#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FOXE3	2301	hgsc.bcm.edu	37	1	47882415	47882415	+	Missense_Mutation	SNP	A	A	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:47882415A>C	ENST00000335071.2	+	1	672	c.428A>C	c.(427-429)aAc>aCc	p.N143T		NM_012186.2	NP_036318.1	Q13461	FOXE3_HUMAN	forkhead box E3	143					camera-type eye development (GO:0043010)|cell development (GO:0048468)|positive regulation of epithelial cell proliferation (GO:0050679)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|upper_aerodigestive_tract(1)	5				READ - Rectum adenocarcinoma(2;0.0908)		GGCAAGGGCAACTACTGGACG	0.687																																					p.N143T		Atlas-SNP	.											.	FOXE3	8	.	0			c.A428C						PASS	.						41.0	43.0	43.0					1																	47882415		2203	4299	6502	SO:0001583	missense	2301	exon1			AGGGCAACTACTG	AF275722	CCDS550.1	1p32	2008-02-05			ENSG00000186790	ENSG00000186790		"""Forkhead boxes"""	3808	protein-coding gene	gene with protein product		601094		FKHL12		8825632	Standard	NM_012186		Approved	FREAC8	uc001crk.3	Q13461	OTTHUMG00000007954	ENST00000335071.2:c.428A>C	chr1.hg19:g.47882415A>C	ENSP00000334472:p.Asn143Thr	101.0	0.0	.		103.0	30.0	.	NM_012186	Q5SVY9|Q9NQV9	Missense_Mutation	SNP	ENST00000335071.2	hg19	CCDS550.1	.	.	.	.	.	.	.	.	.	.	a	20.1	3.934136	0.73442	.	.	ENSG00000186790	ENST00000335071	D	0.95518	-3.73	3.45	3.45	0.39498	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.41097	U	0.000952	D	0.97467	0.9171	M	0.87328	2.875	0.54753	D	0.999982	D	0.71674	0.998	D	0.70487	0.969	D	0.97641	1.0148	10	0.62326	D	0.03	.	12.082	0.53675	1.0:0.0:0.0:0.0	.	143	Q13461	FOXE3_HUMAN	T	143	ENSP00000334472:N143T	ENSP00000334472:N143T	N	+	2	0	FOXE3	47655002	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.748000	0.55142	1.427000	0.47276	0.373000	0.22412	AAC	.	.	.	none		0.687	FOXE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021836.1	NM_012186	
PEA15	8682	hgsc.bcm.edu	37	1	160181403	160181403	+	Silent	SNP	C	C	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr1:160181403C>A	ENST00000360472.4	+	2	257	c.69C>A	c.(67-69)ctC>ctA	p.L23L	RP11-536C5.7_ENST00000418602.1_RNA|PEA15_ENST00000368077.1_Silent_p.L23L|PEA15_ENST00000488858.1_3'UTR|PEA15_ENST00000368076.1_Silent_p.L44L	NM_003768.3	NP_003759.1	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15	23	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|DNA damage checkpoint (GO:0000077)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of glucose import (GO:0046325)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|response to morphine (GO:0043278)|transport (GO:0006810)	cytoplasm (GO:0005737)|microtubule associated complex (GO:0005875)				large_intestine(1)|lung(4)	5	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TAGAACAGCTCAAGTCGGCCT	0.542																																					p.L23L		Atlas-SNP	.											.	PEA15	7	.	0			c.C69A						PASS	.						135.0	112.0	120.0					1																	160181403		2203	4300	6503	SO:0001819	synonymous_variant	8682	exon2			ACAGCTCAAGTCG	Y13736	CCDS1199.1, CCDS72954.1	1q21.1	2008-07-18			ENSG00000162734	ENSG00000162734			8822	protein-coding gene	gene with protein product	"""Phosphoprotein enriched in astrocytes, 15kD"", ""homolog of mouse MAT-1 oncogene"""	603434				9205133	Standard	XM_005245564		Approved	HMAT1, MAT1, PED, PEA-15, MAT1H, HUMMAT1H	uc001fvk.3	Q15121	OTTHUMG00000031605	ENST00000360472.4:c.69C>A	chr1.hg19:g.160181403C>A		131.0	0.0	.		100.0	16.0	.	NM_003768	B1AKZ3|O00511	Silent	SNP	ENST00000360472.4	hg19	CCDS1199.1																																																																																			.	.	.	none		0.542	PEA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077407.1	NM_003768	
PROM2	150696	hgsc.bcm.edu	37	2	95941238	95941238	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr2:95941238G>A	ENST00000317620.9	+	2	407	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	PROM2_ENST00000317668.4_Missense_Mutation_p.A92T|PROM2_ENST00000403131.2_Missense_Mutation_p.A92T|PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000542147.1_Missense_Mutation_p.A92T	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	92					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GAATGAGCTGGCCTCCGTGAA	0.602																																					p.A92T		Atlas-SNP	.											.	PROM2	78	.	0			c.G274A						PASS	.						99.0	87.0	91.0					2																	95941238		2203	4300	6503	SO:0001583	missense	150696	exon2			GAGCTGGCCTCCG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.274G>A	chr2.hg19:g.95941238G>A	ENSP00000318270:p.Ala92Thr	88.0	0.0	.		82.0	27.0	.	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	hg19	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194115	0.38707	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.57	-4.2	0.03823	.	1.178410	0.06360	N	0.711489	T	0.34077	0.0885	L	0.44542	1.39	0.09310	N	1	P	0.43578	0.811	B	0.40602	0.334	T	0.37079	-0.9721	10	0.14252	T	0.57	-1.8729	15.0393	0.71777	0.0:0.0:0.1886:0.8114	.	92	Q8N271	PROM2_HUMAN	T	92	ENSP00000385716:A92T;ENSP00000318520:A92T;ENSP00000318270:A92T;ENSP00000442542:A92T	ENSP00000318270:A92T	A	+	1	0	PROM2	95304965	0.000000	0.05858	0.001000	0.08648	0.580000	0.36256	-2.235000	0.01202	-0.468000	0.06922	0.462000	0.41574	GCC	.	.	.	none		0.602	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
ATG16L1	55054	hgsc.bcm.edu	37	2	234173559	234173559	+	Silent	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr2:234173559T>C	ENST00000392017.4	+	5	668	c.411T>C	c.(409-411)acT>acC	p.T137T	ATG16L1_ENST00000392020.4_Silent_p.T137T|ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392018.1_Silent_p.T137T|ATG16L1_ENST00000347464.5_Intron	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	137					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		GTTTGCAGACTATCTCTGACC	0.527																																					p.T137T		Atlas-SNP	.											.	ATG16L1	83	.	0			c.T411C						PASS	.						109.0	97.0	101.0					2																	234173559		2203	4300	6503	SO:0001819	synonymous_variant	55054	exon5			GCAGACTATCTCT	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.411T>C	chr2.hg19:g.234173559T>C		129.0	0.0	.		114.0	38.0	.	NM_017974	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Silent	SNP	ENST00000392017.4	hg19	CCDS2503.2																																																																																			.	.	.	none		0.527	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
TNXB	7148	hgsc.bcm.edu	37	6	32023635	32023635	+	Silent	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr6:32023635A>G	ENST00000375244.3	-	24	8661	c.8460T>C	c.(8458-8460)ggT>ggC	p.G2820G	TNXB_ENST00000375247.2_Silent_p.G2820G			P22105	TENX_HUMAN	tenascin XB	2878	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.G2820G(1)|p.G2907G(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CACCTGTCACACCCACGGTGG	0.582																																					p.G2820G		Atlas-SNP	.											TNXB_ENST00000375247,NS,carcinoma,0,2	TNXB	553	.	2	Substitution - coding silent(2)	lung(2)	c.T8460C						PASS	.						55.0	62.0	59.0					6																	32023635		1258	2556	3814	SO:0001819	synonymous_variant	7148	exon24			TGTCACACCCACG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8460T>C	chr6.hg19:g.32023635A>G		109.0	0.0	.		71.0	5.0	.	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	hg19																																																																																				.	.	.	none		0.582	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
SCRN1	9805	hgsc.bcm.edu	37	7	29994945	29994945	+	Missense_Mutation	SNP	C	C	T	rs75604334	byFrequency	TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:29994945C>T	ENST00000426154.1	-	3	367	c.191G>A	c.(190-192)aGg>aAg	p.R64K	SCRN1_ENST00000494620.1_5'UTR|SCRN1_ENST00000434476.2_Missense_Mutation_p.R84K|SCRN1_ENST00000242059.5_Missense_Mutation_p.R64K|SCRN1_ENST00000416113.2_5'Flank|SCRN1_ENST00000425819.2_5'UTR|SCRN1_ENST00000409497.1_Missense_Mutation_p.R64K|SCRN1_ENST00000409570.1_Missense_Mutation_p.R64K	NM_001145513.1	NP_001138985.1	Q12765	SCRN1_HUMAN	secernin 1	64					exocytosis (GO:0006887)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	dipeptidase activity (GO:0016805)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(2)|prostate(2)|skin(2)	25						GGCATAGGTCCTTGGAACTTG	0.488																																					p.R84K		Atlas-SNP	.											.	SCRN1	85	.	0			c.G251A						PASS	.						109.0	105.0	107.0					7																	29994945		2203	4300	6503	SO:0001583	missense	9805	exon3			TAGGTCCTTGGAA	D83777	CCDS5422.1, CCDS47567.1, CCDS47568.1	7p14.3-p14.1	2006-09-06			ENSG00000136193	ENSG00000136193			22192	protein-coding gene	gene with protein product		614965				12221138	Standard	NM_014766		Approved	KIAA0193	uc011kaa.2	Q12765	OTTHUMG00000097093	ENST00000426154.1:c.191G>A	chr7.hg19:g.29994945C>T	ENSP00000409068:p.Arg64Lys	124.0	0.0	.		164.0	53.0	.	NM_001145514	A8K0E9|B4DHM0|B4DIP5|C9JPG0|Q25QX7|Q8IWD1	Missense_Mutation	SNP	ENST00000426154.1	hg19	CCDS5422.1	.	.	.	.	.	.	.	.	.	.	C	5.644	0.303441	0.10678	.	.	ENSG00000136193	ENST00000242059;ENST00000426154;ENST00000409497;ENST00000434476;ENST00000421434;ENST00000438497;ENST00000409570	T;T;T;T;T;T;T	0.28666	3.37;3.37;3.37;3.35;2.36;1.63;1.6	5.7	3.89	0.44902	.	0.133460	0.52532	N	0.000069	T	0.14184	0.0343	N	0.11789	0.175	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.09487	-1.0672	9	.	.	.	-20.2169	6.2825	0.21015	0.0:0.6834:0.0:0.3166	.	84;64	C9JPG0;Q12765	.;SCRN1_HUMAN	K	64;64;64;84;64;64;64	ENSP00000242059:R64K;ENSP00000409068:R64K;ENSP00000386872:R64K;ENSP00000388942:R84K;ENSP00000413184:R64K;ENSP00000406289:R64K;ENSP00000387052:R64K	.	R	-	2	0	SCRN1	29961470	1.000000	0.71417	0.996000	0.52242	0.879000	0.50718	1.824000	0.39072	1.426000	0.47256	0.557000	0.71058	AGG	.	C|0.982;G|0.018	.	alt		0.488	SCRN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214231.2	NM_014766	
DOCK4	9732	hgsc.bcm.edu	37	7	111368503	111368503	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:111368503G>C	ENST00000437633.1	-	52	5984	c.5728C>G	c.(5728-5730)Ctg>Gtg	p.L1910V	DOCK4_ENST00000494651.2_Missense_Mutation_p.L793V|DOCK4_ENST00000428084.1_Missense_Mutation_p.L1919V	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1910	Pro-rich.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GGGCGCCGCAGAGTCCGCTCG	0.726																																					p.L1910V		Atlas-SNP	.											.	DOCK4	365	.	0			c.C5728G						PASS	.						22.0	29.0	27.0					7																	111368503		2060	4183	6243	SO:0001583	missense	9732	exon52			GCCGCAGAGTCCG		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.5728C>G	chr7.hg19:g.111368503G>C	ENSP00000404179:p.Leu1910Val	98.0	0.0	.		113.0	6.0	.	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	hg19	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.033027	0.35893	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	T;T;T	0.32023	1.47;1.47;1.47	5.59	3.43	0.39272	.	0.139401	0.49305	N	0.000144	T	0.15392	0.0371	N	0.19112	0.55	0.29489	N	0.855803	B;B;B;B;B;P	0.39181	0.0;0.045;0.046;0.001;0.036;0.663	B;B;B;B;B;B	0.33196	0.002;0.045;0.019;0.002;0.009;0.159	T	0.07635	-1.0762	10	0.34782	T	0.22	.	7.1126	0.25399	0.1735:0.1686:0.6579:0.0	.	779;793;1955;1910;1881;223	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2;Q8N1I0-4	.;.;.;DOCK4_HUMAN;.;.	V	1898;1919;793;1910;1869	ENSP00000410746:L1919V;ENSP00000440944:L793V;ENSP00000404179:L1910V	ENSP00000345432:L1869V	L	-	1	2	DOCK4	111155739	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.165000	0.31822	1.340000	0.45581	0.655000	0.94253	CTG	.	.	.	none		0.726	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
GALNT11	63917	hgsc.bcm.edu	37	7	151805279	151805279	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr7:151805279T>C	ENST00000434507.1	+	8	1306	c.869T>C	c.(868-870)gTc>gCc	p.V290A	GALNT11_ENST00000452146.2_Missense_Mutation_p.V209A|GALNT11_ENST00000320311.2_Missense_Mutation_p.V290A|GALNT11_ENST00000430044.2_Missense_Mutation_p.V290A|GALNT11_ENST00000422997.2_3'UTR			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	290					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		TCCCCTGTCGTCCGCGGAGGG	0.602																																					p.V290A		Atlas-SNP	.											.	GALNT11	59	.	0			c.T869C						PASS	.						70.0	69.0	69.0					7																	151805279		2203	4300	6503	SO:0001583	missense	63917	exon6			CTGTCGTCCGCGG	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.869T>C	chr7.hg19:g.151805279T>C	ENSP00000416787:p.Val290Ala	90.0	0.0	.		143.0	106.0	.	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	hg19	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690916	0.88735	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	N	0.13235	0.315	0.80722	D	1	D;D;D	0.89917	0.988;1.0;0.998	D;D;D	0.91635	0.934;0.999;0.971	T	0.58301	-0.7660	10	0.22109	T	0.4	.	15.2076	0.73192	0.0:0.0:0.0:1.0	.	209;290;290	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	A	290;209;290;290;290	ENSP00000395122:V290A;ENSP00000393399:V209A;ENSP00000416787:V290A;ENSP00000315835:V290A	ENSP00000315835:V290A	V	+	2	0	GALNT11	151436212	1.000000	0.71417	0.696000	0.30242	0.671000	0.39405	6.290000	0.72712	1.980000	0.57719	0.528000	0.53228	GTC	.	.	.	none		0.602	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
MYOM2	9172	hgsc.bcm.edu	37	8	2063780	2063780	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr8:2063780C>T	ENST00000262113.4	+	26	3350	c.3209C>T	c.(3208-3210)aCt>aTt	p.T1070I	MYOM2_ENST00000523438.1_Missense_Mutation_p.T495I	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1070					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GACAAAGCTACTGGCATTATT	0.383																																					p.T1070I		Atlas-SNP	.											.	MYOM2	251	.	0			c.C3209T						PASS	.						180.0	173.0	175.0					8																	2063780		2203	4300	6503	SO:0001583	missense	9172	exon26			AAGCTACTGGCAT		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3209C>T	chr8.hg19:g.2063780C>T	ENSP00000262113:p.Thr1070Ile	128.0	0.0	.		79.0	36.0	.	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106096	0.37145	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.43688	0.94;0.94	5.32	5.32	0.75619	.	0.155634	0.56097	D	0.000032	T	0.50292	0.1607	M	0.72118	2.19	0.09310	N	1	P	0.43542	0.81	P	0.47118	0.538	T	0.53627	-0.8412	10	0.72032	D	0.01	.	11.9689	0.53051	0.1347:0.7352:0.13:0.0	.	1070	P54296	MYOM2_HUMAN	I	1070;495	ENSP00000262113:T1070I;ENSP00000428396:T495I	ENSP00000262113:T1070I	T	+	2	0	MYOM2	2051187	0.950000	0.32346	0.017000	0.16124	0.264000	0.26372	3.170000	0.50816	2.495000	0.84180	0.655000	0.94253	ACT	.	.	.	none		0.383	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
MTUS1	57509	hgsc.bcm.edu	37	8	17513393	17513393	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr8:17513393G>T	ENST00000262102.6	-	9	3311	c.3087C>A	c.(3085-3087)taC>taA	p.Y1029*	MTUS1_ENST00000381861.3_Nonsense_Mutation_p.Y276*|MTUS1_ENST00000297488.6_Nonsense_Mutation_p.Y195*|MTUS1_ENST00000519263.1_Nonsense_Mutation_p.Y975*|MTUS1_ENST00000381869.3_Nonsense_Mutation_p.Y975*|MTUS1_ENST00000544260.1_Nonsense_Mutation_p.Y174*|MTUS1_ENST00000518713.1_5'UTR|MTUS1_ENST00000400046.1_Nonsense_Mutation_p.Y101*	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	1029					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		ATTGCATTTTGTACTTCTCTG	0.448																																					p.Y1029X		Atlas-SNP	.											.	MTUS1	144	.	0			c.C3087A						PASS	.						153.0	141.0	145.0					8																	17513393		1890	4122	6012	SO:0001587	stop_gained	57509	exon9			CATTTTGTACTTC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.3087C>A	chr8.hg19:g.17513393G>T	ENSP00000262102:p.Tyr1029*	141.0	0.0	.		115.0	5.0	.	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Nonsense_Mutation	SNP	ENST00000262102.6	hg19	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	42	9.591954	0.99214	.	.	ENSG00000129422	ENST00000381869;ENST00000544260;ENST00000400046;ENST00000297488;ENST00000381861;ENST00000262102;ENST00000519263	.	.	.	5.25	-7.98	0.01135	.	0.172675	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.084	17.0702	0.86571	0.2982:0.0:0.7018:0.0	.	.	.	.	X	975;174;101;195;276;1029;975	.	ENSP00000262102:Y1029X	Y	-	3	2	MTUS1	17557673	0.970000	0.33590	0.144000	0.22314	0.384000	0.30261	0.123000	0.15708	-1.650000	0.01506	-0.218000	0.12543	TAC	.	.	.	none		0.448	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
CCDC180	100499483	hgsc.bcm.edu	37	9	100117239	100117239	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:100117239A>G	ENST00000357054.1	+	35	4193	c.3258A>G	c.(3256-3258)atA>atG	p.I1086M	CCDC180_ENST00000375202.2_Missense_Mutation_p.I1115M|CCDC180_ENST00000395220.1_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.I1115M			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1086						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TTATTTTCATAGAGAAAATCC	0.418																																					p.I1115M		Atlas-SNP	.											.	.	.	.	0			c.A3345G						PASS	.						74.0	75.0	75.0					9																	100117239		2203	4300	6503	SO:0001583	missense	0	exon24			TTTCATAGAGAAA	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3258A>G	chr9.hg19:g.100117239A>G	ENSP00000349562:p.Ile1086Met	112.0	0.0	.		108.0	48.0	.	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.21	2.467293	0.43839	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.10099	3.17;2.91;2.91	5.16	-0.113	0.13568	.	0.642133	0.16850	N	0.196982	T	0.04952	0.0133	N	0.16478	0.41	0.80722	D	1	B;P	0.37370	0.083;0.592	B;B	0.35240	0.044;0.198	T	0.49707	-0.8911	10	0.27785	T	0.31	-2.8056	4.2902	0.10874	0.6091:0.0:0.2494:0.1415	.	1254;1086	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	M	1086;1115;1115	ENSP00000349562:I1086M;ENSP00000364348:I1115M;ENSP00000434727:I1115M	ENSP00000349562:I1086M	I	+	3	3	C9orf174	99157060	0.990000	0.36364	0.986000	0.45419	0.999000	0.98932	0.166000	0.16583	0.022000	0.15160	0.533000	0.62120	ATA	.	.	.	none		0.418	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
GNG10	2790	hgsc.bcm.edu	37	9	114429094	114429094	+	Splice_Site	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:114429094G>A	ENST00000374293.4	+	2	381		c.e2-1		DNAJC25_ENST00000556107.1_Splice_Site|DNAJC25-GNG10_ENST00000374294.3_Splice_Site	NM_001017998.3|NM_001198664.1	NP_001017998.1|NP_001185593.1	P50151	GBG10_HUMAN	guanine nucleotide binding protein (G protein), gamma 10						cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			kidney(1)	1						CTTTGTTTCAGGTCTCTCAGG	0.522																																					.		Atlas-SNP	.											.	DNAJC25-GNG10	7	.	0			c.337-1G>A						PASS	.						80.0	67.0	71.0					9																	114429094		2203	4300	6503	SO:0001630	splice_region_variant	552891	exon2			GTTTCAGGTCTCT		CCDS35107.1	9q31.3	2010-08-17			ENSG00000242616	ENSG00000242616			4402	protein-coding gene	gene with protein product		604389				7665596	Standard	NM_001017998		Approved			P50151	OTTHUMG00000157193	ENST00000374293.4:c.82-1G>A	chr9.hg19:g.114429094G>A		56.0	0.0	.		43.0	14.0	.	NM_004125	Q3B7K2|Q4VC27	Splice_Site	SNP	ENST00000374293.4	hg19	CCDS35107.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486423	0.84854	.	.	ENSG00000059769;ENSG00000244115;ENSG00000242616	ENST00000556107;ENST00000374294;ENST00000374293	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1488	0.93479	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJC25-GNG10;GNG10;DNAJC25	113468915	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	9.460000	0.97641	2.688000	0.91661	0.655000	0.94253	.	.	.	.	none		0.522	GNG10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053644.2		Intron
ZER1	10444	hgsc.bcm.edu	37	9	131513498	131513498	+	Missense_Mutation	SNP	T	T	C			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr9:131513498T>C	ENST00000291900.2	-	7	1494	c.1088A>G	c.(1087-1089)tAc>tGc	p.Y363C	snoU13_ENST00000459043.1_RNA|ZER1_ENST00000494461.1_5'Flank	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	363					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						GTGCTCCGTGTAGGCCTCGAT	0.602																																					p.Y363C		Atlas-SNP	.											ZER1,NS,carcinoma,0,1	ZER1	49	.	0			c.A1088G						PASS	.						93.0	76.0	82.0					9																	131513498		2203	4300	6503	SO:0001583	missense	10444	exon7			TCCGTGTAGGCCT	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.1088A>G	chr9.hg19:g.131513498T>C	ENSP00000291900:p.Tyr363Cys	32.0	0.0	.		34.0	3.0	.	NM_006336	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	hg19	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785754	0.70337	.	.	ENSG00000160445	ENST00000291900	T	0.07688	3.17	5.24	5.24	0.73138	Armadillo-type fold (1);	0.060055	0.64402	D	0.000002	T	0.22781	0.0550	L	0.51914	1.62	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.00425	-1.1747	10	0.44086	T	0.13	-35.0868	14.3759	0.66874	0.0:0.0:0.0:1.0	.	363	Q7Z7L7	ZER1_HUMAN	C	363	ENSP00000291900:Y363C	ENSP00000291900:Y363C	Y	-	2	0	ZER1	130553319	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.499000	0.81566	2.011000	0.59026	0.254000	0.18369	TAC	.	.	.	none		0.602	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
VIM	7431	hgsc.bcm.edu	37	10	17276732	17276732	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr10:17276732C>G	ENST00000224237.5	+	5	1068	c.923C>G	c.(922-924)gCc>gGc	p.A308G	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.A308G			P08670	VIME_HUMAN	vimentin	308	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AACAATGACGCCCTGCGCCAG	0.512																																					p.A308G		Atlas-SNP	.											.	VIM	71	.	0			c.C923G						PASS	.						94.0	89.0	91.0					10																	17276732		2203	4300	6503	SO:0001583	missense	7431	exon6			ATGACGCCCTGCG	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.923C>G	chr10.hg19:g.17276732C>G	ENSP00000224237:p.Ala308Gly	134.0	0.0	.		116.0	17.0	.	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	hg19	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627666	0.87560	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533;ENST00000421459	D;D;D	0.89681	-2.55;-2.55;-2.55	6.05	6.05	0.98169	Filament (1);	0.000000	0.46442	D	0.000298	D	0.95439	0.8519	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.69078	0.989;0.985;0.995;0.997	P;P;D;D	0.69479	0.897;0.902;0.941;0.964	D	0.92981	0.6406	10	0.18710	T	0.47	.	20.6031	0.99464	0.0:1.0:0.0:0.0	.	295;295;308;308	F5H288;B3KRK8;B0YJC4;P08670	.;.;.;VIME_HUMAN	G	308;308;295;134	ENSP00000446007:A308G;ENSP00000224237:A308G;ENSP00000391842:A134G	ENSP00000224237:A308G	A	+	2	0	VIM	17316738	1.000000	0.71417	1.000000	0.80357	0.369000	0.29798	7.811000	0.86092	2.881000	0.98747	0.637000	0.83480	GCC	.	.	.	none		0.512	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
PPA1	5464	hgsc.bcm.edu	37	10	71969322	71969322	+	Missense_Mutation	SNP	T	T	C	rs80155016		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr10:71969322T>C	ENST00000373232.3	-	7	730	c.631A>G	c.(631-633)Aaa>Gaa	p.K211E		NM_021129.3	NP_066952.1	Q15181	IPYR_HUMAN	pyrophosphatase (inorganic) 1	211					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|phosphate-containing compound metabolic process (GO:0006796)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(2)	10						ACCTTATCTTTAAATTCTGCA	0.348																																					p.K211E		Atlas-SNP	.											.	PPA1	24	.	0			c.A631G						PASS	.						98.0	94.0	95.0					10																	71969322		2203	4300	6503	SO:0001583	missense	5464	exon7			TATCTTTAAATTC	AF154065	CCDS7299.1	10q11.1-q24	2012-10-02	2005-10-07	2005-10-07	ENSG00000180817	ENSG00000180817	3.6.1.1		9226	protein-coding gene	gene with protein product	"""cytosolic inorganic pyrophosphatase"", ""inorganic pyrophosphatase 1"", ""pyrophosphate phospho-hydrolase"""	179030	"""pyrophosphatase (inorganic)"""	PP		10542310, 975879	Standard	NM_021129		Approved	SID6-8061, Ppase, IOPPP, PP1	uc001jqv.1	Q15181	OTTHUMG00000018399	ENST00000373232.3:c.631A>G	chr10.hg19:g.71969322T>C	ENSP00000362329:p.Lys211Glu	85.0	0.0	.		81.0	6.0	.	NM_021129	Q2M348|Q5SQT7|Q6P7P4|Q9UQJ5|Q9Y5B1	Missense_Mutation	SNP	ENST00000373232.3	hg19	CCDS7299.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843400	0.91197	.	.	ENSG00000180817	ENST00000373232	T	0.44083	0.93	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.66197	0.2765	M	0.83312	2.635	0.80722	D	1	D	0.67145	0.996	D	0.68192	0.956	T	0.71902	-0.4452	10	0.72032	D	0.01	-6.013	14.3548	0.66730	0.0:0.0:0.0:1.0	.	211	Q15181	IPYR_HUMAN	E	211	ENSP00000362329:K211E	ENSP00000362329:K211E	K	-	1	0	PPA1	71639328	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.796000	0.85898	2.078000	0.62432	0.460000	0.39030	AAA	.	.	.	weak		0.348	PPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048490.2	NM_021129	
C11orf49	79096	hgsc.bcm.edu	37	11	47074069	47074069	+	Splice_Site	SNP	G	G	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:47074069G>T	ENST00000278460.7	+	3	339	c.280G>T	c.(280-282)Gat>Tat	p.D94Y	C11orf49_ENST00000378618.2_Splice_Site_p.D94Y|C11orf49_ENST00000527268.1_3'UTR|C11orf49_ENST00000536126.1_5'UTR|C11orf49_ENST00000395460.2_Splice_Site_p.D94Y|C11orf49_ENST00000378615.3_Splice_Site_p.D94Y|C11orf49_ENST00000543718.1_Intron	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	94						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						CAAAAATGGCGGTAAGTCTTC	0.463																																					p.D94Y		Atlas-SNP	.											.	C11orf49	41	.	0			c.G280T						PASS	.						101.0	102.0	102.0					11																	47074069		2201	4299	6500	SO:0001630	splice_region_variant	79096	exon3			AATGGCGGTAAGT	AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.280+1G>T	chr11.hg19:g.47074069G>T		82.0	0.0	.		102.0	47.0	.	NM_001003677	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	ENST00000278460.7	hg19	CCDS7925.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879678	0.91740	.	.	ENSG00000149179	ENST00000278460;ENST00000378618;ENST00000395460;ENST00000378615;ENST00000526827	T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9	6.03	6.03	0.97812	.	0.097269	0.64402	D	0.000002	T	0.55289	0.1911	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.977;0.977	T	0.54351	-0.8307	10	0.87932	D	0	-17.2898	20.5568	0.99304	0.0:0.0:1.0:0.0	.	94;94;94	E9PAX7;Q9H6J7-2;Q9H6J7	.;.;CK049_HUMAN	Y	94;94;94;94;20	ENSP00000278460:D94Y;ENSP00000367881:D94Y;ENSP00000378844:D94Y;ENSP00000367878:D94Y;ENSP00000433707:D20Y	ENSP00000278460:D94Y	D	+	1	0	C11orf49	47030645	1.000000	0.71417	0.986000	0.45419	0.971000	0.66376	8.948000	0.93006	2.861000	0.98227	0.655000	0.94253	GAT	.	.	.	none		0.463	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391218.1	NM_024113	Missense_Mutation
ANKRD13D	338692	hgsc.bcm.edu	37	11	67059495	67059495	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:67059495A>G	ENST00000447274.2	+	6	1489	c.314A>G	c.(313-315)gAc>gGc	p.D105G	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.D192G|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.D105G|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.D105G			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	105						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GTGGACCATGACCGGCAGGTG	0.672																																					p.D192G		Atlas-SNP	.											.	ANKRD13D	71	.	0			c.A575G						PASS	.						36.0	38.0	37.0					11																	67059495		2200	4294	6494	SO:0001583	missense	338692	exon6			ACCATGACCGGCA	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.314A>G	chr11.hg19:g.67059495A>G	ENSP00000402616:p.Asp105Gly	101.0	0.0	.		57.0	4.0	.	NM_207354	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	hg19		.	.	.	.	.	.	.	.	.	.	A	24.6	4.554741	0.86231	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	3.9	3.9	0.45041	.	0.074445	0.52532	D	0.000070	T	0.63462	0.2513	M	0.80183	2.485	0.58432	D	0.999999	D;P	0.89917	1.0;0.624	D;P	0.75484	0.986;0.525	T	0.66736	-0.5848	10	0.48119	T	0.1	-35.5096	12.1809	0.54211	1.0:0.0:0.0:0.0	.	192;105	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	G	105;192;105;105	ENSP00000402616:D105G;ENSP00000427130:D192G;ENSP00000310874:D105G;ENSP00000444404:D105G	ENSP00000310874:D105G	D	+	2	0	ANKRD13D	66816071	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.912000	0.92726	1.785000	0.52413	0.459000	0.35465	GAC	.	.	.	none		0.672	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73020470	73020470	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:73020470G>A	ENST00000263674.3	+	1	1137	c.787G>A	c.(787-789)Gga>Aga	p.G263R	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	263					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCAGCTGCCTGGAGCCCAGAG	0.721																																					p.G263R		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.G787A						PASS	.						10.0	14.0	13.0					11																	73020470		2079	4096	6175	SO:0001583	missense	9828	exon1			CTGCCTGGAGCCC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.787G>A	chr11.hg19:g.73020470G>A	ENSP00000263674:p.Gly263Arg	47.0	0.0	.		44.0	23.0	.	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654144	0.29425	.	.	ENSG00000110237	ENST00000263674	T	0.64260	-0.09	4.85	0.091	0.14466	.	0.445825	0.16707	N	0.202865	T	0.43656	0.1257	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39251	-0.9623	10	0.87932	D	0	-19.5376	8.2312	0.31599	0.1586:0.385:0.4564:0.0	.	263	Q96PE2	ARHGH_HUMAN	R	263	ENSP00000263674:G263R	ENSP00000263674:G263R	G	+	1	0	ARHGEF17	72698118	0.001000	0.12720	0.001000	0.08648	0.237000	0.25408	0.062000	0.14389	0.096000	0.17463	-0.502000	0.04539	GGA	.	.	.	none		0.721	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
MED17	9440	hgsc.bcm.edu	37	11	93542943	93542943	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:93542943C>A	ENST00000251871.3	+	11	1932	c.1645C>A	c.(1645-1647)Ctg>Atg	p.L549M	MED17_ENST00000533367.1_3'UTR	NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	549					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTGGCAAGTACTGAGCTTCAG	0.493																																					p.L549M		Atlas-SNP	.											.	MED17	37	.	0			c.C1645A						PASS	.						233.0	193.0	206.0					11																	93542943		2201	4298	6499	SO:0001583	missense	9440	exon11			CAAGTACTGAGCT	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.1645C>A	chr11.hg19:g.93542943C>A	ENSP00000251871:p.Leu549Met	189.0	0.0	.		163.0	71.0	.	NM_004268	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	hg19	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	C	31	5.067027	0.93898	.	.	ENSG00000042429	ENST00000251871;ENST00000427225	T	0.64991	-0.13	5.65	5.65	0.86999	.	0.063209	0.64402	D	0.000003	T	0.79040	0.4379	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.79424	-0.1809	10	0.72032	D	0.01	-15.3186	20.0822	0.97779	0.0:1.0:0.0:0.0	.	549	Q9NVC6	MED17_HUMAN	M	549;519	ENSP00000251871:L549M	ENSP00000251871:L549M	L	+	1	2	MED17	93182591	1.000000	0.71417	0.719000	0.30619	0.979000	0.70002	4.846000	0.62860	2.826000	0.97356	0.563000	0.77884	CTG	.	.	.	none		0.493	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
VPS26B	112936	hgsc.bcm.edu	37	11	134115448	134115448	+	Silent	SNP	C	C	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr11:134115448C>T	ENST00000281187.5	+	6	1453	c.975C>T	c.(973-975)acC>acT	p.T325T	VPS26B_ENST00000525095.2_Silent_p.T325T	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	325					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		AGGTGCGGACCCCCAGCCAGC	0.652																																					p.T325T	Colon(171;1263 1952 15904 45703 47982)	Atlas-SNP	.											.	VPS26B	30	.	0			c.C975T						PASS	.						44.0	37.0	39.0					11																	134115448		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon6			GCGGACCCCCAGC		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.975C>T	chr11.hg19:g.134115448C>T		37.0	0.0	.		32.0	18.0	.	NM_052875	Q96A55	Silent	SNP	ENST00000281187.5	hg19	CCDS8495.1																																																																																			.	.	.	none		0.652	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1	NM_052875	
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		73.0	2.0	.		69.0	3.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
PTGDR	5729	hgsc.bcm.edu	37	14	52734893	52734894	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr14:52734893_52734894CT>AG	ENST00000306051.2	+	1	463_464	c.361_362CT>AG	c.(361-363)CTg>AGg	p.L121R	PTGDR_ENST00000553372.1_Missense_Mutation_p.L121R	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	121					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	CTCCTCGACACTGCAACTCCTG	0.629																																					p.L121M|p.L121R		Atlas-SNP	.											.	PTGDR	58	.	0			c.C361A|c.T362G						PASS	.																																			SO:0001583	missense	5729	exon1			TCGACACTGCAAC|CGACACTGCAACT	U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	Exception_encountered	chr14.hg19:g.52734893_52734894delinsAG	ENSP00000303424:p.Leu121Arg	306.0|309.0	0.0	.		229.0|231.0	82.0|81.0	.	NM_000953	G3V5L3|Q13250|Q13251|Q1ZZ52	Missense_Mutation	SNP	ENST00000306051.2	hg19	CCDS9707.1																																																																																			.	.	.	none		0.629	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276889.1	NM_000953	
PLA2G4F	255189	hgsc.bcm.edu	37	15	42442584	42442584	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr15:42442584A>G	ENST00000382396.4	-	9	958	c.872T>C	c.(871-873)gTg>gCg	p.V291A	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.V291A			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	291					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CCCCAGGGCCACAGAACACTG	0.652																																					p.V291A		Atlas-SNP	.											.	PLA2G4F	75	.	0			c.T872C						PASS	.						22.0	23.0	22.0					15																	42442584		2203	4299	6502	SO:0001583	missense	255189	exon9			AGGGCCACAGAAC		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.872T>C	chr15.hg19:g.42442584A>G	ENSP00000371833:p.Val291Ala	31.0	0.0	.		29.0	15.0	.	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	hg19	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.632244	0.29068	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.01560	4.77;4.82	4.88	4.88	0.63580	Lysophospholipase, catalytic domain (1);	0.320592	0.21644	N	0.071298	T	0.02848	0.0085	M	0.64404	1.975	0.31744	N	0.635362	P;P	0.46395	0.877;0.877	B;B	0.38106	0.265;0.197	T	0.12142	-1.0559	10	0.72032	D	0.01	-9.9511	11.1909	0.48685	1.0:0.0:0.0:0.0	.	78;291	A2RRC4;Q68DD2	.;PA24F_HUMAN	A	287;291;291;291;291	ENSP00000380442:V291A;ENSP00000371833:V291A	ENSP00000290497:V287A	V	-	2	0	PLA2G4F	40229876	0.055000	0.20627	0.840000	0.33206	0.044000	0.14063	4.335000	0.59298	1.982000	0.57802	0.533000	0.62120	GTG	.	.	.	none		0.652	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
TICRR	90381	hgsc.bcm.edu	37	15	90129030	90129030	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr15:90129030G>A	ENST00000268138.7	+	4	1373	c.1268G>A	c.(1267-1269)cGc>cAc	p.R423H	TICRR_ENST00000560985.1_Missense_Mutation_p.R422H|RP11-429B14.1_ENST00000559041.1_RNA			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	423					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										ACTGTGTGCCGCACCAAGGAG	0.542																																					p.R423H		Atlas-SNP	.											.	.	.	.	0			c.G1268A						PASS	.						86.0	88.0	87.0					15																	90129030		1978	4151	6129	SO:0001583	missense	90381	exon4			TGTGCCGCACCAA	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.1268G>A	chr15.hg19:g.90129030G>A	ENSP00000268138:p.Arg423His	90.0	0.0	.		68.0	6.0	.	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	hg19	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	g	3.132	-0.178303	0.06380	.	.	ENSG00000140534	ENST00000268138	T	0.13901	2.55	5.24	-2.38	0.06622	.	0.846013	0.11198	N	0.589141	T	0.08447	0.0210	L	0.27053	0.805	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.28964	-1.0027	10	0.46703	T	0.11	0.7395	7.3452	0.26660	0.4494:0.1087:0.4419:0.0	.	423	Q7Z2Z1	TICRR_HUMAN	H	423	ENSP00000268138:R423H	ENSP00000268138:R423H	R	+	2	0	C15orf42	87930034	0.000000	0.05858	0.005000	0.12908	0.010000	0.07245	-0.060000	0.11712	-0.695000	0.05105	-0.150000	0.13652	CGC	.	.	.	none		0.542	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
DSG4	147409	hgsc.bcm.edu	37	18	28980927	28980927	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr18:28980927A>T	ENST00000308128.4	+	10	1496	c.1361A>T	c.(1360-1362)aAg>aTg	p.K454M	DSG4_ENST00000359747.4_Missense_Mutation_p.K454M|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GAATTTGATAAGAAGTCAAAA	0.289																																					p.K454M		Atlas-SNP	.											.	DSG4	343	.	0			c.A1361T						PASS	.						43.0	48.0	47.0					18																	28980927		2199	4283	6482	SO:0001583	missense	147409	exon10			TTGATAAGAAGTC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1361A>T	chr18.hg19:g.28980927A>T	ENSP00000311859:p.Lys454Met	77.0	0.0	.		78.0	37.0	.	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	hg19	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710083	0.30322	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.52754	0.65;0.65	5.24	-7.62	0.01294	Cadherin (4);Cadherin-like (1);	1.092760	0.07279	N	0.870439	T	0.14657	0.0354	N	0.01188	-0.97	0.21740	N	0.999565	B;B	0.18013	0.025;0.003	B;B	0.19666	0.025;0.026	T	0.23226	-1.0194	10	0.62326	D	0.03	.	2.8038	0.05422	0.1395:0.4432:0.1978:0.2195	.	454;454	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	M	454	ENSP00000311859:K454M;ENSP00000352785:K454M	ENSP00000311859:K454M	K	+	2	0	DSG4	27234925	0.528000	0.26314	0.657000	0.29651	0.818000	0.46254	0.238000	0.18004	-1.023000	0.03342	-2.955000	0.00083	AAG	.	.	.	none		0.289	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
WDR18	57418	hgsc.bcm.edu	37	19	992048	992048	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:992048A>G	ENST00000251289.5	+	8	1048	c.1025A>G	c.(1024-1026)cAc>cGc	p.H342R	WDR18_ENST00000587001.2_Missense_Mutation_p.H342R	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	342					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCAACAAGCACCTGCTGGGC	0.716																																					p.H342R		Atlas-SNP	.											.	WDR18	20	.	0			c.A1025G						PASS	.						9.0	10.0	9.0					19																	992048		2129	4155	6284	SO:0001583	missense	57418	exon8			ACAAGCACCTGCT		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.1025A>G	chr19.hg19:g.992048A>G	ENSP00000251289:p.His342Arg	9.0	0.0	.		27.0	16.0	.	NM_024100	O60390|Q9BWR2	Missense_Mutation	SNP	ENST00000251289.5	hg19	CCDS12051.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692269	0.30052	.	.	ENSG00000065268	ENST00000251289	T	0.69435	-0.4	4.28	4.28	0.50868	.	0.056115	0.64402	D	0.000001	T	0.60843	0.2300	M	0.63843	1.955	0.44798	D	0.997803	P	0.50272	0.933	B	0.44108	0.441	T	0.62020	-0.6942	10	0.06757	T	0.87	.	12.3826	0.55315	1.0:0.0:0.0:0.0	.	342	Q9BV38	WDR18_HUMAN	R	342	ENSP00000251289:H342R	ENSP00000251289:H342R	H	+	2	0	WDR18	943048	1.000000	0.71417	1.000000	0.80357	0.541000	0.35023	5.202000	0.65169	1.806000	0.52798	0.402000	0.26972	CAC	.	.	.	none		0.716	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
NLRP5	126206	hgsc.bcm.edu	37	19	56511120	56511120	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr19:56511120G>A	ENST00000390649.3	+	1	29	c.29G>A	c.(28-30)gGa>gAa	p.G10E		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	10					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		cttgaacttggagctgcTGCT	0.517																																					p.G10E		Atlas-SNP	.											.	NLRP5	217	.	0			c.G29A						PASS	.						208.0	212.0	210.0					19																	56511120		2101	4218	6319	SO:0001583	missense	126206	exon1			AACTTGGAGCTGC	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.29G>A	chr19.hg19:g.56511120G>A	ENSP00000375063:p.Gly10Glu	241.0	0.0	.		234.0	35.0	.	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	hg19	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	G	7.564	0.665223	0.14710	.	.	ENSG00000171487	ENST00000390649	T	0.74106	-0.81	0.492	0.492	0.16872	.	.	.	.	.	T	0.68860	0.3047	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.71184	0.972	T	0.59215	-0.7496	8	0.87932	D	0	.	.	.	.	.	10	P59047	NALP5_HUMAN	E	10	ENSP00000375063:G10E	ENSP00000375063:G10E	G	+	2	0	NLRP5	61202932	0.005000	0.15991	0.037000	0.18230	0.032000	0.12392	-0.354000	0.07681	0.528000	0.28580	0.298000	0.19748	GGA	.	.	.	none		0.517	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
SLC19A1	6573	hgsc.bcm.edu	37	21	46935688	46935688	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr21:46935688A>G	ENST00000311124.4	-	6	1812	c.1660T>C	c.(1660-1662)Tca>Cca	p.S554P	SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000380010.4_Intron|SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000485649.2_Missense_Mutation_p.S514P	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	554					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	TCAGGGCCTGAGGCTTGGGCG	0.637																																					p.S554P		Atlas-SNP	.											.	SLC19A1	53	.	0			c.T1660C						PASS	.						44.0	44.0	44.0					21																	46935688		2203	4300	6503	SO:0001583	missense	6573	exon6			GGCCTGAGGCTTG	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.1660T>C	chr21.hg19:g.46935688A>G	ENSP00000308895:p.Ser554Pro	65.0	0.0	.		57.0	4.0	.	NM_194255	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000311124.4	hg19	CCDS13725.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.430071	0.43122	.	.	ENSG00000173638	ENST00000311124;ENST00000485649	D;D	0.84944	-1.91;-1.92	2.86	-2.08	0.07254	.	.	.	.	.	T	0.64713	0.2623	N	0.19112	0.55	0.09310	N	1	P;P	0.42078	0.77;0.77	B;B	0.32090	0.14;0.14	T	0.59700	-0.7405	9	0.87932	D	0	.	0.6492	0.00823	0.4614:0.2055:0.1326:0.2004	.	514;554	B7Z8C3;P41440	.;S19A1_HUMAN	P	554;514	ENSP00000308895:S554P;ENSP00000441772:S514P	ENSP00000308895:S554P	S	-	1	0	SLC19A1	45760116	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	-0.670000	0.05256	-0.524000	0.06400	-0.456000	0.05471	TCA	.	.	.	none		0.637	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1		
ARHGAP21	57584	hgsc.bcm.edu	37	10	24885703	24885704	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DW-7842-01A-11D-2136-08	TCGA-DW-7842-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fe91ee01-61e4-4310-b1e9-387033d215a6	bbdb56a6-a63a-419c-91dc-54bd9502aa64	g.chr10:24885703_24885704insG	ENST00000396432.2	-	17	3928_3929	c.3442_3443insC	c.(3442-3444)cgafs	p.R1148fs	ARHGAP21_ENST00000320481.6_Frame_Shift_Ins_p.R935fs|ARHGAP21_ENST00000493154.1_5'Flank	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1147	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GTCATCTAGTCGGACGCCGAAA	0.455																																					p.R1148fs		Atlas-INDEL	.											.	ARHGAP21	185	.	0			c.3443_3444insC						PASS	.																																			SO:0001589	frameshift_variant	57584	exon17			.	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3443dupC	chr10.hg19:g.24885705_24885705dupG	ENSP00000379709:p.Arg1148fs	119.0	0.0	0		99.0	42.0	0.424242	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Frame_Shift_Ins	INS	ENST00000396432.2	hg19	CCDS7144.2																																																																																			.	.	.	none		0.455	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
