#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A5	6518	hgsc.bcm.edu	37	1	9097752	9097752	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:9097752T>C	ENST00000377424.4	-	12	1578	c.1399A>G	c.(1399-1401)Acg>Gcg	p.T467A	SLC2A5_ENST00000536305.1_Missense_Mutation_p.T408A|SLC2A5_ENST00000535586.1_Missense_Mutation_p.T352A	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	467					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TCTATGAACGTCTTGGCCTTG	0.512																																					p.T467A		Atlas-SNP	.											.	SLC2A5	77	.	0			c.A1399G						PASS	.						127.0	131.0	130.0					1																	9097752		2203	4300	6503	SO:0001583	missense	6518	exon12			TGAACGTCTTGGC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1399A>G	chr1.hg19:g.9097752T>C	ENSP00000366641:p.Thr467Ala	209.0	0.0	.		181.0	30.0	.	NM_003039	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	hg19	CCDS99.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661340	0.67700	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.76448	-1.02;-1.02;-1.02	5.53	5.53	0.82687	Major facilitator superfamily domain, general substrate transporter (1);	0.047424	0.85682	D	0.000000	D	0.89842	0.6832	M	0.93197	3.39	0.53005	D	0.999969	D;D;D	0.61080	0.971;0.971;0.989	P;P;D	0.64042	0.872;0.872;0.921	D	0.92195	0.5763	10	0.87932	D	0	.	13.3288	0.60475	0.0:0.0:0.0:1.0	.	423;408;467	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	A	467;450;408;352	ENSP00000366641:T467A;ENSP00000440688:T408A;ENSP00000442744:T352A	ENSP00000366641:T467A	T	-	1	0	SLC2A5	9020339	1.000000	0.71417	0.853000	0.33588	0.611000	0.37282	3.992000	0.56980	2.220000	0.72140	0.533000	0.62120	ACG	.	.	.	none		0.512	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
ALPL	249	hgsc.bcm.edu	37	1	21902288	21902288	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:21902288G>A	ENST00000374840.3	+	10	1310	c.1060G>A	c.(1060-1062)Gag>Aag	p.E354K	ALPL_ENST00000374832.1_Missense_Mutation_p.E354K|ALPL_ENST00000539907.1_Missense_Mutation_p.E277K|ALPL_ENST00000374829.1_5'UTR|ALPL_ENST00000425315.2_Missense_Mutation_p.E354K|ALPL_ENST00000540617.1_Missense_Mutation_p.E299K|ALPL_ENST00000374830.1_5'UTR	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	354			E -> D (in HOPS).		cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	TGAGGCGGTGGAGATGGACCG	0.612																																					p.E354K		Atlas-SNP	.											.	ALPL	50	.	0			c.G1060A						PASS	.						142.0	136.0	138.0					1																	21902288		2203	4300	6503	SO:0001583	missense	249	exon10			GCGGTGGAGATGG	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.1060G>A	chr1.hg19:g.21902288G>A	ENSP00000363973:p.Glu354Lys	278.0	0.0	.		186.0	25.0	.	NM_000478	A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	ENST00000374840.3	hg19	CCDS217.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371272	0.42003	.	.	ENSG00000162551	ENST00000539907;ENST00000540617;ENST00000374840;ENST00000374832;ENST00000425315	D;D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1;-4.1	4.91	3.99	0.46301	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.056236	0.64402	D	0.000001	D	0.96796	0.8954	M	0.83852	2.665	0.51233	D	0.999917	B;P	0.52692	0.407;0.955	P;P	0.54544	0.507;0.755	D	0.95649	0.8705	10	0.52906	T	0.07	-8.6255	7.1413	0.25558	0.0934:0.1721:0.7345:0.0	.	277;354	B7Z387;P05186	.;PPBT_HUMAN	K	277;299;354;354;354	ENSP00000437674:E277K;ENSP00000442672:E299K;ENSP00000363973:E354K;ENSP00000363965:E354K;ENSP00000394765:E354K	ENSP00000363965:E354K	E	+	1	0	ALPL	21774875	1.000000	0.71417	0.892000	0.35008	0.007000	0.05969	5.646000	0.67916	1.071000	0.40834	-0.291000	0.09656	GAG	.	.	.	none		0.612	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000008202.1	NM_000478	
WASF2	10163	hgsc.bcm.edu	37	1	27739179	27739179	+	Silent	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:27739179A>G	ENST00000430629.2	-	7	926	c.711T>C	c.(709-711)tgT>tgC	p.C237C	WASF2_ENST00000536657.1_Silent_p.C237C	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	237					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		CGTTTTCAACACAGCCAATGC	0.488																																					p.C237C		Atlas-SNP	.											.	WASF2	41	.	0			c.T711C						PASS	.						153.0	137.0	142.0					1																	27739179		2203	4300	6503	SO:0001819	synonymous_variant	10163	exon7			TTCAACACAGCCA	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.711T>C	chr1.hg19:g.27739179A>G		147.0	0.0	.		128.0	22.0	.	NM_006990	B4DZN0|O60794|Q9UDY7	Silent	SNP	ENST00000430629.2	hg19	CCDS304.1																																																																																			.	.	.	none		0.488	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
TESK2	10420	hgsc.bcm.edu	37	1	45813333	45813333	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:45813333G>A	ENST00000372086.3	-	7	1056	c.656C>T	c.(655-657)tCc>tTc	p.S219F	TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Missense_Mutation_p.S219F|TESK2_ENST00000538496.1_Missense_Mutation_p.S136F|TESK2_ENST00000341771.6_Missense_Mutation_p.S219F	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	219	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					CCAGAATGGGGAACCCACCAC	0.473																																					p.S219F		Atlas-SNP	.											.	TESK2	60	.	0			c.C656T						PASS	.						112.0	113.0	113.0					1																	45813333		1904	4153	6057	SO:0001583	missense	10420	exon7			AATGGGGAACCCA	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.656C>T	chr1.hg19:g.45813333G>A	ENSP00000361158:p.Ser219Phe	217.0	0.0	.		175.0	38.0	.	NM_007170	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	ENST00000372086.3	hg19	CCDS41323.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874832	0.91664	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496	T;T;T;T	0.69926	-0.44;-0.12;-0.44;-0.12	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.104533	0.43110	N	0.000604	D	0.84933	0.5582	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86499	0.1802	10	0.87932	D	0	-17.2903	18.6171	0.91306	0.0:0.0:1.0:0.0	.	219;219	Q96S53-3;Q96S53	.;TESK2_HUMAN	F	219;219;203;219;136	ENSP00000361156:S219F;ENSP00000361158:S219F;ENSP00000343940:S219F;ENSP00000441746:S136F	ENSP00000343940:S219F	S	-	2	0	TESK2	45585920	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	7.907000	0.87430	2.843000	0.97960	0.585000	0.79938	TCC	.	.	.	none		0.473	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
TMEM69	51249	hgsc.bcm.edu	37	1	46159260	46159260	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:46159260A>G	ENST00000372025.4	+	3	1584	c.427A>G	c.(427-429)Atc>Gtc	p.I143V	RP11-767N6.7_ENST00000430643.1_RNA|TMEM69_ENST00000496366.1_3'UTR	NM_016486.3	NP_057570.2	Q5SWH9	TMM69_HUMAN	transmembrane protein 69	143						integral component of membrane (GO:0016021)				kidney(3)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTTGGGTGGGATCAGATGGGG	0.438																																					p.I143V		Atlas-SNP	.											.	TMEM69	20	.	0			c.A427G						PASS	.						89.0	87.0	88.0					1																	46159260		1859	4090	5949	SO:0001583	missense	51249	exon3			GGTGGGATCAGAT	BC040289, BC013608	CCDS41325.1	1p34.1	2008-02-05	2005-08-17	2005-08-17	ENSG00000159596	ENSG00000159596			28035	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 154"""	C1orf154			Standard	NM_016486		Approved	FLJ21029	uc001cor.1	Q5SWH9	OTTHUMG00000040993	ENST00000372025.4:c.427A>G	chr1.hg19:g.46159260A>G	ENSP00000361095:p.Ile143Val	196.0	0.0	.		176.0	31.0	.	NM_016486	Q3SWW5|Q7Z2G0|Q9P0P9	Missense_Mutation	SNP	ENST00000372025.4	hg19	CCDS41325.1	.	.	.	.	.	.	.	.	.	.	A	4.400	0.073919	0.08485	.	.	ENSG00000159596	ENST00000372025	.	.	.	5.83	-1.16	0.09678	.	0.588234	0.19061	N	0.123779	T	0.23330	0.0564	N	0.20357	0.565	0.19575	N	0.999966	B	0.10296	0.003	B	0.10450	0.005	T	0.25745	-1.0123	9	0.11794	T	0.64	-0.7606	12.6228	0.56614	0.7619:0.0:0.2381:0.0	.	143	Q5SWH9	TMM69_HUMAN	V	143	.	ENSP00000361095:I143V	I	+	1	0	TMEM69	45931847	0.218000	0.23608	0.138000	0.22173	0.907000	0.53573	0.632000	0.24583	-0.248000	0.09583	-0.415000	0.06103	ATC	.	.	.	none		0.438	TMEM69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098390.1	NM_016486	
ZFYVE9	9372	hgsc.bcm.edu	37	1	52704507	52704507	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:52704507A>G	ENST00000371591.1	+	3	1549	c.1418A>G	c.(1417-1419)tAt>tGt	p.Y473C	ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Y473C|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Y473C	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	473					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GCAGCAAATTATCTATCTAAT	0.378																																					p.Y473C		Atlas-SNP	.											.	ZFYVE9	131	.	0			c.A1418G						PASS	.						95.0	101.0	99.0					1																	52704507		2203	4299	6502	SO:0001583	missense	9372	exon4			CAAATTATCTATC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.1418A>G	chr1.hg19:g.52704507A>G	ENSP00000360647:p.Tyr473Cys	173.0	0.0	.		176.0	32.0	.	NM_007323	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	hg19	CCDS563.1	.	.	.	.	.	.	.	.	.	.	A	7.890	0.732073	0.15507	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	T;T;T;T	0.51574	1.19;0.7;1.19;1.19	5.69	4.78	0.61160	.	0.445610	0.20824	N	0.085019	T	0.25005	0.0607	N	0.08118	0	0.20764	N	0.99985	B;B;B	0.33512	0.415;0.01;0.0	B;B;B	0.33392	0.163;0.002;0.0	T	0.09662	-1.0664	10	0.38643	T	0.18	.	6.1713	0.20418	0.1413:0.6538:0.1348:0.0701	.	473;473;473	O95405-2;O95405;O95405-3	.;ZFYV9_HUMAN;.	C	473	ENSP00000349737:Y473C;ENSP00000355358:Y473C;ENSP00000287727:Y473C;ENSP00000360647:Y473C	ENSP00000287727:Y473C	Y	+	2	0	ZFYVE9	52477095	1.000000	0.71417	0.843000	0.33291	0.920000	0.55202	1.818000	0.39012	1.420000	0.47138	-0.132000	0.14878	TAT	.	.	.	none		0.378	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
ZYG11B	79699	hgsc.bcm.edu	37	1	53262039	53262039	+	Silent	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:53262039T>C	ENST00000294353.6	+	7	1555	c.1410T>C	c.(1408-1410)gcT>gcC	p.A470A	ZYG11B_ENST00000443756.2_Silent_p.A470A|ZYG11B_ENST00000545132.1_Silent_p.A470A	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	470										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TGGCAGTTGCTATCATTTCTA	0.433																																					p.A470A		Atlas-SNP	.											.	ZYG11B	61	.	0			c.T1410C						PASS	.						82.0	76.0	78.0					1																	53262039		2203	4300	6503	SO:0001819	synonymous_variant	79699	exon7			AGTTGCTATCATT	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1410T>C	chr1.hg19:g.53262039T>C		69.0	0.0	.		71.0	10.0	.	NM_024646	Q8N2X3|Q9H8L8	Silent	SNP	ENST00000294353.6	hg19	CCDS30717.1																																																																																			.	.	.	none		0.433	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
ODF2L	57489	hgsc.bcm.edu	37	1	86851227	86851227	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:86851227G>A	ENST00000359242.3	-	3	441	c.160C>T	c.(160-162)Ctt>Ttt	p.L54F	ODF2L_ENST00000370566.3_Missense_Mutation_p.L54F|ODF2L_ENST00000317336.7_Missense_Mutation_p.L54F|ODF2L_ENST00000394731.1_Intron|ODF2L_ENST00000294678.2_Missense_Mutation_p.L54F|ODF2L_ENST00000370567.1_Missense_Mutation_p.L54F	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	54						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GCTTCCTTAAGTGTTGCTTCC	0.323																																					p.L54F		Atlas-SNP	.											.	ODF2L	53	.	0			c.C160T						PASS	.						87.0	84.0	85.0					1																	86851227		2203	4298	6501	SO:0001583	missense	57489	exon3			CCTTAAGTGTTGC		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.160C>T	chr1.hg19:g.86851227G>A	ENSP00000359600:p.Leu54Phe	43.0	0.0	.		53.0	12.0	.	NM_001184766	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	hg19	CCDS41354.2	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718586	0.30503	.	.	ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000317336;ENST00000370567;ENST00000294678;ENST00000465959	T;T;T;T;T	0.39056	1.1;1.1;1.15;1.15;1.12	5.4	0.554	0.17241	.	0.523188	0.20488	N	0.091342	T	0.06280	0.0162	N	0.04768	-0.165	0.44417	D	0.997339	B;B;B;B;B	0.24043	0.001;0.027;0.008;0.011;0.096	B;B;B;B;B	0.21360	0.004;0.013;0.012;0.009;0.034	T	0.15752	-1.0426	10	0.38643	T	0.18	0.4325	1.1465	0.01776	0.2214:0.1715:0.4328:0.1743	.	54;54;54;54;54	B4E037;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;.;.;ODF2L_HUMAN	F	54	ENSP00000359597:L54F;ENSP00000359600:L54F;ENSP00000320165:L54F;ENSP00000359598:L54F;ENSP00000294678:L54F	ENSP00000294678:L54F	L	-	1	0	ODF2L	86623815	0.325000	0.24660	0.872000	0.34217	0.966000	0.64601	0.460000	0.21924	0.196000	0.20367	0.650000	0.86243	CTT	.	.	.	none		0.323	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
ARHGAP29	9411	hgsc.bcm.edu	37	1	94639942	94639942	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:94639942A>G	ENST00000260526.6	-	23	3451	c.3269T>C	c.(3268-3270)cTa>cCa	p.L1090P	ARHGAP29_ENST00000482481.1_5'Flank	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	1090					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CTTGGCAGTTAGGCTGTTTTG	0.418																																					p.L1090P		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.T3269C						PASS	.						228.0	214.0	218.0					1																	94639942		2203	4300	6503	SO:0001583	missense	9411	exon23			GCAGTTAGGCTGT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.3269T>C	chr1.hg19:g.94639942A>G	ENSP00000260526:p.Leu1090Pro	428.0	0.0	.		341.0	56.0	.	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	hg19	CCDS748.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.660169	0.47572	.	.	ENSG00000137962	ENST00000260526	T	0.24723	1.84	5.73	-1.98	0.07480	.	1.632400	0.04169	N	0.324470	T	0.04497	0.0123	L	0.29908	0.895	0.09310	N	1	P	0.50710	0.938	B	0.33799	0.17	T	0.21827	-1.0234	10	0.48119	T	0.1	3.2259	2.7638	0.05314	0.5497:0.1174:0.2307:0.1023	.	1090	Q52LW3	RHG29_HUMAN	P	1090	ENSP00000260526:L1090P	ENSP00000260526:L1090P	L	-	2	0	ARHGAP29	94412530	0.041000	0.20044	0.000000	0.03702	0.391000	0.30476	0.816000	0.27267	-0.171000	0.10797	0.482000	0.46254	CTA	.	.	.	none		0.418	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
GSTM1	2944	hgsc.bcm.edu	37	1	110233169	110233169	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:110233169T>G	ENST00000309851.5	+	7	604	c.550T>G	c.(550-552)Ttc>Gtc	p.F184V	GSTM1_ENST00000369819.2_Intron|GSTM2_ENST00000460717.3_Intron|GSTM1_ENST00000483399.2_Intron|GSTM1_ENST00000349334.3_Intron|AC000032.2_ENST00000562538.1_RNA|GSTM2_ENST00000369831.2_Intron|GSTM1_ENST00000490021.2_Intron|GSTM1_ENST00000369823.2_Missense_Mutation_p.F203V	NM_000561.3	NP_000552.2	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1	184	GST C-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)|ovary(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Azathioprine(DB00993)|Busulfan(DB01008)|Carboplatin(DB00958)|Cisplatin(DB00515)|Glutathione(DB00143)|Oxaliplatin(DB00526)	TCTGAAGGACTTCATCTCCCG	0.488									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.F184V		Atlas-SNP	.											.	GSTM1	13	.	0			c.T550G						PASS	.						209.0	116.0	148.0					1																	110233169		2158	4209	6367	SO:0001583	missense	2944	exon7	Familial Cancer Database	incl.: Familial Head and Neck Cancer; ;AIMAH, Cushing disease, Adrenal, Familial	AAGGACTTCATCT	BC036805	CCDS809.1, CCDS810.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134184	ENSG00000134184	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4632	protein-coding gene	gene with protein product		138350	"""glutathione S-transferase M1"""	GST1			Standard	NM_000561		Approved	MU, H-B	uc001dyk.3	P09488	OTTHUMG00000011635	ENST00000309851.5:c.550T>G	chr1.hg19:g.110233169T>G	ENSP00000311469:p.Phe184Val	317.0	0.0	.		240.0	72.0	.	NM_000561	Q5GHG0|Q6FH88|Q8TC98|Q9UC96	Missense_Mutation	SNP	ENST00000309851.5	hg19	CCDS809.1	.	.	.	.	.	.	.	.	.	.	T	12.77	2.037761	0.35989	.	.	ENSG00000134184	ENST00000369823;ENST00000309851	T;T	0.02345	4.33;4.33	3.53	3.53	0.40419	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.149445	0.43416	U	0.000564	T	0.14056	0.0340	H	0.96269	3.795	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.01810	-1.1269	10	0.87932	D	0	.	9.98	0.41809	0.0:0.0:0.0:1.0	.	184	P09488	GSTM1_HUMAN	V	203;184	ENSP00000358838:F203V;ENSP00000311469:F184V	ENSP00000311469:F184V	F	+	1	0	GSTM1	110034692	1.000000	0.71417	0.979000	0.43373	0.246000	0.25737	3.033000	0.49743	1.594000	0.50039	0.459000	0.35465	TTC	.	.	.	none		0.488	GSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032151.2	NM_000561	
ATP1A2	477	hgsc.bcm.edu	37	1	160105252	160105252	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:160105252G>A	ENST00000361216.3	+	16	2233	c.2144G>A	c.(2143-2145)gGg>gAg	p.G715E	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G715E	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	715			G -> R (in FHM2; de novo mutation in a sporadic case). {ECO:0000269|PubMed:21352219}.		adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			ACGGGTGACGGGGTGAACGAC	0.602																																					p.G715E		Atlas-SNP	.											.	ATP1A2	167	.	0			c.G2144A						PASS	.						170.0	123.0	139.0					1																	160105252		2203	4300	6503	SO:0001583	missense	477	exon16			GTGACGGGGTGAA	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2144G>A	chr1.hg19:g.160105252G>A	ENSP00000354490:p.Gly715Glu	110.0	0.0	.		73.0	12.0	.	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	ENST00000361216.3	hg19	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.642964|4.642964	0.87859|0.87859	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|D	0.99483|0.99499	-5.99;-5.99|-6.02	4.31|4.31	4.31|4.31	0.51392|0.51392	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.99806|0.99806	0.9916|0.9916	H|H	0.99182|0.99182	4.46|4.46	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.96615|0.96615	0.9455|0.9455	10|8	0.87932|0.87932	D|D	0|0	.|.	16.0832|16.0832	0.81020|0.81020	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	615;715|.	F5GXJ7;P50993|.	.;AT1A2_HUMAN|.	E|R	715;715;418|426	ENSP00000354490:G715E;ENSP00000376066:G715E|ENSP00000411705:G426R	ENSP00000354490:G715E|ENSP00000411705:G426R	G|G	+|+	2|1	0|0	ATP1A2|ATP1A2	158371876|158371876	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.889000|0.889000	0.51656|0.51656	9.593000|9.593000	0.98250|0.98250	2.383000|2.383000	0.81215|0.81215	0.561000|0.561000	0.74099|0.74099	GGG|GGG	.	.	.	none		0.602	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
NME7	29922	hgsc.bcm.edu	37	1	169102046	169102046	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:169102046A>G	ENST00000367811.3	-	12	1364	c.1108T>C	c.(1108-1110)Ttc>Ctc	p.F370L	NME7_ENST00000472647.1_Missense_Mutation_p.F334L	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	370					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					ATCTTGAAGAAGTATTGAACC	0.388																																					p.F370L		Atlas-SNP	.											.	NME7	34	.	0			c.T1108C						PASS	.						122.0	110.0	114.0					1																	169102046		2203	4300	6503	SO:0001583	missense	29922	exon12			TGAAGAAGTATTG	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.1108T>C	chr1.hg19:g.169102046A>G	ENSP00000356785:p.Phe370Leu	71.0	0.0	.		66.0	7.0	.	NM_013330	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	ENST00000367811.3	hg19	CCDS1277.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943147	0.53079	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55234	0.53;0.53	6.17	6.17	0.99709	.	0.557913	0.21023	N	0.081462	T	0.50837	0.1639	M	0.84683	2.71	0.45995	D	0.998806	B	0.20988	0.05	B	0.31686	0.134	T	0.54132	-0.8339	9	0.34782	T	0.22	-13.3948	16.8222	0.85835	1.0:0.0:0.0:0.0	.	370	Q9Y5B8	NDK7_HUMAN	L	334;370	ENSP00000433341:F334L;ENSP00000356785:F370L	ENSP00000356785:F370L	F	-	1	0	NME7	167368670	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.416000	0.90244	2.371000	0.80710	0.533000	0.62120	TTC	.	.	.	none		0.388	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083688.1	NM_013330	
PPFIA4	8497	hgsc.bcm.edu	37	1	203036824	203036824	+	Splice_Site	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:203036824A>G	ENST00000447715.2	+	31	3427	c.2986A>G	c.(2986-2988)Acc>Gcc	p.T996A	PPFIA4_ENST00000295706.4_Splice_Site_p.T503A|PPFIA4_ENST00000414050.2_Splice_Site_p.T725A|PPFIA4_ENST00000599966.1_Splice_Site_p.T503A|PPFIA4_ENST00000367240.2_Splice_Site_p.T997A|PPFIA4_ENST00000272198.6_Splice_Site_p.T512A			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	996	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						TGCCTGCAGAACCAGTCTTCA	0.552																																					p.T512A		Atlas-SNP	.											.	PPFIA4	139	.	0			c.A1534G						PASS	.						78.0	84.0	82.0					1																	203036824		2156	4266	6422	SO:0001630	splice_region_variant	8497	exon13			TGCAGAACCAGTC	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2985-1A>G	chr1.hg19:g.203036824A>G		94.0	0.0	.		67.0	8.0	.	NM_015053	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	hg19		.	.	.	.	.	.	.	.	.	.	A	10.88	1.474689	0.26511	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	3.89	2.72	0.32119	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.349867	0.20011	U	0.101127	T	0.27933	0.0688	N	0.11892	0.195	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.0;0.0;0.001	T	0.04930	-1.0917	10	0.44086	T	0.13	-16.0337	9.5608	0.39369	0.9138:0.0:0.0862:0.0	.	725;996;198;503;512	B4DIS5;B1N949;B3KN22;O75335-2;O75335	.;.;.;.;LIPA4_HUMAN	A	997;996;503;725;512	ENSP00000356209:T997A;ENSP00000402576:T996A;ENSP00000295706:T503A;ENSP00000400379:T725A;ENSP00000272198:T512A	ENSP00000272198:T512A	T	+	1	0	PPFIA4	201303447	0.971000	0.33674	1.000000	0.80357	0.968000	0.65278	2.234000	0.43035	0.618000	0.30179	0.397000	0.26171	ACC	.	.	.	none		0.552	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	Missense_Mutation
SDE2	163859	hgsc.bcm.edu	37	1	226175877	226175877	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr1:226175877G>T	ENST00000272091.7	-	6	872	c.854C>A	c.(853-855)cCg>cAg	p.P285Q		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	285																	GTCAGTCACCGGGATCTGCAG	0.502																																					p.P285Q		Atlas-SNP	.											.	.	.	.	0			c.C854A						PASS	.						175.0	164.0	168.0					1																	226175877		1943	4144	6087	SO:0001583	missense	163859	exon6			GTCACCGGGATCT	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.854C>A	chr1.hg19:g.226175877G>T	ENSP00000272091:p.Pro285Gln	311.0	0.0	.		236.0	10.0	.	NM_152608	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	hg19	CCDS41473.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653524	0.47362	.	.	ENSG00000143751	ENST00000272091;ENST00000366818;ENST00000366817	T;T	0.53206	0.78;0.63	6.05	0.9	0.19278	.	0.513077	0.23622	N	0.046231	T	0.34135	0.0887	L	0.59436	1.845	0.09310	N	1	B;B	0.23591	0.088;0.021	B;B	0.25614	0.062;0.017	T	0.18085	-1.0348	10	0.21540	T	0.41	-0.685	1.397	0.02263	0.2086:0.1076:0.3867:0.2972	.	273;285	Q6IQ49-2;Q6IQ49	.;CA055_HUMAN	Q	285;273;190	ENSP00000272091:P285Q;ENSP00000355782:P190Q	ENSP00000272091:P285Q	P	-	2	0	C1orf55	224242500	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.191000	0.17076	-0.069000	0.12931	0.650000	0.86243	CCG	.	.	.	none		0.502	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1	NM_152608	
GMPPA	29926	hgsc.bcm.edu	37	2	220370077	220370077	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr2:220370077T>C	ENST00000358215.3	+	8	1117	c.748T>C	c.(748-750)Tcc>Ccc	p.S250P	GMPPA_ENST00000313597.5_Missense_Mutation_p.S250P|AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000373908.1_Missense_Mutation_p.S250P|GMPPA_ENST00000373917.3_Missense_Mutation_p.S250P|GMPPA_ENST00000341142.3_Missense_Mutation_p.S250P	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	250					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		TCAGATCAAGTCCGCAGGGTA	0.607																																					p.S250P		Atlas-SNP	.											.	GMPPA	50	.	0			c.T748C						PASS	.						64.0	65.0	65.0					2																	220370077		2203	4300	6503	SO:0001583	missense	29926	exon8			ATCAAGTCCGCAG	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.748T>C	chr2.hg19:g.220370077T>C	ENSP00000350949:p.Ser250Pro	142.0	0.0	.		120.0	22.0	.	NM_205847	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	hg19	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	t	25.4	4.632235	0.87660	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000435316;ENST00000341142	D;D;D;D;T;D	0.94650	-3.48;-3.48;-3.48;-3.48;1.84;-3.48	4.9	4.9	0.64082	.	0.271361	0.37530	N	0.002048	D	0.96592	0.8888	M	0.73962	2.25	0.80722	D	1	D;D	0.71674	0.998;0.97	D;P	0.66847	0.947;0.737	D	0.96980	0.9714	10	0.66056	D	0.02	-23.7265	14.211	0.65764	0.0:0.0:0.0:1.0	.	250;250	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	P	250;250;250;250;215;250	ENSP00000315925:S250P;ENSP00000363027:S250P;ENSP00000350949:S250P;ENSP00000363016:S250P;ENSP00000411060:S215P;ENSP00000340760:S250P	ENSP00000315925:S250P	S	+	1	0	GMPPA	220078321	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.745000	0.85046	1.828000	0.53243	0.529000	0.55759	TCC	.	.	.	none		0.607	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
CAMK1	8536	hgsc.bcm.edu	37	3	9801228	9801228	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:9801228T>C	ENST00000256460.3	-	10	1033	c.856A>G	c.(856-858)Atc>Gtc	p.I286V	OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302036.7_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000349503.5_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	286	Autoinhibitory domain.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		GACTGGTGGATATTCTTATCT	0.537																																					p.I286V		Atlas-SNP	.											.	CAMK1	32	.	0			c.A856G						PASS	.						179.0	171.0	174.0					3																	9801228		2203	4300	6503	SO:0001583	missense	8536	exon10			GGTGGATATTCTT	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.856A>G	chr3.hg19:g.9801228T>C	ENSP00000256460:p.Ile286Val	250.0	0.0	.		204.0	42.0	.	NM_003656	Q3KPF6	Missense_Mutation	SNP	ENST00000256460.3	hg19	CCDS2582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.415377|4.415377	0.83449|0.83449	.|.	.|.	ENSG00000134072|ENSG00000134072	ENST00000256460|ENST00000421120	T|.	0.39056|.	1.1|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80407|0.80407	0.4617|0.4617	M|M	0.87038|0.87038	2.855|2.855	0.80722|0.80722	D|D	1|1	P;P|.	0.48162|.	0.906;0.906|.	P;P|.	0.45099|.	0.469;0.469|.	T|T	0.83025|0.83025	-0.0165|-0.0165	10|5	0.59425|.	D|.	0.04|.	-11.1309|-11.1309	16.0971|16.0971	0.81132|0.81132	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	286;286|.	Q14012;B0YIY3|.	KCC1A_HUMAN;.|.	V|C	286|132	ENSP00000256460:I286V|.	ENSP00000256460:I286V|.	I|Y	-|-	1|2	0|0	CAMK1|CAMK1	9776228|9776228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.589000|7.589000	0.82641|0.82641	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	ATC|TAT	.	.	.	none		0.537	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
GPD1L	23171	hgsc.bcm.edu	37	3	32169609	32169609	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:32169609A>C	ENST00000282541.5	+	2	290	c.89A>C	c.(88-90)aAa>aCa	p.K30T		NM_015141.3	NP_055956.1	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	30					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophospholipid biosynthetic process (GO:0046474)|NAD metabolic process (GO:0019674)|NADH metabolic process (GO:0006734)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase C signaling (GO:0090038)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|ventricular cardiac muscle cell action potential (GO:0086005)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|plasma membrane (GO:0005886)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|ion channel binding (GO:0044325)|NAD binding (GO:0051287)|sodium channel regulator activity (GO:0017080)			large_intestine(4)|lung(7)|ovary(1)	12						AATGTCAAGAAACTTCAGAAA	0.368																																					p.K30T		Atlas-SNP	.											.	GPD1L	25	.	0			c.A89C						PASS	.						59.0	59.0	59.0					3																	32169609		2203	4300	6503	SO:0001583	missense	23171	exon2			TCAAGAAACTTCA	D42047	CCDS33729.1	3p22.3	2014-09-17			ENSG00000152642	ENSG00000152642			28956	protein-coding gene	gene with protein product		611778				7788527	Standard	NM_015141		Approved	KIAA0089	uc003cew.3	Q8N335	OTTHUMG00000155846	ENST00000282541.5:c.89A>C	chr3.hg19:g.32169609A>C	ENSP00000282541:p.Lys30Thr	50.0	0.0	.		49.0	9.0	.	NM_015141	A8K9U3|Q14702|Q9BRM5	Missense_Mutation	SNP	ENST00000282541.5	hg19	CCDS33729.1	.	.	.	.	.	.	.	.	.	.	A	12.00	1.807729	0.31961	.	.	ENSG00000152642	ENST00000282541;ENST00000425459	T;T	0.58652	0.32;1.2	4.8	3.62	0.41486	Glycerol-3-phosphate dehydrogenase, NAD-dependent, N-terminal (1);NAD(P)-binding domain (1);	0.435694	0.28257	N	0.016007	T	0.52917	0.1764	M	0.70595	2.14	0.29089	N	0.882201	B	0.06786	0.001	B	0.20184	0.028	T	0.52697	-0.8541	10	0.46703	T	0.11	-9.553	6.5277	0.22310	0.6226:0.3005:0.0769:0.0	.	30	Q8N335	GPD1L_HUMAN	T	30	ENSP00000282541:K30T;ENSP00000408770:K30T	ENSP00000282541:K30T	K	+	2	0	GPD1L	32144613	0.036000	0.19791	0.834000	0.33040	0.984000	0.73092	2.830000	0.48136	0.938000	0.37419	0.459000	0.35465	AAA	.	.	.	none		0.368	GPD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341975.2	NM_015141	
NXPE3	91775	hgsc.bcm.edu	37	3	101540473	101540473	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:101540473C>G	ENST00000491511.2	+	8	2311	c.1355C>G	c.(1354-1356)cCt>cGt	p.P452R	NXPE3_ENST00000422132.1_Missense_Mutation_p.P452R|NXPE3_ENST00000273347.5_Missense_Mutation_p.P452R|RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000477909.1_Missense_Mutation_p.P452R	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	452						extracellular region (GO:0005576)											AGCACCTTCCCTTTGGAAGTG	0.552																																					p.P452R		Atlas-SNP	.											.	.	.	.	0			c.C1355G						PASS	.						113.0	99.0	104.0					3																	101540473		2203	4300	6503	SO:0001583	missense	91775	exon8			CCTTCCCTTTGGA	AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1355C>G	chr3.hg19:g.101540473C>G	ENSP00000417485:p.Pro452Arg	85.0	0.0	.		64.0	11.0	.	NM_145037	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	hg19	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	C	31	5.070163	0.93950	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	6.03	6.03	0.97812	.	0.044822	0.85682	D	0.000000	T	0.67325	0.2881	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73017	-0.4115	10	0.87932	D	0	-17.0676	20.5568	0.99304	0.0:1.0:0.0:0.0	.	452	Q969Y0	FA55C_HUMAN	R	452	ENSP00000273347:P452R;ENSP00000417485:P452R;ENSP00000418369:P452R;ENSP00000396421:P452R	ENSP00000273347:P452R	P	+	2	0	FAM55C	103023163	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.861000	0.98227	0.655000	0.94253	CCT	.	.	.	none		0.552	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
POLQ	10721	hgsc.bcm.edu	37	3	121260288	121260288	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:121260288G>A	ENST00000264233.5	-	3	510	c.382C>T	c.(382-384)Ctt>Ttt	p.L128F		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	128	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTCAAAATAAGTAATTCTGCC	0.348								DNA polymerases (catalytic subunits)																													p.L128F	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.C382T						PASS	.						145.0	164.0	157.0					3																	121260288		2203	4300	6503	SO:0001583	missense	10721	exon3			AAATAAGTAATTC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.382C>T	chr3.hg19:g.121260288G>A	ENSP00000264233:p.Leu128Phe	380.0	0.0	.		448.0	78.0	.	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569858	0.86542	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.60672	0.17	5.74	5.74	0.90152	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.275715	0.37261	N	0.002169	T	0.79787	0.4506	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81741	-0.0794	10	0.87932	D	0	.	19.9346	0.97133	0.0:0.0:1.0:0.0	.	128	O75417	DPOLQ_HUMAN	F	128;263	ENSP00000264233:L128F	ENSP00000264233:L128F	L	-	1	0	POLQ	122742978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.652000	0.54439	2.712000	0.92718	0.563000	0.77884	CTT	.	.	.	none		0.348	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
ATR	545	hgsc.bcm.edu	37	3	142284995	142284995	+	Missense_Mutation	SNP	C	C	T	rs200407265		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:142284995C>T	ENST00000350721.4	-	3	381	c.260G>A	c.(259-261)aGt>aAt	p.S87N	ATR_ENST00000383101.3_Missense_Mutation_p.S87N	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	87					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATGGCTTCCACTCACATTTAC	0.413								Other conserved DNA damage response genes																													p.S87N		Atlas-SNP	.											.	ATR	285	.	0			c.G260A						PASS	.						107.0	101.0	103.0					3																	142284995		2203	4300	6503	SO:0001583	missense	545	exon3			CTTCCACTCACAT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.260G>A	chr3.hg19:g.142284995C>T	ENSP00000343741:p.Ser87Asn	98.0	0.0	.		111.0	23.0	.	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	2.407	-0.336336	0.05278	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.30448	1.53;1.53	5.53	0.0727	0.14388	.	1.113090	0.06757	N	0.781079	T	0.07548	0.0190	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36553	-0.9743	10	0.02654	T	1	-9.1875	2.5644	0.04779	0.1129:0.2236:0.1159:0.5476	.	87	Q13535	ATR_HUMAN	N	87	ENSP00000343741:S87N;ENSP00000372581:S87N	ENSP00000343741:S87N	S	-	2	0	ATR	143767685	0.931000	0.31567	1.000000	0.80357	0.976000	0.68499	0.080000	0.14802	0.369000	0.24510	-0.414000	0.06135	AGT	.	C|1.000;A|0.000	.	alt		0.413	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
LAMP3	27074	hgsc.bcm.edu	37	3	182870222	182870222	+	Silent	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:182870222G>T	ENST00000265598.3	-	3	1084	c.829C>A	c.(829-831)Cga>Aga	p.R277R	LAMP3_ENST00000466939.1_Silent_p.R253R	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	277					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.R277R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TTGGATTTTCGGGTGCCACAG	0.458																																					p.R277R		Atlas-SNP	.											.	LAMP3	48	.	1	Substitution - coding silent(1)	lung(1)	c.C829A						PASS	.						174.0	186.0	182.0					3																	182870222		2203	4300	6503	SO:0001819	synonymous_variant	27074	exon3			ATTTTCGGGTGCC	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.829C>A	chr3.hg19:g.182870222G>T		384.0	0.0	.		415.0	17.0	.	NM_014398	D3DNS4|O94781|Q8NEC8	Silent	SNP	ENST00000265598.3	hg19	CCDS3242.1																																																																																			.	.	.	none		0.458	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
N4BP2	55728	hgsc.bcm.edu	37	4	40122682	40122682	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:40122682C>G	ENST00000261435.6	+	9	3367	c.2951C>G	c.(2950-2952)cCa>cGa	p.P984R		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	984					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AATAGTGCACCAACTGTTTCT	0.443																																					p.P984R		Atlas-SNP	.											.	N4BP2	166	.	0			c.C2951G						PASS	.						84.0	80.0	82.0					4																	40122682		2203	4300	6503	SO:0001583	missense	55728	exon9			GTGCACCAACTGT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.2951C>G	chr4.hg19:g.40122682C>G	ENSP00000261435:p.Pro984Arg	70.0	0.0	.		58.0	9.0	.	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	C	3.483	-0.105433	0.06967	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.21543	2.0	5.1	4.25	0.50352	.	0.600314	0.17354	N	0.177287	T	0.22898	0.0553	L	0.54323	1.7	0.09310	N	1	D;P	0.53151	0.958;0.93	P;B	0.45506	0.483;0.289	T	0.11421	-1.0588	10	0.48119	T	0.1	0.0045	8.0754	0.30714	0.0:0.8201:0.0:0.1799	.	984;984	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	R	984;904	ENSP00000261435:P984R	ENSP00000261435:P984R	P	+	2	0	N4BP2	39799077	0.020000	0.18652	0.005000	0.12908	0.002000	0.02628	2.644000	0.46613	1.513000	0.48852	0.655000	0.94253	CCA	.	.	.	none		0.443	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
SCD5	79966	hgsc.bcm.edu	37	4	83557889	83557889	+	Silent	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:83557889G>C	ENST00000319540.4	-	4	976	c.657C>G	c.(655-657)tcC>tcG	p.S219S		NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	219					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				CCAAGAAGTAGGAATTCCACA	0.537																																					p.S219S		Atlas-SNP	.											.	SCD5	58	.	0			c.C657G						PASS	.						108.0	95.0	100.0					4																	83557889		2203	4300	6503	SO:0001819	synonymous_variant	79966	exon4			GAAGTAGGAATTC	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.657C>G	chr4.hg19:g.83557889G>C		85.0	0.0	.		45.0	9.0	.	NM_001037582	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Silent	SNP	ENST00000319540.4	hg19	CCDS34024.1																																																																																			.	.	.	none		0.537	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
KIAA0922	23240	hgsc.bcm.edu	37	4	154557454	154557454	+	Splice_Site	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:154557454C>T	ENST00000409663.3	+	35	4608	c.4556C>T	c.(4555-4557)cCc>cTc	p.P1519L	KIAA0922_ENST00000440693.1_Splice_Site_p.P1436L|KIAA0922_ENST00000409959.3_Splice_Site_p.P1520L	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1519						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				ATACTTCAGCCCTACCTCACA	0.413																																					p.P1520L		Atlas-SNP	.											.	KIAA0922	214	.	0			c.C4559T						PASS	.						76.0	85.0	82.0					4																	154557454		2203	4300	6503	SO:0001630	splice_region_variant	23240	exon35			TTCAGCCCTACCT	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4555-1C>T	chr4.hg19:g.154557454C>T		230.0	0.0	.		208.0	24.0	.	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	ENST00000409663.3	hg19	CCDS3783.2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298160	0.81025	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.31510	1.76;1.49;1.75;1.51	5.93	5.07	0.68467	.	0.056199	0.64402	D	0.000001	T	0.50034	0.1592	L	0.52573	1.65	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.995	D;D;P	0.68621	0.959;0.934;0.86	T	0.53129	-0.8482	10	0.87932	D	0	-12.4672	16.3753	0.83383	0.133:0.867:0.0:0.0	.	1436;1520;1519	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	L	1519;1436;1520;1297	ENSP00000386574:P1519L;ENSP00000409663:P1436L;ENSP00000386787:P1520L;ENSP00000240487:P1297L	ENSP00000240487:P1297L	P	+	2	0	KIAA0922	154776904	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.205000	0.77881	1.466000	0.48025	0.655000	0.94253	CCC	.	.	.	none		0.413	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	Missense_Mutation
FNIP2	57600	hgsc.bcm.edu	37	4	159756556	159756556	+	Splice_Site	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:159756556G>A	ENST00000264433.6	+	7	730		c.e7-1		FNIP2_ENST00000379346.3_Splice_Site	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CTTTATCTTAGCACACAGCAC	0.383																																					.		Atlas-SNP	.											.	FNIP2	90	.	0			c.656-1G>A						PASS	.						258.0	258.0	258.0					4																	159756556		1966	4155	6121	SO:0001630	splice_region_variant	57600	exon7			ATCTTAGCACACA	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.656-1G>A	chr4.hg19:g.159756556G>A		305.0	0.0	.		298.0	56.0	.	NM_020840	Q05DC3|Q96I31|Q9H994	Splice_Site	SNP	ENST00000264433.6	hg19	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225241	0.79576	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346;ENST00000504715	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2857	0.98533	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FNIP2	159976006	1.000000	0.71417	0.995000	0.50966	0.794000	0.44872	9.224000	0.95209	2.803000	0.96430	0.650000	0.86243	.	.	.	.	none		0.383	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	Intron
LIFR	3977	hgsc.bcm.edu	37	5	38489203	38489203	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:38489203G>A	ENST00000263409.4	-	16	2474	c.2312C>T	c.(2311-2313)tCt>tTt	p.S771F	LIFR_ENST00000503088.1_5'Flank|LIFR_ENST00000453190.2_Missense_Mutation_p.S771F	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	771	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CCTCATCTTAGATGTGTCTCT	0.343			T	PLAG1	salivary adenoma																																p.S771F	Melanoma(13;4 730 6426 9861 34751)	Atlas-SNP	.		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR	348	.	0			c.C2312T						PASS	.						80.0	84.0	83.0					5																	38489203		2203	4300	6503	SO:0001583	missense	3977	exon16			ATCTTAGATGTGT	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2312C>T	chr5.hg19:g.38489203G>A	ENSP00000263409:p.Ser771Phe	96.0	0.0	.		109.0	26.0	.	NM_002310	Q6LCD9	Missense_Mutation	SNP	ENST00000263409.4	hg19	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.037720	0.35989	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.53423	0.62;0.62	5.78	4.92	0.64577	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.715180	0.14869	N	0.293661	T	0.46367	0.1389	M	0.76838	2.35	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.46624	-0.9178	10	0.09084	T	0.74	-6.9518	11.4001	0.49864	0.1549:0.0:0.8451:0.0	.	771	P42702	LIFR_HUMAN	F	771	ENSP00000263409:S771F;ENSP00000398368:S771F	ENSP00000263409:S771F	S	-	2	0	LIFR	38524960	0.985000	0.35326	0.823000	0.32752	0.952000	0.60782	2.593000	0.46180	1.456000	0.47831	0.650000	0.86243	TCT	.	.	.	none		0.343	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PCDHGC4	56098	hgsc.bcm.edu	37	5	140864817	140864817	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:140864817A>G	ENST00000306593.1	+	1	77	c.77A>G	c.(76-78)tAc>tGc	p.Y26C	PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	26					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCTGGGTTACGTTTGTGGG	0.542																																					p.Y26C		Atlas-SNP	.											.	PCDHGC4	91	.	0			c.A77G						PASS	.						61.0	64.0	63.0					5																	140864817		2203	4300	6503	SO:0001583	missense	56098	exon1			TGGGTTACGTTTG	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.77A>G	chr5.hg19:g.140864817A>G	ENSP00000306918:p.Tyr26Cys	117.0	0.0	.		86.0	15.0	.	NM_018928	Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	hg19	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	A	8.646	0.897050	0.17686	.	.	ENSG00000242419	ENST00000306593	T	0.46819	0.86	4.81	4.81	0.61882	.	.	.	.	.	T	0.26557	0.0649	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.017;0.001	B;B	0.16722	0.016;0.004	T	0.07888	-1.0749	9	0.38643	T	0.18	.	6.6967	0.23203	0.6868:0.231:0.0822:0.0	.	26;26	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	C	26	ENSP00000306918:Y26C	ENSP00000306918:Y26C	Y	+	2	0	PCDHGC4	140845001	0.831000	0.29352	0.975000	0.42487	0.979000	0.70002	2.204000	0.42761	2.012000	0.59069	0.459000	0.35465	TAC	.	.	.	none		0.542	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
OR2J3	442186	hgsc.bcm.edu	37	6	29079815	29079815	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:29079815A>G	ENST00000377169.1	+	1	148	c.148A>G	c.(148-150)Atc>Gtc	p.I50V		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						GTTCATCATCATCCTGTCATA	0.423																																					p.I50V		Atlas-SNP	.											.	OR2J3	53	.	0			c.A148G						PASS	.						291.0	305.0	300.0					6																	29079815		1349	2628	3977	SO:0001583	missense	442186	exon1			ATCATCATCCTGT		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.148A>G	chr6.hg19:g.29079815A>G	ENSP00000366374:p.Ile50Val	337.0	0.0	.		269.0	53.0	.	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	hg19	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	A	2.071	-0.413113	0.04799	.	.	ENSG00000204701	ENST00000377169	T	0.03889	3.77	2.78	1.58	0.23477	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00784	0.0026	N	0.05414	-0.055	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48080	-0.9066	9	0.48119	T	0.1	.	4.2981	0.10911	0.682:0.2023:0.1157:0.0	.	50	O76001	OR2J3_HUMAN	V	50	ENSP00000366374:I50V	ENSP00000366374:I50V	I	+	1	0	OR2J3	29187794	0.000000	0.05858	0.992000	0.48379	0.314000	0.28054	-0.814000	0.04486	0.295000	0.22570	0.358000	0.22013	ATC	.	.	.	none		0.423	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
ZBTB22	9278	hgsc.bcm.edu	37	6	33284668	33284668	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:33284668C>T	ENST00000431845.2	-	2	177	c.26G>A	c.(25-27)aGt>aAt	p.S9N	TAPBP_ENST00000489157.1_5'Flank|DAXX_ENST00000477162.1_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.S9N|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000434618.2_5'Flank|TAPBP_ENST00000475304.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						TGCTGCCCCACTGGGAGACAG	0.657																																					p.S9N		Atlas-SNP	.											.	ZBTB22	48	.	0			c.G26A						PASS	.						18.0	22.0	21.0					6																	33284668		2202	4295	6497	SO:0001583	missense	9278	exon2			GCCCCACTGGGAG	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.26G>A	chr6.hg19:g.33284668C>T	ENSP00000407545:p.Ser9Asn	82.0	0.0	.		47.0	10.0	.	NM_001145338	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	hg19	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996665	0.35226	.	.	ENSG00000236104	ENST00000418724;ENST00000431845;ENST00000441117	T;T;T	0.64803	3.38;3.38;-0.12	4.68	2.67	0.31697	.	.	.	.	.	T	0.17831	0.0428	N	0.08118	0	0.26387	N	0.976649	B	0.16166	0.016	B	0.14578	0.011	T	0.11567	-1.0582	9	0.38643	T	0.18	.	4.8891	0.13717	0.0:0.6566:0.2229:0.1205	.	9	O15209	ZBT22_HUMAN	N	9	ENSP00000404403:S9N;ENSP00000407545:S9N;ENSP00000413172:S9N	ENSP00000404403:S9N	S	-	2	0	ZBTB22	33392646	0.013000	0.17824	1.000000	0.80357	0.995000	0.86356	1.367000	0.34204	1.172000	0.42781	0.638000	0.83543	AGT	.	.	.	none		0.657	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
UBR2	23304	hgsc.bcm.edu	37	6	42559909	42559909	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:42559909C>G	ENST00000372899.1	+	3	617	c.359C>G	c.(358-360)aCt>aGt	p.T120S	UBR2_ENST00000372901.1_Missense_Mutation_p.T120S|UBR2_ENST00000372903.2_Missense_Mutation_p.T120S	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	120					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GTTGATCCAACTTGTGTTTTG	0.323																																					p.T120S		Atlas-SNP	.											.	UBR2	134	.	0			c.C359G						PASS	.						112.0	101.0	105.0					6																	42559909		2203	4300	6503	SO:0001583	missense	23304	exon3			ATCCAACTTGTGT	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.359C>G	chr6.hg19:g.42559909C>G	ENSP00000361990:p.Thr120Ser	89.0	0.0	.		78.0	11.0	.	NM_001184801	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	hg19	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730359	0.89390	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	D;D;D	0.82255	-1.59;-1.59;-1.59	5.24	5.24	0.73138	Zinc finger, N-recognin, metazoa (1);Zinc finger, N-recognin (2);	0.000000	0.85682	D	0.000000	D	0.88887	0.6559	M	0.73319	2.225	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.81914	0.995;0.894	D	0.87768	0.2603	10	0.41790	T	0.15	-11.9828	18.4238	0.90602	0.0:1.0:0.0:0.0	.	120;120	Q8IWV8;Q8IWV8-2	UBR2_HUMAN;.	S	120	ENSP00000361994:T120S;ENSP00000361990:T120S;ENSP00000361992:T120S	ENSP00000361990:T120S	T	+	2	0	UBR2	42667887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.756000	0.74919	2.459000	0.83118	0.655000	0.94253	ACT	.	.	.	none		0.323	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
SLC35B2	347734	hgsc.bcm.edu	37	6	44222677	44222677	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr6:44222677G>C	ENST00000393812.3	-	4	1208	c.1065C>G	c.(1063-1065)atC>atG	p.I355M	SLC35B2_ENST00000495706.1_5'UTR|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000393810.1_3'UTR|SLC35B2_ENST00000538577.1_Missense_Mutation_p.I262M|SLC35B2_ENST00000537814.1_Missense_Mutation_p.I222M	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	355					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGGTGTAAAAGATGAAGAGCT	0.577																																					p.I355M		Atlas-SNP	.											.	SLC35B2	40	.	0			c.C1065G						PASS	.						59.0	52.0	54.0					6																	44222677		2203	4300	6503	SO:0001583	missense	347734	exon4			GTAAAAGATGAAG	AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.1065C>G	chr6.hg19:g.44222677G>C	ENSP00000377401:p.Ile355Met	47.0	0.0	.		29.0	6.0	.	NM_178148	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	ENST00000393812.3	hg19	CCDS34462.1	.	.	.	.	.	.	.	.	.	.	g	16.92	3.256373	0.59321	.	.	ENSG00000157593	ENST00000393812;ENST00000537814;ENST00000538577;ENST00000341553	T;T;T	0.40476	1.03;1.03;1.03	5.0	2.85	0.33270	.	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	H	0.96460	3.825	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.77838	-0.2439	10	0.87932	D	0	-30.6983	12.2066	0.54355	0.1659:0.0:0.8341:0.0	.	262;355	F5H7Y9;Q8TB61	.;S35B2_HUMAN	M	355;222;262;315	ENSP00000377401:I355M;ENSP00000440340:I222M;ENSP00000443845:I262M	ENSP00000342455:I315M	I	-	3	3	SLC35B2	44330655	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.845000	0.48254	1.121000	0.41925	0.540000	0.68198	ATC	.	.	.	none		0.577	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
TPST1	8460	hgsc.bcm.edu	37	7	65705725	65705725	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:65705725C>A	ENST00000304842.5	+	2	738	c.313C>A	c.(313-315)Ccc>Acc	p.P105T	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	105					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						CAGGGTCATTCCCCGAATCCT	0.527																																					p.P105T		Atlas-SNP	.											.	TPST1	25	.	0			c.C313A						PASS	.						96.0	93.0	94.0					7																	65705725		2203	4300	6503	SO:0001583	missense	8460	exon2			GTCATTCCCCGAA	AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.313C>A	chr7.hg19:g.65705725C>A	ENSP00000302413:p.Pro105Thr	74.0	0.0	.		96.0	39.0	.	NM_003596	A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	hg19	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574392	0.86542	.	.	ENSG00000169902	ENST00000304842;ENST00000544114;ENST00000451388	T;T	0.41065	1.01;1.01	5.78	5.78	0.91487	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.89658	3.05	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.986;0.994	T	0.76498	-0.2937	10	0.56958	D	0.05	-14.1045	19.0054	0.92848	0.0:1.0:0.0:0.0	.	105;105	F5H7U7;O60507	.;TPST1_HUMAN	T	105	ENSP00000302413:P105T;ENSP00000391338:P105T	ENSP00000302413:P105T	P	+	1	0	TPST1	65343160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.950000	0.75977	2.723000	0.93209	0.585000	0.79938	CCC	.	.	.	none		0.527	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596	
ELN	2006	hgsc.bcm.edu	37	7	73474279	73474279	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:73474279C>T	ENST00000252034.7	+	23	1877	c.1478C>T	c.(1477-1479)cCt>cTt	p.P493L	ELN_ENST00000357036.5_Missense_Mutation_p.P498L|ELN_ENST00000380553.4_Missense_Mutation_p.P357L|ELN_ENST00000414324.1_Missense_Mutation_p.P469L|ELN_ENST00000380584.4_Missense_Mutation_p.P460L|ELN_ENST00000380575.4_Missense_Mutation_p.P464L|ELN_ENST00000380562.4_Missense_Mutation_p.P499L|ELN_ENST00000429192.1_Missense_Mutation_p.P479L|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000445912.1_Missense_Mutation_p.P493L|ELN_ENST00000320492.7_Missense_Mutation_p.P412L|ELN_ENST00000358929.4_Missense_Mutation_p.P528L|ELN_ENST00000380576.5_Missense_Mutation_p.P474L|ELN_ENST00000320399.6_Missense_Mutation_p.P493L|ELN_ENST00000458204.1_Missense_Mutation_p.P483L	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GGTGTGGCTCCTGGAGTTGGC	0.612			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P498L		Atlas-SNP	.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	81	.	0			c.C1493T						PASS	.						205.0	192.0	196.0					7																	73474279		2203	4300	6503	SO:0001583	missense	2006	exon23			TGGCTCCTGGAGT		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1478C>T	chr7.hg19:g.73474279C>T	ENSP00000252034:p.Pro493Leu	408.0	1.0	.		376.0	128.0	.	NM_001081754	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	hg19	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.695839	0.48202	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44482	1.42;1.35;1.26;1.39;0.95;1.27;0.92;1.18;1.41;1.4;0.95;1.07;1.0;1.38	2.86	2.86	0.33363	.	.	.	.	.	T	0.41119	0.1145	.	.	.	0.80722	D	1	P;P;P;P;P;P;P;P;P;P;P;P;P	0.51351	0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.573;0.944;0.573;0.573;0.573	B;B;B;B;B;B;B;B;B;P;B;B;B	0.44811	0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.199;0.461;0.199;0.199;0.199	T	0.47302	-0.9128	8	0.62326	D	0.03	.	11.5518	0.50725	0.0:1.0:0.0:0.0	.	493;412;469;483;499;464;479;498;474;357;404;460;493	E7ENM0;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.	L	493;493;528;412;469;499;464;460;483;498;479;357;474;493	ENSP00000389857:P493L;ENSP00000252034:P493L;ENSP00000351807:P528L;ENSP00000315607:P412L;ENSP00000392575:P469L;ENSP00000369936:P499L;ENSP00000369949:P464L;ENSP00000369958:P460L;ENSP00000403162:P483L;ENSP00000349540:P498L;ENSP00000391129:P479L;ENSP00000369926:P357L;ENSP00000369950:P474L;ENSP00000313565:P493L	ENSP00000252034:P493L	P	+	2	0	ELN	73112215	0.159000	0.22864	0.014000	0.15608	0.005000	0.04900	3.649000	0.54417	1.625000	0.50366	0.555000	0.69702	CCT	.	.	.	none		0.612	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
DLD	1738	hgsc.bcm.edu	37	7	107542828	107542828	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:107542828T>C	ENST00000205402.5	+	4	538	c.257T>C	c.(256-258)aTt>aCt	p.I86T	DLD_ENST00000494441.1_3'UTR|DLD_ENST00000537148.1_Intron|DLD_ENST00000440410.1_Intron|DLD_ENST00000437604.2_Missense_Mutation_p.I86T	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	86					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GTTGGTTGTATTCCTTCTAAG	0.368																																					p.I86T		Atlas-SNP	.											.	DLD	72	.	0			c.T257C						PASS	.						295.0	259.0	271.0					7																	107542828		2203	4300	6503	SO:0001583	missense	1738	exon4			GTTGTATTCCTTC	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.257T>C	chr7.hg19:g.107542828T>C	ENSP00000205402:p.Ile86Thr	75.0	0.0	.		97.0	31.0	.	NM_000108	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	hg19	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.430417	0.83776	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000437604;ENST00000539590	T;T;T	0.56103	0.48;0.48;0.48	6.17	6.17	0.99709	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.82365	0.5021	H	0.96691	3.865	0.80722	D	1	P;D	0.54397	0.945;0.966	D;D	0.83275	0.955;0.996	D	0.87980	0.2742	10	0.87932	D	0	-11.8281	16.0034	0.80327	0.0:0.0:0.0:1.0	.	86;86	B4DT69;P09622	.;DLDH_HUMAN	T	86;86;86;36	ENSP00000205402:I86T;ENSP00000390667:I86T;ENSP00000387542:I86T	ENSP00000205402:I86T	I	+	2	0	DLD	107330064	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.900000	0.75687	2.371000	0.80710	0.533000	0.62120	ATT	.	.	.	none		0.368	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
MET	4233	hgsc.bcm.edu	37	7	116417457	116417457	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:116417457G>A	ENST00000318493.6	+	16	3515	c.3328G>A	c.(3328-3330)Gta>Ata	p.V1110I	MET_ENST00000397752.3_Missense_Mutation_p.V1092I|MET_ENST00000539704.1_5'UTR			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTTGGTTGTGTATATCATGG	0.338			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1110I		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET	412	.	0			c.G3328A	GRCh37	CM990852	MET	M		PASS	.						191.0	176.0	180.0					7																	116417457		1827	4084	5911	SO:0001583	missense	4233	exon16	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GGTTGTGTATATC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3328G>A	chr7.hg19:g.116417457G>A	ENSP00000317272:p.Val1110Ile	158.0	0.0	.		223.0	26.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834124	0.91036	.	.	ENSG00000105976	ENST00000397752;ENST00000318493	T;T	0.64991	-0.13;-0.13	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81178	0.4768	M	0.80422	2.495	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.85130	0.997;0.99	D	0.83726	0.0195	10	0.87932	D	0	.	19.0107	0.92871	0.0:0.0:1.0:0.0	.	1110;1092	P08581-2;P08581	.;MET_HUMAN	I	1092;1110	ENSP00000380860:V1092I;ENSP00000317272:V1110I	ENSP00000317272:V1110I	V	+	1	0	MET	116204693	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.813000	0.99286	2.560000	0.86352	0.563000	0.77884	GTA	.	.	.	none		0.338	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
STRIP2	57464	hgsc.bcm.edu	37	7	129120722	129120722	+	Silent	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr7:129120722C>A	ENST00000249344.2	+	19	2081	c.2041C>A	c.(2041-2043)Cgg>Agg	p.R681R	STRIP2_ENST00000435494.2_Silent_p.R681R	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	681					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)		p.R681R(1)|p.R681W(1)									GAAACATTCCCGGACCATGGT	0.428																																					p.R681R		Atlas-SNP	.											FAM40B,NS,carcinoma,0,1	.	.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.C2041A						PASS	.						141.0	122.0	128.0					7																	129120722		2203	4300	6503	SO:0001819	synonymous_variant	57464	exon19			CATTCCCGGACCA	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.2041C>A	chr7.hg19:g.129120722C>A		118.0	0.0	.		102.0	6.0	.	NM_020704	Q8WUZ4	Silent	SNP	ENST00000249344.2	hg19	CCDS34752.1																																																																																			.	.	.	none		0.428	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
MCPH1	79648	hgsc.bcm.edu	37	8	6302563	6302563	+	Silent	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:6302563T>C	ENST00000344683.5	+	8	1396	c.1320T>C	c.(1318-1320)gcT>gcC	p.A440A	MCPH1_ENST00000522905.1_Silent_p.A392A|MCPH1_ENST00000519480.1_Silent_p.A440A	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	440					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CAAGCCCTGCTCAGTTGAGCT	0.403																																					p.A440A	Colon(95;1448 1467 8277 34473 35819)	Atlas-SNP	.											.	MCPH1	65	.	0			c.T1320C						PASS	.						90.0	88.0	89.0					8																	6302563		1903	4122	6025	SO:0001819	synonymous_variant	79648	exon8			CCCTGCTCAGTTG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1320T>C	chr8.hg19:g.6302563T>C		117.0	0.0	.		120.0	18.0	.	NM_001172574	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	hg19	CCDS43689.1																																																																																			.	.	.	none		0.403	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
ST18	9705	hgsc.bcm.edu	37	8	53092686	53092686	+	Silent	SNP	G	G	T	rs137908806		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:53092686G>T	ENST00000276480.7	-	9	956	c.273C>A	c.(271-273)acC>acA	p.T91T		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	91					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGCTACCTGCGGTAGAGTGAC	0.517																																					p.T91T		Atlas-SNP	.											ST18,NS,carcinoma,0,1	ST18	212	.	0			c.C273A						PASS	.						258.0	210.0	226.0					8																	53092686		2203	4300	6503	SO:0001819	synonymous_variant	9705	exon9			ACCTGCGGTAGAG	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.273C>A	chr8.hg19:g.53092686G>T		268.0	0.0	.		248.0	13.0	.	NM_014682	Q17RY1	Silent	SNP	ENST00000276480.7	hg19	CCDS6149.1																																																																																			.	G|1.000;A|0.000	.	alt		0.517	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
ADCY8	114	hgsc.bcm.edu	37	8	131921969	131921969	+	Missense_Mutation	SNP	G	G	C	rs368729916		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr8:131921969G>C	ENST00000286355.5	-	6	3717	c.1625C>G	c.(1624-1626)tCt>tGt	p.S542C	ADCY8_ENST00000377928.3_Missense_Mutation_p.S542C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	542					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GATTCCTCCAGATTCGAGTTT	0.463										HNSCC(32;0.087)																											p.S542C		Atlas-SNP	.											.	ADCY8	291	.	0			c.C1625G						PASS	.	G	CYS/SER	1,4405	2.1+/-5.4	0,1,2202	242.0	216.0	225.0		1625	5.9	1.0	8		225	0,8600		0,0,4300	no	missense	ADCY8	NM_001115.2	112	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging	542/1252	131921969	1,13005	2203	4300	6503	SO:0001583	missense	114	exon6			CCTCCAGATTCGA	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1625C>G	chr8.hg19:g.131921969G>C	ENSP00000286355:p.Ser542Cys	372.0	0.0	.		337.0	67.0	.	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	hg19	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072076	0.93950	2.27E-4	0.0	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	D;D;D	0.87029	-2.2;-2.2;-2.2	5.93	5.93	0.95920	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.052374	0.85682	D	0.000000	D	0.96423	0.8833	H	0.98276	4.19	0.49483	D	0.999792	D;D	0.69078	0.995;0.997	D;D	0.68353	0.957;0.953	D	0.97510	1.0066	10	0.87932	D	0	.	19.3421	0.94347	0.0:0.0:1.0:0.0	.	542;542	E7EVL1;P40145	.;ADCY8_HUMAN	C	542;542;157	ENSP00000286355:S542C;ENSP00000367161:S542C;ENSP00000428010:S157C	ENSP00000286355:S542C	S	-	2	0	ADCY8	131991151	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	TCT	.	.	.	weak		0.463	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
TEK	7010	hgsc.bcm.edu	37	9	27197591	27197591	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:27197591A>G	ENST00000380036.4	+	12	2345	c.1903A>G	c.(1903-1905)Agt>Ggt	p.S635G	TEK_ENST00000519097.1_Missense_Mutation_p.S488G|TEK_ENST00000406359.4_Missense_Mutation_p.S592G|RNA5SP280_ENST00000411230.1_RNA	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	635	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TTGGACCCTTAGTGACAGTAA	0.493																																					p.S635G		Atlas-SNP	.											.	TEK	250	.	0			c.A1903G						PASS	.						39.0	40.0	40.0					9																	27197591		2203	4300	6503	SO:0001583	missense	7010	exon12			ACCCTTAGTGACA	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1903A>G	chr9.hg19:g.27197591A>G	ENSP00000369375:p.Ser635Gly	44.0	0.0	.		38.0	8.0	.	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	hg19	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	A	9.271	1.045584	0.19748	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359;ENST00000519080	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.54	5.54	0.83059	Fibronectin, type III (1);	0.000000	0.64402	D	0.000010	T	0.62816	0.2459	L	0.56769	1.78	0.51233	D	0.999913	B;P;D;B	0.63880	0.281;0.462;0.993;0.361	B;B;D;B	0.68192	0.056;0.141;0.956;0.081	T	0.58457	-0.7633	10	0.23302	T	0.38	.	15.6853	0.77405	1.0:0.0:0.0:0.0	.	488;668;592;635	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	G	488;635;592;445	ENSP00000430686:S488G;ENSP00000369375:S635G;ENSP00000383977:S592G;ENSP00000428337:S445G	ENSP00000369375:S635G	S	+	1	0	TEK	27187591	0.999000	0.42202	0.744000	0.31058	0.104000	0.19210	4.662000	0.61525	2.117000	0.64856	0.533000	0.62120	AGT	.	.	.	none		0.493	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
ZCCHC6	79670	hgsc.bcm.edu	37	9	88943326	88943326	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:88943326C>G	ENST00000375963.3	-	11	1709	c.1537G>C	c.(1537-1539)Gac>Cac	p.D513H	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.D513H|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.D390H|ZCCHC6_ENST00000277141.6_5'UTR	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	513					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						GCAGCACTGTCAGTATGTTCC	0.408																																					p.D513H		Atlas-SNP	.											.	ZCCHC6	105	.	0			c.G1537C						PASS	.						246.0	214.0	225.0					9																	88943326		2203	4300	6503	SO:0001583	missense	79670	exon11			CACTGTCAGTATG	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.1537G>C	chr9.hg19:g.88943326C>G	ENSP00000365130:p.Asp513His	253.0	0.0	.		232.0	48.0	.	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	hg19	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.662242	0.47572	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.46819	0.86;1.06;1.06	4.35	4.35	0.52113	.	0.478121	0.23602	N	0.046437	T	0.55162	0.1903	L	0.36672	1.1	0.19945	N	0.999947	D;D	0.69078	0.997;0.991	P;P	0.61132	0.884;0.769	T	0.49551	-0.8928	10	0.66056	D	0.02	-18.5595	15.1952	0.73081	0.0:1.0:0.0:0.0	.	390;513	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	H	390;513;513	ENSP00000365127:D390H;ENSP00000365128:D513H;ENSP00000365130:D513H	ENSP00000365127:D390H	D	-	1	0	ZCCHC6	88133146	0.448000	0.25681	0.092000	0.20876	0.015000	0.08874	1.298000	0.33412	2.699000	0.92147	0.462000	0.41574	GAC	.	.	.	none		0.408	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
CRAT	1384	hgsc.bcm.edu	37	9	131864688	131864688	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:131864688G>T	ENST00000318080.2	-	5	915	c.621C>A	c.(619-621)caC>caA	p.H207Q	CRAT_ENST00000464290.1_5'UTR|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	207					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CCTGGTAGTTGTGTACCACGG	0.642																																					p.H207Q		Atlas-SNP	.											.	CRAT	43	.	0			c.C621A						PASS	.						147.0	128.0	135.0					9																	131864688		2203	4300	6503	SO:0001583	missense	1384	exon5			GTAGTTGTGTACC	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.621C>A	chr9.hg19:g.131864688G>T	ENSP00000315013:p.His207Gln	232.0	0.0	.		162.0	42.0	.	NM_000755	Q5T952|Q9BW16	Missense_Mutation	SNP	ENST00000318080.2	hg19	CCDS6919.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.223146	0.79464	.	.	ENSG00000095321	ENST00000351352;ENST00000318080	D	0.89343	-2.5	5.37	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.92528	0.7627	M	0.76170	2.325	0.80722	D	1	D	0.62365	0.991	D	0.68039	0.955	D	0.90458	0.4444	10	0.31617	T	0.26	-47.0361	10.6033	0.45379	0.12:0.0:0.88:0.0	.	207	P43155	CACP_HUMAN	Q	207	ENSP00000315013:H207Q	ENSP00000315013:H207Q	H	-	3	2	CRAT	130904509	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.076000	0.57591	0.913000	0.36797	0.561000	0.74099	CAC	.	.	.	none		0.642	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253700.1		
IKZF5	64376	hgsc.bcm.edu	37	10	124755609	124755609	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:124755609C>A	ENST00000368886.5	-	4	537	c.217G>T	c.(217-219)Ggg>Tgg	p.G73W	IKZF5_ENST00000479103.1_5'Flank|PSTK_ENST00000497219.1_Intron	NM_001271840.1	NP_001258769.1	Q9H5V7	IKZF5_HUMAN	IKAROS family zinc finger 5 (Pegasus)	73					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|lung(3)|prostate(1)	6		all_neural(114;0.169)|Colorectal(57;0.178)|Glioma(114;0.222)		Colorectal(40;0.0701)|COAD - Colon adenocarcinoma(40;0.0754)		CTTTCAAACCCGTCTACTAAC	0.443																																					p.G73W		Atlas-SNP	.											.	IKZF5	26	.	0			c.G217T						PASS	.						128.0	125.0	126.0					10																	124755609		1880	4108	5988	SO:0001583	missense	64376	exon4			CAAACCCGTCTAC	AF230808	CCDS41574.1	10q26	2011-05-31	2006-08-25	2006-08-25	ENSG00000095574	ENSG00000095574		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	14283	protein-coding gene	gene with protein product		606238	"""zinc finger protein, subfamily 1A, 5"", ""zinc finger protein, subfamily 1A, 5 (Pegasus)"""	ZNFN1A5		10978333	Standard	NM_001271840		Approved	Pegasus, FLJ22973	uc021qaj.2	Q9H5V7	OTTHUMG00000019192	ENST00000368886.5:c.217G>T	chr10.hg19:g.124755609C>A	ENSP00000357881:p.Gly73Trp	157.0	0.0	.		136.0	8.0	.	NM_001271840	B3KVH7|D3DRE7|Q9H2T0	Missense_Mutation	SNP	ENST00000368886.5	hg19	CCDS41574.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862844	0.91511	.	.	ENSG00000095574	ENST00000368886	T	0.07327	3.2	6.17	5.25	0.73442	.	0.046543	0.85682	N	0.000000	T	0.18257	0.0438	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.03641	-1.1017	10	0.66056	D	0.02	-6.9707	16.7418	0.85461	0.1302:0.8698:0.0:0.0	.	73	Q9H5V7	IKZF5_HUMAN	W	73	ENSP00000357881:G73W	ENSP00000357881:G73W	G	-	1	0	IKZF5	124745599	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	1.561000	0.49584	0.655000	0.94253	GGG	.	.	.	none		0.443	IKZF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050820.2	NM_022466	
MKI67	4288	hgsc.bcm.edu	37	10	129902189	129902189	+	Missense_Mutation	SNP	C	C	A	rs537885553	byFrequency	TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:129902189C>A	ENST00000368654.3	-	13	8290	c.7915G>T	c.(7915-7917)Ggt>Tgt	p.G2639C	MKI67_ENST00000368653.3_Missense_Mutation_p.G2279C	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2639	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCCTCATCACCGCTTGCTGGT	0.493																																					p.G2639C		Atlas-SNP	.											.	MKI67	363	.	0			c.G7915T						PASS	.						163.0	155.0	158.0					10																	129902189		2203	4300	6503	SO:0001583	missense	4288	exon13			CATCACCGCTTGC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7915G>T	chr10.hg19:g.129902189C>A	ENSP00000357643:p.Gly2639Cys	212.0	0.0	.		161.0	8.0	.	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.922972	0.33908	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02323	4.34;4.34	2.66	-2.89	0.05665	.	2.905960	0.01493	N	0.017166	T	0.05456	0.0144	L	0.27053	0.805	0.09310	N	1	D;P;P	0.63880	0.993;0.91;0.9	P;P;P	0.55112	0.769;0.473;0.673	T	0.31024	-0.9958	10	0.56958	D	0.05	.	7.7285	0.28773	0.0:0.3498:0.0:0.6502	.	2638;2279;2639	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	C	2639;2279;2638	ENSP00000357643:G2639C;ENSP00000357642:G2279C	ENSP00000357642:G2279C	G	-	1	0	MKI67	129792179	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.539000	0.06113	-0.797000	0.04450	-0.261000	0.10672	GGT	.	.	.	none		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
ZNF143	7702	hgsc.bcm.edu	37	11	9519250	9519250	+	Silent	SNP	T	T	G	rs373920789		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:9519250T>G	ENST00000396602.2	+	10	989	c.870T>G	c.(868-870)acT>acG	p.T290T	ZNF143_ENST00000396597.3_Silent_p.T259T|ZNF143_ENST00000396604.1_Silent_p.T289T|ZNF143_ENST00000530463.1_Silent_p.T289T|ZNF143_ENST00000299606.2_Silent_p.T262T	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	290					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ACGTCAGAACTCATACAGGAG	0.328																																					p.T290T		Atlas-SNP	.											.	ZNF143	38	.	0			c.T870G						PASS	.	T		3,4399	6.2+/-15.9	0,3,2198	65.0	66.0	66.0		870	2.7	1.0	11		66	0,8588		0,0,4294	no	coding-synonymous	ZNF143	NM_003442.5		0,3,6492	GG,GT,TT		0.0,0.0682,0.0231		290/639	9519250	3,12987	2201	4294	6495	SO:0001819	synonymous_variant	7702	exon10			CAGAACTCATACA	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.870T>G	chr11.hg19:g.9519250T>G		69.0	0.0	.		56.0	8.0	.	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Silent	SNP	ENST00000396602.2	hg19	CCDS7799.2																																																																																			.	.	.	weak		0.328	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
GIF	2694	hgsc.bcm.edu	37	11	59610049	59610049	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:59610049G>C	ENST00000257248.2	-	4	425	c.378C>G	c.(376-378)aaC>aaG	p.N126K	GIF_ENST00000541311.1_Missense_Mutation_p.N101K	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	126					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	ATGCTTCAGCGTTGGGGCCTC	0.522																																					p.N126K	NSCLC(53;1139 1245 16872 38474 42853)	Atlas-SNP	.											GIF,NS,adenocarcinoma,0,1	GIF	43	.	0			c.C378G						PASS	.						68.0	61.0	63.0					11																	59610049		2201	4295	6496	SO:0001583	missense	2694	exon4			TTCAGCGTTGGGG	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.378C>G	chr11.hg19:g.59610049G>C	ENSP00000257248:p.Asn126Lys	81.0	1.0	.		58.0	9.0	.	NM_005142	B2RAN8|B4DVZ1	Missense_Mutation	SNP	ENST00000257248.2	hg19	CCDS7977.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417564	0.25552	.	.	ENSG00000134812	ENST00000257248;ENST00000541311	T;T	0.35973	1.28;1.28	5.63	-11.3	0.00108	.	1.313500	0.04767	N	0.427342	T	0.21590	0.0520	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22208	-1.0223	10	0.48119	T	0.1	1.5143	8.9085	0.35539	0.1072:0.0807:0.5605:0.2515	.	126	P27352	IF_HUMAN	K	126;101	ENSP00000257248:N126K;ENSP00000440427:N101K	ENSP00000257248:N126K	N	-	3	2	GIF	59366625	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-3.689000	0.00392	-2.813000	0.00347	-2.048000	0.00412	AAC	.	.	.	none		0.522	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394497.1	NM_005142	
FADS1	3992	hgsc.bcm.edu	37	11	61578255	61578255	+	Missense_Mutation	SNP	A	A	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:61578255A>C	ENST00000350997.7	-	5	1115	c.883T>G	c.(883-885)Ttc>Gtc	p.F295V	FADS1_ENST00000433932.1_Missense_Mutation_p.F154V|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000542506.1_Missense_Mutation_p.F154V	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	238					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AAGGCAAAGAAGAAGGGATGC	0.567																																					p.F295V		Atlas-SNP	.											.	FADS1	19	.	0			c.T883G						PASS	.						137.0	150.0	145.0					11																	61578255		2112	4243	6355	SO:0001583	missense	3992	exon5			CAAAGAAGAAGGG		CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.883T>G	chr11.hg19:g.61578255A>C	ENSP00000322229:p.Phe295Val	218.0	0.0	.		146.0	26.0	.	NM_013402	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	ENST00000350997.7	hg19	CCDS8011.2	.	.	.	.	.	.	.	.	.	.	A	10.51	1.369315	0.24771	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000433932;ENST00000542506;ENST00000539999;ENST00000540767;ENST00000545245	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.06	2.75	0.32379	Fatty acid desaturase, type 1 (1);	0.000000	0.50627	U	0.000109	T	0.35248	0.0925	N	0.02973	-0.45	0.42328	D	0.992286	B	0.27192	0.171	B	0.27500	0.08	T	0.06770	-1.0808	10	0.25106	T	0.35	-29.7375	4.9109	0.13821	0.7052:0.0:0.1563:0.1385	.	238	O60427	FADS1_HUMAN	V	171;295;154;154;154;24;154;154	ENSP00000322229:F295V;ENSP00000405087:F154V;ENSP00000441403:F154V;ENSP00000443587:F24V;ENSP00000441871:F154V;ENSP00000442170:F154V	ENSP00000322229:F295V	F	-	1	0	FADS1	61334831	0.998000	0.40836	1.000000	0.80357	0.986000	0.74619	3.525000	0.53502	0.893000	0.36288	-0.250000	0.11733	TTC	.	.	.	none		0.567	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347648.2	NM_013402	
SLC22A8	9376	hgsc.bcm.edu	37	11	62760990	62760990	+	Missense_Mutation	SNP	C	C	A	rs374075913		TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr11:62760990C>A	ENST00000336232.2	-	10	1570	c.1435G>T	c.(1435-1437)Ggg>Tgg	p.G479W	SLC22A8_ENST00000545207.1_Missense_Mutation_p.G388W|SLC22A8_ENST00000535878.1_Missense_Mutation_p.G356W|SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000430500.2_Missense_Mutation_p.G479W|SLC22A8_ENST00000311438.8_Missense_Mutation_p.G479W	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	479				YGI -> FTGS (in Ref. 1; AAD19357). {ECO:0000305}.	glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GCGGTGATCCCGTAGATGATA	0.577																																					p.G479W		Atlas-SNP	.											.	SLC22A8	60	.	0			c.G1435T						PASS	.						98.0	94.0	96.0					11																	62760990		2201	4298	6499	SO:0001583	missense	9376	exon10			TGATCCCGTAGAT	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.1435G>T	chr11.hg19:g.62760990C>A	ENSP00000337335:p.Gly479Trp	137.0	0.0	.		130.0	8.0	.	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	hg19	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600516	0.66332	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11	5.9	4.99	0.66335	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.110148	0.64402	D	0.000009	D	0.82572	0.5066	H	0.96111	3.77	0.45452	D	0.998421	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87435	0.2391	10	0.87932	D	0	.	12.596	0.56470	0.0:0.9204:0.0:0.0796	.	479;479	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	W	479;465;388;356;479;479	ENSP00000337335:G479W;ENSP00000441658:G388W;ENSP00000443368:G356W;ENSP00000311463:G479W;ENSP00000398548:G479W	ENSP00000311463:G479W	G	-	1	0	SLC22A8	62517566	0.996000	0.38824	0.079000	0.20413	0.703000	0.40648	4.811000	0.62606	1.503000	0.48686	0.591000	0.81541	GGG	.	.	.	alt		0.577	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
STYK1	55359	hgsc.bcm.edu	37	12	10780290	10780290	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:10780290G>C	ENST00000075503.3	-	7	1187	c.667C>G	c.(667-669)Ctc>Gtc	p.L223V		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TTTTCTGTGAGATCATAGAGA	0.398										HNSCC(73;0.22)																											p.L223V		Atlas-SNP	.											.	STYK1	55	.	0			c.C667G						PASS	.						209.0	145.0	167.0					12																	10780290		2203	4300	6503	SO:0001583	missense	55359	exon7			CTGTGAGATCATA	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.667C>G	chr12.hg19:g.10780290G>C	ENSP00000075503:p.Leu223Val	57.0	0.0	.		77.0	24.0	.	NM_018423	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	ENST00000075503.3	hg19	CCDS8629.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.34|13.34	2.207320|2.207320	0.39003|0.39003	.|.	.|.	ENSG00000060140|ENSG00000060140	ENST00000542924|ENST00000075503	.|T	.|0.74106	.|-0.81	5.11|5.11	3.25|3.25	0.37280|0.37280	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.092391	.|0.47093	.|D	.|0.000250	T|T	0.73305|0.73305	0.3570|0.3570	L|L	0.56340|0.56340	1.77|1.77	0.40939|0.40939	D|D	0.984457|0.984457	.|B	.|0.22080	.|0.064	.|B	.|0.35727	.|0.209	T|T	0.72640|0.72640	-0.4232|-0.4232	5|10	.|0.87932	.|D	.|0	-6.5489|-6.5489	12.1571|12.1571	0.54083|0.54083	0.0:0.0:0.6901:0.3098|0.0:0.0:0.6901:0.3098	.|.	.|223	.|Q6J9G0	.|STYK1_HUMAN	M|V	66|223	.|ENSP00000075503:L223V	.|ENSP00000075503:L223V	I|L	-|-	3|1	3|0	STYK1|STYK1	10671557|10671557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.014000|2.014000	0.40951|0.40951	0.706000|0.706000	0.31912|0.31912	-0.181000|-0.181000	0.13052|0.13052	ATC|CTC	.	.	.	none		0.398	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19506893	19506893	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:19506893A>G	ENST00000299275.6	+	20	2603	c.2597A>G	c.(2596-2598)tAt>tGt	p.Y866C	PLEKHA5_ENST00000355397.3_Missense_Mutation_p.Y924C|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.Y924C|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.Y624C|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.Y855C|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.Y929C|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.Y1032C|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.Y810C|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.Y848C	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	866					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATAGCTTCCTATGTAACCTTG	0.368																																					p.Y1032C	Pancreas(196;329 2193 11246 14234 19524)	Atlas-SNP	.											.	PLEKHA5	198	.	0			c.A3095G						PASS	.						125.0	119.0	121.0					12																	19506893		2203	4300	6503	SO:0001583	missense	54477	exon26			CTTCCTATGTAAC	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2597A>G	chr12.hg19:g.19506893A>G	ENSP00000299275:p.Tyr866Cys	87.0	0.0	.		112.0	25.0	.	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	hg19	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845797	0.71603	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974;ENST00000538972	T;T;T;T;T;T;T;T;T;T;T	0.31247	2.93;2.93;1.5;2.93;2.93;2.93;2.93;2.93;2.93;2.93;1.5	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.80746	2.51	0.50813	D	0.999898	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.992;0.998;0.996;0.997;0.999;0.994;0.959;0.982	T	0.60105	-0.7328	10	0.41790	T	0.15	-12.8632	14.8567	0.70344	1.0:0.0:0.0:0.0	.	929;848;855;1027;810;1032;866;924	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;Q9HAU0-5;E9PHQ3;Q9HAU0;Q9HAU0-2	.;.;.;.;.;.;PKHA5_HUMAN;.	C	929;924;810;1028;1032;866;624;924;855;848;821;147	ENSP00000325155:Y929C;ENSP00000347560:Y924C;ENSP00000352104:Y810C;ENSP00000404296:Y1032C;ENSP00000299275:Y866C;ENSP00000440611:Y624C;ENSP00000439673:Y924C;ENSP00000400411:Y855C;ENSP00000439837:Y848C;ENSP00000440371:Y821C;ENSP00000443553:Y147C	ENSP00000299275:Y866C	Y	+	2	0	PLEKHA5	19398160	1.000000	0.71417	0.690000	0.30148	0.968000	0.65278	6.016000	0.70798	1.890000	0.54733	0.372000	0.22366	TAT	.	.	.	none		0.368	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
SLC38A4	55089	hgsc.bcm.edu	37	12	47178364	47178364	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:47178364T>A	ENST00000447411.1	-	6	660	c.454A>T	c.(454-456)Att>Ttt	p.I152F	SLC38A4_ENST00000266579.4_Missense_Mutation_p.I152F	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	152					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					AAAGCTCCAATTTTTCCCGGC	0.333																																					p.I152F		Atlas-SNP	.											.	SLC38A4	58	.	0			c.A454T						PASS	.						109.0	107.0	107.0					12																	47178364		2203	4300	6503	SO:0001583	missense	55089	exon6			CTCCAATTTTTCC	AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.454A>T	chr12.hg19:g.47178364T>A	ENSP00000389843:p.Ile152Phe	169.0	0.0	.		175.0	26.0	.	NM_001143824	A8K553	Missense_Mutation	SNP	ENST00000447411.1	hg19	CCDS8750.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.242201	0.39598	.	.	ENSG00000139209	ENST00000395426;ENST00000447411;ENST00000266579;ENST00000547477;ENST00000546940	T;T;T;T	0.02421	4.3;4.3;4.3;4.3	6.07	4.9	0.64082	.	0.311957	0.37906	N	0.001896	T	0.03053	0.0090	L	0.33624	1.015	0.50813	D	0.999895	B	0.09022	0.002	B	0.15870	0.014	T	0.50898	-0.8773	10	0.27785	T	0.31	-8.8755	11.1795	0.48620	0.2577:0.0:0.0:0.7423	.	152	Q969I6	S38A4_HUMAN	F	152	ENSP00000389843:I152F;ENSP00000266579:I152F;ENSP00000450071:I152F;ENSP00000448543:I152F	ENSP00000266579:I152F	I	-	1	0	SLC38A4	45464631	1.000000	0.71417	0.996000	0.52242	0.736000	0.42039	3.555000	0.53727	1.067000	0.40740	0.533000	0.62120	ATT	.	.	.	none		0.333	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404574.1		
EIF4B	1975	hgsc.bcm.edu	37	12	53416313	53416313	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:53416313G>C	ENST00000262056.9	+	6	895	c.569G>C	c.(568-570)cGg>cCg	p.R190P	EIF4B_ENST00000420463.3_Missense_Mutation_p.R190P|EIF4B_ENST00000416762.3_Missense_Mutation_p.R151P|RP11-983P16.4_ENST00000552905.1_RNA	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	190	Arg-rich.|Asp-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						GATAGAAATCGGGATTCTGAC	0.418																																					p.R190P		Atlas-SNP	.											.	EIF4B	38	.	0			c.G569C						PASS	.						133.0	112.0	119.0					12																	53416313		1863	4102	5965	SO:0001583	missense	1975	exon6			GAAATCGGGATTC	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.569G>C	chr12.hg19:g.53416313G>C	ENSP00000262056:p.Arg190Pro	105.0	0.0	.		114.0	16.0	.	NM_001417	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	ENST00000262056.9	hg19	CCDS41788.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124924	0.56613	.	.	ENSG00000063046	ENST00000262056;ENST00000551002;ENST00000420463;ENST00000430205;ENST00000416762;ENST00000552490	T;D;D;D;D	0.94232	0.54;-3.36;-3.36;-3.38;-3.36	3.59	2.7	0.31948	.	0.065726	0.53938	D	0.000044	D	0.87993	0.6318	L	0.27053	0.805	0.58432	D	0.999999	B;B;B	0.33807	0.426;0.301;0.301	B;B;B	0.36504	0.226;0.113;0.113	D	0.86321	0.1692	10	0.56958	D	0.05	.	10.7402	0.46149	0.0982:0.0:0.9018:0.0	.	151;190;190	B4DS13;E7EX17;P23588	.;.;IF4B_HUMAN	P	190;144;190;190;151;190	ENSP00000262056:R190P;ENSP00000447192:R144P;ENSP00000388806:R190P;ENSP00000412530:R151P;ENSP00000450324:R190P	ENSP00000262056:R190P	R	+	2	0	EIF4B	51702580	1.000000	0.71417	0.979000	0.43373	0.935000	0.57460	6.380000	0.73158	1.077000	0.40990	0.650000	0.86243	CGG	.	.	.	none		0.418	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417	
RAB5B	5869	hgsc.bcm.edu	37	12	56385887	56385887	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:56385887A>T	ENST00000360299.5	+	6	760	c.539A>T	c.(538-540)aAg>aTg	p.K180M	RAB5B_ENST00000448789.2_Missense_Mutation_p.K139M|RAB5B_ENST00000553116.1_Missense_Mutation_p.K180M	NM_002868.3	NP_002859.1	P61020	RAB5B_HUMAN	RAB5B, member RAS oncogene family	180					antigen processing and presentation (GO:0019882)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|liver(2)|lung(4)|upper_aerodigestive_tract(1)	9			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)			CTAGCTAAGAAGTTGCCAAAG	0.507																																					p.K180M		Atlas-SNP	.											.	RAB5B	22	.	0			c.A539T						PASS	.						59.0	60.0	60.0					12																	56385887		2203	4300	6503	SO:0001583	missense	5869	exon6			CTAAGAAGTTGCC		CCDS8900.1, CCDS58244.1	12q13	2008-07-30						"""RAB, member RAS oncogene"""	9784	protein-coding gene	gene with protein product		179514				1541686, 10403367	Standard	NM_001252037		Approved		uc001siw.3	P61020		ENST00000360299.5:c.539A>T	chr12.hg19:g.56385887A>T	ENSP00000353444:p.Lys180Met	86.0	0.0	.		105.0	35.0	.	NM_002868	A8K982|B4DKD7|P35239|P35277|Q6PIK9|Q86TH0|Q8IXL2	Missense_Mutation	SNP	ENST00000360299.5	hg19	CCDS8900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.65|16.65	3.183016|3.183016	0.57800|0.57800	.|.	.|.	ENSG00000111540|ENSG00000111540	ENST00000549218|ENST00000553116;ENST00000360299;ENST00000448789	.|T;T;T	.|0.80033	.|-1.17;-1.17;-1.33	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.080850	.|0.49916	.|D	.|0.000138	D|D	0.84710|0.84710	0.5532|0.5532	L|L	0.54863|0.54863	1.705|1.705	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;P	.|0.53619	.|0.961;0.55;0.911	.|P;P;P	.|0.57548	.|0.823;0.575;0.69	D|D	0.86486|0.86486	0.1794|0.1794	5|10	.|0.87932	.|D	.|0	-7.6032|-7.6032	14.1258|14.1258	0.65219|0.65219	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|139;180;180	.|B4DKD7;Q6FI54;P61020	.|.;.;RAB5B_HUMAN	D|M	99|180;180;139	.|ENSP00000450168:K180M;ENSP00000353444:K180M;ENSP00000391319:K139M	.|ENSP00000353444:K180M	E|K	+|+	3|2	2|0	RAB5B|RAB5B	54672154|54672154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.605000|5.605000	0.67634|0.67634	2.236000|2.236000	0.73375|0.73375	0.529000|0.529000	0.55759|0.55759	GAA|AAG	.	.	.	none		0.507	RAB5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405396.1		
BIVM	54841	hgsc.bcm.edu	37	13	103492131	103492131	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:103492131C>G	ENST00000257336.1	+	11	2107	c.1428C>G	c.(1426-1428)gaC>gaG	p.D476E	BIVM_ENST00000419638.1_3'UTR|BIVM_ENST00000448849.2_Missense_Mutation_p.D254E|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.L448V	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	476						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TCCATCAGGACTCGGCATGGA	0.468																																					p.D476E		Atlas-SNP	.											.	.	.	.	0			c.C1428G						PASS	.						154.0	144.0	147.0					13																	103492131		2203	4300	6503	SO:0001583	missense	0	exon9			TCAGGACTCGGCA	AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.1428C>G	chr13.hg19:g.103492131C>G	ENSP00000257336:p.Asp476Glu	153.0	0.0	.		164.0	30.0	.	NM_001204425	Q2M1J2|Q9NXM4	Missense_Mutation	SNP	ENST00000257336.1	hg19	CCDS9505.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.437445	0.01098	.	.	ENSG00000134897;ENSG00000134897;ENSG00000134899	ENST00000257336;ENST00000448849;ENST00000418659	.	.	.	5.4	-0.762	0.11034	.	0.188352	0.45606	D	0.000360	T	0.03651	0.0104	N	0.00347	-1.61	0.19300	N	0.999976	B;B;B	0.21606	0.0;0.058;0.005	B;B;B	0.17098	0.001;0.017;0.004	T	0.35624	-0.9781	9	0.02654	T	1	-13.3799	2.8027	0.05419	0.0935:0.3232:0.301:0.2823	.	254;447;476	Q86UB2-2;Q59FZ7;Q86UB2	.;.;BIVM_HUMAN	E	476;254;447	.	ENSP00000257336:D476E	D	+	3	2	ERCC5;BIVM	102290132	0.097000	0.21791	0.768000	0.31515	0.791000	0.44710	-0.250000	0.08830	-0.183000	0.10585	-1.255000	0.01485	GAC	.	.	.	none		0.468	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045704.2		
ANPEP	290	hgsc.bcm.edu	37	15	90349567	90349567	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr15:90349567T>C	ENST00000300060.6	-	2	561	c.248A>G	c.(247-249)gAt>gGt	p.D83G		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	83	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CCGGTAGGAATCGGGTTTCAG	0.617																																					p.D83G	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.A248G						PASS	.						126.0	102.0	110.0					15																	90349567		2200	4299	6499	SO:0001583	missense	290	exon2			TAGGAATCGGGTT	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.248A>G	chr15.hg19:g.90349567T>C	ENSP00000300060:p.Asp83Gly	137.0	0.0	.		85.0	18.0	.	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	hg19	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	T	6.216	0.408075	0.11754	.	.	ENSG00000166825	ENST00000300060	T	0.02631	4.22	4.74	0.264	0.15607	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	2.111890	0.01982	N	0.044922	T	0.06096	0.0158	M	0.73962	2.25	0.09310	N	1	B	0.26672	0.156	B	0.33121	0.158	T	0.46359	-0.9197	10	0.23891	T	0.37	.	4.6468	0.12575	0.3933:0.0958:0.0:0.5109	.	83	P15144	AMPN_HUMAN	G	83	ENSP00000300060:D83G	ENSP00000300060:D83G	D	-	2	0	ANPEP	88150571	0.000000	0.05858	0.011000	0.14972	0.152000	0.21847	0.560000	0.23500	0.163000	0.19507	0.383000	0.25322	GAT	.	.	.	none		0.617	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
SV2B	9899	hgsc.bcm.edu	37	15	91769497	91769497	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr15:91769497G>C	ENST00000394232.1	+	2	474	c.4G>C	c.(4-6)Gat>Cat	p.D2H	SV2B_ENST00000557291.1_Intron|SV2B_ENST00000545111.2_Intron|SV2B_ENST00000330276.4_Missense_Mutation_p.D2H	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	2					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CCAAGGAATGGATGACTACAA	0.478																																					p.D2H		Atlas-SNP	.											.	SV2B	98	.	0			c.G4C						PASS	.						72.0	58.0	63.0					15																	91769497		2198	4298	6496	SO:0001583	missense	9899	exon3			GGAATGGATGACT	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.4G>C	chr15.hg19:g.91769497G>C	ENSP00000377779:p.Asp2His	47.0	0.0	.		44.0	12.0	.	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	hg19	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469419	0.63625	.	.	ENSG00000185518	ENST00000394232;ENST00000330276	T;T	0.64803	-0.12;-0.12	5.71	4.79	0.61399	.	0.237482	0.42821	D	0.000651	T	0.65249	0.2673	M	0.68317	2.08	0.48830	D	0.999714	P	0.37015	0.578	B	0.41988	0.372	T	0.69007	-0.5259	10	0.72032	D	0.01	-15.0004	13.3113	0.60382	0.077:0.0:0.923:0.0	.	2	Q7L1I2	SV2B_HUMAN	H	2	ENSP00000377779:D2H;ENSP00000332818:D2H	ENSP00000332818:D2H	D	+	1	0	SV2B	89570501	1.000000	0.71417	0.999000	0.59377	0.874000	0.50279	7.523000	0.81856	1.411000	0.46957	0.563000	0.77884	GAT	.	.	.	none		0.478	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
RBBP6	5930	hgsc.bcm.edu	37	16	24582943	24582943	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr16:24582943G>C	ENST00000319715.4	+	18	4988	c.4556G>C	c.(4555-4557)aGa>aCa	p.R1519T	RBBP6_ENST00000381039.3_Missense_Mutation_p.R679T|RBBP6_ENST00000348022.2_Missense_Mutation_p.R1485T	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1519	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGGGAAGAGAGAGATTTGCCT	0.358																																					p.R1519T		Atlas-SNP	.											.	RBBP6	158	.	0			c.G4556C						PASS	.						40.0	39.0	39.0					16																	24582943		2197	4298	6495	SO:0001583	missense	5930	exon18			AAGAGAGAGATTT		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4556G>C	chr16.hg19:g.24582943G>C	ENSP00000317872:p.Arg1519Thr	42.0	0.0	.		45.0	8.0	.	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	hg19	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805084	0.50315	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.19105	2.17;2.4;2.41	6.03	1.9	0.25705	.	0.190657	0.41396	D	0.000897	T	0.12475	0.0303	L	0.27053	0.805	0.27887	N	0.939455	P;B;B	0.39480	0.675;0.241;0.155	B;B;B	0.35550	0.205;0.148;0.071	T	0.12502	-1.0545	10	0.30078	T	0.28	-17.338	10.6299	0.45530	0.2533:0.0:0.7467:0.0	.	679;1485;1519	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	T	679;1519;1485	ENSP00000370427:R679T;ENSP00000317872:R1519T;ENSP00000316291:R1485T	ENSP00000317872:R1519T	R	+	2	0	RBBP6	24490444	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.017000	0.49615	0.428000	0.26173	0.557000	0.71058	AGA	.	.	.	none		0.358	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53691402	53691402	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr16:53691402A>G	ENST00000379925.3	-	13	1594	c.1544T>C	c.(1543-1545)aTg>aCg	p.M515T	RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.M515T|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.M515T|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.M515T	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	515					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				CATAATTAGCATGTTTCTTGT	0.313																																					p.M515T		Atlas-SNP	.											.	RPGRIP1L	118	.	0			c.T1544C						PASS	.						88.0	81.0	83.0					16																	53691402		2196	4300	6496	SO:0001583	missense	23322	exon13			ATTAGCATGTTTC		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1544T>C	chr16.hg19:g.53691402A>G	ENSP00000369257:p.Met515Thr	57.0	0.0	.		89.0	17.0	.	NM_001127897	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	hg19	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138906	0.77775	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	T;D	0.81579	-0.02;-1.51	6.04	6.04	0.98038	.	0.099515	0.64402	D	0.000001	D	0.87834	0.6277	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.76494	0.972;0.972;0.972;0.999	P;P;P;D	0.68765	0.632;0.706;0.706;0.96	D	0.86184	0.1608	10	0.30078	T	0.28	-18.3503	14.8183	0.70052	1.0:0.0:0.0:0.0	.	515;515;515;515	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	T	515	ENSP00000369257:M515T;ENSP00000262135:M515T	ENSP00000262135:M515T	M	-	2	0	RPGRIP1L	52248903	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.353000	0.90077	2.317000	0.78254	0.460000	0.39030	ATG	.	.	.	none		0.313	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
CBX1	10951	hgsc.bcm.edu	37	17	46152378	46152378	+	Silent	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:46152378G>A	ENST00000393408.3	-	4	883	c.403C>T	c.(403-405)Ctg>Ttg	p.L135L	CBX1_ENST00000225603.4_Silent_p.L135L|CBX1_ENST00000495350.1_Silent_p.L135L	NM_006807.4	NP_006798.1	P83916	CBX1_HUMAN	chromobox homolog 1	135	Chromo 2; shadow subtype. {ECO:0000255|PROSITE-ProRule:PRU00053}.				negative regulation of transcription, DNA-templated (GO:0045892)	chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|pericentric heterochromatin (GO:0005721)|spindle (GO:0005819)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)			breast(1)|central_nervous_system(1)|kidney(1)|prostate(1)	4						CATTTCATCAGGAACATGAGC	0.483																																					p.L135L	NSCLC(136;694 2497 38792 39034)	Atlas-SNP	.											.	CBX1	18	.	0			c.C403T						PASS	.						137.0	138.0	138.0					17																	46152378		2203	4300	6503	SO:0001819	synonymous_variant	10951	exon4			TCATCAGGAACAT	U35451	CCDS11525.1	17q21.32	2010-07-06	2010-06-24		ENSG00000108468	ENSG00000108468			1551	protein-coding gene	gene with protein product	"""HP1 beta homolog (Drosophila )"""	604511	"""chromobox homolog 1 (Drosophila HP1 beta)"""			9169582	Standard	NM_001127228		Approved	HP1Hs-beta, M31, MOD1, CBX, HP1-BETA	uc002ind.4	P83916	OTTHUMG00000150417	ENST00000393408.3:c.403C>T	chr17.hg19:g.46152378G>A		273.0	0.0	.		268.0	62.0	.	NM_006807	P23197	Silent	SNP	ENST00000393408.3	hg19	CCDS11525.1																																																																																			.	.	.	none		0.483	CBX1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318016.1	NM_006807	
MTMR4	9110	hgsc.bcm.edu	37	17	56572475	56572475	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:56572475C>T	ENST00000323456.5	-	16	3152	c.3028G>A	c.(3028-3030)Gat>Aat	p.D1010N	MTMR4_ENST00000579925.1_Missense_Mutation_p.D953N	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1010					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCATCATCATCCAAATACAGA	0.512																																					p.D1010N		Atlas-SNP	.											.	MTMR4	91	.	0			c.G3028A						PASS	.						204.0	179.0	187.0					17																	56572475		2203	4300	6503	SO:0001583	missense	9110	exon16			CATCATCCAAATA	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.3028G>A	chr17.hg19:g.56572475C>T	ENSP00000325285:p.Asp1010Asn	205.0	0.0	.		214.0	58.0	.	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	hg19	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689025	0.88735	.	.	ENSG00000108389	ENST00000323456	D	0.96885	-4.16	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	L	0.58101	1.795	0.48452	D	0.999659	D	0.89917	1.0	D	0.85130	0.997	D	0.98181	1.0457	10	0.66056	D	0.02	.	18.5538	0.91075	0.0:1.0:0.0:0.0	.	1010	Q9NYA4	MTMR4_HUMAN	N	1010	ENSP00000325285:D1010N	ENSP00000325285:D1010N	D	-	1	0	MTMR4	53927474	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.104000	0.77024	2.627000	0.88993	0.555000	0.69702	GAT	.	.	.	none		0.512	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
CLTC	1213	hgsc.bcm.edu	37	17	57771125	57771125	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:57771125T>C	ENST00000269122.3	+	32	5214	c.4940T>C	c.(4939-4941)gTt>gCt	p.V1647A	CLTC_ENST00000579456.1_Missense_Mutation_p.V584A	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1647	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GGACCCAGTGTTGCCGTCCCT	0.557			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.V1647A		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.T4940C						PASS	.						144.0	116.0	125.0					17																	57771125		2203	4300	6503	SO:0001583	missense	1213	exon32			CCAGTGTTGCCGT	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4940T>C	chr17.hg19:g.57771125T>C	ENSP00000269122:p.Val1647Ala	151.0	0.0	.		144.0	55.0	.	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	hg19	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	T	12.39	1.923961	0.34002	.	.	ENSG00000141367	ENST00000269122	T	0.10668	2.85	6.08	6.08	0.98989	.	0.052581	0.85682	D	0.000000	T	0.07728	0.0194	N	0.14661	0.345	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.36212	-0.9757	10	0.14252	T	0.57	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	1647	Q00610	CLH1_HUMAN	A	1647	ENSP00000269122:V1647A	ENSP00000269122:V1647A	V	+	2	0	CLTC	55125907	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.162000	0.71874	2.333000	0.79357	0.533000	0.62120	GTT	.	.	.	none		0.557	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
ACE	1636	hgsc.bcm.edu	37	17	61570904	61570904	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:61570904G>T	ENST00000290866.4	+	20	3044	c.3020G>T	c.(3019-3021)aGg>aTg	p.R1007M	ACE_ENST00000428043.1_Missense_Mutation_p.R1007M|ACE_ENST00000413513.3_Missense_Mutation_p.R433M|ACE_ENST00000290863.6_Missense_Mutation_p.R433M|ACE_ENST00000421982.2_Missense_Mutation_p.R253M|ACE_ENST00000577647.1_Missense_Mutation_p.R433M|ACE_ENST00000490216.2_Missense_Mutation_p.R433M	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1007	Peptidase M2 2.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GTGGCCTTGAGGGAGGGTGCC	0.582																																					p.R1007M		Atlas-SNP	.											.	ACE	187	.	0			c.G3020T						PASS	.						80.0	74.0	76.0					17																	61570904		2203	4300	6503	SO:0001583	missense	1636	exon20			CCTTGAGGGAGGG	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3020G>T	chr17.hg19:g.61570904G>T	ENSP00000290866:p.Arg1007Met	86.0	0.0	.		87.0	18.0	.	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	hg19	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.618950	0.46736	.	.	ENSG00000159640	ENST00000290866;ENST00000428043;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.80628	0.4659	H	0.97340	3.985	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.999;1.0	D;D;D;D	0.97110	0.992;0.976;0.986;1.0	D	0.88380	0.3001	10	0.87932	D	0	-34.8796	18.0898	0.89471	0.0:0.0:1.0:0.0	.	253;433;433;1007	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	M	1007;1007;433;433;253	ENSP00000290866:R1007M;ENSP00000397593:R1007M;ENSP00000290863:R433M;ENSP00000392247:R433M;ENSP00000387760:R253M	ENSP00000290863:R433M	R	+	2	0	ACE	58924636	1.000000	0.71417	0.966000	0.40874	0.792000	0.44763	7.975000	0.88055	2.262000	0.75019	0.561000	0.74099	AGG	.	.	.	none		0.582	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
GRB2	2885	hgsc.bcm.edu	37	17	73316567	73316567	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:73316567C>A	ENST00000392562.1	-	6	1318	c.536G>T	c.(535-537)cGg>cTg	p.R179L	GRB2_ENST00000316615.5_Missense_Mutation_p.R138L|GRB2_ENST00000392564.1_Missense_Mutation_p.R179L|GRB2_ENST00000578961.1_Missense_Mutation_p.G123W|GRB2_ENST00000316804.5_Missense_Mutation_p.R179L|GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000392563.1_Missense_Mutation_p.R138L			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	179	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.R179L(1)		breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AAAATCTCCCCGGCGGAAGCC	0.557																																					p.R179L		Atlas-SNP	.											.	GRB2	33	.	1	Substitution - Missense(1)	lung(1)	c.G536T						PASS	.						84.0	92.0	89.0					17																	73316567		2203	4300	6503	SO:0001583	missense	2885	exon6			TCTCCCCGGCGGA		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.536G>T	chr17.hg19:g.73316567C>A	ENSP00000376345:p.Arg179Leu	266.0	0.0	.		223.0	10.0	.	NM_002086	P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	hg19	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	C	35	5.427609	0.96131	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564;ENST00000392563;ENST00000316615	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.45	5.45	0.79879	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.71879	0.3392	M	0.83953	2.67	0.80722	D	1	D;D	0.76494	0.999;0.964	D;P	0.69307	0.963;0.895	T	0.73357	-0.4008	10	0.52906	T	0.07	-32.5557	19.4688	0.94954	0.0:1.0:0.0:0.0	.	138;179	P62993-2;P62993	.;GRB2_HUMAN	L	179;179;179;138;138	ENSP00000339007:R179L;ENSP00000376345:R179L;ENSP00000376347:R179L;ENSP00000376346:R138L;ENSP00000317360:R138L	ENSP00000317360:R138L	R	-	2	0	GRB2	70828162	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.921000	0.70028	2.838000	0.97847	0.561000	0.74099	CGG	.	.	.	none		0.557	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1		
DYM	54808	hgsc.bcm.edu	37	18	46956680	46956680	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr18:46956680T>G	ENST00000269445.6	-	2	542	c.85A>C	c.(85-87)Aat>Cat	p.N29H	DYM_ENST00000442713.2_Missense_Mutation_p.N29H|DYM_ENST00000584977.1_5'UTR|RP11-110H1.9_ENST00000583579.1_RNA	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	29					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						AACGGGTCATTCTCAGAGATA	0.423																																					p.N29H		Atlas-SNP	.											.	DYM	52	.	0			c.A85C						PASS	.						147.0	146.0	146.0					18																	46956680		2203	4300	6503	SO:0001583	missense	54808	exon2			GGTCATTCTCAGA	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.85A>C	chr18.hg19:g.46956680T>G	ENSP00000269445:p.Asn29His	169.0	0.0	.		171.0	29.0	.	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	hg19	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.571437	0.45798	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	D;D	0.82893	-1.66;-1.66	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.90841	0.7123	M	0.78801	2.425	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.991;0.983	D	0.91823	0.5469	10	0.87932	D	0	-23.1803	15.1469	0.72662	0.0:0.0:0.0:1.0	.	29;29	Q7RTS9-2;Q7RTS9	.;DYM_HUMAN	H	29	ENSP00000395942:N29H;ENSP00000269445:N29H	ENSP00000269445:N29H	N	-	1	0	DYM	45210678	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.007000	0.76335	2.371000	0.80710	0.533000	0.62120	AAT	.	.	.	none		0.423	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
MYO1F	4542	hgsc.bcm.edu	37	19	8616967	8616967	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:8616967G>T	ENST00000338257.8	-	7	853	c.586C>A	c.(586-588)Cgc>Agc	p.R196S	AC092316.1_ENST00000598703.1_RNA	NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	196	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R196S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						ATGACCACGCGGGACTTCTCC	0.572																																					p.R196S		Atlas-SNP	.											MYO1F,colon,carcinoma,0,1	MYO1F	128	.	1	Substitution - Missense(1)	kidney(1)	c.C586A						PASS	.						92.0	93.0	93.0					19																	8616967		1977	4198	6175	SO:0001583	missense	4542	exon7			CCACGCGGGACTT	X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.586C>A	chr19.hg19:g.8616967G>T	ENSP00000344871:p.Arg196Ser	188.0	0.0	.		125.0	7.0	.	NM_012335	Q8WWN7	Missense_Mutation	SNP	ENST00000338257.8	hg19	CCDS42494.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461130	0.63513	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.96885	-4.16	3.93	2.82	0.32997	Myosin head, motor domain (2);	0.000000	0.64402	D	0.000001	D	0.98865	0.9616	H	0.99336	4.52	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.993;0.993	D	0.98183	1.0458	10	0.87932	D	0	.	12.9806	0.58562	0.0:0.0:0.827:0.173	.	196;196;196	B4DVP3;B0I1T1;O00160	.;.;MYO1F_HUMAN	S	241;196	ENSP00000344871:R196S	ENSP00000304899:R241S	R	-	1	0	MYO1F	8522967	0.996000	0.38824	0.995000	0.50966	0.987000	0.75469	2.332000	0.43903	2.048000	0.60808	0.460000	0.39030	CGC	.	.	.	none		0.572	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342716.2		
ZNF699	374879	hgsc.bcm.edu	37	19	9406673	9406673	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:9406673G>C	ENST00000591998.1	-	6	1635	c.1407C>G	c.(1405-1407)caC>caG	p.H469Q	ZNF699_ENST00000308650.3_Missense_Mutation_p.H469Q|CTC-325H20.4_ENST00000591336.1_RNA			Q32M78	ZN699_HUMAN	zinc finger protein 699	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTTTCCAGTGTGATCTCTCA	0.458																																					p.H469Q		Atlas-SNP	.											.	ZNF699	67	.	0			c.C1407G						PASS	.						60.0	64.0	63.0					19																	9406673		2200	4296	6496	SO:0001583	missense	374879	exon5			TCCAGTGTGATCT	BC109268	CCDS42495.1	19p13.2	2013-01-08				ENSG00000196110		"""Zinc fingers, C2H2-type"", ""-"""	24750	protein-coding gene	gene with protein product	hangover homolog (Drosophila)	609571				16940975	Standard	NM_198535		Approved	FLJ38144, hang	uc002mlc.1	Q32M78		ENST00000591998.1:c.1407C>G	chr19.hg19:g.9406673G>C	ENSP00000467723:p.His469Gln	57.0	0.0	.		55.0	8.0	.	NM_198535	Q8N9A1	Missense_Mutation	SNP	ENST00000591998.1	hg19	CCDS42495.1	.	.	.	.	.	.	.	.	.	.	g	13.65	2.301105	0.40694	.	.	ENSG00000196110	ENST00000308650	T	0.66995	-0.24	3.28	-0.0525	0.13822	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39407	N	0.001377	T	0.80008	0.4545	M	0.90425	3.115	0.24473	N	0.994389	D	0.71674	0.998	D	0.75484	0.986	T	0.68796	-0.5314	10	0.87932	D	0	.	5.9659	0.19325	0.4949:0.0:0.5051:0.0	.	469	Q32M78	ZN699_HUMAN	Q	469	ENSP00000311596:H469Q	ENSP00000311596:H469Q	H	-	3	2	ZNF699	9267673	0.909000	0.30893	0.019000	0.16419	0.771000	0.43674	0.275000	0.18698	0.085000	0.17107	0.550000	0.68814	CAC	.	.	.	none		0.458	ZNF699-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449010.1	NM_198535	
ATG4D	84971	hgsc.bcm.edu	37	19	10655668	10655668	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:10655668C>A	ENST00000309469.4	+	3	528	c.355C>A	c.(355-357)Cgc>Agc	p.R119S	ATG4D_ENST00000540862.1_5'Flank	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	119					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CTTTGTGTCCCGCCTGTGGCT	0.657																																					p.R119S		Atlas-SNP	.											.	ATG4D	47	.	0			c.C355A						PASS	.						87.0	97.0	94.0					19																	10655668		2203	4300	6503	SO:0001583	missense	84971	exon3			GTGTCCCGCCTGT	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.355C>A	chr19.hg19:g.10655668C>A	ENSP00000311318:p.Arg119Ser	290.0	0.0	.		177.0	9.0	.	NM_032885	Q969K0	Missense_Mutation	SNP	ENST00000309469.4	hg19	CCDS12241.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.686824	0.48097	.	.	ENSG00000130734	ENST00000309469	T	0.48201	0.82	5.06	2.88	0.33553	.	0.292459	0.30538	N	0.009414	T	0.70561	0.3238	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.77557	0.988;0.974;0.99	T	0.70676	-0.4806	10	0.72032	D	0.01	7.4899	6.9005	0.24281	0.3089:0.6081:0.0:0.0831	.	56;142;119	B4DGM8;B7ZAY9;Q86TL0	.;.;ATG4D_HUMAN	S	119	ENSP00000311318:R119S	ENSP00000311318:R119S	R	+	1	0	ATG4D	10516668	0.661000	0.27430	0.758000	0.31321	0.002000	0.02628	1.319000	0.33655	0.503000	0.28060	-0.196000	0.12772	CGC	.	.	.	none		0.657	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
UNC13A	23025	hgsc.bcm.edu	37	19	17763482	17763482	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:17763482C>A	ENST00000519716.2	-	12	1396	c.1397G>T	c.(1396-1398)cGg>cTg	p.R466L	UNC13A_ENST00000551649.1_Missense_Mutation_p.R466L|UNC13A_ENST00000428389.2_Missense_Mutation_p.R554L|UNC13A_ENST00000252773.7_Missense_Mutation_p.R466L|UNC13A_ENST00000550896.1_Missense_Mutation_p.R466L|UNC13A_ENST00000552293.1_Missense_Mutation_p.R466L	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	466					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TCCTTCTCCCCGGGCCTGCAG	0.572																																					p.R466L		Atlas-SNP	.											.	UNC13A	299	.	0			c.G1397T						PASS	.						220.0	223.0	222.0					19																	17763482		1949	4140	6089	SO:0001583	missense	23025	exon12			TCTCCCCGGGCCT	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1397G>T	chr19.hg19:g.17763482C>A	ENSP00000429562:p.Arg466Leu	473.0	0.0	.		363.0	16.0	.	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	C	10.57	1.385968	0.25031	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.80994	-1.43;-1.44;-1.43;-1.29;-1.3;-1.43	4.06	4.06	0.47325	.	0.640937	0.11863	U	0.522146	T	0.69682	0.3138	N	0.24115	0.695	0.35688	D	0.814642	B	0.09022	0.002	B	0.09377	0.004	T	0.67213	-0.5727	10	0.27082	T	0.32	-3.9885	13.7484	0.62890	0.0:1.0:0.0:0.0	.	466	Q9UPW8	UN13A_HUMAN	L	466;554;466;466;466;466	ENSP00000429562:R466L;ENSP00000400409:R554L;ENSP00000252773:R466L;ENSP00000447236:R466L;ENSP00000447572:R466L;ENSP00000446831:R466L	ENSP00000252773:R466L	R	-	2	0	UNC13A	17624482	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	2.345000	0.44018	2.103000	0.63969	0.491000	0.48974	CGG	.	.	.	none		0.572	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
PIK3R2	5296	hgsc.bcm.edu	37	19	18274091	18274091	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:18274091G>A	ENST00000593731.1	+	11	1869	c.1309G>A	c.(1309-1311)Gac>Aac	p.D437N	PIK3R2_ENST00000222254.8_Missense_Mutation_p.D437N			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	437					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	TGTCAAGGAGGACAGCGTGGA	0.577																																					p.D437N		Atlas-SNP	.											.	PIK3R2	48	.	0			c.G1309A						PASS	.						125.0	107.0	113.0					19																	18274091		2203	4300	6503	SO:0001583	missense	5296	exon11			AAGGAGGACAGCG		CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1309G>A	chr19.hg19:g.18274091G>A	ENSP00000471914:p.Asp437Asn	135.0	0.0	.		75.0	13.0	.	NM_005027	Q5EAT5|Q9UPH9	Missense_Mutation	SNP	ENST00000593731.1	hg19	CCDS12371.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.719551	0.48728	.	.	ENSG00000105647	ENST00000222254	T	0.47869	0.83	4.08	4.08	0.47627	.	0.102115	0.64402	D	0.000002	T	0.40171	0.1106	L	0.43152	1.355	0.42153	D	0.991565	B	0.19583	0.037	B	0.15052	0.012	T	0.38950	-0.9637	10	0.52906	T	0.07	-47.255	12.9549	0.58421	0.0:0.0:0.8377:0.1623	.	437	O00459	P85B_HUMAN	N	437	ENSP00000222254:D437N	ENSP00000222254:D437N	D	+	1	0	PIK3R2	18135091	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.262000	0.65501	2.216000	0.71823	0.561000	0.74099	GAC	.	.	.	none		0.577	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000466386.2	NM_005027	
ZNF85	7639	hgsc.bcm.edu	37	19	21132138	21132138	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:21132138T>C	ENST00000328178.8	+	4	931	c.818T>C	c.(817-819)cTt>cCt	p.L273P	ZNF85_ENST00000345030.6_Missense_Mutation_p.L240P|ZNF85_ENST00000601023.1_Missense_Mutation_p.L214P	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	273					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TTCTCAACTCTTACTACCCAT	0.348																																					p.L303P		Atlas-SNP	.											.	ZNF85	72	.	0			c.T908C						PASS	.						26.0	29.0	28.0					19																	21132138		2193	4286	6479	SO:0001583	missense	7639	exon5			CAACTCTTACTAC	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.818T>C	chr19.hg19:g.21132138T>C	ENSP00000329793:p.Leu273Pro	59.0	0.0	.		32.0	4.0	.	NM_001256171	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	hg19	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	11.50	1.657272	0.29425	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.53857	0.6;0.6	1.35	1.35	0.21983	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.76263	0.3963	H	0.94620	3.56	0.25920	N	0.983126	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.63350	-0.6657	9	0.87932	D	0	.	7.5498	0.27790	0.0:0.0:0.0:1.0	.	240;214;273	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	P	273;240;148	ENSP00000329793:L273P;ENSP00000342340:L240P	ENSP00000329793:L273P	L	+	2	0	ZNF85	20923978	0.117000	0.22190	0.004000	0.12327	0.013000	0.08279	2.803000	0.47924	0.569000	0.29329	0.379000	0.24179	CTT	.	.	.	none		0.348	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
SUPT5H	6829	hgsc.bcm.edu	37	19	39964723	39964723	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:39964723C>A	ENST00000599117.1	+	27	2980	c.2613C>A	c.(2611-2613)aaC>aaA	p.N871K	SUPT5H_ENST00000359191.6_Missense_Mutation_p.N867K|SUPT5H_ENST00000402194.2_Missense_Mutation_p.N867K|SUPT5H_ENST00000432763.2_Missense_Mutation_p.N871K|SUPT5H_ENST00000598725.1_Missense_Mutation_p.N871K			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	871	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|Pro-rich.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CACAGGTCAACCCACAATACA	0.647											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N871K		Atlas-SNP	.											.	SUPT5H	119	.	0			c.C2613A						PASS	.						84.0	89.0	87.0					19																	39964723		2203	4300	6503	SO:0001583	missense	6829	exon25			GGTCAACCCACAA	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.2613C>A	chr19.hg19:g.39964723C>A	ENSP00000470252:p.Asn871Lys	121.0	0.0	.	889	66.0	11.0	.	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	hg19	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910409	0.52439	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.36	3.19	0.36642	.	0.043680	0.85682	D	0.000000	T	0.51652	0.1687	L	0.53249	1.67	0.58432	D	0.999995	B;B;B	0.34200	0.367;0.387;0.441	B;B;B	0.37550	0.253;0.131;0.206	T	0.48736	-0.9009	8	.	.	.	-34.0435	10.5839	0.45271	0.0:0.8333:0.0:0.1667	.	663;867;871	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	K	871;867;849;871	.	.	N	+	3	2	SUPT5H	44656563	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	2.352000	0.44080	1.235000	0.43724	0.462000	0.41574	AAC	.	.	.	none		0.647	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
ZNF223	7766	hgsc.bcm.edu	37	19	44570872	44570872	+	Silent	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:44570872C>T	ENST00000434772.3	+	5	1146	c.891C>T	c.(889-891)ttC>ttT	p.F297F	ZNF223_ENST00000591793.1_Silent_p.F407F	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223	297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				GTGTGAGCTTCCGTCTTAGGT	0.448																																					p.F297F		Atlas-SNP	.											.	ZNF223	61	.	0			c.C891T						PASS	.						131.0	126.0	128.0					19																	44570872		2203	4300	6503	SO:0001819	synonymous_variant	7766	exon5			GAGCTTCCGTCTT	AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.891C>T	chr19.hg19:g.44570872C>T		148.0	0.0	.		107.0	15.0	.	NM_013361	Q15736|Q8TBJ3|Q9HCA9	Silent	SNP	ENST00000434772.3	hg19	CCDS12635.1																																																																																			.	.	.	none		0.448	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460469.2		
FCGRT	2217	hgsc.bcm.edu	37	19	50017313	50017313	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:50017313A>G	ENST00000221466.5	+	3	734	c.248A>G	c.(247-249)tAt>tGt	p.Y83C	FCGRT_ENST00000596975.1_Missense_Mutation_p.Y83C|FCGRT_ENST00000426395.3_Missense_Mutation_p.Y83C|FCGRT_ENST00000599988.1_Intron|FCGRT_ENST00000594823.1_3'UTR	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	83	Alpha-1.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		GTGTCCTGGTATTGGGAGAAA	0.582																																					p.Y83C		Atlas-SNP	.											.	FCGRT	23	.	0			c.A248G						PASS	.						41.0	47.0	45.0					19																	50017313		2203	4300	6503	SO:0001583	missense	2217	exon3			CCTGGTATTGGGA	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.248A>G	chr19.hg19:g.50017313A>G	ENSP00000221466:p.Tyr83Cys	63.0	0.0	.		49.0	19.0	.	NM_001136019	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	hg19	CCDS12770.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.150611	0.57151	.	.	ENSG00000104870	ENST00000221466;ENST00000426395;ENST00000415900;ENST00000452439	T;T	0.01185	5.21;5.21	4.83	2.61	0.31194	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.374848	0.19651	N	0.109214	T	0.07369	0.0186	M	0.93197	3.39	0.41878	D	0.990305	D	0.89917	1.0	D	0.83275	0.996	T	0.00662	-1.1621	10	0.87932	D	0	.	3.4456	0.07480	0.6789:0.0:0.1082:0.2129	.	83	P55899	FCGRN_HUMAN	C	83	ENSP00000221466:Y83C;ENSP00000410798:Y83C	ENSP00000221466:Y83C	Y	+	2	0	FCGRT	54709125	0.976000	0.34144	0.999000	0.59377	0.876000	0.50452	2.603000	0.46266	0.868000	0.35678	0.459000	0.35465	TAT	.	.	.	none		0.582	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
ZNF473	25888	hgsc.bcm.edu	37	19	50549983	50549983	+	Missense_Mutation	SNP	G	G	C			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:50549983G>C	ENST00000595661.1	+	6	2778	c.2283G>C	c.(2281-2283)caG>caC	p.Q761H	ZNF473_ENST00000391821.2_Missense_Mutation_p.Q761H|ZNF473_ENST00000445728.3_Missense_Mutation_p.Q749H|ZNF473_ENST00000270617.3_Missense_Mutation_p.Q761H|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599410.1_RNA			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	761					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		ATGTTTGTCAGGAATGCGGGA	0.522											OREG0025632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q761H		Atlas-SNP	.											.	ZNF473	86	.	0			c.G2283C						PASS	.						80.0	80.0	80.0					19																	50549983		2203	4300	6503	SO:0001583	missense	25888	exon5			TTGTCAGGAATGC	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.2283G>C	chr19.hg19:g.50549983G>C	ENSP00000472808:p.Gln761His	136.0	0.0	.	970	111.0	26.0	.	NM_015428	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	hg19	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247320	0.39697	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.07800	3.16;3.16;3.16	3.84	1.72	0.24424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.611213	0.13601	N	0.375867	T	0.07007	0.0178	N	0.02916	-0.46	0.25928	N	0.983026	D	0.61080	0.989	P	0.60173	0.87	T	0.30446	-0.9978	10	0.44086	T	0.13	-0.3948	5.7557	0.18172	0.3335:0.0:0.6665:0.0	.	761	Q8WTR7	ZN473_HUMAN	H	761;761;749	ENSP00000270617:Q761H;ENSP00000375697:Q761H;ENSP00000388961:Q749H	ENSP00000270617:Q761H	Q	+	3	2	ZNF473	55241795	0.000000	0.05858	0.978000	0.43139	0.764000	0.43329	-1.663000	0.01968	0.603000	0.29913	0.650000	0.86243	CAG	.	.	.	none		0.522	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
TTYH1	57348	hgsc.bcm.edu	37	19	54937848	54937848	+	Splice_Site	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:54937848A>G	ENST00000376530.3	+	5	741		c.e5-1		TTYH1_ENST00000391739.3_Splice_Site|TTYH1_ENST00000301194.4_Splice_Site|TTYH1_ENST00000489425.1_Splice_Site|TTYH1_ENST00000376531.3_Splice_Site	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1						cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)	p.?(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		CTCCCCTCCCAGGTGGCTGGC	0.652																																					.		Atlas-SNP	.											TTYH1,larynx,carcinoma,0,1	TTYH1	78	.	1	Unknown(1)	upper_aerodigestive_tract(1)	c.639-2A>G						PASS	.						96.0	79.0	85.0					19																	54937848		2203	4300	6503	SO:0001630	splice_region_variant	57348	exon5			CCTCCCAGGTGGC	AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.639-1A>G	chr19.hg19:g.54937848A>G		162.0	1.0	.		116.0	21.0	.	NM_001005367	B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Splice_Site	SNP	ENST00000376530.3	hg19	CCDS12893.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.478123	0.63849	.	.	ENSG00000167614	ENST00000301194;ENST00000376530;ENST00000445095;ENST00000391739;ENST00000376531	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2014	0.54328	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTYH1	59629660	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.433000	0.59929	1.836000	0.53414	0.459000	0.35465	.	.	.	.	none		0.652	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140498.1		Intron
KIR3DL1	3811	hgsc.bcm.edu	37	19	55324637	55324637	+	Intron	SNP	C	C	T			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr19:55324637C>T	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000396293.1_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000345540.5_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.T253I|KIR2DL4_ENST00000357494.4_Intron|KIR2DL4_ENST00000346587.4_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.T255I			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ATCCTCTTTACCATCCTTCCC	0.502																																					p.T255I		Atlas-SNP	.											.	KIR2DL4	62	.	0			c.C764T						PASS	.						120.0	185.0	164.0					19																	55324637		2009	4160	6169	SO:0001627	intron_variant	3805	exon6			TCTTTACCATCCT	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-4352C>T	chr19.hg19:g.55324637C>T		57.0	0.0	.		63.0	25.0	.	NM_001080772	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	hg19		.	.	.	.	.	.	.	.	.	.	c	0	-2.781565	0.00079	.	.	ENSG00000189013	ENST00000396284;ENST00000359085;ENST00000396289	T;T;T	0.00454	7.39;7.32;7.4	0.569	-1.14	0.09741	.	6.239890	0.01410	N	0.013962	T	0.00271	0.0008	N	0.25060	0.705	0.09310	N	1	B;B;B	0.16802	0.019;0.0;0.001	B;B;B	0.23852	0.049;0.002;0.016	T	0.46596	-0.9180	9	0.28530	T	0.3	.	.	.	.	.	255;253;238	Q99706;E7EST5;Q99706-2	KI2L4_HUMAN;.;.	I	253;255;253	ENSP00000379580:T253I;ENSP00000351988:T255I;ENSP00000379584:T253I	ENSP00000351988:T255I	T	+	2	0	KIR2DL4	60016449	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.795000	0.00764	-1.106000	0.03008	-1.140000	0.01884	ACC	.	.	.	none		0.502	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
STAU1	6780	hgsc.bcm.edu	37	20	47741019	47741019	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr20:47741019T>A	ENST00000371856.2	-	7	1125	c.715A>T	c.(715-717)Aaa>Taa	p.K239*	STAU1_ENST00000347458.5_Nonsense_Mutation_p.K158*|STAU1_ENST00000371792.1_Nonsense_Mutation_p.K158*|STAU1_ENST00000371802.1_Nonsense_Mutation_p.K164*|STAU1_ENST00000360426.4_Nonsense_Mutation_p.K158*|STAU1_ENST00000340954.7_Nonsense_Mutation_p.K158*|STAU1_ENST00000371828.3_Nonsense_Mutation_p.K164*	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	239	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			GCGGCATTTTTCTTTGAAATC	0.483																																					p.K239X		Atlas-SNP	.											.	STAU1	54	.	0			c.A715T						PASS	.						150.0	167.0	161.0					20																	47741019		2203	4300	6503	SO:0001587	stop_gained	6780	exon7			CATTTTTCTTTGA		CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.715A>T	chr20.hg19:g.47741019T>A	ENSP00000360922:p.Lys239*	248.0	0.0	.		268.0	78.0	.	NM_017453	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Nonsense_Mutation	SNP	ENST00000371856.2	hg19	CCDS13414.1	.	.	.	.	.	.	.	.	.	.	T	39	7.406203	0.98265	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404	.	.	.	5.33	5.33	0.75918	.	0.087311	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.3231	15.3236	0.74141	0.0:0.0:0.0:1.0	.	.	.	.	X	164;158;239;158;158;158;164;158;164	.	ENSP00000345425:K158X	K	-	1	0	STAU1	47174426	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.036000	0.88901	2.017000	0.59298	0.528000	0.53228	AAA	.	.	.	none		0.483	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453	
DSCAM	1826	hgsc.bcm.edu	37	21	41496202	41496202	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr21:41496202A>G	ENST00000400454.1	-	20	4093	c.3616T>C	c.(3616-3618)Ttt>Ctt	p.F1206L		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1206	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CAGGACACAAAGACCATGGAG	0.562																																					p.F1206L	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.T3616C						PASS	.						103.0	116.0	112.0					21																	41496202		2044	4179	6223	SO:0001583	missense	1826	exon20			ACACAAAGACCAT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3616T>C	chr21.hg19:g.41496202A>G	ENSP00000383303:p.Phe1206Leu	207.0	0.0	.		163.0	26.0	.	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	A	9.620	1.133520	0.21041	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.55413	0.52;0.52	5.2	4.05	0.47172	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.054089	0.85682	D	0.000000	T	0.26085	0.0636	N	0.02830	-0.485	0.37429	D	0.913953	P	0.35192	0.489	B	0.39379	0.298	T	0.32322	-0.9911	10	0.02654	T	1	.	10.7978	0.46470	0.9249:0.0:0.0751:0.0	.	1206	O60469	DSCAM_HUMAN	L	1206;958	ENSP00000383303:F1206L;ENSP00000385342:F958L	ENSP00000383303:F1206L	F	-	1	0	DSCAM	40418072	1.000000	0.71417	0.998000	0.56505	0.602000	0.36980	5.892000	0.69790	0.805000	0.34159	-0.371000	0.07208	TTT	.	.	.	none		0.562	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
HDHD1	8226	hgsc.bcm.edu	37	X	7023838	7023838	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chrX:7023838T>G	ENST00000381077.5	-	2	179	c.103A>C	c.(103-105)Aat>Cat	p.N35H	HDHD1_ENST00000498474.2_5'UTR|HDHD1_ENST00000424830.2_Missense_Mutation_p.N58H|HDHD1_ENST00000412827.2_Missense_Mutation_p.N35H|HDHD1_ENST00000540122.1_Missense_Mutation_p.N35H	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	35					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						TCATAGCGATTACATATTTCT	0.393																																					p.N58H		Atlas-SNP	.											.	HDHD1	21	.	0			c.A172C						PASS	.						55.0	46.0	49.0					X																	7023838		1847	4082	5929	SO:0001583	missense	8226	exon3			AGCGATTACATAT	M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.103A>C	chrX.hg19:g.7023838T>G	ENSP00000370467:p.Asn35His	34.0	0.0	.		33.0	12.0	.	NM_001135565	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Missense_Mutation	SNP	ENST00000381077.5	hg19	CCDS48075.1	.	.	.	.	.	.	.	.	.	.	c	7.623	0.677318	0.14841	.	.	ENSG00000130021	ENST00000381077;ENST00000544385;ENST00000412827;ENST00000424830;ENST00000540122;ENST00000486446	T;T;T;T;T	0.30714	3.42;1.52;3.42;3.42;3.42	4.01	4.01	0.46588	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.660693	0.15594	N	0.254263	T	0.23766	0.0575	N	0.21282	0.65	0.09310	N	1	D;B;P;B;B	0.53745	0.962;0.346;0.711;0.045;0.136	B;B;P;B;B	0.46419	0.4;0.382;0.516;0.057;0.201	T	0.05500	-1.0881	10	0.45353	T	0.12	-18.7046	7.1959	0.25853	0.0:0.7837:0.0:0.2163	.	35;35;58;35;35	Q08623-3;Q08623-2;E9PAV8;E7EVH9;Q08623	.;.;.;.;HDHD1_HUMAN	H	35;51;35;58;35;35	ENSP00000370467:N35H;ENSP00000406260:N35H;ENSP00000396452:N58H;ENSP00000441208:N35H;ENSP00000430995:N35H	ENSP00000370467:N35H	N	-	1	0	HDHD1	7033838	0.177000	0.23109	0.002000	0.10522	0.370000	0.29829	0.823000	0.27366	0.559000	0.29153	-0.177000	0.13119	AAT	.	.	.	none		0.393	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2	NM_012080	
ZFP37	7539	hgsc.bcm.edu	37	9	115806495	115806495	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr9:115806495delG	ENST00000374227.3	-	4	430	c.403delC	c.(403-405)ctcfs	p.L136fs	ZFP37_ENST00000553380.1_Frame_Shift_Del_p.L151fs|ZFP37_ENST00000555206.1_Frame_Shift_Del_p.L137fs	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TCCCTGAGGAGTTTGTTTTGA	0.353																																					p.L135fs		Atlas-INDEL	.											.	ZFP37	93	.	0			c.404delT						PASS	.						85.0	91.0	89.0					9																	115806495		2171	4194	6365	SO:0001589	frameshift_variant	7539	exon4			.	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.403delC	chr9.hg19:g.115806495delG	ENSP00000363344:p.Leu136fs	165.0	0.0	0		196.0	29.0	0.147959	NM_003408	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Frame_Shift_Del	DEL	ENST00000374227.3	hg19	CCDS6787.1																																																																																			.	.	.	none		0.353	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408	
GRIP1	23426	hgsc.bcm.edu	37	12	66765625	66765625	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr12:66765625delA	ENST00000398016.3	-	22	2773	c.2705delT	c.(2704-2706)ttcfs	p.F902fs	GRIP1_ENST00000286445.7_Frame_Shift_Del_p.F939fs|GRIP1_ENST00000359742.4_Frame_Shift_Del_p.F954fs	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GCGCTCCTGGAAGCTGGCCTG	0.552																																					p.F902fs		Atlas-INDEL	.											.	GRIP1	106	.	0			c.2706delC						PASS	.						86.0	94.0	91.0					12																	66765625		2074	4214	6288	SO:0001589	frameshift_variant	23426	exon22			.	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2705delT	chr12.hg19:g.66765625delA	ENSP00000381098:p.Phe902fs	219.0	0.0	0		202.0	34.0	0.168317	NM_021150	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Frame_Shift_Del	DEL	ENST00000398016.3	hg19	CCDS41807.1																																																																																			.	.	.	none		0.552	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
RCBTB1	55213	hgsc.bcm.edu	37	13	50115836	50115836	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr13:50115836delC	ENST00000378302.2	-	11	1560	c.1300delG	c.(1300-1302)gacfs	p.D434fs	RCBTB1_ENST00000471984.1_5'Flank|RCBTB1_ENST00000258646.3_Frame_Shift_Del_p.D434fs	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	434	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		GGCGGCAGGTCGACTGTGTCT	0.458																																					p.D434fs		Atlas-INDEL	.											.	RCBTB1	34	.	0			c.1301delA						PASS	.						156.0	116.0	130.0					13																	50115836		2203	4300	6503	SO:0001589	frameshift_variant	55213	exon11			.	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1300delG	chr13.hg19:g.50115836delC	ENSP00000367552:p.Asp434fs	95.0	0.0	0		86.0	15.0	0.174419	NM_018191	Q8IY29|Q969U9	Frame_Shift_Del	DEL	ENST00000378302.2	hg19	CCDS9418.1																																																																																			.	.	.	none		0.458	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044912.2	NM_018191	
SLC7A14	57709	hgsc.bcm.edu	37	3	170201153	170201154	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:170201153_170201154insA	ENST00000231706.5	-	6	1379_1380	c.1064_1065insT	c.(1063-1065)ttcfs	p.F355fs	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	355					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TCGGCATCGGGAAGAGGGACCC	0.54											OREG0015917	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F355fs		Atlas-INDEL	.											.	SLC7A14	110	.	0			c.1065_1066insT						PASS	.																																			SO:0001589	frameshift_variant	57709	exon6			.	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1065dupT	chr3.hg19:g.170201155_170201155dupA	ENSP00000231706:p.Phe355fs	166.0	0.0	0	1883	117.0	14.0	0.119658	NM_020949	B3KV33|Q9HCF9	Frame_Shift_Ins	INS	ENST00000231706.5	hg19	CCDS33892.1																																																																																			.	.	.	none		0.540	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24908604	24908604	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:24908604delT	ENST00000396432.2	-	9	2706	c.2220delA	c.(2218-2220)aaafs	p.K740fs	ARHGAP21_ENST00000320481.6_Frame_Shift_Del_p.K527fs	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	739					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CAGATGGAGGTTTTTCCCTTA	0.453																																					p.P741fs		Atlas-INDEL	.											.	ARHGAP21	185	.	0			c.2221delC						PASS	.						102.0	96.0	98.0					10																	24908604		2203	4300	6503	SO:0001589	frameshift_variant	57584	exon9			.	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.2220delA	chr10.hg19:g.24908604delT	ENSP00000379709:p.Lys740fs	177.0	0.0	0		156.0	25.0	0.160256	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Frame_Shift_Del	DEL	ENST00000396432.2	hg19	CCDS7144.2																																																																																			.	.	.	none		0.453	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
INTS2	57508	hgsc.bcm.edu	37	17	59945081	59945082	+	In_Frame_Ins	INS	-	-	GAA			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:59945081_59945082insGAA	ENST00000444766.3	-	25	3526_3527	c.3451_3452insTTC	c.(3451-3453)caa>cTTCaa	p.1150_1151insL	INTS2_ENST00000251334.6_In_Frame_Ins_p.1142_1143insL	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1150					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CTTTATTTGTTGAAGACCTACA	0.351																																					p.Q1151delinsLQ		Atlas-INDEL	.											.	INTS2	89	.	0			c.3452_3453insTTC						PASS	.																																			SO:0001652	inframe_insertion	57508	exon25			.	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.3449_3451dupTTC	chr17.hg19:g.59945082_59945084dupGAA	ENSP00000414237:p.Leu1150_Leu1150dup	100.0	0.0	0		132.0	27.0	0.204545	NM_020748	Q9ULD3	In_Frame_Ins	INS	ENST00000444766.3	hg19	CCDS45750.1																																																																																			.	.	.	none		0.351	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
MYH15	22989	hgsc.bcm.edu	37	3	108107907	108107918	+	In_Frame_Del	DEL	TTCCAGTTCACG	TTCCAGTTCACG	-	rs143417195	byFrequency	TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	TTCCAGTTCACG	TTCCAGTTCACG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:108107907_108107918delTTCCAGTTCACG	ENST00000273353.3	-	39	5550_5561	c.5494_5505delCGTGAACTGGAA	c.(5494-5505)cgtgaactggaadel	p.RELE1832del		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1832						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1832S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCAGTTCACCTTCCAGTTCACGAACCTGCAAC	0.524																																					p.1832_1836del		Atlas-INDEL	.											.	MYH15	223	.	1	Substitution - Missense(1)	lung(1)	c.5495_5506del						PASS	.																																			SO:0001651	inframe_deletion	22989	exon39			.	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5494_5505delCGTGAACTGGAA	chr3.hg19:g.108107907_108107918delTTCCAGTTCACG	ENSP00000273353:p.Arg1832_Glu1835del	242.0	0.0	0		136.0	21.0	0.154412	NM_014981		In_Frame_Del	DEL	ENST00000273353.3	hg19	CCDS43127.1																																																																																			.	.	.	none		0.524	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
RPL24	6152	hgsc.bcm.edu	37	3	101401697	101401698	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr3:101401697_101401698insA	ENST00000394077.3	-	4	351_352	c.246_247insT	c.(244-249)attactfs	p.T83fs	RPL24_ENST00000469605.1_Frame_Shift_Ins_p.T83fs|RPL24_ENST00000495401.1_Frame_Shift_Ins_p.T83fs	NM_000986.3	NP_000977.1	P83731	RL24_HUMAN	ribosomal protein L24	83					cellular protein metabolic process (GO:0044267)|exit from mitosis (GO:0010458)|gene expression (GO:0010467)|mitotic cell cycle checkpoint (GO:0007093)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|optic nerve development (GO:0021554)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|ribosomal large subunit assembly (GO:0000027)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(2)|urinary_tract(1)	4						GATGCACCAGTAATGGCCCTCT	0.436																																					p.T83fs		Atlas-INDEL	.											.	RPL24	8	.	0			c.247_248insT						PASS	.																																			SO:0001589	frameshift_variant	6152	exon4			.	AB007177	CCDS33809.1	3q12	2011-04-06			ENSG00000114391	ENSG00000114391		"""L ribosomal proteins"""	10325	protein-coding gene	gene with protein product		604180				9582194	Standard	NM_000986		Approved	L24	uc003dvh.1	P83731	OTTHUMG00000159146	ENST00000394077.3:c.247dupT	chr3.hg19:g.101401699_101401699dupA	ENSP00000377640:p.Thr83fs	96.0	0.0	0		98.0	23.0	0.234694	NM_000986	B2R4Y3|P38663|Q6IBS3	Frame_Shift_Ins	INS	ENST00000394077.3	hg19	CCDS33809.1																																																																																			.	.	.	none		0.436	RPL24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353487.1	NM_000986	
STOX1	219736	hgsc.bcm.edu	37	10	70645179	70645179	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr10:70645179delT	ENST00000298596.6	+	3	1710	c.1627delT	c.(1627-1629)tttfs	p.F543fs	STOX1_ENST00000399165.4_Intron|STOX1_ENST00000421961.2_Frame_Shift_Del_p.F433fs|STOX1_ENST00000399162.2_Intron|STOX1_ENST00000399169.4_Frame_Shift_Del_p.F543fs	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	543						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CTCAAGAATCTTTGATGGTAA	0.418																																					p.I542fs		Atlas-INDEL	.											STOX1,NS,carcinoma,0,1	STOX1	75	.	0			c.1626delC						PASS	.						66.0	60.0	62.0					10																	70645179		1853	4096	5949	SO:0001589	frameshift_variant	219736	exon3			.	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.1627delT	chr10.hg19:g.70645179delT	ENSP00000298596:p.Phe543fs	63.0	0.0	0		53.0	12.0	0.226415	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Frame_Shift_Del	DEL	ENST00000298596.6	hg19	CCDS41535.1																																																																																			.	.	.	none		0.418	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
BAIAP2	10458	hgsc.bcm.edu	37	17	79082274	79082274	+	Splice_Site	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:79082274delG	ENST00000321300.6	+	13	1593		c.e13-1		BAIAP2_ENST00000575712.1_Splice_Site|BAIAP2_ENST00000435091.3_Splice_Site|BAIAP2_ENST00000428708.2_Splice_Site|BAIAP2_ENST00000321280.7_Splice_Site|BAIAP2_ENST00000392411.3_Splice_Site|BAIAP2_ENST00000416299.2_Splice_Site|BAIAP2_ENST00000575245.1_Splice_Site	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2						actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCTGCCCCCAGGGCCTGGATG	0.637																																					.		Atlas-INDEL	.											.	BAIAP2	74	.	0			c.1501-2G>-						PASS	.						72.0	70.0	71.0					17																	79082274		2203	4300	6503	SO:0001630	splice_region_variant	10458	exon13			.	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1501-1G>-	chr17.hg19:g.79082274delG		70.0	0.0	0		55.0	12.0	0.218182	NM_001144888	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Splice_Site	DEL	ENST00000321300.6	hg19	CCDS11775.1																																																																																			.	.	.	none		0.637	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438553.1		Intron
ADAP2	55803	hgsc.bcm.edu	37	17	29261211	29261211	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr17:29261211delG	ENST00000330889.3	+	5	741	c.406delG	c.(406-408)gaafs	p.E136fs	ADAP2_ENST00000580525.1_Frame_Shift_Del_p.E142fs	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	136	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						AGGTAACCGAGAAGGATTCCT	0.478																																					p.R135fs		Atlas-INDEL	.											.	ADAP2	36	.	1	Unknown(1)	central_nervous_system(1)	c.405delA						PASS	.						96.0	80.0	85.0					17																	29261211		2203	4300	6503	SO:0001589	frameshift_variant	55803	exon5			.	AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.406delG	chr17.hg19:g.29261211delG	ENSP00000329468:p.Glu136fs	51.0	0.0	0		59.0	10.0	0.169492	NM_018404	Q8N4Q6|Q96SD5	Frame_Shift_Del	DEL	ENST00000330889.3	hg19	CCDS11261.1																																																																																			.	.	.	none		0.478	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256346.1	NM_018404	
SYNPO	11346	hgsc.bcm.edu	37	5	150027927	150027927	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr5:150027927delA	ENST00000394243.1	+	3	1196	c.822delA	c.(820-822)ctafs	p.L274fs	SYNPO_ENST00000519664.1_Frame_Shift_Del_p.L30fs|SYNPO_ENST00000307662.4_Frame_Shift_Del_p.L30fs|SYNPO_ENST00000518872.1_Intron|SYNPO_ENST00000522122.1_Frame_Shift_Del_p.L274fs	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	274					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGTTTATCTAAAGGAGAATG	0.602																																					p.L274fs		Atlas-INDEL	.											.	SYNPO	147	.	0			c.821delT						PASS	.						82.0	91.0	88.0					5																	150027927		2203	4300	6503	SO:0001589	frameshift_variant	11346	exon3			.	AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.822delA	chr5.hg19:g.150027927delA	ENSP00000377789:p.Leu274fs	135.0	0.0	0		92.0	24.0	0.26087	NM_001166209	A5PKZ8|D3DQG8|O15271|Q9UPX1	Frame_Shift_Del	DEL	ENST00000394243.1	hg19	CCDS54937.1																																																																																			.	.	.	none		0.602	SYNPO-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252371.1	NM_007286	
ANK2	287	hgsc.bcm.edu	37	4	114195785	114195785	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr4:114195785delG	ENST00000357077.4	+	15	1716	c.1663delG	c.(1663-1665)gccfs	p.A555fs	ANK2_ENST00000264366.6_Frame_Shift_Del_p.A555fs|ANK2_ENST00000506722.1_Frame_Shift_Del_p.A534fs|ANK2_ENST00000394537.3_Frame_Shift_Del_p.A555fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	555					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AGCAGGAGCAGCCCACTCCTT	0.517																																					p.A554fs		Atlas-INDEL	.											.	ANK2	576	.	0			c.1662delA						PASS	.						80.0	78.0	79.0					4																	114195785		2203	4300	6503	SO:0001589	frameshift_variant	287	exon15			.	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1663delG	chr4.hg19:g.114195785delG	ENSP00000349588:p.Ala555fs	85.0	0.0	0		69.0	12.0	0.173913	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	ENST00000357077.4	hg19	CCDS3702.1																																																																																			.	.	.	none		0.517	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
SOCS6	9306	hgsc.bcm.edu	37	18	67992496	67992496	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6132-01A-11D-1961-08	TCGA-DZ-6132-11A-01D-1961-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	be6d6e8a-236f-4a34-a19c-c7d6290d97f0	499ed479-d046-4343-9bd4-14b7201bdc55	g.chr18:67992496delA	ENST00000397942.3	+	2	908	c.592delA	c.(592-594)aatfs	p.N198fs	SOCS6_ENST00000582322.1_Frame_Shift_Del_p.N198fs	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	198					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GGCTTCTCATAATGGAGACCT	0.512																																					p.H197fs	Melanoma(84;1024 1361 24382 36583 42651)	Atlas-INDEL	.											.	SOCS6	54	.	0			c.591delT						PASS	.						108.0	94.0	99.0					18																	67992496		2203	4300	6503	SO:0001589	frameshift_variant	9306	exon2			.	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.592delA	chr18.hg19:g.67992496delA	ENSP00000381034:p.Asn198fs	146.0	0.0	0		129.0	28.0	0.217054	NM_004232	Q8WUM3	Frame_Shift_Del	DEL	ENST00000397942.3	hg19	CCDS11998.1																																																																																			.	.	.	none		0.512	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
