#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HIVEP3	59269	hgsc.bcm.edu	37	1	42048765	42048765	+	Silent	SNP	G	G	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:42048765G>T	ENST00000372583.1	-	4	2589	c.1704C>A	c.(1702-1704)acC>acA	p.T568T	HIVEP3_ENST00000247584.5_Silent_p.T568T|HIVEP3_ENST00000429157.2_Silent_p.T568T|HIVEP3_ENST00000372584.1_Silent_p.T568T	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	568	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T568T(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTTCGGAGTCGGTGATATGGT	0.587																																					p.T568T		Atlas-SNP	.											HIVEP3,NS,carcinoma,0,1	HIVEP3	235	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1704A						PASS	.						49.0	52.0	51.0					1																	42048765		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon4			GGAGTCGGTGATA	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1704C>A	chr1.hg19:g.42048765G>T		109.0	1.0	.		94.0	5.0	.	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.	.	none		0.587	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
POGZ	23126	hgsc.bcm.edu	37	1	151378756	151378756	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:151378756G>A	ENST00000271715.2	-	19	3069	c.2755C>T	c.(2755-2757)Cca>Tca	p.P919S	POGZ_ENST00000392723.1_Missense_Mutation_p.P866S|POGZ_ENST00000368863.2_Missense_Mutation_p.P824S|POGZ_ENST00000409503.1_Missense_Mutation_p.P910S|POGZ_ENST00000361398.3_Missense_Mutation_p.P866S|POGZ_ENST00000491586.1_Missense_Mutation_p.P875S|POGZ_ENST00000540984.1_Missense_Mutation_p.P281S|POGZ_ENST00000531094.1_Missense_Mutation_p.P857S	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	919	Pro-rich.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTGGGGGTTGGTGGTGGGGTT	0.592																																					p.P919S		Atlas-SNP	.											.	POGZ	211	.	0			c.C2755T						PASS	.						73.0	73.0	73.0					1																	151378756		2203	4300	6503	SO:0001583	missense	23126	exon19			GGGTTGGTGGTGG	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2755C>T	chr1.hg19:g.151378756G>A	ENSP00000271715:p.Pro919Ser	114.0	0.0	.		140.0	32.0	.	NM_015100	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	hg19	CCDS997.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653454	0.29425	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000540984;ENST00000491586	T;T;T;T;T;T;T;T	0.23552	5.88;5.91;5.88;5.84;5.89;5.88;1.9;5.37	5.87	3.95	0.45737	.	0.748779	0.12616	N	0.453449	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001;0.0	T	0.34527	-0.9825	10	0.45353	T	0.12	-1.4299	8.593	0.33699	0.0805:0.2988:0.6207:0.0	.	857;910;824;875;866;919	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	S	866;919;866;824;910;857;281;875	ENSP00000376484:P866S;ENSP00000271715:P919S;ENSP00000354467:P866S;ENSP00000357856:P824S;ENSP00000386836:P910S;ENSP00000431259:P857S;ENSP00000443547:P281S;ENSP00000418408:P875S	ENSP00000271715:P919S	P	-	1	0	POGZ	149645380	0.165000	0.22948	0.788000	0.31933	0.966000	0.64601	0.747000	0.26290	1.446000	0.47643	0.655000	0.94253	CCA	.	.	.	none		0.592	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
ACTA1	58	hgsc.bcm.edu	37	1	229568083	229568083	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr1:229568083C>T	ENST00000366684.3	-	4	652	c.550G>A	c.(550-552)Ggc>Agc	p.G184S	ACTA1_ENST00000366683.2_Intron	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	184			G -> D (in NEM3; mild). {ECO:0000269|PubMed:10508519, ECO:0000269|PubMed:15236405}.		cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				AGATCGCGGCCCGCCAGGTCC	0.677																																					p.G184S		Atlas-SNP	.											.	ACTA1	65	.	0			c.G550A						PASS	.						38.0	37.0	38.0					1																	229568083		2203	4299	6502	SO:0001583	missense	58	exon4			CGCGGCCCGCCAG	J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.550G>A	chr1.hg19:g.229568083C>T	ENSP00000355645:p.Gly184Ser	63.0	0.0	.		76.0	13.0	.	NM_001100	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	hg19	CCDS1578.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399571	0.62177	.	.	ENSG00000143632	ENST00000366684;ENST00000366682	D	0.99586	-6.23	4.58	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	H	0.99609	4.655	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.96775	0.9571	10	0.87932	D	0	.	12.6981	0.57016	0.0:0.9198:0.0:0.0802	.	184	P68133	ACTS_HUMAN	S	184;149	ENSP00000355645:G184S	ENSP00000355643:G149S	G	-	1	0	ACTA1	227634706	1.000000	0.71417	0.846000	0.33378	0.920000	0.55202	7.545000	0.82128	1.143000	0.42306	0.650000	0.86243	GGC	.	.	.	none		0.677	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	NM_001100	
PDIA6	10130	hgsc.bcm.edu	37	2	10927529	10927529	+	Silent	SNP	A	A	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:10927529A>T	ENST00000272227.3	-	11	1182	c.1035T>A	c.(1033-1035)ctT>ctA	p.L345L	PDIA6_ENST00000404371.2_Silent_p.L397L|PDIA6_ENST00000404824.2_Silent_p.L393L|PDIA6_ENST00000381611.4_Silent_p.L350L|PDIA6_ENST00000540494.1_Silent_p.L342L	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	345					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		ACGCGGTCTCAAGTTCAGACT	0.488																																					p.L345L	GBM(73;509 1219 34219 41343 41551)	Atlas-SNP	.											.	PDIA6	31	.	0			c.T1035A						PASS	.						81.0	83.0	82.0					2																	10927529		2203	4300	6503	SO:0001819	synonymous_variant	10130	exon11			GGTCTCAAGTTCA	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.1035T>A	chr2.hg19:g.10927529A>T		79.0	0.0	.		80.0	10.0	.	NM_005742	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Silent	SNP	ENST00000272227.3	hg19	CCDS1675.1																																																																																			.	.	.	none		0.488	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742	
WNT10A	80326	hgsc.bcm.edu	37	2	219754883	219754883	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr2:219754883G>A	ENST00000258411.3	+	3	1187	c.554G>A	c.(553-555)gGt>gAt	p.G185D		NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	185					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGCAGCGTGGTAAGGGCCTG	0.672																																					p.G185D		Atlas-SNP	.											.	WNT10A	35	.	0			c.G554A						PASS	.						48.0	43.0	45.0					2																	219754883		2203	4300	6503	SO:0001583	missense	80326	exon3			AGCGTGGTAAGGG	AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.554G>A	chr2.hg19:g.219754883G>A	ENSP00000258411:p.Gly185Asp	67.0	0.0	.		67.0	13.0	.	NM_025216	Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	ENST00000258411.3	hg19	CCDS2426.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760111	0.89932	.	.	ENSG00000135925	ENST00000258411	T	0.75821	-0.97	4.46	4.46	0.54185	.	0.408178	0.26328	N	0.025007	D	0.84165	0.5412	M	0.71581	2.175	0.80722	D	1	D	0.63880	0.993	D	0.64144	0.922	D	0.86269	0.1660	10	0.72032	D	0.01	.	16.6424	0.85129	0.0:0.0:1.0:0.0	.	185	Q9GZT5	WN10A_HUMAN	D	185	ENSP00000258411:G185D	ENSP00000258411:G185D	G	+	2	0	WNT10A	219463127	1.000000	0.71417	0.795000	0.32087	0.929000	0.56500	9.117000	0.94347	2.478000	0.83669	0.655000	0.94253	GGT	.	.	.	none		0.672	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256730.2	NM_025216	
PIK3CA	5290	hgsc.bcm.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E542K	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,2	PIK3CA	8460	.	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)	c.G1624A						PASS	.						56.0	56.0	56.0					3																	178936082		1809	4069	5878	SO:0001583	missense	5290	exon10			CTCTCTGAAATCA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	chr3.hg19:g.178936082G>A	ENSP00000263967:p.Glu542Lys	78.0	0.0	.		87.0	24.0	.	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	.	.	.	weak		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
NPNT	255743	hgsc.bcm.edu	37	4	106859521	106859521	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr4:106859521G>T	ENST00000379987.2	+	5	665	c.449G>T	c.(448-450)cGg>cTg	p.R150L	NPNT_ENST00000427316.2_Missense_Mutation_p.R180L|NPNT_ENST00000305572.8_Missense_Mutation_p.R150L|NPNT_ENST00000506666.1_Missense_Mutation_p.R180L|NPNT_ENST00000514622.1_Missense_Mutation_p.R150L|NPNT_ENST00000453617.2_Missense_Mutation_p.R167L	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	150	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		GGACAAATACGGTGCCAGTGC	0.532																																					p.R180L		Atlas-SNP	.											.	NPNT	69	.	0			c.G539T						PASS	.						90.0	81.0	84.0					4																	106859521		2203	4300	6503	SO:0001583	missense	255743	exon6			AAATACGGTGCCA		CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.449G>T	chr4.hg19:g.106859521G>T	ENSP00000369323:p.Arg150Leu	77.0	0.0	.		111.0	5.0	.	NM_001184691	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Missense_Mutation	SNP	ENST00000379987.2	hg19	CCDS34046.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.443175	0.63067	.	.	ENSG00000168743	ENST00000504304;ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451	D;D;D;T;D;D;T;T	0.86865	-2.18;-2.18;-2.18;-1.05;-2.18;-2.18;-1.07;-0.22	5.22	4.37	0.52481	Epidermal growth factor-like (1);	0.052801	0.85682	D	0.000000	D	0.91764	0.7395	M	0.66506	2.035	0.58432	D	0.999998	D;D;D;D;D;D;D	0.71674	0.998;0.992;0.996;0.985;0.996;0.965;0.997	D;P;P;P;P;P;D	0.69654	0.954;0.86;0.903;0.86;0.903;0.826;0.965	D	0.91899	0.5530	10	0.52906	T	0.07	.	14.1773	0.65549	0.0729:0.0:0.9271:0.0	.	150;180;180;167;197;150;150	E9PF04;E9PE64;E9PCQ1;E9PCK8;D6RH31;Q6UXI9-2;Q6UXI9	.;.;.;.;.;.;NPNT_HUMAN	L	46;150;167;180;150;150;180;197	ENSP00000426951:R46L;ENSP00000369323:R150L;ENSP00000402884:R167L;ENSP00000389252:R180L;ENSP00000422044:R150L;ENSP00000302557:R150L;ENSP00000422474:R180L;ENSP00000426146:R197L	ENSP00000302557:R150L	R	+	2	0	NPNT	107078970	1.000000	0.71417	0.298000	0.25002	0.165000	0.22458	6.341000	0.72977	1.325000	0.45301	0.655000	0.94253	CGG	.	.	.	none		0.532	NPNT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364083.1	NM_198278	
CRIP3	401262	hgsc.bcm.edu	37	6	43275462	43275462	+	Silent	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr6:43275462T>C	ENST00000274990.4	-	4	220	c.216A>G	c.(214-216)gtA>gtG	p.V72V	ZNF318_ENST00000607252.1_5'UTR|CRIP3_ENST00000372569.3_Silent_p.V72V			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	72					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AGTAGGAGCCTACACCACCAA	0.627																																					p.V72V		Atlas-SNP	.											.	CRIP3	30	.	0			c.A216G						PASS	.						45.0	48.0	47.0					6																	43275462		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon4			GGAGCCTACACCA	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.216A>G	chr6.hg19:g.43275462T>C		90.0	0.0	.		97.0	18.0	.	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	hg19		.	.	.	.	.	.	.	.	.	.	T	7.040	0.562412	0.13498	.	.	ENSG00000146215	ENST00000416431	.	.	.	5.52	3.63	0.41609	.	.	.	.	.	T	0.33323	0.0859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30592	-0.9973	4	.	.	.	-35.039	4.1803	0.10372	0.1604:0.5979:0.1554:0.0862	.	.	.	.	G	20	.	.	R	-	1	2	CRIP3	43383440	0.290000	0.24343	1.000000	0.80357	0.744000	0.42396	-0.819000	0.04462	1.470000	0.48102	-0.132000	0.14878	AGG	.	.	.	none		0.627	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
BCLAF1	9774	hgsc.bcm.edu	37	6	136599912	136599912	+	Missense_Mutation	SNP	G	G	T	rs200334350		TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr6:136599912G>T	ENST00000531224.1	-	4	359	c.107C>A	c.(106-108)tCt>tAt	p.S36Y	BCLAF1_ENST00000530767.1_Missense_Mutation_p.S36Y|BCLAF1_ENST00000527536.1_Missense_Mutation_p.S36Y|BCLAF1_ENST00000527759.1_Intron|BCLAF1_ENST00000353331.4_Intron|BCLAF1_ENST00000392348.2_Intron	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	36					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ACGAGACCTAGAACTAAAAAT	0.318																																					p.S36Y	Colon(142;1534 1789 5427 7063 28491)	Atlas-SNP	.											.	BCLAF1	203	.	0			c.C107A						PASS	.						23.0	24.0	24.0					6																	136599912		2199	4289	6488	SO:0001583	missense	9774	exon4			GACCTAGAACTAA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.107C>A	chr6.hg19:g.136599912G>T	ENSP00000435210:p.Ser36Tyr	29.0	0.0	.		47.0	6.0	.	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	hg19	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	5.506	0.278344	0.10403	.	.	ENSG00000029363	ENST00000531224;ENST00000527536;ENST00000530767;ENST00000529826	T;T;T;T	0.46819	1.23;1.07;0.86;0.93	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000004	T	0.63295	0.2499	M	0.61703	1.905	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.74348	0.983;0.983	T	0.64245	-0.6453	10	0.87932	D	0	-6.9024	20.1392	0.98050	0.0:0.0:1.0:0.0	.	36;36	Q9NYF8;Q9NYF8-4	BCLF1_HUMAN;.	Y	36	ENSP00000435210:S36Y;ENSP00000435441:S36Y;ENSP00000436501:S36Y;ENSP00000431734:S36Y	ENSP00000435441:S36Y	S	-	2	0	BCLAF1	136641605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.159000	0.77483	2.765000	0.95021	0.557000	0.71058	TCT	.	.	.	weak		0.318	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
FZD1	8321	hgsc.bcm.edu	37	7	90894779	90894779	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:90894779G>A	ENST00000287934.2	+	1	997	c.584G>A	c.(583-585)cGc>cAc	p.R195H		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	195	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GAGCGCGCGCGCCAGGGCTGC	0.672																																					p.R195H		Atlas-SNP	.											.	FZD1	64	.	0			c.G584A						PASS	.						52.0	58.0	56.0					7																	90894779		2199	4299	6498	SO:0001583	missense	8321	exon1			GCGCGCGCCAGGG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.584G>A	chr7.hg19:g.90894779G>A	ENSP00000287934:p.Arg195His	119.0	0.0	.		169.0	33.0	.	NM_003505	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	hg19	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.936514	0.92458	.	.	ENSG00000157240	ENST00000287934	T	0.76839	-1.05	4.69	4.69	0.59074	Frizzled domain (5);	0.000000	0.64402	D	0.000003	D	0.90407	0.6997	H	0.94542	3.55	0.80722	D	1	D	0.65815	0.995	P	0.61132	0.884	D	0.93351	0.6718	10	0.87932	D	0	.	17.7914	0.88553	0.0:0.0:1.0:0.0	.	195	Q9UP38	FZD1_HUMAN	H	195	ENSP00000287934:R195H	ENSP00000287934:R195H	R	+	2	0	FZD1	90732715	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.543000	0.73874	2.430000	0.82344	0.561000	0.74099	CGC	.	.	.	none		0.672	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
PTCD1	26024	hgsc.bcm.edu	37	7	99022814	99022814	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:99022814G>A	ENST00000292478.4	-	6	1591	c.1341C>T	c.(1339-1341)gcC>gcT	p.A447A	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.A496A|PTCD1_ENST00000555673.1_Silent_p.A496A	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	447					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TAGGGGGAACGGCCCCGGGGG	0.647																																					p.A496A		Atlas-SNP	.											.	.	.	.	0			c.C1488T						PASS	.						58.0	61.0	60.0					7																	99022814		2203	4300	6503	SO:0001819	synonymous_variant	100526740	exon7			GGGAACGGCCCCG	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1341C>T	chr7.hg19:g.99022814G>A		136.0	0.0	.		149.0	50.0	.	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	ENST00000292478.4	hg19	CCDS34691.1																																																																																			.	.	.	none		0.647	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
SERPINE1	5054	hgsc.bcm.edu	37	7	100780346	100780346	+	Silent	SNP	G	G	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr7:100780346G>C	ENST00000223095.4	+	8	1309	c.1152G>C	c.(1150-1152)gtG>gtC	p.V384V	SERPINE1_ENST00000445463.2_Silent_p.V369V	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	384					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TCCTCTTTGTGGTCCGGCACA	0.552																																					p.V384V		Atlas-SNP	.											.	SERPINE1	60	.	0			c.G1152C						PASS	.						139.0	117.0	125.0					7																	100780346		2203	4300	6503	SO:0001819	synonymous_variant	5054	exon8			CTTTGTGGTCCGG	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.1152G>C	chr7.hg19:g.100780346G>C		202.0	0.0	.		203.0	27.0	.	NM_000602	B7Z4S0|F8WD53	Silent	SNP	ENST00000223095.4	hg19	CCDS5711.1																																																																																			.	.	.	none		0.552	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602	
HSDL2	84263	hgsc.bcm.edu	37	9	115181173	115181173	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr9:115181173A>G	ENST00000398805.3	+	6	760	c.533A>G	c.(532-534)tAt>tGt	p.Y178C	HSDL2_ENST00000398803.1_Missense_Mutation_p.Y105C|HSDL2_ENST00000488101.1_3'UTR|HSDL2_ENST00000262542.7_Missense_Mutation_p.Y58C|HSDL2_ENST00000539114.1_Intron	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	178						membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						ATGTCTATGTATGTGCTTGGA	0.274																																					p.Y178C		Atlas-SNP	.											.	HSDL2	24	.	0			c.A533G						PASS	.						146.0	133.0	137.0					9																	115181173		1844	4082	5926	SO:0001583	missense	84263	exon6			CTATGTATGTGCT	AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.533A>G	chr9.hg19:g.115181173A>G	ENSP00000381785:p.Tyr178Cys	70.0	0.0	.		83.0	6.0	.	NM_032303	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	ENST00000398805.3	hg19	CCDS43864.1	.	.	.	.	.	.	.	.	.	.	A	4.417	0.077003	0.08485	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542	D;D;T	0.89810	-2.23;-2.57;2.17	5.54	4.61	0.57282	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.043003	0.85682	N	0.000000	T	0.66237	0.2769	N	0.00611	-1.325	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.01281	0.0;0.0	T	0.67364	-0.5689	10	0.02654	T	1	.	14.288	0.66258	0.0732:0.0:0.9268:0.0	.	105;178	Q6YN16-2;Q6YN16	.;HSDL2_HUMAN	C	178;105;58	ENSP00000381785:Y178C;ENSP00000381783:Y105C;ENSP00000262542:Y58C	ENSP00000262542:Y58C	Y	+	2	0	HSDL2	114220994	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.348000	0.79366	1.462000	0.47948	-0.321000	0.08615	TAT	.	.	.	none		0.274	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053681.1	NM_032303	
ALAD	210	hgsc.bcm.edu	37	9	116151742	116151742	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr9:116151742G>A	ENST00000409155.3	-	10	973	c.777C>T	c.(775-777)gaC>gaT	p.D259D	ALAD_ENST00000482001.1_5'Flank|ALAD_ENST00000277315.5_Silent_p.D242D	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	259					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	CCCGCACGATGTCCAGGTAGG	0.567																																					p.D259D		Atlas-SNP	.											.	ALAD	36	.	0			c.C777T						PASS	.						116.0	110.0	112.0					9																	116151742		2203	4300	6503	SO:0001819	synonymous_variant	210	exon10			CACGATGTCCAGG	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.777C>T	chr9.hg19:g.116151742G>A		168.0	0.0	.		112.0	26.0	.	NM_000031	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Silent	SNP	ENST00000409155.3	hg19	CCDS6794.2																																																																																			.	.	.	none		0.567	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
CAMK1D	57118	hgsc.bcm.edu	37	10	12595265	12595265	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr10:12595265C>T	ENST00000378847.3	+	2	471	c.134C>T	c.(133-135)aCt>aTt	p.T45I	CAMK1D_ENST00000378845.1_Missense_Mutation_p.T45I|CAMK1D_ENST00000487696.1_Intron	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	45	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		GAGAAGGCAACTGGCAAGCTC	0.468																																					p.T45I		Atlas-SNP	.											.	CAMK1D	99	.	0			c.C134T						PASS	.						162.0	150.0	154.0					10																	12595265		2203	4300	6503	SO:0001583	missense	57118	exon2			AGGCAACTGGCAA	AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.134C>T	chr10.hg19:g.12595265C>T	ENSP00000368124:p.Thr45Ile	205.0	0.0	.		189.0	35.0	.	NM_153498	B0YIY0|Q9HD31	Missense_Mutation	SNP	ENST00000378847.3	hg19	CCDS7091.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.507699	0.44558	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.49139	0.79;0.79	5.14	4.23	0.50019	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055122	0.64402	D	0.000001	T	0.57888	0.2084	M	0.89785	3.06	0.45648	D	0.99857	B;B	0.19073	0.033;0.011	B;B	0.23716	0.048;0.047	T	0.62586	-0.6823	10	0.87932	D	0	-12.4567	13.7457	0.62874	0.0:0.6876:0.3124:0.0	.	45;45	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	I	45	ENSP00000368124:T45I;ENSP00000368122:T45I	ENSP00000368122:T45I	T	+	2	0	CAMK1D	12635271	1.000000	0.71417	0.981000	0.43875	0.946000	0.59487	3.132000	0.50523	1.127000	0.42034	0.561000	0.74099	ACT	.	.	.	none		0.468	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046820.1	NM_020397	
SLC43A1	8501	hgsc.bcm.edu	37	11	57261478	57261478	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:57261478T>A	ENST00000278426.3	-	8	1214	c.859A>T	c.(859-861)Aac>Tac	p.N287Y	SLC43A1_ENST00000528450.1_Missense_Mutation_p.N287Y|SLC43A1_ENST00000533515.1_5'UTR	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TCAGGAAGGTTTTCTGAGGTG	0.567											OREG0020651	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N287Y		Atlas-SNP	.											.	SLC43A1	48	.	0			c.A859T						PASS	.						74.0	65.0	68.0					11																	57261478		2201	4296	6497	SO:0001583	missense	8501	exon8			GAAGGTTTTCTGA	AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.859A>T	chr11.hg19:g.57261478T>A	ENSP00000278426:p.Asn287Tyr	74.0	0.0	.	1021	62.0	13.0	.	NM_001198810		Missense_Mutation	SNP	ENST00000278426.3	hg19	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	t	15.67	2.901506	0.52227	.	.	ENSG00000149150	ENST00000278426;ENST00000528450;ENST00000533066	T;T;T	0.58060	0.36;0.36;1.47	5.57	-2.09	0.07232	Major facilitator superfamily domain, general substrate transporter (1);	1.826000	0.01877	N	0.037616	T	0.36524	0.0970	N	0.14661	0.345	0.09310	N	1	P	0.48911	0.917	P	0.46419	0.516	T	0.21965	-1.0230	10	0.35671	T	0.21	0.3003	1.7106	0.02891	0.1305:0.2328:0.1338:0.5029	.	287	O75387	LAT3_HUMAN	Y	287;287;256	ENSP00000278426:N287Y;ENSP00000435673:N287Y;ENSP00000435647:N256Y	ENSP00000278426:N287Y	N	-	1	0	SLC43A1	57018054	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	0.234000	0.17930	-0.008000	0.14320	0.459000	0.35465	AAC	.	.	.	none		0.567	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	
USP35	57558	hgsc.bcm.edu	37	11	77921303	77921303	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:77921303C>T	ENST00000529308.1	+	10	2663	c.2402C>T	c.(2401-2403)cCg>cTg	p.P801L	USP35_ENST00000530267.1_Missense_Mutation_p.P369L|USP35_ENST00000526425.1_Missense_Mutation_p.P532L|USP35_ENST00000441408.2_Missense_Mutation_p.P387L|USP35_ENST00000530535.1_3'UTR	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	801	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			AGCCAAGGGCCGTGCTACCTC	0.622																																					p.P801L		Atlas-SNP	.											.	USP35	179	.	0			c.C2402T						PASS	.						86.0	98.0	94.0					11																	77921303		2167	4250	6417	SO:0001583	missense	57558	exon10			AAGGGCCGTGCTA	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2402C>T	chr11.hg19:g.77921303C>T	ENSP00000431876:p.Pro801Leu	165.0	0.0	.		112.0	8.0	.	NM_020798		Missense_Mutation	SNP	ENST00000529308.1	hg19	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572013	0.86542	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.35	4.35	0.52113	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000019	D	0.96457	0.8844	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98113	1.0421	10	0.87932	D	0	-41.8622	17.0748	0.86583	0.0:1.0:0.0:0.0	.	801;387	Q9P2H5;E7EWV7	UBP35_HUMAN;.	L	369;801;387;532	ENSP00000435468:P369L;ENSP00000431876:P801L;ENSP00000400825:P387L;ENSP00000434942:P532L	ENSP00000400825:P387L	P	+	2	0	USP35	77598951	1.000000	0.71417	0.993000	0.49108	0.817000	0.46193	7.600000	0.82769	2.257000	0.74773	0.436000	0.28706	CCG	.	.	.	none		0.622	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
PCF11	51585	hgsc.bcm.edu	37	11	82877713	82877713	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr11:82877713A>G	ENST00000298281.4	+	5	2226	c.1774A>G	c.(1774-1776)Aag>Gag	p.K592E		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	592					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GCAAAGTTCCAAGTCTGCCAA	0.368																																					p.K592E		Atlas-SNP	.											.	PCF11	220	.	0			c.A1774G						PASS	.						71.0	71.0	71.0					11																	82877713		1781	3947	5728	SO:0001583	missense	51585	exon5			AGTTCCAAGTCTG	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1774A>G	chr11.hg19:g.82877713A>G	ENSP00000298281:p.Lys592Glu	134.0	0.0	.		156.0	29.0	.	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926781	0.52759	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.49720	1.75;0.79;0.77	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000007	T	0.58293	0.2112	L	0.32530	0.975	0.49687	D	0.999816	D;D	0.69078	0.997;0.993	D;D	0.75020	0.985;0.971	T	0.54801	-0.8239	9	.	.	.	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	592;592	E9PQ01;O94913	.;PCF11_HUMAN	E	592	ENSP00000298281:K592E;ENSP00000434540:K592E;ENSP00000431567:K592E	.	K	+	1	0	PCF11	82555361	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.414000	0.73318	2.326000	0.78906	0.533000	0.62120	AAG	.	.	.	none		0.368	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
ATF7	11016	hgsc.bcm.edu	37	12	53910964	53910964	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr12:53910964G>A	ENST00000548446.2	-	12	1554	c.1442C>T	c.(1441-1443)tCg>tTg	p.S481L	RP11-793H13.3_ENST00000548347.1_RNA|ATF7_ENST00000456903.4_Missense_Mutation_p.S470L|ATF7_ENST00000420353.2_Missense_Mutation_p.S470L|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000415113.1_Missense_Mutation_p.S449L|ATF7_ENST00000546661.1_5'UTR|ATF7_ENST00000328463.7_Missense_Mutation_p.S481L			P17544	ATF7_HUMAN	activating transcription factor 7	481	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	GATTACATGCGATTGTATCGG	0.587																																					p.S470L		Atlas-SNP	.											.	ATF7	51	.	0			c.C1409T						PASS	.						112.0	109.0	110.0					12																	53910964		2075	4216	6291	SO:0001583	missense	11016	exon12			ACATGCGATTGTA	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1442C>T	chr12.hg19:g.53910964G>A	ENSP00000449938:p.Ser481Leu	171.0	0.0	.		184.0	36.0	.	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	hg19		.	.	.	.	.	.	.	.	.	.	G	24.4	4.522447	0.85600	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.56776	0.47;0.47;0.44;0.49;0.49	4.47	4.47	0.54385	.	0.132552	0.52532	D	0.000064	T	0.43233	0.1238	L	0.53249	1.67	0.54753	D	0.999981	P;P;B	0.46327	0.876;0.804;0.0	B;B;B	0.28553	0.091;0.042;0.001	T	0.58797	-0.7573	10	0.87932	D	0	-16.9898	16.5074	0.84276	0.0:0.0:1.0:0.0	.	449;470;481	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	L	481;481;294;449;470;470	ENSP00000449938:S481L;ENSP00000329212:S481L;ENSP00000404880:S449L;ENSP00000399465:S470L;ENSP00000387406:S470L	ENSP00000304187:S294L	S	-	2	0	ATF7	52197231	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.990000	0.76225	2.513000	0.84729	0.456000	0.33151	TCG	.	.	.	none		0.587	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
SMARCC2	6601	hgsc.bcm.edu	37	12	56558339	56558339	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr12:56558339T>C	ENST00000267064.4	-	27	3402	c.3316A>G	c.(3316-3318)Atc>Gtc	p.I1106V	SMARCC2_ENST00000347471.4_Intron|SMARCC2_ENST00000550164.1_Missense_Mutation_p.I1137V|SMARCC2_ENST00000394023.3_Intron|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	1106	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TTAATACTGATGGAGTCAGCT	0.587																																					p.I1106V		Atlas-SNP	.											.	SMARCC2	212	.	0			c.A3316G						PASS	.						103.0	89.0	94.0					12																	56558339		2203	4300	6503	SO:0001583	missense	6601	exon27			TACTGATGGAGTC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.3316A>G	chr12.hg19:g.56558339T>C	ENSP00000267064:p.Ile1106Val	92.0	0.0	.		120.0	42.0	.	NM_003075	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	ENST00000267064.4	hg19	CCDS8907.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.300338	0.23650	.	.	ENSG00000139613	ENST00000550164;ENST00000267064	T;T	0.44881	0.91;0.94	5.28	3.99	0.46301	.	0.593150	0.16689	N	0.203617	T	0.20577	0.0495	N	0.08118	0	0.25483	N	0.987717	B	0.02656	0.0	B	0.01281	0.0	T	0.19811	-1.0294	9	.	.	.	-5.712	7.8812	0.29623	0.0:0.1805:0.0:0.8195	.	1106	Q8TAQ2	SMRC2_HUMAN	V	1137;1106	ENSP00000449396:I1137V;ENSP00000267064:I1106V	.	I	-	1	0	SMARCC2	54844606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.211000	0.32382	0.832000	0.34804	0.460000	0.39030	ATC	.	.	.	none		0.587	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408370.1		
BTBD6	90135	hgsc.bcm.edu	37	14	105716270	105716270	+	Missense_Mutation	SNP	C	C	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr14:105716270C>T	ENST00000392554.3	+	4	1016	c.719C>T	c.(718-720)gCc>gTc	p.A240V	BRF1_ENST00000546474.1_Intron|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000440513.3_Intron|BTBD6_ENST00000463376.2_Missense_Mutation_p.A165V|BRF1_ENST00000379932.4_5'Flank|BTBD6_ENST00000536364.1_Missense_Mutation_p.A240V|BRF1_ENST00000551787.1_5'Flank|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BTBD6_ENST00000327471.3_Missense_Mutation_p.A165V|BRF1_ENST00000446501.2_5'Flank			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	240						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		ACTCGGGAGGCCCTCAACACC	0.617																																					p.A240V		Atlas-SNP	.											.	BTBD6	24	.	0			c.C719T						PASS	.						30.0	27.0	28.0					14																	105716270		2201	4298	6499	SO:0001583	missense	90135	exon5			GGGAGGCCCTCAA	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.719C>T	chr14.hg19:g.105716270C>T	ENSP00000376337:p.Ala240Val	54.0	0.0	.		44.0	7.0	.	NM_033271	Q8IVQ7|Q9BR94	Missense_Mutation	SNP	ENST00000392554.3	hg19	CCDS10002.2	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920172	0.52653	.	.	ENSG00000184887	ENST00000536364;ENST00000537513;ENST00000392554;ENST00000463376;ENST00000327471	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	5.07	5.07	0.68467	BTB/Kelch-associated (2);	0.118294	0.64402	D	0.000020	T	0.66218	0.2767	L	0.39898	1.24	0.48511	D	0.999668	B	0.29341	0.242	B	0.39935	0.314	T	0.69011	-0.5258	10	0.87932	D	0	-31.8506	15.9457	0.79792	0.0:1.0:0.0:0.0	.	240	Q96KE9	BTBD6_HUMAN	V	240;240;240;165;165	ENSP00000443091:A240V;ENSP00000446223:A240V;ENSP00000376337:A240V;ENSP00000418150:A165V;ENSP00000329361:A165V	ENSP00000329361:A165V	A	+	2	0	BTBD6	104787315	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	7.655000	0.83696	2.331000	0.79229	0.563000	0.77884	GCC	.	.	.	none		0.617	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4		
FAM86A	196483	hgsc.bcm.edu	37	16	5140457	5140457	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr16:5140457T>A	ENST00000427587.4	-	5	520	c.452A>T	c.(451-453)gAg>gTg	p.E151V	FAM86A_ENST00000458008.4_Missense_Mutation_p.E117V|FAM86A_ENST00000587133.1_Missense_Mutation_p.E90V	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	151						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						TGCCGGGTTCTCGATGGCCCA	0.642																																					p.E151V		Atlas-SNP	.											.	FAM86A	32	.	0			c.A452T						PASS	.						86.0	84.0	85.0					16																	5140457		2197	4300	6497	SO:0001583	missense	196483	exon5			GGGTTCTCGATGG	BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.452A>T	chr16.hg19:g.5140457T>A	ENSP00000398502:p.Glu151Val	128.0	0.0	.		159.0	16.0	.	NM_201400	D3DUF0|Q96S85	Missense_Mutation	SNP	ENST00000427587.4	hg19	CCDS10529.1	.	.	.	.	.	.	.	.	.	.	t	17.73	3.461895	0.63513	.	.	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.20200	2.09;2.09	5.02	5.02	0.67125	.	0.188239	0.45867	D	0.000338	T	0.21761	0.0524	N	0.26042	0.785	0.44337	D	0.997227	P;P	0.40731	0.682;0.728	P;P	0.46850	0.522;0.529	T	0.02042	-1.1224	10	0.51188	T	0.08	.	12.2508	0.54597	0.0:0.0:0.0:1.0	.	117;151	Q96G04-2;Q96G04	.;FA86A_HUMAN	V	117;151	ENSP00000389710:E117V;ENSP00000398502:E151V	ENSP00000398502:E151V	E	-	2	0	FAM86A	5080458	0.999000	0.42202	0.910000	0.35882	0.241000	0.25554	6.872000	0.75536	2.117000	0.64856	0.370000	0.22315	GAG	.	.	.	none		0.642	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251713.1	NM_201400	
TPPP3	51673	hgsc.bcm.edu	37	16	67424233	67424233	+	Silent	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr16:67424233C>G	ENST00000564104.1	-	3	1216	c.375G>C	c.(373-375)ctG>ctC	p.L125L	TPPP3_ENST00000290942.5_Silent_p.L125L|TPPP3_ENST00000393957.2_Silent_p.L125L|TPPP3_ENST00000562206.1_Silent_p.L125L|RNU1-123P_ENST00000458950.1_RNA			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	125					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		TGGTGTCCGTCAGCCGGTCTA	0.617																																					p.L125L		Atlas-SNP	.											.	TPPP3	13	.	0			c.G375C						PASS	.						129.0	119.0	122.0					16																	67424233		2198	4300	6498	SO:0001819	synonymous_variant	51673	exon5			GTCCGTCAGCCGG	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.375G>C	chr16.hg19:g.67424233C>G		281.0	0.0	.		268.0	11.0	.	NM_016140	Q49AH9|Q9Y326|Q9Y6H0	Silent	SNP	ENST00000564104.1	hg19	CCDS10835.1																																																																																			.	.	.	none		0.617	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	NM_015964	
MYH2	4620	hgsc.bcm.edu	37	17	10426831	10426831	+	Silent	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:10426831G>A	ENST00000245503.5	-	37	5838	c.5454C>T	c.(5452-5454)atC>atT	p.I1818I	RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Silent_p.I1818I|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1818					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCAGTTTCTGGATCTGCTTCT	0.507																																					p.I1818I		Atlas-SNP	.											.	MYH2	390	.	0			c.C5454T						PASS	.						97.0	103.0	101.0					17																	10426831		2203	4300	6503	SO:0001819	synonymous_variant	4620	exon37			TTTCTGGATCTGC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5454C>T	chr17.hg19:g.10426831G>A		190.0	0.0	.		230.0	82.0	.	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	ENST00000245503.5	hg19	CCDS11156.1																																																																																			.	.	.	none		0.507	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
RDM1	201299	hgsc.bcm.edu	37	17	34257138	34257138	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:34257138G>A	ENST00000293273.6	-	2	263	c.218C>T	c.(217-219)gCc>gTc	p.A73V	RDM1_ENST00000591402.1_Missense_Mutation_p.A50V|RDM1_ENST00000425909.3_Missense_Mutation_p.A73V|RDM1_ENST00000394527.1_Missense_Mutation_p.A50V|RDM1_ENST00000394528.3_Missense_Mutation_p.A73V|RDM1_ENST00000431884.2_Missense_Mutation_p.A73V|RDM1_ENST00000419453.2_Missense_Mutation_p.A50V|RDM1_ENST00000430160.2_Missense_Mutation_p.A50V|RDM1_ENST00000394529.3_Missense_Mutation_p.A50V	NM_145654.3	NP_663629.1	Q8NG50	RDM1_HUMAN	RAD52 motif containing 1	73	Necessary for nuclear localization and for nucleolar accumulation in response to heat shock.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(3)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)	9		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GGCTCTGTGGGCAGCCCTTGC	0.493								Other identified genes with known or suspected DNA repair function																													p.A73V		Atlas-SNP	.											.	RDM1	46	.	0			c.C218T						PASS	.						115.0	125.0	122.0					17																	34257138		2203	4300	6503	SO:0001583	missense	201299	exon2			CTGTGGGCAGCCC	AB080728	CCDS11301.1, CCDS42299.1, CCDS54111.1, CCDS54108.1, CCDS54109.1, CCDS54110.1, CCDS59280.1, CCDS59281.1	17q11.2	2014-04-10	2014-04-10	2005-10-20	ENSG00000187456	ENSG00000278023		"""RNA binding motif (RRM) containing"""	19950	protein-coding gene	gene with protein product		612896	"""RAD52 homolog B (S. cerevisiae)"", ""RAD52 motif 1"""	RAD52B		15611051	Standard	NM_001163120		Approved	MGC33977	uc002hkh.3	Q8NG50	OTTHUMG00000188399	ENST00000293273.6:c.218C>T	chr17.hg19:g.34257138G>A	ENSP00000293273:p.Ala73Val	271.0	0.0	.		361.0	23.0	.	NM_001034836	A0JP55|A8MV46|A8MY68|A8MZ92|A8RCS5|A8RCT0|A8RCT5|A8RCT8|A8RCU3|A8RCU8|A8RCW0|A8RCW5	Missense_Mutation	SNP	ENST00000293273.6	hg19	CCDS11301.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807688	0.50421	.	.	ENSG00000187456	ENST00000293273;ENST00000394529;ENST00000431884;ENST00000425909;ENST00000436836;ENST00000430160;ENST00000394528;ENST00000394527	T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.58	3.78	3.78	0.43462	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.134512	0.49916	D	0.000140	T	0.52108	0.1714	M	0.79475	2.455	0.35240	D	0.777732	D;D;P;P;P;D;D;D;P	0.54397	0.957;0.957;0.946;0.859;0.946;0.957;0.957;0.966;0.946	P;P;B;B;P;P;P;P;P	0.61874	0.751;0.491;0.41;0.41;0.636;0.491;0.545;0.895;0.636	T	0.67090	-0.5758	10	0.54805	T	0.06	-6.8607	13.5182	0.61553	0.0:0.0:1.0:0.0	.	50;50;73;73;50;50;73;73;50	B4DZ74;Q8NG50-4;Q8NG50-5;Q8NG50-10;Q8NG50-2;Q8NG50-11;A8MY68;Q8NG50;Q8NG50-6	.;.;.;.;.;.;.;RDM1_HUMAN;.	V	73;50;73;73;73;50;73;50	ENSP00000293273:A73V;ENSP00000378037:A50V;ENSP00000391290:A73V;ENSP00000393620:A73V;ENSP00000397431:A73V;ENSP00000413421:A50V;ENSP00000378036:A73V;ENSP00000378035:A50V	ENSP00000293273:A73V	A	-	2	0	RDM1	31281251	1.000000	0.71417	0.014000	0.15608	0.101000	0.19017	4.843000	0.62838	2.141000	0.66446	0.655000	0.94253	GCC	.	.	.	none		0.493	RDM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256588.2	NM_145654	
MLX	6945	hgsc.bcm.edu	37	17	40720856	40720856	+	Splice_Site	SNP	T	T	C			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr17:40720856T>C	ENST00000246912.4	+	4	386	c.333T>C	c.(331-333)gaT>gaC	p.D111D	MLX_ENST00000346833.4_Splice_Site_p.D27D|MLX_ENST00000435881.2_Splice_Site_p.D57D	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	111					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TGAGCGTAGATGATGAGGACA	0.607																																					p.D111D	GBM(121;657 1601 4665 24731 34640)	Atlas-SNP	.											.	MLX	17	.	0			c.T333C						PASS	.						30.0	26.0	27.0					17																	40720856		2203	4300	6503	SO:0001630	splice_region_variant	6945	exon4			CGTAGATGATGAG	AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.332-1T>C	chr17.hg19:g.40720856T>C		21.0	0.0	.		23.0	6.0	.	NM_170607	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Silent	SNP	ENST00000246912.4	hg19	CCDS11430.1																																																																																			.	.	.	none		0.607	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450415.1	NM_170607	Silent
DHDH	27294	hgsc.bcm.edu	37	19	49447704	49447704	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:49447704T>G	ENST00000221403.2	+	6	875	c.835T>G	c.(835-837)Ttt>Gtt	p.F279V	DHDH_ENST00000522614.1_Intron|DHDH_ENST00000523250.1_Missense_Mutation_p.F140V	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	279					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGACTGCAATTTTGACAACGG	0.622																																					p.F279V		Atlas-SNP	.											.	DHDH	35	.	0			c.T835G						PASS	.						65.0	63.0	63.0					19																	49447704		2203	4300	6503	SO:0001583	missense	27294	exon6			TGCAATTTTGACA	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.835T>G	chr19.hg19:g.49447704T>G	ENSP00000221403:p.Phe279Val	147.0	0.0	.		110.0	24.0	.	NM_014475		Missense_Mutation	SNP	ENST00000221403.2	hg19	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453658	0.63290	.	.	ENSG00000104808	ENST00000221403;ENST00000523250	T;T	0.21361	2.01;2.01	4.89	3.87	0.44632	.	0.210406	0.49916	D	0.000136	T	0.23330	0.0564	M	0.77616	2.38	0.80722	D	1	B	0.27117	0.168	B	0.28638	0.092	T	0.05903	-1.0857	10	0.33940	T	0.23	-6.6788	6.733	0.23393	0.0:0.1029:0.0:0.8971	.	279	Q9UQ10	DHDH_HUMAN	V	279;140	ENSP00000221403:F279V;ENSP00000428935:F140V	ENSP00000221403:F279V	F	+	1	0	DHDH	54139516	1.000000	0.71417	0.040000	0.18447	0.014000	0.08584	4.583000	0.60964	2.183000	0.69458	0.402000	0.26972	TTT	.	.	.	none		0.622	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
DHDH	27294	hgsc.bcm.edu	37	19	49447728	49447728	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:49447728T>A	ENST00000221403.2	+	6	899	c.859T>A	c.(859-861)Tat>Aat	p.Y287N	DHDH_ENST00000522614.1_Intron|DHDH_ENST00000523250.1_Missense_Mutation_p.Y148N	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	287					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		AGGCATGAGTTATGAGGCCAA	0.627																																					p.Y287N		Atlas-SNP	.											.	DHDH	35	.	0			c.T859A						PASS	.						70.0	67.0	68.0					19																	49447728		2203	4300	6503	SO:0001583	missense	27294	exon6			ATGAGTTATGAGG	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.859T>A	chr19.hg19:g.49447728T>A	ENSP00000221403:p.Tyr287Asn	153.0	0.0	.		116.0	20.0	.	NM_014475		Missense_Mutation	SNP	ENST00000221403.2	hg19	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	T	34	5.369860	0.95900	.	.	ENSG00000104808	ENST00000221403;ENST00000523250	T;T	0.24151	1.87;1.87	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.63301	-0.6668	10	0.59425	D	0.04	-13.1857	11.3361	0.49505	0.0:0.0:0.0:1.0	.	287	Q9UQ10	DHDH_HUMAN	N	287;148	ENSP00000221403:Y287N;ENSP00000428935:Y148N	ENSP00000221403:Y287N	Y	+	1	0	DHDH	54139540	0.999000	0.42202	0.059000	0.19551	0.914000	0.54420	6.248000	0.72418	2.252000	0.74401	0.402000	0.26972	TAT	.	.	.	none		0.627	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
C20orf141	128653	hgsc.bcm.edu	37	20	2796280	2796280	+	Silent	SNP	G	G	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:2796280G>T	ENST00000380589.4	+	2	531	c.357G>T	c.(355-357)ctG>ctT	p.L119L	TMEM239_ENST00000554164.1_Intron|TMEM239_ENST00000361033.1_5'Flank|TMEM239_ENST00000380585.1_5'Flank|TMEM239_ENST00000380593.4_Intron|C20orf141_ENST00000603872.1_Silent_p.L119L	NM_080739.2	NP_542777.1	Q9NUB4	CT141_HUMAN	chromosome 20 open reading frame 141	119	Leu-rich.					integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	10						CTCTACTCCTGCAAATGGGTA	0.627																																					p.L119L		Atlas-SNP	.											.	C20orf141	21	.	0			c.G357T						PASS	.						57.0	55.0	56.0					20																	2796280		2203	4300	6503	SO:0001819	synonymous_variant	128653	exon2			ACTCCTGCAAATG		CCDS13034.1	20p13	2012-10-30			ENSG00000258713	ENSG00000258713			16134	protein-coding gene	gene with protein product							Standard	NM_001256538		Approved	dJ860F19.4	uc002wgw.3	Q9NUB4	OTTHUMG00000031707	ENST00000380589.4:c.357G>T	chr20.hg19:g.2796280G>T		98.0	0.0	.		89.0	14.0	.	NM_080739		Silent	SNP	ENST00000380589.4	hg19	CCDS13034.1																																																																																			.	.	.	none		0.627	C20orf141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077644.2	NM_080739	
NINL	22981	hgsc.bcm.edu	37	20	25469911	25469911	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:25469911G>T	ENST00000278886.6	-	13	1719	c.1646C>A	c.(1645-1647)gCa>gAa	p.A549E	NINL_ENST00000422516.1_Missense_Mutation_p.A549E	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	549					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CTTCAGGACTGCTGCGAACCG	0.617																																					p.A549E		Atlas-SNP	.											.	NINL	148	.	0			c.C1646A						PASS	.						170.0	155.0	160.0					20																	25469911		2203	4300	6503	SO:0001583	missense	22981	exon13			AGGACTGCTGCGA		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1646C>A	chr20.hg19:g.25469911G>T	ENSP00000278886:p.Ala549Glu	205.0	0.0	.		170.0	24.0	.	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.724364	0.00694	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.27402	1.91;1.67	4.58	0.0634	0.14348	.	0.597531	0.16327	N	0.219312	T	0.10508	0.0257	N	0.14661	0.345	0.09310	N	1	B;B	0.16603	0.018;0.012	B;B	0.11329	0.005;0.006	T	0.27673	-1.0067	10	0.02654	T	1	-1.509	0.7711	0.01024	0.2336:0.1117:0.2575:0.3972	.	549;549	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	E	549	ENSP00000278886:A549E;ENSP00000410431:A549E	ENSP00000278886:A549E	A	-	2	0	NINL	25417911	0.001000	0.12720	0.000000	0.03702	0.299000	0.27559	0.333000	0.19768	-0.118000	0.11851	0.651000	0.88453	GCA	.	.	.	none		0.617	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
TP53TG5	27296	hgsc.bcm.edu	37	20	44005872	44005872	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr20:44005872C>G	ENST00000372726.3	-	3	390	c.234G>C	c.(232-234)aaG>aaC	p.K78N	TP53TG5_ENST00000494455.1_5'UTR|SYS1-DBNDD2_ENST00000475242.1_Intron|TP53TG5_ENST00000537995.1_Missense_Mutation_p.K62N|SYS1-DBNDD2_ENST00000452133.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	78					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						TGCGGAGAATCTTTGGAACAC	0.512																																					p.K78N		Atlas-SNP	.											.	TP53TG5	36	.	0			c.G234C						PASS	.						168.0	155.0	160.0					20																	44005872		2203	4300	6503	SO:0001583	missense	27296	exon3			GAGAATCTTTGGA	AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.234G>C	chr20.hg19:g.44005872C>G	ENSP00000361811:p.Lys78Asn	219.0	0.0	.		185.0	11.0	.	NM_014477		Missense_Mutation	SNP	ENST00000372726.3	hg19	CCDS13352.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593647	0.46214	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.18338	2.22;2.22	5.43	5.43	0.79202	.	1.020720	0.07785	N	0.953949	T	0.25195	0.0612	L	0.39898	1.24	0.09310	N	1	P	0.49090	0.919	P	0.48704	0.587	T	0.20438	-1.0275	10	0.66056	D	0.02	-0.733	12.8311	0.57746	0.0:0.8361:0.1639:0.0	.	78	Q9Y2B4	T53G5_HUMAN	N	78;62	ENSP00000361811:K78N;ENSP00000438374:K62N	ENSP00000361811:K78N	K	-	3	2	TP53TG5	43439286	0.039000	0.19947	0.020000	0.16555	0.437000	0.31866	2.319000	0.43788	2.720000	0.93068	0.591000	0.81541	AAG	.	.	.	none		0.512	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079460.1	NM_014477	
NR2C2AP	126382	hgsc.bcm.edu	37	19	19313644	19313645	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DZ-6134-01A-11D-1961-08	TCGA-DZ-6134-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	230ddafa-8d9f-4ddc-b864-ba8eb42a31ab	8e8a3cd2-c9ae-4be6-8682-214badaa00a5	g.chr19:19313644_19313645insT	ENST00000331552.7	-	2	447_448	c.84_85insA	c.(82-87)aaacatfs	p.H29fs	NR2C2AP_ENST00000420605.3_Frame_Shift_Ins_p.H29fs|NR2C2AP_ENST00000544883.1_Frame_Shift_Ins_p.H29fs|NR2C2AP_ENST00000538165.2_Frame_Shift_Ins_p.H29fs	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein	29					cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			TCGAAAAGATGTTTTTTTCCAA	0.54																																					p.H29fs		Atlas-INDEL	.											.	NR2C2AP	7	.	0			c.85_86insA						PASS	.																																			SO:0001589	frameshift_variant	126382	exon2			.	AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.85dupA	chr19.hg19:g.19313651_19313651dupT	ENSP00000332823:p.His29fs	138.0	0.0	0		116.0	20.0	0.172414	NM_176880	A6NGP7|B4DW92	Frame_Shift_Ins	INS	ENST00000331552.7	hg19	CCDS32967.1																																																																																			.	.	.	none		0.540	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402936.4	NM_176880	
