#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM52	339456	hgsc.bcm.edu	37	1	1850654	1850654	+	Silent	SNP	G	G	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:1850654G>C	ENST00000310991.3	-	1	58	c.51C>G	c.(49-51)ctC>ctG	p.L17L	TMEM52_ENST00000378602.3_5'Flank	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	17						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ggagcggcaggagcggcagca	0.771																																					p.L17L		Atlas-SNP	.											TMEM52,NS,carcinoma,0,1	TMEM52	21	.	0			c.C51G						PASS	.						1.0	2.0	1.0					1																	1850654		671	1684	2355	SO:0001819	synonymous_variant	339456	exon1			CGGCAGGAGCGGC	AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.51C>G	chr1.hg19:g.1850654G>C		0.0	0.0	.		7.0	2.0	.	NM_178545	Q4VXS6|Q6UX25	Silent	SNP	ENST00000310991.3	hg19	CCDS35.1	.	.	.	.	.	.	.	.	.	.	.	4.530	0.098402	0.08681	.	.	ENSG00000178821	ENST00000378598	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.22446	N	0.999091	.	.	.	.	.	.	T	0.39035	-0.9633	4	0.87932	D	0	.	.	.	.	.	.	.	.	C	15	.	ENSP00000367861:S15C	S	-	2	0	TMEM52	1840514	0.001000	0.12720	0.009000	0.14445	0.010000	0.07245	0.286000	0.18902	0.192000	0.20272	0.195000	0.17529	TCC	.	.	.	none		0.771	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000002781.1	NM_178545	
KIAA2013	90231	hgsc.bcm.edu	37	1	11986231	11986231	+	Missense_Mutation	SNP	G	G	A	rs552116013	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:11986231G>A	ENST00000376572.3	-	1	249	c.64C>T	c.(64-66)Ctc>Ttc	p.L22F	KIAA2013_ENST00000376576.3_Missense_Mutation_p.L22F	NM_138346.2	NP_612355.1	Q8IYS2	K2013_HUMAN	KIAA2013	22						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCAGAGGAGGCGGCGGGCC	0.771													G|||	26	0.00519169	0.0166	0.0043	5008	,	,		4617	0.0		0.001	False		,,,				2504	0.0				p.L22F		Atlas-SNP	.											.	KIAA2013	25	.	0			c.C64T						PASS	.						1.0	1.0	1.0					1																	11986231		852	2025	2877	SO:0001583	missense	90231	exon1			AGAGGAGGCGGCG	AB095933	CCDS141.1	1p36.22	2011-02-09			ENSG00000116685	ENSG00000116685			28513	protein-coding gene	gene with protein product						12477932	Standard	NM_138346		Approved	MGC33867, RP5-1077B9.1	uc001atk.3	Q8IYS2	OTTHUMG00000002391	ENST00000376572.3:c.64C>T	chr1.hg19:g.11986231G>A	ENSP00000365756:p.Leu22Phe	0.0	0.0	.		4.0	4.0	.	NM_138346	Q5JXC1|Q8IVF8|Q8NDI7|Q9BSY1	Missense_Mutation	SNP	ENST00000376572.3	hg19	CCDS141.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691701	0.68271	.	.	ENSG00000116685	ENST00000376572;ENST00000376576	.	.	.	2.55	1.47	0.22746	.	0.221922	0.29040	U	0.013323	T	0.31638	0.0803	N	0.14661	0.345	0.29766	N	0.835158	D;P	0.61080	0.989;0.954	P;P	0.59487	0.858;0.812	T	0.08659	-1.0711	9	0.46703	T	0.11	-19.9466	7.5843	0.27982	0.0:0.4455:0.5544:0.0	.	22;22	Q8IYS2-2;Q8IYS2	.;K2013_HUMAN	F	22	.	ENSP00000365756:L22F	L	-	1	0	KIAA2013	11908818	0.998000	0.40836	0.999000	0.59377	0.991000	0.79684	0.719000	0.25881	1.409000	0.46915	0.563000	0.77884	CTC	.	.	.	none		0.771	KIAA2013-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006858.1	NM_138346	
UBXN11	91544	hgsc.bcm.edu	37	1	26608865	26608865	+	Silent	SNP	A	A	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:26608865A>G	ENST00000374222.1	-	16	1952	c.1488T>C	c.(1486-1488)ggT>ggC	p.G496G	UBXN11_ENST00000374223.1_Silent_p.G253G|UBXN11_ENST00000314675.7_Silent_p.G376G|UBXN11_ENST00000357089.4_Silent_p.G463G|UBXN11_ENST00000374221.3_Silent_p.G496G|UBXN11_ENST00000374217.2_Silent_p.G463G			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						cgggaccgggaccgggactgg	0.721																																					p.G496G		Atlas-SNP	.											.	UBXN11	54	.	1	Deletion - In frame(1)	ovary(1)	c.T1488C						PASS	.						25.0	29.0	28.0					1																	26608865		1768	4016	5784	SO:0001819	synonymous_variant	91544	exon16			ACCGGGACCGGGA	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1488T>C	chr1.hg19:g.26608865A>G		21.0	0.0	.		32.0	18.0	.	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Silent	SNP	ENST00000374222.1	hg19	CCDS41288.1																																																																																			.	.	.	none		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ECHDC2	55268	hgsc.bcm.edu	37	1	53362195	53362195	+	Silent	SNP	T	T	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:53362195T>C	ENST00000371522.4	-	10	969	c.876A>G	c.(874-876)aaA>aaG	p.K292K	ECHDC2_ENST00000536120.1_Silent_p.K246K|ECHDC2_ENST00000358358.5_Silent_p.K261K	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	292					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						ATGGGGGTCATTTGCCAACAA	0.488																																					p.K292K		Atlas-SNP	.											.	ECHDC2	37	.	0			c.A876G						PASS	.						71.0	73.0	72.0					1																	53362195		2203	4300	6503	SO:0001819	synonymous_variant	55268	exon10			GGGTCATTTGCCA	AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.876A>G	chr1.hg19:g.53362195T>C		75.0	0.0	.		49.0	13.0	.	NM_001198961	D3DQ36|Q9NV38	Silent	SNP	ENST00000371522.4	hg19	CCDS55600.1																																																																																			.	.	.	none		0.488	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024712.3	NM_018281	
USH2A	7399	hgsc.bcm.edu	37	1	216262462	216262462	+	Missense_Mutation	SNP	G	G	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:216262462G>T	ENST00000307340.3	-	23	5164	c.4778C>A	c.(4777-4779)aCt>aAt	p.T1593N	RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.T1593N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1593	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTAGTTGTAGTTACTTCCAC	0.333										HNSCC(13;0.011)																											p.T1593N		Atlas-SNP	.											.	USH2A	1168	.	0			c.C4778A						PASS	.						184.0	168.0	173.0					1																	216262462		2203	4300	6503	SO:0001583	missense	7399	exon23			GTTGTAGTTACTT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4778C>A	chr1.hg19:g.216262462G>T	ENSP00000305941:p.Thr1593Asn	74.0	0.0	.		52.0	18.0	.	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336688	0.60963	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.80304	-1.36;-1.36	5.8	4.88	0.63580	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.45361	D	0.000370	D	0.87006	0.6070	M	0.73962	2.25	0.38859	D	0.95643	D	0.61080	0.989	P	0.58780	0.845	D	0.87966	0.2733	10	0.41790	T	0.15	.	15.1749	0.72903	0.0:0.2669:0.7331:0.0	.	1593	O75445	USH2A_HUMAN	N	1593	ENSP00000305941:T1593N;ENSP00000355910:T1593N	ENSP00000305941:T1593N	T	-	2	0	USH2A	214329085	1.000000	0.71417	0.699000	0.30290	0.787000	0.44495	5.826000	0.69293	1.417000	0.47077	0.655000	0.94253	ACT	.	.	.	none		0.333	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
RYR2	6262	hgsc.bcm.edu	37	1	237730023	237730023	+	Missense_Mutation	SNP	C	C	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr1:237730023C>G	ENST00000366574.2	+	28	3688	c.3371C>G	c.(3370-3372)cCg>cGg	p.P1124R	RYR2_ENST00000542537.1_Missense_Mutation_p.P1108R|RYR2_ENST00000360064.6_Missense_Mutation_p.P1122R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1124	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGTTGTCAACCGGATCAGGAG	0.532																																					p.P1124R		Atlas-SNP	.											RYR2,colon,carcinoma,0,1	RYR2	1273	.	0			c.C3371G						PASS	.						218.0	216.0	217.0					1																	237730023		2066	4209	6275	SO:0001583	missense	6262	exon28			GTCAACCGGATCA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3371C>G	chr1.hg19:g.237730023C>G	ENSP00000355533:p.Pro1124Arg	152.0	0.0	.		185.0	48.0	.	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966699	0.74131	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.55588	0.51;0.51;0.51	5.29	5.29	0.74685	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000008	T	0.72558	0.3475	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.75814	-0.3185	10	0.87932	D	0	.	18.9442	0.92615	0.0:1.0:0.0:0.0	.	1124	Q92736	RYR2_HUMAN	R	1124;1122;1108	ENSP00000355533:P1124R;ENSP00000353174:P1122R;ENSP00000443798:P1108R	ENSP00000353174:P1122R	P	+	2	0	RYR2	235796646	1.000000	0.71417	0.114000	0.21550	0.563000	0.35712	7.814000	0.86154	2.465000	0.83290	0.655000	0.94253	CCG	.	.	.	none		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OXER1	165140	hgsc.bcm.edu	37	2	42990999	42990999	+	Silent	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr2:42990999C>A	ENST00000378661.2	-	1	402	c.321G>T	c.(319-321)ctG>ctT	p.L107L		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	107					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						TGTTCCCCACCAGGCCCAGGA	0.647																																					p.L107L		Atlas-SNP	.											.	OXER1	33	.	0			c.G321T						PASS	.						43.0	47.0	45.0					2																	42990999		2203	4300	6503	SO:0001819	synonymous_variant	165140	exon1			CCCCACCAGGCCC	AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.321G>T	chr2.hg19:g.42990999C>A		100.0	0.0	.		100.0	34.0	.	NM_148962	Q86WP7|Q8NGW4	Silent	SNP	ENST00000378661.2	hg19	CCDS1810.1																																																																																			.	.	.	none		0.647	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250514.1	NM_148962	
OSBPL11	114885	hgsc.bcm.edu	37	3	125298795	125298795	+	Missense_Mutation	SNP	A	A	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr3:125298795A>T	ENST00000296220.5	-	3	612	c.323T>A	c.(322-324)cTt>cAt	p.L108H		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	108	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						AGCTCCTGCAAGCTGCAAAGT	0.403																																					p.L108H		Atlas-SNP	.											.	OSBPL11	64	.	0			c.T323A						PASS	.						118.0	121.0	120.0					3																	125298795		2203	4300	6503	SO:0001583	missense	114885	exon3			CCTGCAAGCTGCA	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.323T>A	chr3.hg19:g.125298795A>T	ENSP00000296220:p.Leu108His	101.0	0.0	.		130.0	25.0	.	NM_022776	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	hg19	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.595561	0.86953	.	.	ENSG00000144909	ENST00000296220	D	0.84223	-1.82	5.07	5.07	0.68467	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.071226	0.56097	D	0.000021	D	0.94739	0.8302	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96314	0.9231	10	0.87932	D	0	0.5235	14.9917	0.71393	1.0:0.0:0.0:0.0	.	108	Q9BXB4	OSB11_HUMAN	H	108	ENSP00000296220:L108H	ENSP00000296220:L108H	L	-	2	0	OSBPL11	126781485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.073000	0.93992	2.124000	0.65301	0.533000	0.62120	CTT	.	.	.	none		0.403	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
NPHP3	27031	hgsc.bcm.edu	37	3	132418235	132418235	+	Silent	SNP	A	A	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr3:132418235A>T	ENST00000337331.5	-	13	2033	c.1947T>A	c.(1945-1947)atT>atA	p.I649I	NPHP3_ENST00000326682.8_Silent_p.I649I	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	649					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TCACAGAAACAATTACTCTTA	0.328																																					p.I649I		Atlas-SNP	.											.	NPHP3	110	.	0			c.T1947A						PASS	.						122.0	107.0	112.0					3																	132418235		2203	4300	6503	SO:0001819	synonymous_variant	27031	exon13			AGAAACAATTACT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.1947T>A	chr3.hg19:g.132418235A>T		48.0	0.0	.		61.0	22.0	.	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Silent	SNP	ENST00000337331.5	hg19	CCDS3078.1																																																																																			.	.	.	none		0.328	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
SLC22A3	6581	hgsc.bcm.edu	37	6	160769796	160769796	+	Silent	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:160769796C>T	ENST00000275300.2	+	1	497	c.345C>T	c.(343-345)gcC>gcT	p.A115A	SLC22A3_ENST00000392145.1_Silent_p.A115A	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	115					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	ACCCACTCGCCGCCTTCCCCA	0.756																																					p.A115A		Atlas-SNP	.											.	SLC22A3	58	.	0			c.C345T						PASS	.						3.0	3.0	3.0					6																	160769796		1659	3388	5047	SO:0001819	synonymous_variant	6581	exon1			ACTCGCCGCCTTC	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.345C>T	chr6.hg19:g.160769796C>T		0.0	0.0	.		23.0	11.0	.	NM_021977	Q5SYN6|Q9UP02	Silent	SNP	ENST00000275300.2	hg19	CCDS5277.1																																																																																			.	.	.	none		0.756	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		58.0	0.0	.		75.0	10.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TNRC18	84629	hgsc.bcm.edu	37	7	5352626	5352626	+	Silent	SNP	A	A	T	rs180704395		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr7:5352626A>T	ENST00000430969.1	-	27	8244	c.7896T>A	c.(7894-7896)tcT>tcA	p.S2632S	TNRC18_ENST00000399537.4_Silent_p.S2632S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2632	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aggaggaggaagaggaggatg	0.627																																					p.S2632S		Atlas-SNP	.											TNRC18_ENST00000430969,NS,malignant_melanoma,0,3	TNRC18	311	.	0			c.T7896A						PASS	.						6.0	7.0	7.0					7																	5352626		1437	3278	4715	SO:0001819	synonymous_variant	84629	exon27			GGAGGAAGAGGAG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7896T>A	chr7.hg19:g.5352626A>T		3.0	0.0	.		16.0	3.0	.	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	N	0.241	-1.013754	0.02095	.	.	ENSG00000182095	ENST00000399544	.	.	.	4.15	0.579	0.17397	.	0.267986	0.19999	N	0.101365	T	0.62829	0.2460	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61426	-0.7065	6	0.87932	D	0	.	8.5864	0.33660	0.458:0.0:0.542:0.0	.	.	.	.	H	1145	.	ENSP00000382459:L1145H	L	-	2	0	TNRC18	5319152	0.991000	0.36638	0.765000	0.31456	0.005000	0.04900	0.298000	0.19120	-0.159000	0.11021	-1.232000	0.01568	CTT	.	A|0.966;G|0.034	.	alt		0.627	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TAF6	6878	hgsc.bcm.edu	37	7	99707631	99707631	+	Silent	SNP	G	G	A	rs148894017		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr7:99707631G>A	ENST00000344095.4	-	12	1749	c.1224C>T	c.(1222-1224)gaC>gaT	p.D408D	TAF6_ENST00000452041.1_Silent_p.D408D|TAF6_ENST00000453269.2_Silent_p.D408D|AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000418432.2_Silent_p.D332D|TAF6_ENST00000437822.2_Silent_p.D445D|TAF6_ENST00000472509.1_Silent_p.D465D	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	408					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACAGGGCCGTCCAGCACAC	0.587																																					p.D445D		Atlas-SNP	.											.	TAF6	55	.	0			c.C1335T						PASS	.	G	,,	0,4406		0,0,2203	110.0	97.0	101.0		1335,1224,1224	-6.5	0.9	7	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TAF6	NM_001190415.1,NM_005641.3,NM_139315.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	445/715,408/678,408/678	99707631	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6878	exon12			AGGGCCGTCCAGC		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1224C>T	chr7.hg19:g.99707631G>A		124.0	0.0	.		155.0	37.0	.	NM_001190415	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	hg19	CCDS5686.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.587	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
AKNA	80709	hgsc.bcm.edu	37	9	117143567	117143567	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr9:117143567C>A	ENST00000307564.4	-	2	208	c.47G>T	c.(46-48)gGg>gTg	p.G16V	AKNA_ENST00000312033.3_Missense_Mutation_p.G16V|AKNA_ENST00000374088.3_Missense_Mutation_p.G16V	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	16					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GGGGCCCTTCCCCAGGCCAGG	0.622																																					p.G16V		Atlas-SNP	.											.	AKNA	119	.	0			c.G47T						PASS	.						35.0	28.0	31.0					9																	117143567		2201	4299	6500	SO:0001583	missense	80709	exon2			CCCTTCCCCAGGC	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.47G>T	chr9.hg19:g.117143567C>A	ENSP00000303769:p.Gly16Val	38.0	0.0	.		83.0	25.0	.	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	hg19	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167000	0.38217	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000312033;ENST00000394574	T;T;T	0.58940	1.58;1.58;0.3	3.83	3.83	0.44106	.	0.000000	0.43919	D	0.000520	T	0.64023	0.2561	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66614	-0.5879	10	0.87932	D	0	-30.4003	11.5452	0.50690	0.0:1.0:0.0:0.0	.	16;16	Q7Z591-6;Q7Z591	.;AKNA_HUMAN	V	16	ENSP00000303769:G16V;ENSP00000363201:G16V;ENSP00000309222:G16V	ENSP00000303769:G16V	G	-	2	0	AKNA	116183388	0.873000	0.30073	0.977000	0.42913	0.053000	0.15095	1.457000	0.35212	2.460000	0.83146	0.561000	0.74099	GGG	.	.	.	none		0.622	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
GAD2	2572	hgsc.bcm.edu	37	10	26506915	26506915	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:26506915C>T	ENST00000376261.3	+	3	784	c.281C>T	c.(280-282)gCa>gTa	p.A94V	GAD2_ENST00000376248.1_5'Flank|GAD2_ENST00000259271.3_Missense_Mutation_p.A94V	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	94					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTTCTCCATGCAACAGGTAAA	0.721																																					p.A94V		Atlas-SNP	.											.	GAD2	116	.	0			c.C281T						PASS	.						27.0	36.0	33.0					10																	26506915		2200	4295	6495	SO:0001583	missense	2572	exon3			TCCATGCAACAGG	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.281C>T	chr10.hg19:g.26506915C>T	ENSP00000365437:p.Ala94Val	77.0	0.0	.		195.0	54.0	.	NM_000818	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	hg19	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996975	0.54147	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517	T;T;T	0.59638	0.25;0.25;0.25	5.84	4.88	0.63580	.	0.414814	0.27068	N	0.021100	T	0.51398	0.1672	L	0.54323	1.7	0.80722	D	1	P;B	0.39480	0.675;0.048	B;B	0.32864	0.154;0.016	T	0.59289	-0.7482	10	0.56958	D	0.05	-3.897	16.0867	0.81060	0.0:0.866:0.134:0.0	.	94;94	Q4G154;Q05329	.;DCE2_HUMAN	V	94	ENSP00000365437:A94V;ENSP00000259271:A94V;ENSP00000390434:A94V	ENSP00000259271:A94V	A	+	2	0	GAD2	26546921	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	4.858000	0.62947	2.768000	0.95171	0.561000	0.74099	GCA	.	.	.	none		0.721	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
KIF5B	3799	hgsc.bcm.edu	37	10	32326205	32326205	+	Missense_Mutation	SNP	C	C	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:32326205C>A	ENST00000302418.4	-	8	1145	c.688G>T	c.(688-690)Gtt>Ttt	p.V230F		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	230	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				GCTAAATCAACCAGATAAAGT	0.338			T	"""RET, ALK"""	NSCLC																																p.V230F		Atlas-SNP	.		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	KIF5B	81	.	0			c.G688T						PASS	.						127.0	110.0	116.0					10																	32326205		2202	4298	6500	SO:0001583	missense	3799	exon8			AATCAACCAGATA	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.688G>T	chr10.hg19:g.32326205C>A	ENSP00000307078:p.Val230Phe	89.0	0.0	.		77.0	10.0	.	NM_004521	A0AVB2|Q5VZ85	Missense_Mutation	SNP	ENST00000302418.4	hg19	CCDS7171.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891963	0.91889	.	.	ENSG00000170759	ENST00000302418	D	0.83335	-1.71	5.0	5.0	0.66597	Kinesin, motor domain (5);Kinesin, motor region, conserved site (1);	0.062994	0.64402	D	0.000007	D	0.95404	0.8508	H	0.99299	4.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97679	1.0171	10	0.87932	D	0	.	18.6607	0.91471	0.0:1.0:0.0:0.0	.	230	P33176	KINH_HUMAN	F	230	ENSP00000307078:V230F	ENSP00000307078:V230F	V	-	1	0	KIF5B	32366211	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.811000	0.86092	2.449000	0.82847	0.557000	0.71058	GTT	.	.	.	none		0.338	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	
WDFY4	57705	hgsc.bcm.edu	37	10	49983779	49983779	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr10:49983779C>T	ENST00000325239.5	+	14	2818	c.2791C>T	c.(2791-2793)Ccc>Tcc	p.P931S	WDFY4_ENST00000413659.2_Missense_Mutation_p.P931S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	931						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TCTTGGAATTCCCTCATCTCT	0.453																																					p.P931S		Atlas-SNP	.											.	WDFY4	205	.	0			c.C2791T						PASS	.						185.0	156.0	165.0					10																	49983779		692	1591	2283	SO:0001583	missense	57705	exon15			GGAATTCCCTCAT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2791C>T	chr10.hg19:g.49983779C>T	ENSP00000320563:p.Pro931Ser	93.0	0.0	.		92.0	30.0	.	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.81|14.81	2.645807|2.645807	0.47258|0.47258	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659|ENST00000312002	T;T|.	0.66815|.	-0.23;-0.23|.	4.51|4.51	-2.44|-2.44	0.06502|0.06502	.|.	.|.	.|.	.|.	.|.	T|T	0.52693|0.52693	0.1750|0.1750	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	B|.	0.20780|.	0.048|.	B|.	0.20577|.	0.03|.	T|T	0.54616|0.54616	-0.8267|-0.8267	8|5	.|.	.|.	.|.	.|.	11.8647|11.8647	0.52486|0.52486	0.0:0.2247:0.6889:0.0864|0.0:0.2247:0.6889:0.0864	.|.	931|.	Q6ZS81|.	WDFY4_HUMAN|.	S|F	940;931;931;931|21	ENSP00000320563:P931S;ENSP00000403789:P931S|.	.|.	P|S	+|+	1|2	0|0	WDFY4|WDFY4	49653785|49653785	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.855000|0.855000	0.48748|0.48748	-0.810000|-0.810000	0.04505|0.04505	-0.324000|-0.324000	0.08589|0.08589	-0.121000|-0.121000	0.15023|0.15023	CCC|TCC	.	.	.	none		0.453	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
MUC2	4583	hgsc.bcm.edu	37	11	1093204	1093204	+	Missense_Mutation	SNP	C	C	A	rs56299570		TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:1093204C>A	ENST00000441003.2	+	30	5050	c.5023C>A	c.(5023-5025)Cca>Aca	p.P1675T	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.P1642T|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1675T(1)|p.P1642T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gtccccaaccccaacagccat	0.627																																					p.P1675T		Atlas-SNP	.											MUC2_ENST00000441003,caecum,carcinoma,0,4	MUC2	614	.	2	Substitution - Missense(2)	kidney(2)	c.C5023A						PASS	.																																			SO:0001583	missense	4583	exon30			CCAACCCCAACAG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5023C>A	chr11.hg19:g.1093204C>A	ENSP00000415183:p.Pro1675Thr	70.0	1.0	.		55.0	5.0	.	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	C	0.954	-0.705464	0.03255	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.09073	3.02;3.53	1.75	-3.49	0.04724	.	0.575351	0.10542	U	0.662513	T	0.04092	0.0114	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45381	-0.9265	9	0.16896	T	0.51	.	6.9769	0.24681	0.6778:0.3222:0.0:0.0	rs56299570	1675	E7EUV1	.	T	1675;1642	ENSP00000415183:P1675T;ENSP00000351956:P1642T	ENSP00000351956:P1642T	P	+	1	0	MUC2	1083204	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.268000	0.00533	-1.450000	0.01936	0.184000	0.17185	CCA	.	.	.	weak		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
STIM1	6786	hgsc.bcm.edu	37	11	4104179	4104179	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr11:4104179T>G	ENST00000300737.4	+	9	1774	c.1205T>G	c.(1204-1206)cTg>cGg	p.L402R	STIM1_ENST00000527651.1_Missense_Mutation_p.L402R|STIM1_ENST00000533977.1_Missense_Mutation_p.L229R	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	402	SOAR/CAD.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		AGCTCTTCCCTGGATGATGTA	0.448																																					p.L402R		Atlas-SNP	.											.	STIM1	55	.	0			c.T1205G						PASS	.						104.0	93.0	97.0					11																	4104179		2201	4298	6499	SO:0001583	missense	6786	exon9			CTTCCCTGGATGA	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1205T>G	chr11.hg19:g.4104179T>G	ENSP00000300737:p.Leu402Arg	365.0	0.0	.		324.0	102.0	.	NM_003156	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	hg19	CCDS7749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.99|19.99	3.928765|3.928765	0.73327|0.73327	.|.	.|.	ENSG00000167323|ENSG00000167323	ENST00000300737;ENST00000527651;ENST00000533977|ENST00000526596	T;T;T|.	0.81330|.	-0.52;-1.48;-0.51|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73009|0.73009	0.3532|0.3532	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.69307|.	0.946;0.963|.	T|T	0.73528|0.73528	-0.3954|-0.3954	10|5	0.87932|.	D|.	0|.	-15.7324|-15.7324	14.4442|14.4442	0.67338|0.67338	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	402;402|.	E9PQJ4;Q13586|.	.;STIM1_HUMAN|.	R|G	402;402;229|133	ENSP00000300737:L402R;ENSP00000436208:L402R;ENSP00000434767:L229R|.	ENSP00000300737:L402R|.	L|W	+|+	2|1	0|0	STIM1|STIM1	4060755|4060755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.687000|7.687000	0.84139|0.84139	2.007000|2.007000	0.58848|0.58848	0.374000|0.374000	0.22700|0.22700	CTG|TGG	.	.	.	none		0.448	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
ALX1	8092	hgsc.bcm.edu	37	12	85674223	85674223	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr12:85674223C>T	ENST00000316824.3	+	1	339	c.184C>T	c.(184-186)Cac>Tac	p.H62Y		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	62					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CGCCGAGCATCACGTGCGCTT	0.637																																					p.H62Y		Atlas-SNP	.											.	ALX1	61	.	0			c.C184T						PASS	.						34.0	35.0	35.0					12																	85674223		2203	4300	6503	SO:0001583	missense	8092	exon1			GAGCATCACGTGC	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.184C>T	chr12.hg19:g.85674223C>T	ENSP00000315417:p.His62Tyr	76.0	0.0	.		120.0	5.0	.	NM_006982	Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	hg19	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496984	0.85069	.	.	ENSG00000180318	ENST00000316824	D	0.92149	-2.98	5.47	5.47	0.80525	.	0.115168	0.64402	D	0.000015	D	0.88633	0.6489	N	0.19112	0.55	0.80722	D	1	P	0.39094	0.659	B	0.42959	0.403	D	0.87426	0.2385	10	0.32370	T	0.25	.	19.3325	0.94297	0.0:1.0:0.0:0.0	.	62	Q15699	ALX1_HUMAN	Y	62	ENSP00000315417:H62Y	ENSP00000315417:H62Y	H	+	1	0	ALX1	84198354	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.483000	0.60264	2.558000	0.86282	0.650000	0.86243	CAC	.	.	.	none		0.637	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
HECTD1	25831	hgsc.bcm.edu	37	14	31576342	31576342	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr14:31576342G>A	ENST00000399332.1	-	38	7224	c.6736C>T	c.(6736-6738)Cat>Tat	p.H2246Y	HECTD1_ENST00000553700.1_Missense_Mutation_p.H2246Y	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2246	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		CCAAGGAAATGAAACAGTTTC	0.383																																					p.H2246Y		Atlas-SNP	.											.	HECTD1	159	.	0			c.C6736T						PASS	.						113.0	108.0	110.0					14																	31576342		1901	4112	6013	SO:0001583	missense	25831	exon38			GGAAATGAAACAG	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6736C>T	chr14.hg19:g.31576342G>A	ENSP00000382269:p.His2246Tyr	191.0	0.0	.		161.0	36.0	.	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	3.742	-0.053467	0.07362	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332	T;T	0.56941	0.43;0.43	6.06	6.06	0.98353	HECT (4);	0.256570	0.26903	U	0.021909	T	0.31949	0.0813	N	0.11201	0.11	0.46298	D	0.99897	P	0.35208	0.49	B	0.32762	0.152	T	0.28138	-1.0053	10	0.02654	T	1	-11.499	18.8088	0.92050	0.0:0.0:1.0:0.0	.	2246	Q9ULT8	HECD1_HUMAN	Y	2246;2248;2246	ENSP00000450697:H2246Y;ENSP00000382269:H2246Y	ENSP00000261312:H2248Y	H	-	1	0	HECTD1	30646093	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.391000	0.73208	2.871000	0.98454	0.655000	0.94253	CAT	.	.	.	none		0.383	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
KIF7	374654	hgsc.bcm.edu	37	15	90174782	90174782	+	Missense_Mutation	SNP	T	T	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr15:90174782T>G	ENST00000394412.3	-	15	3131	c.3055A>C	c.(3055-3057)Aag>Cag	p.K1019Q	KIF7_ENST00000558928.1_5'Flank	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1019					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AGGCGCTGCTTGAGCAGCGAG	0.677																																					p.K1019Q		Atlas-SNP	.											.	KIF7	130	.	0			c.A3055C						PASS	.						29.0	27.0	27.0					15																	90174782		2199	4292	6491	SO:0001583	missense	374654	exon15			GCTGCTTGAGCAG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3055A>C	chr15.hg19:g.90174782T>G	ENSP00000377934:p.Lys1019Gln	69.0	0.0	.		100.0	32.0	.	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	hg19	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.877591	0.91664	.	.	ENSG00000166813	ENST00000394412	T	0.48836	0.8	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.66577	0.2803	M	0.70275	2.135	0.54753	D	0.999983	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.67321	-0.5700	10	0.40728	T	0.16	.	14.4086	0.67101	0.0:0.0:0.0:1.0	.	505;1019	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Q	1019	ENSP00000377934:K1019Q	ENSP00000377934:K1019Q	K	-	1	0	KIF7	87975786	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.570000	0.82390	1.802000	0.52723	0.379000	0.24179	AAG	.	.	.	none		0.677	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
PYDC1	260434	hgsc.bcm.edu	37	16	31226442	31226442	+	IGR	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:31226442G>A	ENST00000302964.3	-	0	813				TRIM72_ENST00000322122.3_Missense_Mutation_p.R128H|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1						innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GCCCACGCACGCCTCAAGGTG	0.687																																					p.R128H		Atlas-SNP	.											.	TRIM72	32	.	0			c.G383A						PASS	.						9.0	9.0	9.0					16																	31226442		1778	3412	5190	SO:0001628	intergenic_variant	493829	exon2			ACGCACGCCTCAA		CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407		chr16.hg19:g.31226442G>A		0.0	0.0	.		31.0	19.0	.	NM_001008274	B2R8L4|Q8NFP8	Missense_Mutation	SNP	ENST00000302964.3	hg19	CCDS10710.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815564	0.70912	.	.	ENSG00000177238	ENST00000322122	T	0.57436	0.4	4.93	4.93	0.64822	.	0.080103	0.48767	D	0.000171	T	0.62441	0.2428	L	0.58101	1.795	0.34316	D	0.686018	D	0.89917	1.0	D	0.67725	0.953	T	0.65340	-0.6192	10	0.16420	T	0.52	.	10.896	0.47023	0.0887:0.0:0.9113:0.0	.	128	Q6ZMU5	TRI72_HUMAN	H	128	ENSP00000312675:R128H	ENSP00000312675:R128H	R	+	2	0	TRIM72	31133943	0.998000	0.40836	0.997000	0.53966	0.042000	0.13812	3.403000	0.52615	2.454000	0.82982	0.655000	0.94253	CGC	.	.	.	none		0.687	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255543.2	NM_152901	
ZDHHC7	55625	hgsc.bcm.edu	37	16	85010785	85010785	+	Silent	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr16:85010785G>A	ENST00000313732.4	-	7	1018	c.666C>T	c.(664-666)ttC>ttT	p.F222F	ZDHHC7_ENST00000564466.1_Silent_p.F259F|ZDHHC7_ENST00000569488.1_5'UTR	NM_017740.2	NP_060210.2	Q9NXF8	ZDHC7_HUMAN	zinc finger, DHHC-type containing 7	222					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			large_intestine(6)|lung(4)	10						CAAGGCACAGGAAGATCAACA	0.463																																					p.F259F		Atlas-SNP	.											.	ZDHHC7	55	.	0			c.C777T						PASS	.						155.0	139.0	144.0					16																	85010785		2199	4300	6499	SO:0001819	synonymous_variant	55625	exon8			GCACAGGAAGATC	AK000286	CCDS10950.1, CCDS45538.1	16q23.1	2010-02-09			ENSG00000153786	ENSG00000153786		"""Zinc fingers, DHHC-type"""	18459	protein-coding gene	gene with protein product	"""Sertoli cell gene with zinc finger domain-&#946;"""	614604					Standard	NM_017740		Approved	FLJ10792, ZNF370, FLJ20279, SERZ-B, SERZ1	uc002fiq.2	Q9NXF8	OTTHUMG00000137645	ENST00000313732.4:c.666C>T	chr16.hg19:g.85010785G>A		165.0	0.0	.		209.0	45.0	.	NM_001145548	D3DUM1|Q8WV42|Q9NVD8	Silent	SNP	ENST00000313732.4	hg19	CCDS10950.1																																																																																			.	.	.	none		0.463	ZDHHC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269087.1	NM_017740	
ZNF429	353088	hgsc.bcm.edu	37	19	21720704	21720704	+	Missense_Mutation	SNP	A	A	G			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr19:21720704A>G	ENST00000358491.4	+	4	2057	c.1849A>G	c.(1849-1851)Aga>Gga	p.R617G	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	617					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AATTCATACTAGAGAGAAACC	0.373																																					p.R617G		Atlas-SNP	.											ZNF429,NS,malignant_melanoma,0,1	ZNF429	338	.	0			c.A1849G						PASS	.						59.0	65.0	63.0					19																	21720704		2081	4245	6326	SO:0001583	missense	353088	exon4			CATACTAGAGAGA	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1849A>G	chr19.hg19:g.21720704A>G	ENSP00000351280:p.Arg617Gly	59.0	0.0	.		63.0	3.0	.	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	hg19	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.970090	0.00457	.	.	ENSG00000197013	ENST00000358491	T	0.11495	2.77	1.25	-2.5	0.06384	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01489	0.0048	N	0.00094	-2.165	0.27992	N	0.935624	B	0.02656	0.0	B	0.01281	0.0	T	0.42666	-0.9438	9	0.02654	T	1	.	7.448	0.27221	0.2389:0.0:0.7611:0.0	.	617	Q86V71	ZN429_HUMAN	G	617	ENSP00000351280:R617G	ENSP00000351280:R617G	R	+	1	2	ZNF429	21512544	0.360000	0.24964	0.000000	0.03702	0.008000	0.06430	0.999000	0.29757	-0.893000	0.03930	-0.627000	0.03993	AGA	.	.	.	none		0.373	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
DNMT3B	1789	hgsc.bcm.edu	37	20	31389169	31389169	+	Missense_Mutation	SNP	G	G	C			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:31389169G>C	ENST00000328111.2	+	19	2403	c.2082G>C	c.(2080-2082)tgG>tgC	p.W694C	DNMT3B_ENST00000443239.3_Missense_Mutation_p.W632C|DNMT3B_ENST00000201963.3_Missense_Mutation_p.W686C|DNMT3B_ENST00000348286.2_Missense_Mutation_p.W674C|DNMT3B_ENST00000353855.2_Missense_Mutation_p.W674C|DNMT3B_ENST00000456297.2_Missense_Mutation_p.W598C|DNMT3B_ENST00000344505.4_Missense_Mutation_p.W674C	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	694	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGTTCTTCTGGATGTTTGAGA	0.532																																					p.W694C		Atlas-SNP	.											.	DNMT3B	196	.	0			c.G2082C						PASS	.						105.0	95.0	98.0					20																	31389169		2203	4300	6503	SO:0001583	missense	1789	exon19			CTTCTGGATGTTT		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.2082G>C	chr20.hg19:g.31389169G>C	ENSP00000328547:p.Trp694Cys	216.0	0.0	.		264.0	77.0	.	NM_006892	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	hg19	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875757	0.91664	.	.	ENSG00000088305	ENST00000328111;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000201963	D;D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.91858	0.7423	M	0.80508	2.5	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.992;0.998;0.999;0.999;0.987;0.999;0.999	D	0.92078	0.5670	10	0.87932	D	0	-23.2234	19.2924	0.94105	0.0:0.0:1.0:0.0	.	598;632;393;686;674;674;694	E9PBF2;E7EN63;B3KM53;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;.;DNM3B_HUMAN	C	694;674;674;632;598;674;686	ENSP00000328547:W694C;ENSP00000313397:W674C;ENSP00000337764:W674C;ENSP00000403169:W632C;ENSP00000412305:W598C;ENSP00000345105:W674C;ENSP00000201963:W686C	ENSP00000201963:W686C	W	+	3	0	DNMT3B	30852830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.878000	0.98634	0.650000	0.86243	TGG	.	.	.	none		0.532	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
L3MBTL1	26013	hgsc.bcm.edu	37	20	42162966	42162966	+	Missense_Mutation	SNP	G	G	A			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr20:42162966G>A	ENST00000427442.2	+	15	1735	c.1576G>A	c.(1576-1578)Gtg>Atg	p.V526M	L3MBTL1_ENST00000444063.1_Missense_Mutation_p.V458M|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.V526M|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.V458M|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.V458M			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	458					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GCTGGAGGCTGTGGACCGCAG	0.632																																					p.V526M		Atlas-SNP	.											.	L3MBTL1	105	.	0			c.G1576A						PASS	.						45.0	47.0	46.0					20																	42162966		2203	4300	6503	SO:0001583	missense	26013	exon15			GAGGCTGTGGACC	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1576G>A	chr20.hg19:g.42162966G>A	ENSP00000402107:p.Val526Met	79.0	0.0	.		101.0	25.0	.	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	hg19	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	G	31	5.080728	0.94050	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133	T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19	5.39	5.39	0.77823	.	0.115236	0.64402	D	0.000019	T	0.69324	0.3098	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.997;1.0;0.996	T	0.76170	-0.3057	10	0.87932	D	0	.	18.0965	0.89492	0.0:0.0:1.0:0.0	.	526;110;458;458	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1	.;.;.;.	M	526;526;458;458;458;244;110	ENSP00000402107:V526M;ENSP00000398516:V526M;ENSP00000362227:V458M;ENSP00000403316:V458M;ENSP00000362226:V458M;ENSP00000410139:V244M	ENSP00000362225:V110M	V	+	1	0	L3MBTL1	41596380	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.598000	0.98277	2.804000	0.96469	0.655000	0.94253	GTG	.	.	.	none		0.632	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
DOPEY2	9980	hgsc.bcm.edu	37	21	37642372	37642372	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr21:37642372C>T	ENST00000399151.3	+	27	5634	c.5549C>T	c.(5548-5550)aCc>aTc	p.T1850I		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1850					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTGGAGCAAACCAGCTGGCTA	0.493																																					p.T1850I		Atlas-SNP	.											.	DOPEY2	184	.	0			c.C5549T						PASS	.						104.0	109.0	108.0					21																	37642372		2203	4300	6503	SO:0001583	missense	9980	exon27			AGCAAACCAGCTG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.5549C>T	chr21.hg19:g.37642372C>T	ENSP00000382104:p.Thr1850Ile	79.0	0.0	.		82.0	25.0	.	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	hg19	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422737	0.83559	.	.	ENSG00000142197	ENST00000399151	T	0.14516	2.5	5.47	4.59	0.56863	.	0.049713	0.85682	N	0.000000	T	0.41119	0.1145	M	0.85542	2.76	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.41998	-0.9477	10	0.51188	T	0.08	-3.5123	13.7957	0.63168	0.0:0.9267:0.0:0.0733	.	1850;1850	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	I	1850	ENSP00000382104:T1850I	ENSP00000382104:T1850I	T	+	2	0	DOPEY2	36564242	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.300000	0.78841	1.311000	0.45024	0.650000	0.86243	ACC	.	.	.	none		0.493	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
ZBED4	9889	hgsc.bcm.edu	37	22	50279802	50279802	+	Missense_Mutation	SNP	C	C	T			TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr22:50279802C>T	ENST00000216268.5	+	2	2969	c.2492C>T	c.(2491-2493)aCg>aTg	p.T831M		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	831						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		TTCAGCCATACGGTGAACCTG	0.642																																					p.T831M		Atlas-SNP	.											ZBED4,NS,adenocarcinoma,0,1	ZBED4	102	.	0			c.C2492T						PASS	.						35.0	35.0	35.0					22																	50279802		2202	4300	6502	SO:0001583	missense	9889	exon2			GCCATACGGTGAA	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2492C>T	chr22.hg19:g.50279802C>T	ENSP00000216268:p.Thr831Met	114.0	1.0	.		159.0	49.0	.	NM_014838	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	hg19	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	C	14.16	2.451158	0.43531	.	.	ENSG00000100426	ENST00000216268	T	0.23348	1.91	5.57	3.46	0.39613	Ribonuclease H-like (1);	0.113857	0.64402	N	0.000019	T	0.47911	0.1471	M	0.77820	2.39	0.49483	D	0.999791	D	0.89917	1.0	D	0.71656	0.974	T	0.44757	-0.9307	10	0.54805	T	0.06	-22.2447	10.3753	0.44079	0.1354:0.7951:0.0:0.0695	.	831	O75132	ZBED4_HUMAN	M	831	ENSP00000216268:T831M	ENSP00000216268:T831M	T	+	2	0	ZBED4	48665806	0.999000	0.42202	0.659000	0.29680	0.301000	0.27625	4.300000	0.59079	0.688000	0.31529	0.655000	0.94253	ACG	.	.	.	none		0.642	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
F12	2161	hgsc.bcm.edu	37	5	176833055	176833058	+	Frame_Shift_Del	DEL	AGTG	AGTG	-	rs149368999	byFrequency	TCGA-DW-7963-01B-11D-A28G-10	TCGA-DW-7963-10C-01D-A28G-10	AGTG	AGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	15b3020f-71db-4d0e-8f6a-edf5552e3064	a522a63d-1b4f-46ea-bcfc-5dbbc855a5bb	g.chr5:176833055_176833058delAGTG	ENST00000253496.3	-	3	168_171	c.120_123delCACT	c.(118-123)ctcactfs	p.LT40fs	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	40					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CCCCGGTGACAGTGAGAACTGCAG	0.588									Hereditary Angioedema																												p.41_42del		Atlas-Indel,Pindel	.											.	F12	35	.	0			c.121_124del						PASS	.																																			SO:0001589	frameshift_variant	2161	exon3	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	.	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.120_123delCACT	chr5.hg19:g.176833055_176833058delAGTG	ENSP00000253496:p.Leu40fs	63.0	0.0	0		71.0	23.0	0.323944	NM_000505	P78339	Frame_Shift_Del	DEL	ENST00000253496.3	hg19	CCDS34302.1																																																																																			.	.	.	none		0.588	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
