#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZCCHC17	51538	hgsc.bcm.edu	37	1	31836979	31836979	+	Missense_Mutation	SNP	A	A	C	rs111803813		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:31836979A>C	ENST00000373714.1	+	8	926	c.665A>C	c.(664-666)gAc>gCc	p.D222A	ZCCHC17_ENST00000546109.1_Missense_Mutation_p.D214A|ZCCHC17_ENST00000344147.5_Missense_Mutation_p.D222A|FABP3_ENST00000497275.1_5'Flank|ZCCHC17_ENST00000422613.2_Missense_Mutation_p.D224A	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	222	Lys-rich.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		ACATCAAAAGACAGCAAGGCA	0.433																																					p.D222A		Atlas-SNP	.											.	ZCCHC17	30	.	0			c.A665C						PASS	.						82.0	86.0	85.0					1																	31836979		2203	4300	6503	SO:0001583	missense	51538	exon8			CAAAAGACAGCAA	AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.665A>C	chr1.hg19:g.31836979A>C	ENSP00000362819:p.Asp222Ala	99.0	0.0	.		133.0	23.0	.	NM_016505	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Missense_Mutation	SNP	ENST00000373714.1	hg19	CCDS341.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.025038	0.54683	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	.	.	.	5.08	5.08	0.68730	.	0.376195	0.32055	N	0.006643	T	0.41488	0.1161	N	0.19112	0.55	0.25685	N	0.98575	D;B;B	0.69078	0.997;0.023;0.008	D;B;B	0.75484	0.986;0.007;0.001	T	0.23904	-1.0175	9	0.66056	D	0.02	.	9.0275	0.36239	0.814:0.186:0.0:0.0	.	224;214;222	E7EPF0;B4DY38;Q9NP64	.;.;NO40_HUMAN	A	222;222;214;224	.	ENSP00000343557:D222A	D	+	2	0	ZCCHC17	31609566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.513000	0.45494	2.135000	0.66039	0.528000	0.53228	GAC	.	G|1.000;|0.000	.	alt		0.433	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010665.1	NM_016505	
ADAM30	11085	hgsc.bcm.edu	37	1	120436921	120436921	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:120436921C>T	ENST00000369400.1	-	1	2197	c.2039G>A	c.(2038-2040)gGg>gAg	p.G680E		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	680					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GGGAATCGCCCCTCTGAGCAG	0.473																																					p.G680E		Atlas-SNP	.											.	ADAM30	88	.	0			c.G2039A						PASS	.						65.0	64.0	64.0					1																	120436921		2203	4300	6503	SO:0001583	missense	11085	exon1			ATCGCCCCTCTGA	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2039G>A	chr1.hg19:g.120436921C>T	ENSP00000358407:p.Gly680Glu	65.0	0.0	.		95.0	31.0	.	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	hg19	CCDS907.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.021307	0.00414	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01126	5.3	5.05	-10.1	0.00402	.	3.564080	0.01402	N	0.013659	T	0.00109	0.0003	N	0.05031	-0.125	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.47394	-0.9121	10	0.02654	T	1	.	1.9545	0.03373	0.4755:0.1902:0.2118:0.1224	.	680	Q9UKF2	ADA30_HUMAN	E	680	ENSP00000358407:G680E	ENSP00000358407:G680E	G	-	2	0	ADAM30	120238444	.	.	0.000000	0.03702	0.002000	0.02628	.	.	-4.800000	0.00031	-1.047000	0.02352	GGG	.	.	.	none		0.473	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
AIM2	9447	hgsc.bcm.edu	37	1	159033450	159033450	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:159033450C>G	ENST00000368130.4	-	5	1119	c.831G>C	c.(829-831)aaG>aaC	p.K277N	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	277	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					ATATGTTTTTCTTCTTTTCTG	0.398																																					p.K277N		Atlas-SNP	.											.	AIM2	70	.	0			c.G831C						PASS	.						117.0	121.0	120.0					1																	159033450		2203	4300	6503	SO:0001583	missense	9447	exon5			GTTTTTCTTCTTT	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.831G>C	chr1.hg19:g.159033450C>G	ENSP00000357112:p.Lys277Asn	167.0	0.0	.		199.0	60.0	.	NM_004833	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	ENST00000368130.4	hg19	CCDS1181.1	.	.	.	.	.	.	.	.	.	.	C	2.160	-0.392489	0.04899	.	.	ENSG00000163568	ENST00000368130;ENST00000368129	T;T	0.14266	2.52;2.52	3.92	-4.82	0.03171	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	1.433050	0.05063	N	0.480252	T	0.01558	0.0050	N	0.17723	0.515	0.09310	N	1	B	0.21606	0.058	B	0.19391	0.025	T	0.42816	-0.9429	10	0.14252	T	0.57	-0.6466	1.0125	0.01500	0.1428:0.2093:0.2823:0.3657	.	277	O14862	AIM2_HUMAN	N	277;140	ENSP00000357112:K277N;ENSP00000357111:K140N	ENSP00000357111:K140N	K	-	3	2	AIM2	157300074	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.991000	0.03728	-0.739000	0.04809	-1.099000	0.02127	AAG	.	.	.	none		0.398	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833	
GLUL	2752	hgsc.bcm.edu	37	1	182356292	182356292	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:182356292A>T	ENST00000331872.6	-	3	842	c.302T>A	c.(301-303)gTt>gAt	p.V101D	GLUL_ENST00000311223.5_Missense_Mutation_p.V101D|GLUL_ENST00000417584.2_Missense_Mutation_p.V101D|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000339526.4_Missense_Mutation_p.V101D	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	101					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GTACTTGAAAACTTCACATAA	0.493																																					p.V101D		Atlas-SNP	.											.	GLUL	38	.	0			c.T302A						PASS	.						112.0	101.0	105.0					1																	182356292		2203	4300	6503	SO:0001583	missense	2752	exon3			TTGAAAACTTCAC	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.302T>A	chr1.hg19:g.182356292A>T	ENSP00000356537:p.Val101Asp	109.0	0.0	.		106.0	10.0	.	NM_001033056	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	ENST00000331872.6	hg19	CCDS1344.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704904	0.88924	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526;ENST00000435013	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	4.79	4.79	0.61399	Glutamine synthetase, beta-Grasp (3);	0.057690	0.64402	D	0.000002	T	0.78534	0.4298	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84301	0.0505	10	0.72032	D	0.01	-23.933	13.4137	0.60956	1.0:0.0:0.0:0.0	.	101	P15104	GLNA_HUMAN	D	101	ENSP00000356537:V101D;ENSP00000307900:V101D;ENSP00000398320:V101D;ENSP00000344958:V101D	ENSP00000307900:V101D	V	-	2	0	GLUL	180622915	1.000000	0.71417	0.998000	0.56505	0.884000	0.51177	8.881000	0.92415	1.897000	0.54924	0.533000	0.62120	GTT	.	.	.	none		0.493	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	
PTGS2	5743	hgsc.bcm.edu	37	1	186645691	186645691	+	Missense_Mutation	SNP	C	C	A	rs148160346		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr1:186645691C>A	ENST00000367468.5	-	7	1014	c.878G>T	c.(877-879)cGg>cTg	p.R293L	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	293					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)	p.R293L(2)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	GTTGTGTTCCCGCAGCCAGAT	0.502																																					p.R293L		Atlas-SNP	.											PTGS2_ENST00000367468,NS,carcinoma,-1,2	PTGS2	144	.	2	Substitution - Missense(2)	lung(2)	c.G878T						PASS	.						144.0	132.0	136.0					1																	186645691		2203	4300	6503	SO:0001583	missense	5743	exon7			TGTTCCCGCAGCC	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.878G>T	chr1.hg19:g.186645691C>A	ENSP00000356438:p.Arg293Leu	114.0	0.0	.		152.0	7.0	.	NM_000963	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	hg19	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	C	33	5.214936	0.95104	.	.	ENSG00000073756	ENST00000367468	T	0.81163	-1.46	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.93690	0.7984	H	0.96720	3.87	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.97110	0.968;1.0	D	0.95450	0.8533	10	0.87932	D	0	-21.2931	19.4407	0.94820	0.0:1.0:0.0:0.0	.	293;293	Q8IZA9;P35354	.;PGH2_HUMAN	L	293	ENSP00000356438:R293L	ENSP00000356438:R293L	R	-	2	0	PTGS2	184912314	0.997000	0.39634	0.982000	0.44146	0.787000	0.44495	7.627000	0.83176	2.586000	0.87340	0.650000	0.86243	CGG	.	C|1.000;T|0.000	.	alt		0.502	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
APOB	338	hgsc.bcm.edu	37	2	21229220	21229220	+	Missense_Mutation	SNP	C	C	A	rs201156840		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:21229220C>A	ENST00000233242.1	-	26	10647	c.10520G>T	c.(10519-10521)cGg>cTg	p.R3507L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3507	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.R3507L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAATATTCCCGAGAAAGAAC	0.448																																					p.R3507L		Atlas-SNP	.											.	APOB	761	.	1	Substitution - Missense(1)	lung(1)	c.G10520T	GRCh37	CM952192	APOB	M		PASS	.						109.0	110.0	110.0					2																	21229220		2203	4300	6503	SO:0001583	missense	338	exon26			TATTCCCGAGAAA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10520G>T	chr2.hg19:g.21229220C>A	ENSP00000233242:p.Arg3507Leu	133.0	0.0	.		169.0	8.0	.	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478915	0.26511	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.79653	-1.29	5.67	-3.39	0.04868	.	0.839091	0.10443	N	0.674080	T	0.72334	0.3447	L	0.57536	1.79	0.19775	N	0.999952	B	0.26744	0.158	B	0.23150	0.044	T	0.60193	-0.7311	10	0.46703	T	0.11	.	8.7607	0.34672	0.1204:0.2037:0.0:0.6758	.	3507	P04114	APOB_HUMAN	L	3507	ENSP00000233242:R3507L	ENSP00000233242:R3507L	R	-	2	0	APOB	21082725	0.000000	0.05858	0.411000	0.26484	0.262000	0.26303	-2.376000	0.01070	-0.552000	0.06167	-0.136000	0.14681	CGG	.	.	.	weak		0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ZDBF2	57683	hgsc.bcm.edu	37	2	207171574	207171574	+	Silent	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:207171574G>A	ENST00000374423.3	+	5	2708	c.2322G>A	c.(2320-2322)cgG>cgA	p.R774R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	774							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						GAAAAGAACGGCACATTGACC	0.428																																					p.R774R		Atlas-SNP	.											ZDBF2_ENST00000374423,caecum,carcinoma,0,2	ZDBF2	531	.	0			c.G2322A						PASS	.						174.0	175.0	175.0					2																	207171574		1927	4125	6052	SO:0001819	synonymous_variant	57683	exon5			AGAACGGCACATT	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.2322G>A	chr2.hg19:g.207171574G>A		263.0	0.0	.		340.0	54.0	.	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	hg19	CCDS46501.1																																																																																			.	.	.	none		0.428	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
ABCA12	26154	hgsc.bcm.edu	37	2	215865517	215865517	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr2:215865517C>G	ENST00000272895.7	-	22	3310	c.3091G>C	c.(3091-3093)Gca>Cca	p.A1031P	ABCA12_ENST00000389661.4_Missense_Mutation_p.A713P	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1031					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCAATGATTGCTCTTTCAATA	0.428																																					p.A1031P	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											ABCA12,NS,carcinoma,0,1	ABCA12	368	.	0			c.G3091C						PASS	.						125.0	131.0	129.0					2																	215865517		2203	4300	6503	SO:0001583	missense	26154	exon22			TGATTGCTCTTTC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3091G>C	chr2.hg19:g.215865517C>G	ENSP00000272895:p.Ala1031Pro	191.0	0.0	.		226.0	78.0	.	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.864070	0.91511	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.88046	-2.33;-2.33	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	D	0.94896	0.8350	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95165	0.8285	10	0.87932	D	0	.	19.9082	0.97015	0.0:1.0:0.0:0.0	.	1031;713	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	P	1031;713	ENSP00000272895:A1031P;ENSP00000374312:A713P	ENSP00000272895:A1031P	A	-	1	0	ABCA12	215573762	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.594000	0.82698	2.705000	0.92388	0.555000	0.69702	GCA	.	.	.	none		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
DAPP1	27071	hgsc.bcm.edu	37	4	100787246	100787246	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:100787246G>C	ENST00000512369.1	+	8	810	c.742G>C	c.(742-744)Gat>Cat	p.D248H	DAPP1_ENST00000296414.7_Missense_Mutation_p.D248H	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	248	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		AGTAGAAGCTGATGAGTGGAT	0.343																																					p.D248H		Atlas-SNP	.											.	DAPP1	47	.	0			c.G742C						PASS	.						91.0	83.0	86.0					4																	100787246		1863	4100	5963	SO:0001583	missense	27071	exon8			GAAGCTGATGAGT	AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.742G>C	chr4.hg19:g.100787246G>C	ENSP00000423602:p.Asp248His	52.0	0.0	.		63.0	13.0	.	NM_014395	Q8TCK5|Q9UHF2	Missense_Mutation	SNP	ENST00000512369.1	hg19	CCDS47112.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773356	0.90108	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	T;T	0.75589	-0.95;-0.95	6.07	6.07	0.98685	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.83362	0.5238	L	0.55834	1.745	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.68943	0.956;0.961	T	0.79329	-0.1848	10	0.31617	T	0.26	-8.6315	19.4308	0.94765	0.0:0.0:1.0:0.0	.	248;248	Q9UN19-2;Q9UN19	.;DAPP1_HUMAN	H	248	ENSP00000296414:D248H;ENSP00000423602:D248H	ENSP00000296414:D248H	D	+	1	0	DAPP1	101006269	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.197000	0.89727	2.885000	0.99019	0.655000	0.94253	GAT	.	.	.	none		0.343	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363215.1		
GALNT7	51809	hgsc.bcm.edu	37	4	174225146	174225146	+	Splice_Site	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr4:174225146G>A	ENST00000265000.4	+	8	1349		c.e8-1			NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TTCCTTCATAGATATGGCAGT	0.343																																					.		Atlas-SNP	.											.	GALNT7	61	.	0			c.1267-1G>A						PASS	.						137.0	126.0	130.0					4																	174225146		2203	4300	6503	SO:0001630	splice_region_variant	51809	exon8			TTCATAGATATGG	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1267-1G>A	chr4.hg19:g.174225146G>A		135.0	0.0	.		178.0	57.0	.	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Splice_Site	SNP	ENST00000265000.4	hg19	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.313963	0.60414	.	.	ENSG00000109586	ENST00000265000;ENST00000505308;ENST00000458613	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9439	0.97175	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT7	174461721	1.000000	0.71417	0.997000	0.53966	0.593000	0.36681	9.476000	0.97823	2.706000	0.92434	0.561000	0.74099	.	.	.	.	none		0.343	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	Intron
ARSK	153642	hgsc.bcm.edu	37	5	94922371	94922371	+	Missense_Mutation	SNP	A	A	G	rs201849642		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr5:94922371A>G	ENST00000380009.4	+	5	1010	c.805A>G	c.(805-807)Aaa>Gaa	p.K269E		NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K	269					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		AAGATTTACAAAAAAAGAAAT	0.338																																					p.K269E		Atlas-SNP	.											.	ARSK	29	.	0			c.A805G						PASS	.						61.0	65.0	64.0					5																	94922371		2201	4297	6498	SO:0001583	missense	153642	exon5			TTTACAAAAAAAG		CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.805A>G	chr5.hg19:g.94922371A>G	ENSP00000369346:p.Lys269Glu	53.0	0.0	.		86.0	20.0	.	NM_198150	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	ENST00000380009.4	hg19	CCDS4073.1	.	.	.	.	.	.	.	.	.	.	A	3.355	-0.131627	0.06753	.	.	ENSG00000164291	ENST00000380009	D	0.99891	-7.56	5.93	-1.94	0.07571	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.568944	0.20517	N	0.090774	D	0.97851	0.9294	N	0.03016	-0.435	0.30818	N	0.738095	B	0.06786	0.001	B	0.06405	0.002	D	0.99988	1.3720	10	0.02654	T	1	-0.6336	8.1825	0.31319	0.5545:0.1084:0.3371:0.0	.	269	Q6UWY0	ARSK_HUMAN	E	269	ENSP00000369346:K269E	ENSP00000369346:K269E	K	+	1	0	ARSK	94948127	0.982000	0.34865	0.741000	0.31004	0.871000	0.50021	0.596000	0.24044	-0.248000	0.09583	-0.132000	0.14878	AAA	.	A|0.999;G|0.001	0.001	weak		0.338	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241652.2	NM_198150	
TEX15	56154	hgsc.bcm.edu	37	8	30694449	30694449	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr8:30694449T>C	ENST00000256246.2	-	3	8276	c.8202A>G	c.(8200-8202)caA>caG	p.Q2734Q		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2734					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTATTTGAGATTGAAAATACC	0.408																																					p.Q2734Q		Atlas-SNP	.											.	TEX15	350	.	0			c.A8202G						PASS	.						97.0	100.0	99.0					8																	30694449		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon3			TTGAGATTGAAAA	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.8202A>G	chr8.hg19:g.30694449T>C		67.0	0.0	.		104.0	43.0	.	NM_031271		Silent	SNP	ENST00000256246.2	hg19	CCDS6080.1																																																																																			.	.	.	none		0.408	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
MUC2	4583	hgsc.bcm.edu	37	11	1099777	1099777	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr11:1099777T>C	ENST00000441003.2	+	40	7401	c.7374T>C	c.(7372-7374)ccT>ccC	p.P2458P		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4820					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GTGTGGGACCTGACAATGTGC	0.572																																					p.P2454P		Atlas-SNP	.											.	MUC2	614	.	0			c.T7362C						PASS	.						140.0	152.0	148.0					11																	1099777		2080	4206	6286	SO:0001819	synonymous_variant	4583	exon41			GGGACCTGACAAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7374T>C	chr11.hg19:g.1099777T>C		174.0	0.0	.		137.0	54.0	.	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.	.	none		0.572	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
FZD4	8322	hgsc.bcm.edu	37	11	86663408	86663408	+	Silent	SNP	G	G	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr11:86663408G>T	ENST00000531380.1	-	2	695	c.390C>A	c.(388-390)ccC>ccA	p.P130P	PRSS23_ENST00000533902.2_3'UTR	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	130	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.P130P(1)		breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCTTCAGGACGGGTTCACAGC	0.517																																					p.P130P		Atlas-SNP	.											FZD4,NS,carcinoma,0,1	FZD4	52	.	1	Substitution - coding silent(1)	lung(1)	c.C390A						PASS	.						99.0	105.0	103.0					11																	86663408		2201	4299	6500	SO:0001819	synonymous_variant	8322	exon2			CAGGACGGGTTCA	AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.390C>A	chr11.hg19:g.86663408G>T		217.0	1.0	.		212.0	12.0	.	NM_012193	A8K9Q3|Q14C97|Q6S9E4	Silent	SNP	ENST00000531380.1	hg19	CCDS8279.1																																																																																			.	.	.	none		0.517	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393818.2	NM_012193	
A2ML1	144568	hgsc.bcm.edu	37	12	9000291	9000291	+	Silent	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:9000291C>T	ENST00000299698.7	+	15	2010	c.1830C>T	c.(1828-1830)cgC>cgT	p.R610R	A2ML1_ENST00000540049.1_3'UTR|A2ML1_ENST00000539547.1_Silent_p.R119R	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGAGCAACCGCTCTGTGAGTA	0.557																																					p.R610R		Atlas-SNP	.											.	A2ML1	199	.	0			c.C1830T						PASS	.						78.0	77.0	78.0					12																	9000291		1955	4145	6100	SO:0001819	synonymous_variant	144568	exon15			CAACCGCTCTGTG	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1830C>T	chr12.hg19:g.9000291C>T		173.0	0.0	.		199.0	15.0	.	NM_144670		Silent	SNP	ENST00000299698.7	hg19	CCDS8596.2																																																																																			.	.	.	none		0.557	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
TMEM5	10329	hgsc.bcm.edu	37	12	64174892	64174892	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:64174892T>G	ENST00000261234.6	+	2	421	c.263T>G	c.(262-264)tTa>tGa	p.L88*	TMEM5_ENST00000537373.1_5'UTR|TMEM5_ENST00000537982.1_3'UTR|RP11-415I12.3_ENST00000509615.2_RNA	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	88						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		CTTCAAATATTAGATAAATCC	0.363																																					p.L88X		Atlas-SNP	.											.	TMEM5	35	.	0			c.T263G						PASS	.						82.0	89.0	86.0					12																	64174892		2203	4300	6503	SO:0001587	stop_gained	10329	exon2			AAATATTAGATAA	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.263T>G	chr12.hg19:g.64174892T>G	ENSP00000261234:p.Leu88*	163.0	0.0	.		247.0	85.0	.	NM_014254	A8K017|Q6PKD6	Nonsense_Mutation	SNP	ENST00000261234.6	hg19	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051948	0.75960	.	.	ENSG00000118600	ENST00000261234	.	.	.	4.34	4.34	0.51931	.	0.447903	0.20965	N	0.082490	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.428	10.4561	0.44550	0.0:0.0:0.0:1.0	.	.	.	.	X	88	.	.	L	+	2	0	TMEM5	62461159	0.996000	0.38824	0.945000	0.38365	0.457000	0.32468	4.615000	0.61190	1.897000	0.54924	0.402000	0.26972	TTA	.	.	.	none		0.363	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80203769	80203769	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:80203769T>G	ENST00000450142.2	-	10	1527	c.1261A>C	c.(1261-1263)Att>Ctt	p.I421L	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.I421L|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.I334L|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.I421L|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.I421L	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	421					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TTGGGAGAAATTTTTGTAGCT	0.363																																					p.I421L		Atlas-SNP	.											.	PPP1R12A	76	.	0			c.A1261C						PASS	.						86.0	76.0	79.0					12																	80203769		1802	4069	5871	SO:0001583	missense	4659	exon10			GAGAAATTTTTGT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1261A>C	chr12.hg19:g.80203769T>G	ENSP00000389168:p.Ile421Leu	45.0	0.0	.		70.0	21.0	.	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	hg19	CCDS44947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.128|2.128	-0.399892|-0.399892	0.04865|0.04865	.|.	.|.	ENSG00000058272|ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000547131|ENST00000553081	T;T;T;T;T;T;T|T	0.39997|0.34667	1.43;1.43;1.45;1.49;1.44;1.44;1.05|1.35	5.86|5.86	0.0418|0.0418	0.14214|0.14214	.|.	0.725412|.	0.14249|.	N|.	0.331574|.	T|T	0.18045|0.18045	0.0433|0.0433	N|N	0.03608|0.03608	-0.345|-0.345	0.26994|0.26994	N|N	0.965072|0.965072	B;B;B;B|.	0.24823|.	0.112;0.002;0.0;0.0|.	B;B;B;B|.	0.20384|.	0.029;0.001;0.0;0.0|.	T|T	0.26224|0.26224	-1.0109|-1.0109	10|7	0.08381|0.54805	T|T	0.77|0.06	.|.	9.6186|9.6186	0.39708|0.39708	0.0:0.558:0.0:0.442|0.0:0.558:0.0:0.442	.|.	421;421;421;421|.	F8W8Q6;O14974-2;O14974-3;O14974|.	.;.;.;MYPT1_HUMAN|.	L|N	421;421;421;421;421;421;421;334;421;421;116|24	ENSP00000261207:I421L;ENSP00000389168:I421L;ENSP00000416769:I421L;ENSP00000449514:I334L;ENSP00000446855:I421L;ENSP00000446816:I421L;ENSP00000450061:I116L|ENSP00000447144:K24N	ENSP00000261207:I421L|ENSP00000447144:K24N	I|K	-|-	1|3	0|2	PPP1R12A|PPP1R12A	78727900|78727900	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.852000|0.852000	0.48524|0.48524	0.848000|0.848000	0.27710|0.27710	0.016000|0.016000	0.14998|0.14998	0.467000|0.467000	0.42956|0.42956	ATT|AAA	.	.	.	none		0.363	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
P2RX7	5027	hgsc.bcm.edu	37	12	121622232	121622232	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr12:121622232A>G	ENST00000546057.1	+	13	1558	c.1415A>G	c.(1414-1416)gAt>gGt	p.D472G	P2RX7_ENST00000535250.1_Missense_Mutation_p.D382G|P2RX7_ENST00000328963.5_Missense_Mutation_p.D302G|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000541446.1_Missense_Mutation_p.D183G	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	472					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGATCCAGGGATAGCCCCGTC	0.617																																					p.D472G		Atlas-SNP	.											.	P2RX7	53	.	0			c.A1415G						PASS	.						67.0	63.0	64.0					12																	121622232		2203	4300	6503	SO:0001583	missense	5027	exon13			CCAGGGATAGCCC	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.1415A>G	chr12.hg19:g.121622232A>G	ENSP00000442349:p.Asp472Gly	77.0	0.0	.		68.0	4.0	.	NM_002562	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	hg19	CCDS9213.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.721694	0.48728	.	.	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250;ENST00000541446	T;T;T;T	0.05081	4.39;4.01;4.18;3.5	5.21	-0.0551	0.13811	.	1.055260	0.07477	N	0.903142	T	0.06188	0.0160	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.08055	0.003;0.002;0.003;0.002	T	0.41980	-0.9478	10	0.38643	T	0.18	.	5.215	0.15338	0.6048:0.1445:0.2507:0.0	.	302;183;382;472	F8W951;F5H6P2;F5H7E8;Q99572	.;.;.;P2RX7_HUMAN	G	472;302;382;183	ENSP00000442349:D472G;ENSP00000330696:D302G;ENSP00000442572:D382G;ENSP00000437471:D183G	ENSP00000330696:D302G	D	+	2	0	P2RX7	120106615	0.000000	0.05858	0.091000	0.20842	0.830000	0.47004	-0.143000	0.10296	0.321000	0.23259	0.482000	0.46254	GAT	.	.	.	none		0.617	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	NM_002562	
PCDH8	5100	hgsc.bcm.edu	37	13	53422307	53422307	+	Missense_Mutation	SNP	C	C	T	rs570624635	byFrequency	TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr13:53422307C>T	ENST00000377942.3	-	1	468	c.265G>A	c.(265-267)Ggc>Agc	p.G89S	PCDH8_ENST00000338862.4_Missense_Mutation_p.G89S	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	89	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGGTCCAGGCCGGCGTCCCCG	0.657																																					p.G89S	GBM(36;25 841 9273 49207)	Atlas-SNP	.											PCDH8,NS,carcinoma,0,1	PCDH8	95	.	0			c.G265A						PASS	.						35.0	38.0	37.0					13																	53422307		2201	4296	6497	SO:0001583	missense	5100	exon1			CCAGGCCGGCGTC	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.265G>A	chr13.hg19:g.53422307C>T	ENSP00000367177:p.Gly89Ser	91.0	0.0	.		96.0	35.0	.	NM_032949	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	hg19	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724665	0.68959	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.26373	1.74;1.74	4.99	4.99	0.66335	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.41605	D	0.000846	T	0.33702	0.0872	N	0.20530	0.585	0.32118	N	0.588379	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.28650	-1.0037	10	0.32370	T	0.25	.	13.1397	0.59428	0.0:0.84:0.1599:0.0	.	89;89	O95206-2;O95206	.;PCDH8_HUMAN	S	89	ENSP00000367177:G89S;ENSP00000341350:G89S	ENSP00000341350:G89S	G	-	1	0	PCDH8	52320308	0.981000	0.34729	0.997000	0.53966	0.948000	0.59901	2.542000	0.45744	2.337000	0.79520	0.561000	0.74099	GGC	.	.	.	none		0.657	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
MAGEL2	54551	hgsc.bcm.edu	37	15	23890238	23890238	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr15:23890238C>G	ENST00000532292.1	-	1	937	c.843G>C	c.(841-843)aaG>aaC	p.K281N		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	164					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TCCGGGTGGCCTTGCCGGAGC	0.637																																					p.K884N		Atlas-SNP	.											.	MAGEL2	108	.	0			c.G2652C						PASS	.						42.0	49.0	47.0					15																	23890238		2189	4294	6483	SO:0001583	missense	54551	exon1			GGTGGCCTTGCCG	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.843G>C	chr15.hg19:g.23890238C>G	ENSP00000433433:p.Lys281Asn	107.0	0.0	.		111.0	13.0	.	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.19	2.758766	0.49468	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.22	0.668	0.17912	.	.	.	.	.	T	0.23688	0.0573	N	0.24115	0.695	0.24891	N	0.99217	.	.	.	.	.	.	T	0.26916	-1.0089	5	.	.	.	.	7.2244	0.26007	0.0:0.461:0.0:0.539	.	.	.	.	T	313	.	.	R	-	2	0	MAGEL2	21441331	0.347000	0.24853	0.771000	0.31576	0.872000	0.50106	-0.733000	0.04898	0.092000	0.17331	-0.302000	0.09304	AGG	.	.	.	none		0.637	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MGRN1	23295	hgsc.bcm.edu	37	16	4700468	4700468	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr16:4700468G>T	ENST00000399577.5	+	2	284	c.191G>T	c.(190-192)gGc>gTc	p.G64V	MGRN1_ENST00000415496.1_Missense_Mutation_p.G64V|MGRN1_ENST00000588994.1_Missense_Mutation_p.G64V|MGRN1_ENST00000262370.7_Missense_Mutation_p.G64V|MGRN1_ENST00000586183.1_Missense_Mutation_p.G64V	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	64					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						AACTTCCTGGGCAGCCGCCCG	0.597																																					p.G64V		Atlas-SNP	.											.	MGRN1	66	.	0			c.G191T						PASS	.						76.0	81.0	80.0					16																	4700468		1892	4125	6017	SO:0001583	missense	23295	exon2			TCCTGGGCAGCCG	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.191G>T	chr16.hg19:g.4700468G>T	ENSP00000382487:p.Gly64Val	182.0	0.0	.		140.0	46.0	.	NM_001142291	A4URL3|A4URL4|Q86W76	Missense_Mutation	SNP	ENST00000399577.5	hg19	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518548	0.85495	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.4	5.4	0.78164	.	0.099811	0.64402	D	0.000001	T	0.62183	0.2407	M	0.86864	2.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.998;0.979;0.996;0.991;1.0	T	0.68907	-0.5285	10	0.87932	D	0	-46.144	16.6736	0.85273	0.0:0.0:1.0:0.0	.	64;64;64;64;64;64	O60291-4;O60291-3;B4DR12;E9PB19;O60291-2;O60291	.;.;.;.;.;MGRN1_HUMAN	V	64	ENSP00000262370:G64V;ENSP00000382487:G64V;ENSP00000393311:G64V;ENSP00000443810:G64V	ENSP00000262370:G64V	G	+	2	0	MGRN1	4640469	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	9.785000	0.99042	2.537000	0.85549	0.561000	0.74099	GGC	.	.	.	none		0.597	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
CMTM1	113540	hgsc.bcm.edu	37	16	66612903	66612903	+	Silent	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr16:66612903G>A	ENST00000457188.2	+	4	630	c.509G>A	c.(508-510)tGa>tAa	p.*170*	CMTM1_ENST00000533666.1_3'UTR|CMTM1_ENST00000529506.1_Silent_p.*71*|CMTM1_ENST00000528324.1_3'UTR|CMTM2_ENST00000379486.2_5'Flank|CMTM1_ENST00000332695.7_Silent_p.*123*|CMTM1_ENST00000328020.6_3'UTR|CMTM1_ENST00000531885.1_3'UTR|CMTM1_ENST00000336328.6_Silent_p.*117*|CMTM2_ENST00000268595.2_5'Flank|CMTM1_ENST00000533953.1_Silent_p.*239*|RP11-403P17.2_ENST00000568430.1_RNA|CMTM1_ENST00000379500.2_Silent_p.*287*|CKLF-CMTM1_ENST00000527729.1_Silent_p.*116*	NM_181269.2	NP_851786.1	Q8IZ96	CKLF1_HUMAN	CKLF-like MARVEL transmembrane domain containing 1	0					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0702)|Epithelial(162;0.222)		AGGCCCGCCTGAAGCCAGCCC	0.627																																					p.X287X		Atlas-SNP	.											.	CMTM1	34	.	0			c.G860A						PASS	.						34.0	41.0	38.0					16																	66612903		2201	4299	6500	SO:0001819	synonymous_variant	113540	exon4			CCGCCTGAAGCCA	AF278577	CCDS10810.1, CCDS10811.1, CCDS10812.2, CCDS45503.1, CCDS45504.1, CCDS54019.1, CCDS54020.1, CCDS54021.1	16q22.1	2009-10-06	2005-11-08	2005-11-08	ENSG00000089505	ENSG00000089505			19172	protein-coding gene	gene with protein product		607884	"""chemokine-like factor super family 1"", ""chemokine-like factor superfamily 1"""	CKLFSF1		12782130	Standard	NM_181268		Approved	CKLFH1a, CKLFH	uc002epr.4	Q8IZ96	OTTHUMG00000137502	ENST00000457188.2:c.509G>A	chr16.hg19:g.66612903G>A		95.0	0.0	.		101.0	38.0	.	NM_052999	Q2PPY5|Q6PEV5|Q8IU76|Q8IU83|Q8IU86|Q8IU93|Q8IZ87|Q8IZ88|Q8IZ89|Q8IZ90|Q8IZ91|Q8IZ92|Q8IZ93|Q8IZ94|Q8IZ95|Q96JC2|Q96JC3	Silent	SNP	ENST00000457188.2	hg19	CCDS45503.1																																																																																			.	.	.	none		0.627	CMTM1-015	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390261.2	NM_052999	
VMP1	81671	hgsc.bcm.edu	37	17	57812735	57812735	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr17:57812735G>T	ENST00000262291.4	+	3	423	c.113G>T	c.(112-114)cGg>cTg	p.R38L	VMP1_ENST00000539763.1_Intron|VMP1_ENST00000536180.1_5'UTR|VMP1_ENST00000537567.1_5'UTR|VMP1_ENST00000545362.1_Missense_Mutation_p.R38L	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	38					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						AGGAGGGAGCGGGAAGAAAGG	0.398																																					p.R38L		Atlas-SNP	.											.	VMP1	49	.	0			c.G113T						PASS	.						95.0	85.0	89.0					17																	57812735		2203	4300	6503	SO:0001583	missense	81671	exon3			GGGAGCGGGAAGA		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.113G>T	chr17.hg19:g.57812735G>T	ENSP00000262291:p.Arg38Leu	49.0	0.0	.		74.0	7.0	.	NM_030938	B4DVV9|Q9H0P4|Q9P089	Missense_Mutation	SNP	ENST00000262291.4	hg19	CCDS11619.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418001	0.62622	.	.	ENSG00000062716	ENST00000262291;ENST00000545362	.	.	.	5.46	5.46	0.80206	.	0.056181	0.64402	D	0.000001	T	0.70430	0.3223	M	0.71581	2.175	0.80722	D	1	P;P	0.47191	0.891;0.785	P;B	0.47044	0.535;0.43	T	0.74390	-0.3681	9	0.62326	D	0.03	-13.682	19.321	0.94240	0.0:0.0:1.0:0.0	.	38;38	F5H2J3;Q96GC9	.;VMP1_HUMAN	L	38	.	ENSP00000262291:R38L	R	+	2	0	VMP1	55167517	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.973000	0.49264	2.548000	0.85928	0.591000	0.81541	CGG	.	.	.	none		0.398	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448793.1	NM_030938	
ZNF337	26152	hgsc.bcm.edu	37	20	25656223	25656223	+	Silent	SNP	C	C	A	rs370580651		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr20:25656223C>A	ENST00000376436.1	-	4	2240	c.1701G>T	c.(1699-1701)tcG>tcT	p.S567S	RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000481610.1_5'Flank|ZNF337_ENST00000538750.1_Silent_p.S535S|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000252979.5_Silent_p.S567S|RP4-694B14.5_ENST00000455791.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S567S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCCTTTCCCCCGAGTGTGTCC	0.473																																					p.S567S		Atlas-SNP	.											.	ZNF337	65	.	1	Substitution - coding silent(1)	lung(1)	c.G1701T						PASS	.						89.0	82.0	84.0					20																	25656223		2203	4300	6503	SO:0001819	synonymous_variant	26152	exon5			TTCCCCCGAGTGT		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1701G>T	chr20.hg19:g.25656223C>A		143.0	0.0	.		156.0	7.0	.	NM_015655	B4DSM2|Q9Y3Y5	Silent	SNP	ENST00000376436.1	hg19	CCDS13174.1																																																																																			.	.	.	alt		0.473	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
C21orf62	56245	hgsc.bcm.edu	37	21	34166192	34166192	+	Missense_Mutation	SNP	A	A	G	rs79194766		TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:34166192A>G	ENST00000536776.1	-	2	681	c.541T>C	c.(541-543)Ttt>Ctt	p.F181L	C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000382375.4_Intron|C21orf62_ENST00000479548.1_Missense_Mutation_p.F181L|C21orf62_ENST00000490358.1_Missense_Mutation_p.F181L|C21orf62_ENST00000487113.1_Missense_Mutation_p.F181L|C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000453404.1_Intron|C21orf49_ENST00000477513.1_Intron	NM_001162495.2|NM_001162496.2|NM_019596.5	NP_001155967.2|NP_001155968.2|NP_062542.5	Q9NYP8	CU062_HUMAN	chromosome 21 open reading frame 62	181				F -> L (in Ref. 2; BAF83672). {ECO:0000305}.						endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	6		Myeloproliferative disorder(46;0.0255)				TATGATTTAAAGGCTGAGTCC	0.408																																					p.F181L		Atlas-SNP	.											.	C21orf62	26	.	0			c.T541C						PASS	.						103.0	102.0	102.0					21																	34166192		1921	4116	6037	SO:0001583	missense	56245	exon4			ATTTAAAGGCTGA	AF231922	CCDS42919.1, CCDS42919.2	21q22.1	2011-02-24			ENSG00000205929	ENSG00000205929			1305	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 120"""	C21orf120			Standard	NM_001162495		Approved	B37, PRED81	uc011adu.2	Q9NYP8	OTTHUMG00000163477	ENST00000536776.1:c.541T>C	chr21.hg19:g.34166192A>G	ENSP00000444950:p.Phe181Leu	82.0	0.0	.		114.0	5.0	.	NM_001162495	A8K4L8	Missense_Mutation	SNP	ENST00000536776.1	hg19	CCDS42919.2	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.947291	0.00475	.	.	ENSG00000205929	ENST00000536776;ENST00000490358;ENST00000487113;ENST00000382373;ENST00000479548	.	.	.	5.57	-1.39	0.08997	.	.	.	.	.	T	0.05640	0.0148	N	0.00101	-2.135	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39583	-0.9607	8	0.02654	T	1	.	12.2491	0.54587	0.5042:0.0:0.4958:0.0	.	181	Q9NYP8	CU062_HUMAN	L	181;181;181;228;181	.	ENSP00000371810:F228L	F	-	1	0	C21orf62	33088062	0.749000	0.28305	0.002000	0.10522	0.069000	0.16628	0.096000	0.15147	-0.490000	0.06707	-0.624000	0.04008	TTT	.	.	.	weak		0.408	C21orf62-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139598.5	NM_019596	
ZBTB21	49854	hgsc.bcm.edu	37	21	43413770	43413770	+	Silent	SNP	T	T	C			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:43413770T>C	ENST00000310826.5	-	3	618	c.435A>G	c.(433-435)caA>caG	p.Q145Q	ZBTB21_ENST00000398505.3_Silent_p.Q145Q|ZBTB21_ENST00000465968.1_Intron|ZBTB21_ENST00000398499.1_Silent_p.Q145Q|ZBTB21_ENST00000398511.3_Silent_p.Q145Q	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	145					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)										CACTTCTCTTTTGAGAACTGT	0.403																																					p.Q145Q		Atlas-SNP	.											.	.	.	.	0			c.A435G						PASS	.						98.0	88.0	91.0					21																	43413770		2203	4300	6503	SO:0001819	synonymous_variant	49854	exon3			TCTCTTTTGAGAA	AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.435A>G	chr21.hg19:g.43413770T>C		112.0	0.0	.		130.0	56.0	.	NM_001098402	Q5R2W1|Q5R2W2|Q6P4R0	Silent	SNP	ENST00000310826.5	hg19	CCDS13678.1																																																																																			.	.	.	none		0.403	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
KRTAP10-10	353333	hgsc.bcm.edu	37	21	46057373	46057373	+	Silent	SNP	C	C	T			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr21:46057373C>T	ENST00000380095.1	+	1	101	c.39C>T	c.(37-39)tgC>tgT	p.C13C	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	13						keratin filament (GO:0045095)		p.C13C(1)		NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CCAGCGCCTGCACTGACTCTT	0.652																																					p.C13C		Atlas-SNP	.											KRTAP10-10,NS,carcinoma,0,1	KRTAP10-10	37	.	1	Substitution - coding silent(1)	endometrium(1)	c.C39T						PASS	.						104.0	109.0	108.0					21																	46057373		2203	4300	6503	SO:0001819	synonymous_variant	353333	exon1			CGCCTGCACTGAC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.39C>T	chr21.hg19:g.46057373C>T		219.0	0.0	.		201.0	37.0	.	NM_181688		Silent	SNP	ENST00000380095.1	hg19	CCDS33585.1																																																																																			.	.	.	none		0.652	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
FAM47B	170062	hgsc.bcm.edu	37	X	34961454	34961454	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chrX:34961454G>A	ENST00000329357.5	+	1	542	c.506G>A	c.(505-507)cGg>cAg	p.R169Q		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	169										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TGTGAGGCCCGGGAGAAGACA	0.592																																					p.R169Q		Atlas-SNP	.											.	FAM47B	209	.	0			c.G506A						PASS	.						36.0	35.0	35.0					X																	34961454		2202	4300	6502	SO:0001583	missense	170062	exon1			AGGCCCGGGAGAA	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.506G>A	chrX.hg19:g.34961454G>A	ENSP00000328307:p.Arg169Gln	34.0	0.0	.		36.0	30.0	.	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	hg19	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	1.355	-0.590410	0.03799	.	.	ENSG00000189132	ENST00000329357	T	0.14266	2.52	0.843	-0.104	0.13605	.	.	.	.	.	T	0.04952	0.0133	N	0.05259	-0.085	0.09310	N	1	B	0.19073	0.033	B	0.08055	0.003	T	0.45175	-0.9279	8	0.13108	T	0.6	.	.	.	.	.	169	Q8NA70	FA47B_HUMAN	Q	169	ENSP00000328307:R169Q	ENSP00000328307:R169Q	R	+	2	0	FAM47B	34871375	0.070000	0.21116	0.001000	0.08648	0.009000	0.06853	-2.406000	0.01044	-0.099000	0.12263	-0.780000	0.03373	CGG	.	.	.	none		0.592	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
IQSEC2	23096	hgsc.bcm.edu	37	X	53268433	53268433	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chrX:53268433C>G	ENST00000375368.5	-	10	3229	c.3029G>C	c.(3028-3030)aGt>aCt	p.S1010T	IQSEC2_ENST00000396435.3_Missense_Mutation_p.S1020T|IQSEC2_ENST00000375365.2_Missense_Mutation_p.S815T			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1010	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTGACGGAAACTGTACGTCAC	0.502											OREG0019800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1020T		Atlas-SNP	.											.	IQSEC2	195	.	0			c.G3059C						PASS	.						114.0	103.0	107.0					X																	53268433		2203	4300	6503	SO:0001583	missense	23096	exon11			CGGAAACTGTACG	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3029G>C	chrX.hg19:g.53268433C>G	ENSP00000364517:p.Ser1010Thr	58.0	0.0	.	991	42.0	33.0	.	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	hg19		.	.	.	.	.	.	.	.	.	.	C	14.06	2.422471	0.43020	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.54071	0.59;0.59;0.59	5.61	5.61	0.85477	.	.	.	.	.	T	0.52240	0.1722	N	0.19112	0.55	0.80722	D	1	B;P	0.39903	0.039;0.694	B;P	0.56434	0.105;0.798	T	0.40001	-0.9586	9	0.02654	T	1	.	17.3443	0.87306	0.0:1.0:0.0:0.0	.	1020;815	Q5JU85-2;Q5JU85-3	.;.	T	1020;1010;815	ENSP00000379712:S1020T;ENSP00000364517:S1010T;ENSP00000364514:S815T	ENSP00000364514:S815T	S	-	2	0	IQSEC2	53285158	0.998000	0.40836	1.000000	0.80357	0.962000	0.63368	2.668000	0.46816	2.363000	0.80096	0.511000	0.50034	AGT	.	.	.	none		0.502	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
C9orf84	158401	hgsc.bcm.edu	37	9	114454268	114454270	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DZ-6131-01A-11D-1961-08	TCGA-DZ-6131-11A-01D-1961-08	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	29368ff9-9921-468b-89e7-f004ec2ddb39	3e6c0c90-5ee6-4ec6-ba68-59aae72c362c	g.chr9:114454268_114454270delCTC	ENST00000318737.4	-	25	3923_3925	c.3795_3797delGAG	c.(3793-3798)aggaga>aga	p.1265_1266RR>R	C9orf84_ENST00000394777.4_In_Frame_Del_p.1191_1192RR>R|C9orf84_ENST00000374287.3_In_Frame_Del_p.1265_1266RR>R|C9orf84_ENST00000394779.3_In_Frame_Del_p.1226_1227RR>R	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	1265										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTCATGTGTTCTCCTTTTCTGAG	0.369																																					p.1266_1266del		Atlas-INDEL	.											.	C9orf84	207	.	0			c.3796_3798del						PASS	.																																			SO:0001651	inframe_deletion	158401	exon25			.	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.3795_3797delGAG	chr9.hg19:g.114454268_114454270delCTC	ENSP00000322108:p.Arg1266del	45.0	0.0	0		56.0	10.0	0.178571	NM_173521	A2A2V3|Q2M1H8|Q96M73	In_Frame_Del	DEL	ENST00000318737.4	hg19	CCDS6781.3																																																																																			.	.	.	none		0.369	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
