	45869784		2161	4260	6421	SO:0001583	missense	240	exon1			CACTGACGACTAC	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.57C>A	chr10.hg19:g.45869784C>A	ENSP00000363512:p.Asp19Glu	10.0	0.0	.		12.0	6.0	.	NM_000698	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	hg19	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	c	13.35	2.210677	0.39102	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.66280	-0.2;-0.2	4.82	1.81	0.25067	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.051214	0.85682	D	0.000000	T	0.75042	0.3796	M	0.88310	2.945	0.49798	D	0.999823	D;D;D	0.76494	0.998;0.999;0.985	P;D;P	0.69142	0.757;0.962;0.554	T	0.70651	-0.4813	10	0.30854	T	0.27	-37.9305	4.7968	0.13276	0.0:0.5691:0.1591:0.2717	.	19;19;19	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	E	19	ENSP00000437634:D19E;ENSP00000363512:D19E	ENSP00000363512:D19E	D	+	3	2	ALOX5	45189790	1.000000	0.71417	1.000000	0.80357	0.016000	0.09150	1.011000	0.29911	0.420000	0.25954	-0.533000	0.04299	GAC	.	.	.	none		0.701	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		
GRID1	2894	hgsc.bcm.edu	37	10	87407050	87407050	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:87407050T>C	ENST00000327946.7	-	13	2187	c.2102A>G	c.(2101-2103)cAg>cGg	p.Q701R	RN7SKP238_ENST00000516483.1_RNA|RP11-93H12.4_ENST00000474115.2_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.Q272R	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	701					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGTGCTGTCCTGCTCCAGGGG	0.552										Multiple Myeloma(13;0.14)																											p.Q701R		Atlas-SNP	.											.	GRID1	204	.	0			c.A2102G						PASS	.						271.0	252.0	259.0					10																	87407050		2203	4300	6503	SO:0001583	missense	2894	exon13			CTGTCCTGCTCCA	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2102A>G	chr10.hg19:g.87407050T>C	ENSP00000330148:p.Gln701Arg	418.0	0.0	.		427.0	157.0	.	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	hg19	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261225	0.39995	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.27402	1.67;1.67	5.7	5.7	0.88788	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	N	0.11106	0.095	0.80722	D	1	D	0.59357	0.985	D	0.74023	0.982	T	0.28650	-1.0037	10	0.26408	T	0.33	.	15.1462	0.72653	0.0:0.0:0.0:1.0	.	701	Q9ULK0	GRID1_HUMAN	R	701;272	ENSP00000330148:Q701R;ENSP00000444455:Q272R	ENSP00000330148:Q701R	Q	-	2	0	GRID1	87397030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.175000	0.68902	0.528000	0.53228	CAG	.	.	.	none		0.552	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
NRAP	4892	hgsc.bcm.edu	37	10	115411657	115411657	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr10:115411657T>C	ENST00000359988.3	-	7	824	c.580A>G	c.(580-582)Aag>Gag	p.K194E	NRAP_ENST00000360478.3_Missense_Mutation_p.K194E|NRAP_ENST00000369360.3_Missense_Mutation_p.K194E|NRAP_ENST00000369358.4_Missense_Mutation_p.K194E	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TGCCCTCTCTTATACTCCACC	0.547																																					p.K194E		Atlas-SNP	.											.	NRAP	208	.	0			c.A580G						PASS	.						108.0	88.0	94.0					10																	115411657		2203	4300	6503	SO:0001583	missense	4892	exon7			CTCTCTTATACTC		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.580A>G	chr10.hg19:g.115411657T>C	ENSP00000353078:p.Lys194Glu	66.0	0.0	.		71.0	21.0	.	NM_001261463		Missense_Mutation	SNP	ENST00000359988.3	hg19	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719870	0.68844	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	6.03	6.03	0.97812	.	0.044427	0.85682	D	0.000000	D	0.82393	0.5027	M	0.87827	2.91	0.43988	D	0.996689	D;D;D	0.59357	0.985;0.982;0.985	P;P;D	0.64506	0.868;0.879;0.926	D	0.85146	0.0983	10	0.66056	D	0.02	.	12.952	0.58407	0.0:0.0:0.0:1.0	.	194;194;194	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	E	194	ENSP00000358365:K194E;ENSP00000358367:K194E;ENSP00000353078:K194E;ENSP00000353666:K194E	ENSP00000353078:K194E	K	-	1	0	NRAP	115401647	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	6.117000	0.71577	2.313000	0.78055	0.454000	0.30748	AAG	.	.	.	none		0.547	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
IFITM1	8519	hgsc.bcm.edu	37	11	315058	315058	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:315058C>G	ENST00000408968.3	+	2	641	c.323C>G	c.(322-324)tCt>tGt	p.S108C	IFITM1_ENST00000528780.1_Missense_Mutation_p.S108C|IFITM1_ENST00000328221.5_Missense_Mutation_p.S108C	NM_003641.3	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	108	Interaction with CAV1.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of immune response (GO:0050776)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			large_intestine(1)|lung(3)	4		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTATTCGGCTCTGTGACAGTC	0.507																																					p.S108C		Atlas-SNP	.											IFITM1,NS,carcinoma,0,1	IFITM1	15	.	0			c.C323G						PASS	.						129.0	129.0	129.0					11																	315058		1942	4128	6070	SO:0001583	missense	8519	exon2			TCGGCTCTGTGAC	J04164	CCDS41584.1	11p15.5	2012-03-15	2012-03-13		ENSG00000185885	ENSG00000185885		"""CD molecules"""	5412	protein-coding gene	gene with protein product	"""interferon-induced transmembrane protein 1"""	604456	"""interferon induced transmembrane protein 1 (9-27)"""	IFI17		7559564	Standard	NM_003641		Approved	9-27, CD225	uc001loy.4	P13164		ENST00000408968.3:c.323C>G	chr11.hg19:g.315058C>G	ENSP00000386187:p.Ser108Cys	114.0	0.0	.		122.0	35.0	.	NM_003641	Q15322|Q53XZ0	Missense_Mutation	SNP	ENST00000408968.3	hg19	CCDS41584.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150346	0.37923	.	.	ENSG00000185885	ENST00000528780;ENST00000328221;ENST00000408968	T;T;T	0.80304	-1.36;-1.36;-1.36	3.73	-0.746	0.11095	.	.	.	.	.	T	0.61578	0.2358	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.15870	0.014	T	0.45571	-0.9252	9	0.38643	T	0.18	.	0.8934	0.01259	0.1942:0.4108:0.1719:0.2231	.	108	P13164	IFM1_HUMAN	C	108	ENSP00000437057:S108C;ENSP00000330825:S108C;ENSP00000386187:S108C	ENSP00000330825:S108C	S	+	2	0	IFITM1	305058	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.419000	0.02460	-0.422000	0.07405	0.313000	0.20887	TCT	.	.	.	none		0.507	IFITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383595.1	NM_003641	
SIGIRR	59307	hgsc.bcm.edu	37	11	407548	407548	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:407548A>G	ENST00000431843.2	-	6	808	c.502T>C	c.(502-504)Tac>Cac	p.Y168H	SIGIRR_ENST00000332725.3_Missense_Mutation_p.Y168H|SIGIRR_ENST00000529486.1_5'UTR|SIGIRR_ENST00000531205.1_Missense_Mutation_p.Y168H|SIGIRR_ENST00000397632.3_Missense_Mutation_p.Y168H|SIGIRR_ENST00000382520.2_Missense_Mutation_p.Y168H	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	168	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TAGGAGACGTAGGCGTCGTAG	0.647																																					p.Y168H		Atlas-SNP	.											.	SIGIRR	22	.	0			c.T502C						PASS	.						26.0	27.0	27.0					11																	407548		2189	4291	6480	SO:0001583	missense	59307	exon6			AGACGTAGGCGTC		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.502T>C	chr11.hg19:g.407548A>G	ENSP00000403104:p.Tyr168His	21.0	0.0	.		40.0	10.0	.	NM_001135053	Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	hg19	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	a	17.94	3.510696	0.64522	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520;ENST00000528209	T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71	2.75	2.75	0.32379	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.240626	0.36303	N	0.002663	T	0.36082	0.0954	M	0.83118	2.625	0.58432	D	0.999999	D;D	0.76494	0.999;0.987	D;D	0.72625	0.978;0.944	T	0.30001	-0.9993	10	0.87932	D	0	.	10.2759	0.43510	1.0:0.0:0.0:0.0	.	168;168	C9JFX4;Q6IA17	.;SIGIR_HUMAN	H	168;168;168;168;168;64	ENSP00000403104:Y168H;ENSP00000380756:Y168H;ENSP00000333656:Y168H;ENSP00000433022:Y168H;ENSP00000371960:Y168H;ENSP00000435135:Y64H	ENSP00000333656:Y168H	Y	-	1	0	SIGIRR	397548	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	4.453000	0.60061	1.525000	0.49052	0.240000	0.17902	TAC	.	.	.	none		0.647	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
ALKBH3	221120	hgsc.bcm.edu	37	11	43905565	43905565	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:43905565T>C	ENST00000302708.4	+	4	627	c.216T>C	c.(214-216)atT>atC	p.I72I	ALKBH3_ENST00000532410.1_3'UTR|ALKBH3_ENST00000378840.4_Silent_p.I72I	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	72					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	CACGAGTGATTGAGTAAGTAA	0.433								Direct reversal of damage																													p.I72I		Atlas-SNP	.											.	ALKBH3	33	.	0			c.T216C						PASS	.						256.0	225.0	236.0					11																	43905565		2203	4300	6503	SO:0001819	synonymous_variant	221120	exon4			AGTGATTGAGTAA	AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.216T>C	chr11.hg19:g.43905565T>C		233.0	0.0	.		214.0	83.0	.	NM_139178	A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Silent	SNP	ENST00000302708.4	hg19	CCDS7906.1																																																																																			.	.	.	none		0.433	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389693.1	NM_139178	
PC	5091	hgsc.bcm.edu	37	11	66620716	66620716	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66620716A>T	ENST00000393958.2	-	12	1600	c.1507T>A	c.(1507-1509)Tac>Aac	p.Y503N	PC_ENST00000529047.1_5'Flank|PC_ENST00000393960.1_Missense_Mutation_p.Y503N|PC_ENST00000393955.2_Missense_Mutation_p.Y503N	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	503					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	AGACCGAGGTAGTGCAACAGC	0.622																																					p.Y503N		Atlas-SNP	.											.	PC	116	.	0			c.T1507A						PASS	.						122.0	92.0	102.0					11																	66620716		2200	4295	6495	SO:0001583	missense	5091	exon12			CGAGGTAGTGCAA	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1507T>A	chr11.hg19:g.66620716A>T	ENSP00000377530:p.Tyr503Asn	104.0	0.0	.		88.0	28.0	.	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	hg19	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370348	0.61624	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.96745	-4.11;-4.11;-4.11	4.15	4.15	0.48705	.	0.000000	0.85682	D	0.000000	D	0.98435	0.9479	H	0.95780	3.72	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.98985	1.0806	10	0.87932	D	0	-24.4033	11.2003	0.48736	1.0:0.0:0.0:0.0	.	503	P11498	PYC_HUMAN	N	503	ENSP00000377527:Y503N;ENSP00000377530:Y503N;ENSP00000377532:Y503N	ENSP00000377527:Y503N	Y	-	1	0	PC	66377292	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	8.288000	0.89921	1.744000	0.51775	0.379000	0.24179	TAC	.	.	.	none		0.622	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PHLDB1	23187	hgsc.bcm.edu	37	11	118513026	118513026	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:118513026A>T	ENST00000361417.2	+	14	3202	c.2791A>T	c.(2791-2793)Atg>Ttg	p.M931L	PHLDB1_ENST00000527898.1_Intron|PHLDB1_ENST00000534672.1_Intron|PHLDB1_ENST00000524713.1_Missense_Mutation_p.M74L|PHLDB1_ENST00000356063.5_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	931										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCAGGAGCTGATGGCCGGGCT	0.642																																					p.M931L		Atlas-SNP	.											.	PHLDB1	103	.	0			c.A2791T						PASS	.						76.0	79.0	78.0					11																	118513026		2200	4295	6495	SO:0001583	missense	23187	exon13			GAGCTGATGGCCG		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2791A>T	chr11.hg19:g.118513026A>T	ENSP00000354498:p.Met931Leu	151.0	0.0	.		155.0	53.0	.	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	hg19	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	A	15.56	2.870388	0.51588	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000524713	T;T	0.50813	1.52;0.73	5.14	5.14	0.70334	.	0.543120	0.21674	N	0.070828	T	0.34832	0.0911	L	0.40543	1.245	0.26911	N	0.966889	B;B;B	0.24576	0.106;0.039;0.01	B;B;B	0.25614	0.062;0.019;0.011	T	0.27706	-1.0066	10	0.02654	T	1	-9.3743	12.3456	0.55119	1.0:0.0:0.0:0.0	.	69;74;931	B7Z2B9;B4DK17;Q86UU1	.;.;PHLB1_HUMAN	L	931;690;295;74	ENSP00000354498:M931L;ENSP00000434905:M74L	ENSP00000350921:M295L	M	+	1	0	PHLDB1	118018236	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.723000	0.54955	1.925000	0.55765	0.379000	0.24179	ATG	.	.	.	none		0.642	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
LRP6	4040	hgsc.bcm.edu	37	12	12334248	12334248	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:12334248C>T	ENST00000261349.4	-	6	1178	c.1102G>A	c.(1102-1104)Gat>Aat	p.D368N	LRP6_ENST00000543091.1_Missense_Mutation_p.D368N	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	368	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TCCACAGGATCGTAATCTATG	0.453																																					p.D368N		Atlas-SNP	.											.	LRP6	170	.	0			c.G1102A						PASS	.						199.0	170.0	180.0					12																	12334248		2203	4300	6503	SO:0001583	missense	4040	exon6			CAGGATCGTAATC	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1102G>A	chr12.hg19:g.12334248C>T	ENSP00000261349:p.Asp368Asn	171.0	0.0	.		295.0	162.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848081	0.91277	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.92545	-3.06;-3.06	5.82	5.82	0.92795	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000006	D	0.96396	0.8824	M	0.89534	3.04	0.80722	D	1	D;D	0.67145	0.994;0.996	P;P	0.57960	0.79;0.83	D	0.96559	0.9414	10	0.72032	D	0.01	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	368;368	F5H7J9;O75581	.;LRP6_HUMAN	N	368	ENSP00000261349:D368N;ENSP00000442472:D368N	ENSP00000261349:D368N	D	-	1	0	LRP6	12225515	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	5.999000	0.70665	2.752000	0.94435	0.655000	0.94253	GAT	.	.	.	none		0.453	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
PPFIA2	8499	hgsc.bcm.edu	37	12	81671123	81671123	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:81671123G>A	ENST00000549396.1	-	28	3443	c.3283C>T	c.(3283-3285)Cgg>Tgg	p.R1095W	PPFIA2_ENST00000407050.4_Missense_Mutation_p.R994W|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R1089W|PPFIA2_ENST00000541017.1_Missense_Mutation_p.R281W|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R1083W|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R631W|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R1080W|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R942W|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R990W|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R1095W|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R1074W|PPFIA2_ENST00000545296.2_Intron|RP11-121G22.3_ENST00000549161.1_lincRNA	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1095					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTTGCTTCCCGTCTTCTTTCT	0.274																																					p.R1095W		Atlas-SNP	.											.	PPFIA2	207	.	0			c.C3283T						PASS	.						130.0	117.0	121.0					12																	81671123		1797	4055	5852	SO:0001583	missense	8499	exon27			CTTCCCGTCTTCT	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3283C>T	chr12.hg19:g.81671123G>A	ENSP00000450337:p.Arg1095Trp	15.0	0.0	.		20.0	12.0	.	NM_001220473	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	hg19	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686642	0.68157	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T;T	0.38240	1.92;1.93;1.55;1.15;1.5;1.92;1.92;1.6;1.85	5.71	3.83	0.44106	Sterile alpha motif/pointed domain (1);	0.131846	0.49916	D	0.000132	T	0.69178	0.3082	H	0.94847	3.59	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.77705	-0.2488	10	0.87932	D	0	-12.2793	13.6442	0.62270	0.0:0.0:0.4348:0.5652	.	1095	O75334	LIPA2_HUMAN	W	1095;1080;631;281;994;1106;1083;1089;990;1074	ENSP00000450337:R1095W;ENSP00000450298:R1080W;ENSP00000438337:R631W;ENSP00000445532:R281W;ENSP00000385093:R994W;ENSP00000327416:R1083W;ENSP00000449338:R1089W;ENSP00000388373:R990W;ENSP00000447868:R1074W	ENSP00000327416:R1083W	R	-	1	2	PPFIA2	80195254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.119000	0.50422	0.721000	0.32231	-0.181000	0.13052	CGG	.	.	.	none		0.274	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
RASSF9	9182	hgsc.bcm.edu	37	12	86199543	86199543	+	Missense_Mutation	SNP	T	T	C	rs367564230		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:86199543T>C	ENST00000361228.3	-	2	613	c.245A>G	c.(244-246)aAg>aGg	p.K82R		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	82	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCCTCTCCACTTCTCTATGAT	0.473																																					p.K82R		Atlas-SNP	.											.	RASSF9	100	.	0			c.A245G						PASS	.						95.0	95.0	95.0					12																	86199543		1885	4121	6006	SO:0001583	missense	9182	exon2			CTCCACTTCTCTA		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.245A>G	chr12.hg19:g.86199543T>C	ENSP00000354884:p.Lys82Arg	137.0	0.0	.		216.0	53.0	.	NM_005447	B3KMQ4|Q8N5U8	Missense_Mutation	SNP	ENST00000361228.3	hg19	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.084459	0.55861	.	.	ENSG00000198774	ENST00000361228	T	0.46451	0.87	4.82	4.82	0.62117	Ras-association (2);	0.139782	0.47852	D	0.000216	T	0.30479	0.0766	L	0.33485	1.01	0.37061	D	0.898052	P	0.46784	0.884	B	0.39152	0.292	T	0.22487	-1.0215	10	0.16420	T	0.52	-5.5864	14.68	0.69009	0.0:0.0:0.0:1.0	.	82	O75901	RASF9_HUMAN	R	82	ENSP00000354884:K82R	ENSP00000354884:K82R	K	-	2	0	RASSF9	84723674	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.997000	0.40786	1.941000	0.56285	0.421000	0.28195	AAG	.	.	.	alt		0.473	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
TECPR2	9895	hgsc.bcm.edu	37	14	102906785	102906786	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr14:102906785_102906786GG>TT	ENST00000359520.7	+	11	2817_2818	c.2591_2592GG>TT	c.(2590-2592)tGG>tTT	p.W864F	TECPR2_ENST00000558678.1_Missense_Mutation_p.W864F	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	864					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCCCTTCTCTGGAAGATTGAAC	0.446																																					p.W864L|p.W864C		Atlas-SNP	.											.	TECPR2	114	.	0			c.G2591T|c.G2592T						PASS	.																																			SO:0001583	missense	9895	exon11			TTCTCTGGAAGAT|TCTCTGGAAGATT	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		Exception_encountered	chr14.hg19:g.102906785_102906786delinsTT	ENSP00000352510:p.Trp864Phe	179.0|177.0	0.0	.		187.0|183.0	64.0|63.0	.	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	hg19	CCDS32162.1																																																																																			.	.	.	none		0.446	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
TRPM1	4308	hgsc.bcm.edu	37	15	31362391	31362391	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:31362391G>T	ENST00000256552.6	-	4	269	c.122C>A	c.(121-123)cCt>cAt	p.P41H	TRPM1_ENST00000397795.2_Missense_Mutation_p.P19H|TRPM1_ENST00000542188.1_Missense_Mutation_p.P58H|TRPM1_ENST00000559179.1_Missense_Mutation_p.P19H	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		ACTTGGCAGAGGGGGGATATG	0.507																																					p.P58H		Atlas-SNP	.											.	TRPM1	183	.	0			c.C173A						PASS	.						243.0	229.0	234.0					15																	31362391		1976	4162	6138	SO:0001583	missense	4308	exon3			GGCAGAGGGGGGA	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.122C>A	chr15.hg19:g.31362391G>T	ENSP00000256552:p.Pro41His	370.0	1.0	.		382.0	147.0	.	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	hg19	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336399	0.24253	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.55760	0.5;0.5;0.5	6.03	5.12	0.69794	.	0.408600	0.22654	U	0.057296	T	0.60340	0.2261	L	0.36672	1.1	0.33691	D	0.613333	D;D	0.71674	0.998;0.983	D;P	0.73708	0.981;0.827	T	0.71192	-0.4665	10	0.72032	D	0.01	-15.4292	9.4507	0.38725	0.2106:0.0:0.7894:0.0	.	19;19	Q6PE48;Q7Z4N2	.;TRPM1_HUMAN	H	19;58;41;19	ENSP00000380897:P19H;ENSP00000437849:P58H;ENSP00000256552:P41H	ENSP00000256552:P41H	P	-	2	0	TRPM1	29149683	1.000000	0.71417	0.918000	0.36340	0.307000	0.27823	3.722000	0.54948	1.541000	0.49316	0.655000	0.94253	CCT	.	.	.	none		0.507	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
ANKDD1A	348094	hgsc.bcm.edu	37	15	65223120	65223120	+	Splice_Site	SNP	T	T	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:65223120T>G	ENST00000380230.3	+	7	698		c.e7+2		ANKDD1A_ENST00000491145.1_Splice_Site|ANKDD1A_ENST00000496660.1_Splice_Site|ANKDD1A_ENST00000395720.1_Splice_Site|ANKDD1A_ENST00000357698.3_Splice_Site|ANKDD1A_ENST00000395723.1_Splice_Site|ANKDD1A_ENST00000319580.8_Splice_Site	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						CAGAATGCGGTGAGTCACCGC	0.607																																					.		Atlas-SNP	.											.	ANKDD1A	47	.	0			c.669+2T>G						PASS	.						68.0	54.0	59.0					15																	65223120		2202	4299	6501	SO:0001630	splice_region_variant	348094	exon7			ATGCGGTGAGTCA		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.669+2T>G	chr15.hg19:g.65223120T>G		24.0	0.0	.		33.0	14.0	.	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Splice_Site	SNP	ENST00000380230.3	hg19	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	T	17.32	3.360134	0.61403	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720;ENST00000319597;ENST00000496660;ENST00000483400;ENST00000395723	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.27	0.37666	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKDD1A	63010173	1.000000	0.71417	0.940000	0.37924	0.376000	0.30014	5.235000	0.65348	1.699000	0.51192	0.459000	0.35465	.	.	.	.	none		0.607	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	Intron
IGDCC4	57722	hgsc.bcm.edu	37	15	65684505	65684505	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:65684505T>A	ENST00000352385.2	-	11	2298	c.2089A>T	c.(2089-2091)Aag>Tag	p.K697*		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	697	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTCACTTTCTTCTTGAGCCGG	0.632																																					p.K697X		Atlas-SNP	.											.	IGDCC4	95	.	0			c.A2089T						PASS	.						32.0	39.0	37.0					15																	65684505		2184	4286	6470	SO:0001587	stop_gained	57722	exon11			CTTTCTTCTTGAG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2089A>T	chr15.hg19:g.65684505T>A	ENSP00000319623:p.Lys697*	91.0	0.0	.		112.0	44.0	.	NM_020962	Q9HCE4	Nonsense_Mutation	SNP	ENST00000352385.2	hg19	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	T	41	8.769097	0.98948	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	.	.	.	5.49	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-23.8407	10.907	0.47086	0.0:0.0731:0.0:0.9269	.	.	.	.	X	697;426	.	ENSP00000319623:K697X	K	-	1	0	IGDCC4	63471558	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	5.434000	0.66526	0.947000	0.37659	0.533000	0.62120	AAG	.	.	.	none		0.632	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
MAP2K5	5607	hgsc.bcm.edu	37	15	67985904	67985904	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:67985904G>T	ENST00000178640.5	+	15	1597	c.970G>T	c.(970-972)Gcg>Tcg	p.A324S	MAP2K5_ENST00000395476.2_Missense_Mutation_p.A324S|MAP2K5_ENST00000354498.5_Missense_Mutation_p.A288S|MAP2K5_ENST00000340972.4_Missense_Mutation_p.A134S	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						TGCTTATATGGCGGTAAGTAA	0.303																																					p.A324S		Atlas-SNP	.											.	MAP2K5	70	.	0			c.G970T						PASS	.						132.0	126.0	128.0					15																	67985904		2200	4297	6497	SO:0001583	missense	5607	exon15			TATATGGCGGTAA	U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.970G>T	chr15.hg19:g.67985904G>T	ENSP00000178640:p.Ala324Ser	86.0	0.0	.		95.0	30.0	.	NM_145160	B4DE43|Q92961|Q92962	Missense_Mutation	SNP	ENST00000178640.5	hg19	CCDS10224.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.107121	0.37145	.	.	ENSG00000137764	ENST00000541298;ENST00000395476;ENST00000178640;ENST00000354498;ENST00000340972	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36358	0.0964	L	0.31752	0.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.02728	-1.1118	10	0.28530	T	0.3	-16.1519	19.5552	0.95342	0.0:0.0:1.0:0.0	.	134;324;324	A6NK28;Q13163-2;Q13163	.;.;MP2K5_HUMAN	S	324;324;324;288;134	ENSP00000378859:A324S;ENSP00000178640:A324S;ENSP00000346493:A288S;ENSP00000342101:A134S	ENSP00000178640:A324S	A	+	1	0	MAP2K5	65772958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.968000	0.93407	2.630000	0.89119	0.585000	0.79938	GCG	.	.	.	none		0.303	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257041.1	NM_145162	
RASGRF1	5923	hgsc.bcm.edu	37	15	79254568	79254568	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr15:79254568T>C	ENST00000419573.3	-	28	4014	c.3740A>G	c.(3739-3741)tAt>tGt	p.Y1247C	RASGRF1_ENST00000394745.3_Missense_Mutation_p.Y463C|RASGRF1_ENST00000558480.2_Missense_Mutation_p.Y1231C	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	1247	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GTCCAGTAAATATTGCGTTAC	0.468																																					p.Y1247C		Atlas-SNP	.											.	RASGRF1	168	.	0			c.A3740G						PASS	.						58.0	56.0	56.0					15																	79254568		2196	4290	6486	SO:0001583	missense	5923	exon28			AGTAAATATTGCG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.3740A>G	chr15.hg19:g.79254568T>C	ENSP00000405963:p.Tyr1247Cys	11.0	0.0	.		13.0	5.0	.	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.169141	0.57584	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.34472	1.36;1.36	3.96	3.96	0.45880	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000003	T	0.56381	0.1981	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.68483	0.867;0.958	T	0.60826	-0.7186	10	0.87932	D	0	.	9.5252	0.39160	0.0:0.0:0.0:1.0	.	1249;1231	Q13972;F8VPA5	RGRF1_HUMAN;.	C	1247;1231;463	ENSP00000405963:Y1247C;ENSP00000378228:Y463C	ENSP00000378224:Y1231C	Y	-	2	0	RASGRF1	77041623	1.000000	0.71417	0.170000	0.22879	0.948000	0.59901	6.883000	0.75595	1.545000	0.49373	0.402000	0.26972	TAT	.	.	.	none		0.468	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
MYH8	4626	hgsc.bcm.edu	37	17	10312636	10312636	+	Silent	SNP	A	A	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr17:10312636A>T	ENST00000403437.2	-	16	1951	c.1857T>A	c.(1855-1857)acT>acA	p.T619T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	619	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GACTGGCTAGAGTCTTCATTG	0.423									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.T619T		Atlas-SNP	.											.	MYH8	346	.	0			c.T1857A						PASS	.						67.0	69.0	68.0					17																	10312636		2203	4300	6503	SO:0001819	synonymous_variant	4626	exon16	Familial Cancer Database	Carney Complex Variant	GGCTAGAGTCTTC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1857T>A	chr17.hg19:g.10312636A>T		124.0	0.0	.		147.0	77.0	.	NM_002472	Q14910	Silent	SNP	ENST00000403437.2	hg19	CCDS11153.1																																																																																			.	.	.	none		0.423	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
MISP	126353	hgsc.bcm.edu	37	19	758211	758211	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:758211C>A	ENST00000215582.6	+	2	1368	c.1265C>A	c.(1264-1266)cCt>cAt	p.P422H		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	422					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CGCATCCCACCTGATGCCTAC	0.652																																					p.P422H		Atlas-SNP	.											.	C19orf21	56	.	0			c.C1265A						PASS	.						25.0	20.0	22.0					19																	758211		2201	4298	6499	SO:0001583	missense	126353	exon2			TCCCACCTGATGC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1265C>A	chr19.hg19:g.758211C>A	ENSP00000215582:p.Pro422His	32.0	0.0	.		47.0	25.0	.	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	hg19	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819234	0.50633	.	.	ENSG00000099812	ENST00000215582	T	0.35421	1.31	4.11	-1.68	0.08212	.	2.124670	0.02785	N	0.121388	T	0.47173	0.1431	L	0.54323	1.7	0.09310	N	1	D	0.69078	0.997	P	0.57548	0.823	T	0.41875	-0.9484	10	0.59425	D	0.04	-0.009	5.8678	0.18786	0.0:0.4423:0.1475:0.4102	.	422	Q8IVT2	CS021_HUMAN	H	422	ENSP00000215582:P422H	ENSP00000215582:P422H	P	+	2	0	C19orf21	709211	0.000000	0.05858	0.001000	0.08648	0.398000	0.30690	-0.883000	0.04170	-0.165000	0.10908	0.491000	0.48974	CCT	.	.	.	none		0.652	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
TUBB4A	10382	hgsc.bcm.edu	37	19	6501326	6501326	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:6501326C>A	ENST00000264071.2	-	3	620	c.249G>T	c.(247-249)caG>caT	p.Q83H	TUBB4A_ENST00000598006.1_Missense_Mutation_p.R69I|TUBB4A_ENST00000601152.1_Missense_Mutation_p.R58I|TUBB4A_ENST00000540257.1_Missense_Mutation_p.Q83H|TUBB4A_ENST00000596926.1_Missense_Mutation_p.Q83H			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	83					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										GCCGAAAGATCTGACCGAAGG	0.577																																					p.Q83H		Atlas-SNP	.											.	.	.	.	0			c.G249T						PASS	.						49.0	44.0	46.0					19																	6501326		2203	4300	6503	SO:0001583	missense	10382	exon3			AAAGATCTGACCG	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.249G>T	chr19.hg19:g.6501326C>A	ENSP00000264071:p.Gln83His	65.0	0.0	.		53.0	27.0	.	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	hg19	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	5.184	0.219490	0.09863	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	T;T	0.70164	-0.46;-0.46	3.83	1.13	0.20643	.	0.000000	0.64402	D	0.000003	T	0.65491	0.2696	M	0.82923	2.615	0.40614	D	0.981708	B	0.10296	0.003	B	0.08055	0.003	T	0.67039	-0.5771	10	0.87932	D	0	.	9.7907	0.40704	0.0:0.7717:0.0:0.2283	.	83	P04350	TBB4A_HUMAN	H	83	ENSP00000264071:Q83H;ENSP00000443590:Q83H	ENSP00000264071:Q83H	Q	-	3	2	TUBB4	6452326	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	2.026000	0.41069	0.592000	0.29728	0.313000	0.20887	CAG	.	.	.	none		0.577	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
ZNF557	79230	hgsc.bcm.edu	37	19	7083599	7083599	+	Silent	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:7083599T>C	ENST00000439035.2	+	8	1356	c.1116T>C	c.(1114-1116)agT>agC	p.S372S	ZNF557_ENST00000414706.1_Silent_p.S379S|ZNF557_ENST00000252840.6_Silent_p.S379S			Q8N988	ZN557_HUMAN	zinc finger protein 557	372					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		ATGAGTGCAGTGATTGTGGAA	0.368																																					p.S379S		Atlas-SNP	.											.	ZNF557	40	.	0			c.T1137C						PASS	.						64.0	68.0	67.0					19																	7083599		2125	4254	6379	SO:0001819	synonymous_variant	79230	exon8			GTGCAGTGATTGT	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.1116T>C	chr19.hg19:g.7083599T>C		76.0	0.0	.		65.0	16.0	.	NM_001044387	Q6PEJ3|Q9BTZ1	Silent	SNP	ENST00000439035.2	hg19	CCDS45945.1																																																																																			.	.	.	none		0.368	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	
SMARCA4	6597	hgsc.bcm.edu	37	19	11135092	11135092	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:11135092A>G	ENST00000429416.3	+	22	3340	c.3059A>G	c.(3058-3060)gAt>gGt	p.D1020G	SMARCA4_ENST00000413806.3_Missense_Mutation_p.D1020G|SMARCA4_ENST00000589677.1_Missense_Mutation_p.D1020G|SMARCA4_ENST00000358026.2_Missense_Mutation_p.D1020G|SMARCA4_ENST00000344626.4_Missense_Mutation_p.D1020G|SMARCA4_ENST00000590574.1_Missense_Mutation_p.D1020G|SMARCA4_ENST00000541122.2_Missense_Mutation_p.D1020G|SMARCA4_ENST00000450717.3_Missense_Mutation_p.D1020G|SMARCA4_ENST00000444061.3_Missense_Mutation_p.D1020G	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1020					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTGCTGACTGATGGCTCCGAG	0.632			"""F, N, Mis"""		NSCLC																																p.D1020G		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.A3059G						PASS	.						73.0	58.0	63.0					19																	11135092		2203	4300	6503	SO:0001583	missense	6597	exon21			TGACTGATGGCTC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3059A>G	chr19.hg19:g.11135092A>G	ENSP00000395654:p.Asp1020Gly	77.0	0.0	.		66.0	21.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166378	0.57476	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	4.76	4.76	0.60689	SNF2-related (1);	0.000000	0.85682	D	0.000000	T	0.82130	0.4970	L	0.37897	1.145	0.58432	D	0.999994	D;B;P;B;D;B;P;P	0.56287	0.975;0.418;0.78;0.002;0.975;0.0;0.78;0.78	P;B;B;B;P;B;P;P	0.57720	0.826;0.304;0.377;0.007;0.826;0.014;0.531;0.531	D	0.84375	0.0546	10	0.87932	D	0	-36.5944	13.3812	0.60768	1.0:0.0:0.0:0.0	.	1020;1020;1020;1020;1020;240;1020;1020	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	G	1020;1020;1084;1020;1020;1020;1020;1020	ENSP00000395654:D1020G;ENSP00000350720:D1020G;ENSP00000343896:D1020G;ENSP00000445036:D1020G;ENSP00000392837:D1020G;ENSP00000397783:D1020G;ENSP00000414727:D1020G	ENSP00000343896:D1020G	D	+	2	0	SMARCA4	10996092	1.000000	0.71417	0.922000	0.36590	0.498000	0.33706	8.908000	0.92640	1.997000	0.58415	0.533000	0.62120	GAT	.	.	.	none		0.632	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ZNF443	10224	hgsc.bcm.edu	37	19	12541116	12541116	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:12541116C>T	ENST00000301547.5	-	4	2067	c.1870G>A	c.(1870-1872)Gca>Aca	p.A624T	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	624					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GAAGCAAATGCTTTCCCACAT	0.408																																					p.A624T		Atlas-SNP	.											.	ZNF443	63	.	0			c.G1870A						PASS	.						62.0	68.0	66.0					19																	12541116		2200	4292	6492	SO:0001583	missense	10224	exon4			CAAATGCTTTCCC	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.1870G>A	chr19.hg19:g.12541116C>T	ENSP00000301547:p.Ala624Thr	183.0	0.0	.		218.0	64.0	.	NM_005815		Missense_Mutation	SNP	ENST00000301547.5	hg19	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473549	0.26423	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.13778	2.56	1.36	-0.965	0.10323	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09686	0.0238	L	0.28504	0.86	0.09310	N	1	B	0.30664	0.289	B	0.37888	0.26	T	0.39231	-0.9624	9	0.38643	T	0.18	.	1.9484	0.03361	0.2638:0.3516:0.0:0.3846	.	624	Q9Y2A4	ZN443_HUMAN	T	624;596	ENSP00000301547:A624T	ENSP00000301547:A624T	A	-	1	0	ZNF443	12402116	0.000000	0.05858	0.001000	0.08648	0.586000	0.36452	-1.775000	0.01783	-0.214000	0.10078	0.454000	0.30748	GCA	.	.	.	none		0.408	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
RHPN2	85415	hgsc.bcm.edu	37	19	33493859	33493859	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:33493859C>T	ENST00000254260.3	-	8	843	c.808G>A	c.(808-810)Gac>Aac	p.D270N	RHPN2_ENST00000400226.4_Missense_Mutation_p.D119N	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	270	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.D270N(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GGGCTCATGTCGTAACTTGGA	0.433																																					p.D270N		Atlas-SNP	.											RHPN2,colon,carcinoma,0,1	RHPN2	107	.	1	Substitution - Missense(1)	large_intestine(1)	c.G808A						PASS	.						51.0	46.0	48.0					19																	33493859		2203	4300	6503	SO:0001583	missense	85415	exon8			TCATGTCGTAACT	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.808G>A	chr19.hg19:g.33493859C>T	ENSP00000254260:p.Asp270Asn	62.0	0.0	.		83.0	4.0	.	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	hg19	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	31	5.102511	0.94245	.	.	ENSG00000131941	ENST00000254260;ENST00000400226	T;T	0.55760	0.5;0.5	4.7	4.7	0.59300	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.79221	0.4409	H	0.95187	3.635	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	D	0.86783	0.1980	10	0.87932	D	0	0.141	18.0539	0.89358	0.0:1.0:0.0:0.0	.	270	Q8IUC4	RHPN2_HUMAN	N	270;119	ENSP00000254260:D270N;ENSP00000402244:D119N	ENSP00000254260:D270N	D	-	1	0	RHPN2	38185699	1.000000	0.71417	0.996000	0.52242	0.938000	0.57974	7.752000	0.85141	2.325000	0.78763	0.478000	0.44815	GAC	.	.	.	none		0.433	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
DNMT3B	1789	hgsc.bcm.edu	37	20	31374365	31374365	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:31374365C>G	ENST00000328111.2	+	5	685	c.364C>G	c.(364-366)Cgt>Ggt	p.R122G	DNMT3B_ENST00000443239.3_Intron|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000353855.2_Missense_Mutation_p.R122G|DNMT3B_ENST00000348286.2_Missense_Mutation_p.R122G|DNMT3B_ENST00000201963.3_Missense_Mutation_p.R134G|DNMT3B_ENST00000344505.4_Missense_Mutation_p.R122G|DNMT3B_ENST00000375623.4_Intron	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	122	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.R134C(1)|p.R122C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCCTTCCCCACGTTCCACCCG	0.632																																					p.R134G		Atlas-SNP	.											DNMT3B_ENST00000201963,NS,carcinoma,0,2	DNMT3B	196	.	2	Substitution - Missense(2)	lung(2)	c.C400G						PASS	.						68.0	66.0	66.0					20																	31374365		2203	4300	6503	SO:0001583	missense	1789	exon5			TCCCCACGTTCCA		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.364C>G	chr20.hg19:g.31374365C>G	ENSP00000328547:p.Arg122Gly	114.0	0.0	.		123.0	54.0	.	NM_175850	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	hg19	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465264	0.26335	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000344505;ENST00000201963	D;D;D;D;D	0.98400	-4.67;-4.89;-4.82;-4.77;-4.91	4.84	3.86	0.44501	.	0.246993	0.38326	N	0.001738	D	0.97219	0.9091	L	0.27053	0.805	0.23070	N	0.998346	D;P;P;P	0.71674	0.998;0.811;0.804;0.752	D;B;B;B	0.80764	0.994;0.309;0.28;0.191	D	0.92382	0.5914	10	0.26408	T	0.33	-6.5354	9.8664	0.41145	0.2125:0.7875:0.0:0.0	.	134;122;122;122	Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;DNM3B_HUMAN	G	122;208;122;122;122;134	ENSP00000328547:R122G;ENSP00000313397:R122G;ENSP00000337764:R122G;ENSP00000345105:R122G;ENSP00000201963:R134G	ENSP00000201963:R134G	R	+	1	0	DNMT3B	30838026	0.456000	0.25744	0.018000	0.16275	0.031000	0.12232	1.919000	0.40015	1.211000	0.43351	0.561000	0.74099	CGT	.	.	.	none		0.632	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
MMP24	10893	hgsc.bcm.edu	37	20	33851627	33851627	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:33851627T>C	ENST00000246186.6	+	5	936	c.851T>C	c.(850-852)cTg>cCg	p.L284P	MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000453892.1_RNA|MMP24-AS1_ENST00000438751.1_RNA|EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000454184.1_RNA|MMP24-AS1_ENST00000456350.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	284					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	GTGCATGAGCTGGGCCACGCG	0.622																																					p.L284P		Atlas-SNP	.											.	MMP24	35	.	0			c.T851C						PASS	.						24.0	24.0	24.0					20																	33851627		2203	4300	6503	SO:0001583	missense	10893	exon5			ATGAGCTGGGCCA	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.851T>C	chr20.hg19:g.33851627T>C	ENSP00000246186:p.Leu284Pro	16.0	0.0	.		23.0	10.0	.	NM_006690	B7ZBG8|Q9H440	Missense_Mutation	SNP	ENST00000246186.6	hg19	CCDS46593.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546808	0.86022	.	.	ENSG00000125966	ENST00000246186;ENST00000540655	T	0.35605	1.3	5.05	5.05	0.67936	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.72145	0.3424	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82337	-0.0507	10	0.87932	D	0	.	14.1037	0.65075	0.0:0.0:0.0:1.0	.	284	Q9Y5R2	MMP24_HUMAN	P	284;232	ENSP00000246186:L284P	ENSP00000246186:L284P	L	+	2	0	MMP24	33315043	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.819000	0.86621	2.105000	0.64084	0.533000	0.62120	CTG	.	.	.	none		0.622	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078851.4	NM_006690	
FAM217B	63939	hgsc.bcm.edu	37	20	58519969	58519969	+	Missense_Mutation	SNP	G	G	C	rs377074437		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:58519969G>C	ENST00000358293.3	+	5	1386	c.971G>C	c.(970-972)cGa>cCa	p.R324P	FAM217B_ENST00000360816.3_Missense_Mutation_p.R324P|FAM217B_ENST00000469084.1_3'UTR	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	324																	GGTCACATTCGAGTTCCCAAA	0.493																																					p.R324P		Atlas-SNP	.											.	.	.	.	0			c.G971C						PASS	.						65.0	68.0	67.0					20																	58519969		2203	4300	6503	SO:0001583	missense	63939	exon4			ACATTCGAGTTCC	AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.971G>C	chr20.hg19:g.58519969G>C	ENSP00000351040:p.Arg324Pro	76.0	0.0	.		98.0	4.0	.	NM_022106	B3KWH1|Q9NTA3	Missense_Mutation	SNP	ENST00000358293.3	hg19	CCDS13484.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813583	0.70912	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.26660	1.72;1.72	5.35	4.4	0.53042	.	0.512737	0.15763	N	0.245848	T	0.38268	0.1034	L	0.29908	0.895	0.19300	N	0.999975	D	0.89917	1.0	D	0.83275	0.996	T	0.11817	-1.0572	10	0.48119	T	0.1	-14.475	13.4353	0.61079	0.0753:0.0:0.9247:0.0	.	324	Q9NTX9	CT177_HUMAN	P	324	ENSP00000351040:R324P;ENSP00000354056:R324P	ENSP00000351040:R324P	R	+	2	0	C20orf177	57953364	0.341000	0.24801	0.133000	0.22050	0.030000	0.12068	3.151000	0.50670	2.497000	0.84241	0.591000	0.81541	CGA	.	.	.	alt		0.493	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268139.1	NM_022106	
KRTAP10-12	386685	hgsc.bcm.edu	37	21	46117131	46117131	+	Silent	SNP	C	C	T	rs554572469|rs372249758	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr21:46117131C>T	ENST00000400365.3	+	1	45	c.15C>T	c.(13-15)tcC>tcT	p.S5S	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	5						keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CCGTCTGCTCCAGCGACCTGA	0.632																																					p.S5S		Atlas-SNP	.											.	KRTAP10-12	21	.	0			c.C15T						PASS	.	C	,	0,4330		0,0,2165	83.0	95.0	91.0		,15	2.2	1.0	21		91	1,8545		0,1,4272	no	intron,coding-synonymous	TSPEAR,KRTAP10-12	NM_144991.2,NM_198699.1	,	0,1,6437	TT,TC,CC		0.0117,0.0,0.0078	,	,5/246	46117131	1,12875	2165	4273	6438	SO:0001819	synonymous_variant	386685	exon1			CTGCTCCAGCGAC	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.15C>T	chr21.hg19:g.46117131C>T		217.0	0.0	.		188.0	70.0	.	NM_198699	B2RPA3	Silent	SNP	ENST00000400365.3	hg19	CCDS42967.1																																																																																			.	.	.	weak		0.632	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
C21orf58	54058	hgsc.bcm.edu	37	21	47731374	47731374	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr21:47731374C>A	ENST00000291691.7	-	6	1853	c.717G>T	c.(715-717)aaG>aaT	p.K239N	C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397683.1_Missense_Mutation_p.K133N|C21orf58_ENST00000397679.1_Missense_Mutation_p.K133N|C21orf58_ENST00000397682.3_Missense_Mutation_p.K133N|C21orf58_ENST00000397680.1_Missense_Mutation_p.K133N	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	239										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		ACTTACCTTCCTTAATACTTC	0.488																																					p.K239N		Atlas-SNP	.											.	C21orf58	25	.	0			c.G717T						PASS	.						109.0	90.0	97.0					21																	47731374		2202	4299	6501	SO:0001583	missense	54058	exon6			ACCTTCCTTAATA		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.717G>T	chr21.hg19:g.47731374C>A	ENSP00000291691:p.Lys239Asn	22.0	0.0	.		19.0	9.0	.	NM_058180	B3KPI1	Missense_Mutation	SNP	ENST00000291691.7	hg19	CCDS13735.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674609	0.47781	.	.	ENSG00000160298	ENST00000397683;ENST00000417060;ENST00000397682;ENST00000291691;ENST00000397679;ENST00000397680	T;T;T;T;T;T	0.68903	0.21;-0.34;0.21;-0.36;0.21;0.21	5.46	1.62	0.23740	.	0.148272	0.42548	D	0.000695	T	0.69806	0.3152	L	0.39898	1.24	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79784	0.993;0.993;0.985	T	0.68911	-0.5284	10	0.87932	D	0	-21.1468	7.2122	0.25939	0.0:0.6518:0.0:0.3482	.	239;133;239	P58505;Q8N7N9;P58505-2	CU058_HUMAN;.;.	N	133;201;133;239;133;133	ENSP00000380799:K133N;ENSP00000402356:K201N;ENSP00000380798:K133N;ENSP00000291691:K239N;ENSP00000380796:K133N;ENSP00000380797:K133N	ENSP00000291691:K239N	K	-	3	2	C21orf58	46555802	0.998000	0.40836	1.000000	0.80357	0.392000	0.30506	0.249000	0.18216	0.711000	0.32018	-0.199000	0.12753	AAG	.	.	.	none		0.488	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	
ZNRF3	84133	hgsc.bcm.edu	37	22	29445939	29445939	+	Silent	SNP	C	C	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:29445939C>G	ENST00000544604.2	+	8	1945	c.1770C>G	c.(1768-1770)ctC>ctG	p.L590L	ZNRF3_ENST00000402174.1_Silent_p.L490L|ZNRF3_ENST00000332811.4_Silent_p.L490L|ZNRF3_ENST00000406323.3_Silent_p.L490L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	590					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GCAGCTCCCTCAGCAGCGACT	0.672																																					p.L590L		Atlas-SNP	.											.	ZNRF3	75	.	0			c.C1770G						PASS	.						54.0	62.0	59.0					22																	29445939		2076	4222	6298	SO:0001819	synonymous_variant	84133	exon8			CTCCCTCAGCAGC	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.1770C>G	chr22.hg19:g.29445939C>G		220.0	0.0	.		235.0	81.0	.	NM_001206998	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Silent	SNP	ENST00000544604.2	hg19	CCDS56225.1																																																																																			.	.	.	none		0.672	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
SH3KBP1	30011	hgsc.bcm.edu	37	X	19626146	19626146	+	Silent	SNP	G	G	T			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:19626146G>T	ENST00000397821.3	-	9	1205	c.915C>A	c.(913-915)ggC>ggA	p.G305G	SH3KBP1_ENST00000379716.1_Silent_p.G67G|SH3KBP1_ENST00000379698.4_Silent_p.G268G|SH3KBP1_ENST00000379697.3_Silent_p.G349G|SH3KBP1_ENST00000477102.1_5'UTR|SH3KBP1_ENST00000541422.1_Silent_p.G44G	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	305	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						CTTCCCACCAGCCTACGTCGA	0.537																																					p.G305G		Atlas-SNP	.											.	SH3KBP1	96	.	0			c.C915A						PASS	.						82.0	64.0	70.0					X																	19626146		2203	4300	6503	SO:0001819	synonymous_variant	30011	exon9			CCACCAGCCTACG	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.915C>A	chrX.hg19:g.19626146G>T		38.0	0.0	.		50.0	40.0	.	NM_031892	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Silent	SNP	ENST00000397821.3	hg19	CCDS14193.1																																																																																			.	.	.	none		0.537	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
DCAF12L1	139170	hgsc.bcm.edu	37	X	125685498	125685498	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chrX:125685498A>C	ENST00000371126.1	-	1	1336	c.1094T>G	c.(1093-1095)gTg>gGg	p.V365G		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	365										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						ACCGGTGCCCACAGTGATGAT	0.632																																					p.V365G		Atlas-SNP	.											.	DCAF12L1	135	.	0			c.T1094G						PASS	.						35.0	38.0	37.0					X																	125685498		2203	4299	6502	SO:0001583	missense	139170	exon1			GTGCCCACAGTGA	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.1094T>G	chrX.hg19:g.125685498A>C	ENSP00000360167:p.Val365Gly	48.0	0.0	.		66.0	55.0	.	NM_178470	Q8IYK3	Missense_Mutation	SNP	ENST00000371126.1	hg19	CCDS14610.1	.	.	.	.	.	.	.	.	.	.	A	14.03	2.414963	0.42817	.	.	ENSG00000198889	ENST00000371126	T	0.66099	-0.19	3.64	3.64	0.41730	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.343553	0.17248	N	0.181261	T	0.65491	0.2696	M	0.73962	2.25	0.58432	D	0.999996	D	0.54397	0.966	P	0.47299	0.543	T	0.70691	-0.4802	10	0.87932	D	0	.	9.8475	0.41037	1.0:0.0:0.0:0.0	.	365	Q5VU92	DC121_HUMAN	G	365	ENSP00000360167:V365G	ENSP00000360167:V365G	V	-	2	0	DCAF12L1	125513179	1.000000	0.71417	0.124000	0.21820	0.171000	0.22731	5.855000	0.69510	1.683000	0.51011	0.350000	0.21858	GTG	.	.	.	none		0.632	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058186.1	NM_178470	
SRRT	51593	hgsc.bcm.edu	37	7	100485469	100485473	+	Frame_Shift_Del	DEL	GCCCC	GCCCC	-	rs568329863		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	GCCCC	GCCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr7:100485469_100485473delGCCCC	ENST00000347433.4	+	17	2473_2477	c.2315_2319delGCCCC	c.(2314-2319)ggccccfs	p.GP772fs	SRRT_ENST00000457580.2_Frame_Shift_Del_p.GP772fs|SRRT_ENST00000388793.4_Frame_Shift_Del_p.GP771fs|SRRT_ENST00000432932.1_Frame_Shift_Del_p.GP771fs			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	772	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CAGCCACCTGGCCCCGCCCAGAGTA	0.512																																					p.772_773del		Atlas-INDEL	.											.	SRRT	108	.	0			c.2314_2318del						PASS	.																																			SO:0001589	frameshift_variant	51593	exon17			.		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2315_2319delGCCCC	chr7.hg19:g.100485469_100485473delGCCCC	ENSP00000314491:p.Gly772fs	107.0	0.0	0		224.0	18.0	0.0803571	NM_001128853	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Frame_Shift_Del	DEL	ENST00000347433.4	hg19	CCDS34709.1																																																																																			.	.	.	none		0.512	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
SIGLEC11	114132	hgsc.bcm.edu	37	19	50463980	50463980	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:50463980delT	ENST00000447370.2	-	2	379	c.289delA	c.(289-291)atgfs	p.M97fs	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Frame_Shift_Del_p.M97fs	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	97	Ig-like V-type.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CGGGTGCTCATTTCCACCTCT	0.582																																					p.M97fs		Atlas-INDEL	.											.	SIGLEC11	70	.	0			c.290delT						PASS	.						19.0	23.0	22.0					19																	50463980		2107	4293	6400	SO:0001589	frameshift_variant	114132	exon2			.	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.289delA	chr19.hg19:g.50463980delT	ENSP00000412361:p.Met97fs	116.0	0.0	0		124.0	11.0	0.0887097	NM_001135163		Frame_Shift_Del	DEL	ENST00000447370.2	hg19	CCDS12790.2																																																																																			.	.	.	none		0.582	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
RFPL3	10738	hgsc.bcm.edu	37	22	32754385	32754386	+	Frame_Shift_Del	DEL	GC	GC	-	rs9621427	byFrequency	TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:32754385_32754386delGC	ENST00000249007.4	+	1	532_533	c.327_328delGC	c.(325-330)aagctgfs	p.KL109fs	RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000397468.1_Frame_Shift_Del_p.KL80fs|RFPL3_ENST00000382088.3_Frame_Shift_Del_p.KL80fs	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	109	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						TGGAGCCCAAGCTGAAGAAGAT	0.5																																					p.109_109del		Atlas-INDEL	.											.	RFPL3	91	.	0			c.326_327del						PASS	.																																			SO:0001589	frameshift_variant	10738	exon1			.	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.327_328delGC	chr22.hg19:g.32754385_32754386delGC	ENSP00000249007:p.Lys109fs	174.0	0.0	0		184.0	72.0	0.391304	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Frame_Shift_Del	DEL	ENST00000249007.4	hg19	CCDS43011.1																																																																																			.	.	.	none		0.500	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
AIM1	202	hgsc.bcm.edu	37	6	106967843	106967843	+	Frame_Shift_Del	DEL	T	T	-	rs551716379		TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:106967843delT	ENST00000369066.3	+	2	2023	c.1536delT	c.(1534-1536)aatfs	p.N512fs		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GTCAGAACAATGAGAAAATGC	0.453																																					p.N512fs		Atlas-INDEL	.											.	AIM1	161	.	0			c.1535delA						PASS	.						82.0	90.0	87.0					6																	106967843		2203	4300	6503	SO:0001589	frameshift_variant	202	exon2			.	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1536delT	chr6.hg19:g.106967843delT	ENSP00000358062:p.Asn512fs	120.0	0.0	0		150.0	60.0	0.4	NM_001624	Q6P2P0|Q9BTM3	Frame_Shift_Del	DEL	ENST00000369066.3	hg19	CCDS34506.1																																																																																			.	.	.	none		0.453	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
ZNF814	730051	hgsc.bcm.edu	37	19	58386399	58386399	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr19:58386399delT	ENST00000435989.2	-	3	593	c.359delA	c.(358-360)cacfs	p.H120fs	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	120					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CTCACACCTGTGCAGTTTCTG	0.502																																					p.H120fs		Atlas-INDEL	.											.	ZNF814	93	.	0			c.360delC						PASS	.						18.0	14.0	15.0					19																	58386399		692	1568	2260	SO:0001589	frameshift_variant	730051	exon3			.		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.359delA	chr19.hg19:g.58386399delT	ENSP00000410545:p.His120fs	109.0	0.0	0		118.0	16.0	0.135593	NM_001144989	A6NF35	Frame_Shift_Del	DEL	ENST00000435989.2	hg19	CCDS46212.1																																																																																			.	.	.	none		0.502	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
SGK2	10110	hgsc.bcm.edu	37	20	42203603	42203603	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr20:42203603delT	ENST00000341458.4	+	9	1051	c.832delT	c.(832-834)tggfs	p.W278fs	SGK2_ENST00000423407.3_Frame_Shift_Del_p.W218fs|SGK2_ENST00000426287.1_Frame_Shift_Del_p.W244fs|SGK2_ENST00000373100.1_Frame_Shift_Del_p.W218fs|SGK2_ENST00000373092.3_Frame_Shift_Del_p.W218fs|SGK2_ENST00000373077.1_Frame_Shift_Del_p.W217fs	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGTGGACTGGTGGTGCTTGGG	0.512																																					p.W277fs		Atlas-INDEL	.											.	SGK2	50	.	0			c.831delG						PASS	.						114.0	103.0	107.0					20																	42203603		2203	4300	6503	SO:0001589	frameshift_variant	10110	exon9			.	AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.832delT	chr20.hg19:g.42203603delT	ENSP00000340608:p.Trp278fs	52.0	0.0	0		48.0	21.0	0.4375	NM_016276	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Frame_Shift_Del	DEL	ENST00000341458.4	hg19	CCDS13320.1																																																																																			.	.	.	none		0.512	SGK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080383.1		
IL36RN	26525	hgsc.bcm.edu	37	2	113820191	113820191	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr2:113820191delG	ENST00000393200.2	+	5	566	c.405delG	c.(403-405)cagfs	p.Q135fs	IL36RN_ENST00000346807.3_Frame_Shift_Del_p.Q135fs	NM_012275.2	NP_036407.1	Q9UBH0	I36RA_HUMAN	interleukin 36 receptor antagonist	135					antifungal humoral response (GO:0019732)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of interferon-gamma secretion (GO:1902714)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)	extracellular space (GO:0005615)	interleukin-1 receptor antagonist activity (GO:0005152)			large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GACTCACCCAGCTTCCCGAGA	0.632																																					p.Q135fs		Atlas-INDEL	.											.	IL36RN	15	.	0			c.404delA						PASS	.						50.0	48.0	49.0					2																	113820191		2203	4300	6503	SO:0001589	frameshift_variant	26525	exon5			.	AF201830	CCDS2111.1	2q14	2014-09-17	2011-06-06	2011-06-06	ENSG00000136695	ENSG00000136695		"""Interleukins and interleukin receptors"""	15561	protein-coding gene	gene with protein product	"""family of interleukin 1-delta"", ""interleukin-1 receptor antagonist homolog 1"", ""interleukin-1 HY1"", ""IL-1 related protein 3"""	605507	"""interleukin 1 family, member 5 (delta)"""	IL1F5		10625660, 10512743, 11574262	Standard	NM_012275		Approved	FIL1, FIL1(DELTA), FIL1D, IL1HY1, IL1RP3, IL1L1, IL-1F5, IL36RA, MGC29840	uc002tit.3	Q9UBH0	OTTHUMG00000131337	ENST00000393200.2:c.405delG	chr2.hg19:g.113820191delG	ENSP00000376896:p.Gln135fs	101.0	0.0	0		71.0	18.0	0.253521	NM_173170	A8K2I4|Q56AT9|Q7RTZ6	Frame_Shift_Del	DEL	ENST00000393200.2	hg19	CCDS2111.1																																																																																			.	.	.	none		0.632	IL36RN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330729.1	NM_173170	
ADTRP	84830	hgsc.bcm.edu	37	6	11723657	11723657	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:11723657delC	ENST00000414691.3	-	5	993	c.583delG	c.(583-585)gctfs	p.A195fs	ADTRP_ENST00000514824.1_5'UTR|ADTRP_ENST00000379413.2_Frame_Shift_Del_p.A195fs|ADTRP_ENST00000229583.5_Frame_Shift_Del_p.A213fs	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGAAGAAAGCTGCTAGACCC	0.483																																					p.A213fs		Atlas-INDEL	.											.,1	ADTRP	3	.	0			c.638delC						PASS	.						209.0	208.0	209.0					6																	11723657		2203	4300	6503	SO:0001589	frameshift_variant	84830	exon6			.	AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.583delG	chr6.hg19:g.11723657delC	ENSP00000404416:p.Ala195fs	246.0	0.0	0		259.0	92.0	0.355212	NM_001143948	B2R7T9|B4DV39|Q5THW1	Frame_Shift_Del	DEL	ENST00000414691.3	hg19	CCDS4521.1																																																																																			.	.	.	none		0.483	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039864.3	NM_032744	
PC	5091	hgsc.bcm.edu	37	11	66617140	66617141	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr11:66617140_66617141insG	ENST00000393958.2	-	20	3181_3182	c.3088_3089insC	c.(3088-3090)ctgfs	p.L1030fs	PC_ENST00000528224.1_5'UTR|PC_ENST00000529047.1_Frame_Shift_Ins_p.L150fs|PC_ENST00000393960.1_Frame_Shift_Ins_p.L1030fs|PC_ENST00000393955.2_Frame_Shift_Ins_p.L1030fs	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	1030					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CAGGCTATCCAGGGGGCCAAAG	0.604																																					p.L1030fs		Atlas-INDEL	.											.	PC	116	.	0			c.3089_3090insC						PASS	.																																			SO:0001589	frameshift_variant	5091	exon20			.	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.3089dupC	chr11.hg19:g.66617145_66617145dupG	ENSP00000377530:p.Leu1030fs	77.0	0.0	0		77.0	18.0	0.233766	NM_000920	B4DN00|Q16705	Frame_Shift_Ins	INS	ENST00000393958.2	hg19	CCDS8152.1																																																																																			.	.	.	none		0.604	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
ATP2A2	488	hgsc.bcm.edu	37	12	110765478	110765478	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr12:110765478delC	ENST00000539276.2	+	8	860	c.751delC	c.(751-753)caafs	p.Q251fs	ATP2A2_ENST00000308664.6_Frame_Shift_Del_p.Q251fs|ATP2A2_ENST00000395494.2_Frame_Shift_Del_p.Q224fs			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	251					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						ACCCCTTCAGCAAAAACTAGA	0.453																																					p.Q250fs		Atlas-INDEL	.											.	ATP2A2	78	.	0			c.750delG						PASS	.						166.0	166.0	166.0					12																	110765478		2203	4300	6503	SO:0001589	frameshift_variant	488	exon8			.		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.751delC	chr12.hg19:g.110765478delC	ENSP00000440045:p.Gln251fs	237.0	0.0	0		346.0	90.0	0.260116	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	Frame_Shift_Del	DEL	ENST00000539276.2	hg19	CCDS9144.1																																																																																			.	.	.	none		0.453	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
EP300	2033	hgsc.bcm.edu	37	22	41574164	41574176	+	Frame_Shift_Del	DEL	CACAGCAGCAACT	CACAGCAGCAACT	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	CACAGCAGCAACT	CACAGCAGCAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr22:41574164_41574176delCACAGCAGCAACT	ENST00000263253.7	+	31	7668_7680	c.6449_6461delCACAGCAGCAACT	c.(6448-6462)ccacagcagcaactcfs	p.PQQQL2150fs	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2150	Interaction with HTLV-1 Tax.|Interaction with NCOA2.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CAGCAGCAACCACAGCAGCAACTCCAGCCACCC	0.582			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.2150_2154del		Atlas-INDEL	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.6448_6460del						PASS	.																																			SO:0001589	frameshift_variant	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6449_6461delCACAGCAGCAACT	chr22.hg19:g.41574164_41574176delCACAGCAGCAACT	ENSP00000263253:p.Pro2150fs	120.0	0.0	0		106.0	42.0	0.396226	NM_001429	B1AKC2	Frame_Shift_Del	DEL	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.582	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
SOBP	55084	hgsc.bcm.edu	37	6	107827597	107827597	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DW-7840-01A-11D-2136-08	TCGA-DW-7840-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9967ba89-7c82-4192-b2fa-ff7dfd8e1d38	0f3c3813-e814-4e7f-9a99-c3c2abc1d0bd	g.chr6:107827597delT	ENST00000317357.5	+	3	1046	c.387delT	c.(385-387)cctfs	p.P129fs		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TTATTGTACCTTTAATTCCAC	0.423																																					p.P129fs		Atlas-INDEL	.											.	SOBP	53	.	0			c.386delC						PASS	.						204.0	194.0	197.0					6																	107827597		1912	4142	6054	SO:0001589	frameshift_variant	55084	exon3			.	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.387delT	chr6.hg19:g.107827597delT	ENSP00000318900:p.Pro129fs	256.0	0.0	0		300.0	100.0	0.333333	NM_018013		Frame_Shift_Del	DEL	ENST00000317357.5	hg19	CCDS43488.1																																																																																			.	.	.	none		0.423	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
