#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MCOLN3	55283	hgsc.bcm.edu	37	1	85491894	85491894	+	Silent	SNP	G	G	C			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr1:85491894G>C	ENST00000370589.2	-	8	958	c.906C>G	c.(904-906)ctC>ctG	p.L302L	WDR63_ENST00000370596.1_Intron|MCOLN3_ENST00000370587.1_Silent_p.L302L|MCOLN3_ENST00000474447.1_5'Flank|MCOLN3_ENST00000341115.4_Silent_p.L246L	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	302					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		ATCTAATGCAGAGGATTAATG	0.398																																					p.L302L		Atlas-SNP	.											.	MCOLN3	74	.	0			c.C906G						PASS	.						133.0	121.0	125.0					1																	85491894		2203	4300	6503	SO:0001819	synonymous_variant	55283	exon8			AATGCAGAGGATT	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.906C>G	chr1.hg19:g.85491894G>C		132.0	0.0	.		116.0	44.0	.	NM_018298	Q5T4H5|Q5T4H6|Q9NV09	Silent	SNP	ENST00000370589.2	hg19	CCDS701.1																																																																																			.	.	.	none		0.398	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
ARHGAP30	257106	hgsc.bcm.edu	37	1	161029441	161029441	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr1:161029441G>T	ENST00000368013.3	-	2	483	c.163C>A	c.(163-165)Cgc>Agc	p.R55S	ARHGAP30_ENST00000368015.1_Intron|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.R55S	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	55	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CCTGAGAGGCGGTAGATCCCA	0.562																																					p.R55S		Atlas-SNP	.											.	ARHGAP30	105	.	0			c.C163A						PASS	.						106.0	94.0	98.0					1																	161029441		2203	4300	6503	SO:0001583	missense	257106	exon2			AGAGGCGGTAGAT	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.163C>A	chr1.hg19:g.161029441G>T	ENSP00000356992:p.Arg55Ser	138.0	0.0	.		140.0	6.0	.	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	hg19	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106697	0.77096	.	.	ENSG00000186517	ENST00000368016;ENST00000368013	T;T	0.52295	0.67;0.67	4.91	4.91	0.64330	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.73961	0.3654	H	0.97732	4.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82063	-0.0643	10	0.87932	D	0	.	11.1138	0.48249	0.0:0.0:0.8152:0.1848	.	55;55	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	S	55	ENSP00000356995:R55S;ENSP00000356992:R55S	ENSP00000356992:R55S	R	-	1	0	ARHGAP30	159296065	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.839000	0.39220	2.419000	0.82065	0.484000	0.47621	CGC	.	.	.	none		0.562	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
STON1	11037	hgsc.bcm.edu	37	2	48818889	48818889	+	Silent	SNP	C	C	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr2:48818889C>A	ENST00000406226.1	+	4	2223	c.2028C>A	c.(2026-2028)tcC>tcA	p.S676S	STON1-GTF2A1L_ENST00000394751.3_Silent_p.S676S|STON1_ENST00000309835.3_Silent_p.S676S|STON1-GTF2A1L_ENST00000309827.2_Silent_p.S676S|STON1-GTF2A1L_ENST00000402114.2_Silent_p.S676S|STON1-GTF2A1L_ENST00000405008.1_Silent_p.S676S|STON1_ENST00000404752.1_Silent_p.S676S|STON1-GTF2A1L_ENST00000394754.1_Silent_p.S676S	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	676	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTCAGTTTTCCGTGCCTGACA	0.483																																					p.S676S		Atlas-SNP	.											.	STON1	100	.	0			c.C2028A						PASS	.						155.0	146.0	149.0					2																	48818889		2203	4300	6503	SO:0001819	synonymous_variant	11037	exon4			GTTTTCCGTGCCT	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.2028C>A	chr2.hg19:g.48818889C>A		138.0	0.0	.		129.0	7.0	.	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	ENST00000406226.1	hg19	CCDS1841.1																																																																																			.	.	.	none		0.483	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
SULT1C4	27233	hgsc.bcm.edu	37	2	108994906	108994906	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr2:108994906T>C	ENST00000272452.2	+	1	439	c.113T>C	c.(112-114)aTc>aCc	p.I38T	SULT1C4_ENST00000409309.3_Missense_Mutation_p.I38T	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	38					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						TGGGATAAGATCTGGAACTTC	0.473																																					p.I38T		Atlas-SNP	.											.	SULT1C4	41	.	0			c.T113C						PASS	.						171.0	176.0	174.0					2																	108994906		2203	4300	6503	SO:0001583	missense	27233	exon1			ATAAGATCTGGAA	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.113T>C	chr2.hg19:g.108994906T>C	ENSP00000272452:p.Ile38Thr	289.0	0.0	.		315.0	134.0	.	NM_006588	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	ENST00000272452.2	hg19	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.318519	0.81469	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	T;T	0.01918	4.56;4.56	5.06	5.06	0.68205	.	0.127728	0.35555	N	0.003129	T	0.04452	0.0122	N	0.08118	0	0.31369	N	0.680401	P;D;D	0.63880	0.954;0.993;0.991	P;D;D	0.68765	0.476;0.96;0.918	T	0.35773	-0.9775	10	0.66056	D	0.02	.	14.1553	0.65413	0.0:0.0:0.0:1.0	.	38;38;38	Q08AS5;O75897;Q6PD90	.;ST1C4_HUMAN;.	T	38	ENSP00000272452:I38T;ENSP00000387225:I38T	ENSP00000272452:I38T	I	+	2	0	SULT1C4	108361338	0.999000	0.42202	1.000000	0.80357	0.870000	0.49936	4.416000	0.59815	2.125000	0.65367	0.496000	0.49642	ATC	.	.	.	none		0.473	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
ROBO1	6091	hgsc.bcm.edu	37	3	78683096	78683096	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr3:78683096C>A	ENST00000464233.1	-	24	3583	c.3470G>T	c.(3469-3471)aGt>aTt	p.S1157I	ROBO1_ENST00000467549.1_Missense_Mutation_p.S1057I|ROBO1_ENST00000436010.2_Missense_Mutation_p.S1118I|ROBO1_ENST00000495273.1_Missense_Mutation_p.S1112I	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1157					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGATGTACTACTGCCCCGGTC	0.423																																					p.S1157I		Atlas-SNP	.											.	ROBO1	833	.	0			c.G3470T						PASS	.						224.0	211.0	215.0					3																	78683096		1928	4130	6058	SO:0001583	missense	6091	exon24			GTACTACTGCCCC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3470G>T	chr3.hg19:g.78683096C>A	ENSP00000420321:p.Ser1157Ile	128.0	0.0	.		155.0	38.0	.	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	hg19	CCDS54611.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.301088|4.301088	0.81136|0.81136	.|.	.|.	ENSG00000169855|ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414|ENST00000472273	D;D;D;D|.	0.91464|.	-2.85;-2.85;-2.85;-2.85|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74756|0.74756	0.3758|0.3758	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	D;B;D;P;P|.	0.76494|.	0.997;0.27;0.999;0.754;0.866|.	D;B;D;B;B|.	0.83275|.	0.994;0.082;0.996;0.293;0.376|.	T|T	0.70912|0.70912	-0.4743|-0.4743	9|5	.|.	.|.	.|.	.|.	20.1001|20.1001	0.97870|0.97870	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1121;1157;1112;1057;1118|.	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4|.	.;ROBO1_HUMAN;.;.;.|.	I|L	1118;1112;1157;1112;1057;1161|84	ENSP00000406043:S1118I;ENSP00000420321:S1157I;ENSP00000420637:S1112I;ENSP00000417992:S1057I|.	.|.	S|V	-|-	2|1	0|0	ROBO1|ROBO1	78765786|78765786	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.595000|0.595000	0.36748|0.36748	7.466000|7.466000	0.80914|0.80914	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	AGT|GTA	.	.	.	none		0.423	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376148	113376148	+	Missense_Mutation	SNP	T	T	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr3:113376148T>G	ENST00000478658.1	-	5	4398	c.4381A>C	c.(4381-4383)Aag>Cag	p.K1461Q	KIAA2018_ENST00000316407.4_Missense_Mutation_p.K1461Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1461	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						tgctgctgctTTATGTAGAGA	0.498																																					p.K1461Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A4381C						PASS	.						66.0	71.0	69.0					3																	113376148		2179	4278	6457	SO:0001583	missense	205717	exon7			GCTGCTTTATGTA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4381A>C	chr3.hg19:g.113376148T>G	ENSP00000420721:p.Lys1461Gln	52.0	0.0	.		105.0	7.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.802014	0.50315	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.31247	1.5;1.5	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	L	0.32530	0.975	0.49213	D	0.999766	D	0.71674	0.998	D	0.78314	0.991	T	0.41822	-0.9487	10	0.62326	D	0.03	-15.6625	15.5299	0.75952	0.0:0.0:0.0:1.0	.	1461	Q68DE3	K2018_HUMAN	Q	1461	ENSP00000320794:K1461Q;ENSP00000420721:K1461Q	ENSP00000320794:K1461Q	K	-	1	0	KIAA2018	114858838	1.000000	0.71417	0.987000	0.45799	0.600000	0.36913	7.182000	0.77689	2.254000	0.74563	0.459000	0.35465	AAG	.	.	.	none		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ADCY5	111	hgsc.bcm.edu	37	3	123047579	123047579	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr3:123047579C>A	ENST00000462833.1	-	6	2929	c.1717G>T	c.(1717-1719)Ggt>Tgt	p.G573C	ADCY5_ENST00000491190.1_Missense_Mutation_p.G206C|ADCY5_ENST00000309879.5_Missense_Mutation_p.G223C	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	573	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CCAAGGACACCGCAGTGTACT	0.597											OREG0015742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G573C		Atlas-SNP	.											.	ADCY5	169	.	0			c.G1717T						PASS	.						179.0	140.0	153.0					3																	123047579		2203	4300	6503	SO:0001583	missense	111	exon6			GGACACCGCAGTG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1717G>T	chr3.hg19:g.123047579C>A	ENSP00000419361:p.Gly573Cys	151.0	0.0	.	1523	189.0	11.0	.	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	hg19	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403693	0.96051	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63	5.38	5.38	0.77491	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.97536	0.9193	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99063	1.0831	10	0.87932	D	0	.	19.1549	0.93506	0.0:1.0:0.0:0.0	.	573;206	O95622;B3KWA8	ADCY5_HUMAN;.	C	573;206;223;132	ENSP00000419361:G573C;ENSP00000418537:G206C;ENSP00000308685:G223C;ENSP00000420082:G132C	ENSP00000308685:G223C	G	-	1	0	ADCY5	124530269	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.529000	0.85273	0.655000	0.94253	GGT	.	.	.	none		0.597	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
SSR3	6747	hgsc.bcm.edu	37	3	156266708	156266708	+	Missense_Mutation	SNP	C	C	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr3:156266708C>A	ENST00000265044.2	-	3	439	c.345G>T	c.(343-345)aaG>aaT	p.K115N	SSR3_ENST00000496050.1_Missense_Mutation_p.K63N|SSR3_ENST00000476217.1_Missense_Mutation_p.K115N|SSR3_ENST00000463503.1_Missense_Mutation_p.K63N|SSR3_ENST00000467789.1_Missense_Mutation_p.K115N|SSR3_ENST00000478842.1_5'UTR	NM_007107.3	NP_009038.1	Q9UNL2	SSRG_HUMAN	signal sequence receptor, gamma (translocon-associated protein gamma)	115					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	integral component of endoplasmic reticulum membrane (GO:0030176)|Sec61 translocon complex (GO:0005784)				endometrium(1)|prostate(2)	3			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CATCTTTCTCCTTCCGAGACA	0.363																																					p.K115N		Atlas-SNP	.											.	SSR3	17	.	0			c.G345T						PASS	.						88.0	85.0	86.0					3																	156266708		2203	4300	6503	SO:0001583	missense	6747	exon3			TTTCTCCTTCCGA	BC017203	CCDS3176.1	3q25.31	2004-02-27			ENSG00000114850	ENSG00000114850			11325	protein-coding gene	gene with protein product		606213					Standard	NM_007107		Approved	TRAPG	uc003fau.3	Q9UNL2	OTTHUMG00000158632	ENST00000265044.2:c.345G>T	chr3.hg19:g.156266708C>A	ENSP00000265044:p.Lys115Asn	77.0	0.0	.		116.0	26.0	.	NM_007107	B2R7D0|B4E2P2|D3DNK5|Q549M4	Missense_Mutation	SNP	ENST00000265044.2	hg19	CCDS3176.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955265	0.73902	.	.	ENSG00000114850	ENST00000265044;ENST00000467789;ENST00000476217;ENST00000463503;ENST00000496050	.	.	.	5.41	2.62	0.31277	.	0.094589	0.64402	D	0.000001	T	0.79015	0.4375	M	0.87827	2.91	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.971	T	0.81282	-0.1003	9	0.87932	D	0	-1.3739	11.1574	0.48495	0.0:0.7892:0.0:0.2108	.	115;115	B4E2P2;Q9UNL2	.;SSRG_HUMAN	N	115;115;115;63;63	.	ENSP00000265044:K115N	K	-	3	2	SSR3	157749402	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.461000	0.35255	0.767000	0.33267	0.650000	0.86243	AAG	.	.	.	none		0.363	SSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351521.1	NM_007107	
HELQ	113510	hgsc.bcm.edu	37	4	84342848	84342848	+	Silent	SNP	A	A	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr4:84342848A>G	ENST00000295488.3	-	15	2979	c.2817T>C	c.(2815-2817)ttT>ttC	p.F939F	HELQ_ENST00000510985.1_Silent_p.F872F	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	939					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						TATAAAGAACAAAAGACAGAT	0.343								Other identified genes with known or suspected DNA repair function																													p.F939F		Atlas-SNP	.											.	HELQ	95	.	0			c.T2817C						PASS	.						84.0	83.0	84.0					4																	84342848		2203	4300	6503	SO:0001819	synonymous_variant	113510	exon15			AAGAACAAAAGAC	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.2817T>C	chr4.hg19:g.84342848A>G		58.0	0.0	.		61.0	26.0	.	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Silent	SNP	ENST00000295488.3	hg19	CCDS3603.1																																																																																			.	.	.	none		0.343	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
BHMT	635	hgsc.bcm.edu	37	5	78415091	78415091	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr5:78415091T>C	ENST00000274353.5	+	3	283	c.176T>C	c.(175-177)cTt>cCt	p.L59P	DMGDH_ENST00000520388.1_Intron|BHMT_ENST00000524080.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	59	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GTTCGCCAGCTTCATCGAGAG	0.438																																					p.L59P		Atlas-SNP	.											.	BHMT	53	.	0			c.T176C						PASS	.						99.0	94.0	95.0					5																	78415091		2203	4300	6503	SO:0001583	missense	635	exon3			GCCAGCTTCATCG	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.176T>C	chr5.hg19:g.78415091T>C	ENSP00000274353:p.Leu59Pro	98.0	0.0	.		112.0	42.0	.	NM_001713	Q9UNI9	Missense_Mutation	SNP	ENST00000274353.5	hg19	CCDS4046.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611557	0.87258	.	.	ENSG00000145692	ENST00000274353	T	0.13089	2.62	5.6	5.6	0.85130	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.48390	0.1497	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61237	-0.7103	10	0.87932	D	0	-13.4798	16.0786	0.80985	0.0:0.0:0.0:1.0	.	59	Q93088	BHMT1_HUMAN	P	59	ENSP00000274353:L59P	ENSP00000274353:L59P	L	+	2	0	BHMT	78450847	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.669000	0.83911	2.254000	0.74563	0.460000	0.39030	CTT	.	.	.	none		0.438	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	
PGGT1B	5229	hgsc.bcm.edu	37	5	114573574	114573574	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr5:114573574G>A	ENST00000419445.1	-	4	480	c.460C>T	c.(460-462)Ctt>Ttt	p.L154F	PGGT1B_ENST00000379615.3_Missense_Mutation_p.L154F	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	154					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TCCAGCTGAAGGGCTCTCAAG	0.383																																					p.L154F		Atlas-SNP	.											.	PGGT1B	26	.	0			c.C460T						PASS	.						72.0	78.0	76.0					5																	114573574		2201	4300	6501	SO:0001583	missense	5229	exon4			GCTGAAGGGCTCT		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.460C>T	chr5.hg19:g.114573574G>A	ENSP00000404676:p.Leu154Phe	161.0	0.0	.		188.0	79.0	.	NM_005023	Q5MJP9	Missense_Mutation	SNP	ENST00000419445.1	hg19	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254124	0.59212	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.32515	1.45;1.45	5.47	4.6	0.57074	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.113305	0.64402	D	0.000008	T	0.64692	0.2621	M	0.91818	3.245	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	T	0.75164	-0.3414	10	0.66056	D	0.02	-11.4224	16.6769	0.85281	0.0:0.1298:0.8702:0.0	.	154;154	P53609-2;P53609	.;PGTB1_HUMAN	F	154	ENSP00000404676:L154F;ENSP00000368935:L154F	ENSP00000368935:L154F	L	-	1	0	PGGT1B	114601473	1.000000	0.71417	0.947000	0.38551	0.329000	0.28539	9.740000	0.98839	1.422000	0.47177	0.655000	0.94253	CTT	.	.	.	none		0.383	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023	
WDR55	54853	hgsc.bcm.edu	37	5	140049032	140049032	+	Silent	SNP	T	T	C			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr5:140049032T>C	ENST00000358337.5	+	7	1182	c.945T>C	c.(943-945)caT>caC	p.H315H	WDR55_ENST00000520764.1_3'UTR	NM_017706.4	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	315					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)				NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTAGTGGCCATGACCAGCGCC	0.632																																					p.H315H		Atlas-SNP	.											.	WDR55	27	.	0			c.T945C						PASS	.						27.0	30.0	29.0					5																	140049032		2203	4300	6503	SO:0001819	synonymous_variant	54853	exon7			TGGCCATGACCAG	AK000202	CCDS4235.1	5q31.3	2013-01-09			ENSG00000120314	ENSG00000120314		"""WD repeat domain containing"""	25971	protein-coding gene	gene with protein product						12477932	Standard	NM_017706		Approved	FLJ20195, FLJ21702	uc003lgr.4	Q9H6Y2	OTTHUMG00000129506	ENST00000358337.5:c.945T>C	chr5.hg19:g.140049032T>C		36.0	0.0	.		45.0	18.0	.	NM_017706	Q9NXK4	Silent	SNP	ENST00000358337.5	hg19	CCDS4235.1																																																																																			.	.	.	none		0.632	WDR55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251680.3	NM_017706	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140856169	140856169	+	Silent	SNP	C	C	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr5:140856169C>A	ENST00000308177.3	+	1	590	c.486C>A	c.(484-486)ccC>ccA	p.P162P	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	162	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCACGATCCCGATGTGGGAA	0.567																																					p.P162P		Atlas-SNP	.											.	PCDHGC3	173	.	0			c.C486A						PASS	.						54.0	56.0	56.0					5																	140856169		2203	4300	6503	SO:0001819	synonymous_variant	5098	exon1			CGATCCCGATGTG	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.486C>A	chr5.hg19:g.140856169C>A		125.0	0.0	.		101.0	7.0	.	NM_032402	O60622|Q08192|Q9Y5C4	Silent	SNP	ENST00000308177.3	hg19	CCDS4261.1																																																																																			.	.	.	none		0.567	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
REV3L	5980	hgsc.bcm.edu	37	6	111632330	111632330	+	Missense_Mutation	SNP	A	A	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr6:111632330A>T	ENST00000358835.3	-	30	9191	c.8737T>A	c.(8737-8739)Tac>Aac	p.Y2913N	REV3L_ENST00000368805.1_Missense_Mutation_p.Y2913N|REV3L_ENST00000368802.3_Missense_Mutation_p.Y2913N|REV3L_ENST00000435970.1_Missense_Mutation_p.Y2835N|RP5-1112D6.8_ENST00000607434.1_RNA|REV3L_ENST00000462119.1_5'UTR			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2913					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTTCCTCTGTATTCCTTGGCA	0.408								DNA polymerases (catalytic subunits)																													p.Y2913N		Atlas-SNP	.											.	REV3L	386	.	0			c.T8737A						PASS	.						179.0	179.0	179.0					6																	111632330		2203	4300	6503	SO:0001583	missense	5980	exon29			CTCTGTATTCCTT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.8737T>A	chr6.hg19:g.111632330A>T	ENSP00000351697:p.Tyr2913Asn	258.0	0.0	.		267.0	91.0	.	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	A	27.2	4.809421	0.90707	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.48	5.48	0.80851	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.069117	0.64402	D	0.000012	T	0.41026	0.1141	M	0.88310	2.945	0.58432	D	0.999999	D	0.69078	0.997	D	0.81914	0.995	T	0.52601	-0.8554	10	0.87932	D	0	-3.7627	15.5643	0.76277	1.0:0.0:0.0:0.0	.	2913	O60673	DPOLZ_HUMAN	N	2913;2913;2913;2835	ENSP00000357792:Y2913N;ENSP00000357795:Y2913N;ENSP00000351697:Y2913N;ENSP00000402003:Y2835N	ENSP00000351697:Y2913N	Y	-	1	0	REV3L	111739023	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.266000	0.95659	2.085000	0.62840	0.455000	0.32223	TAC	.	.	.	none		0.408	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
MET	4233	hgsc.bcm.edu	37	7	116423474	116423474	+	Missense_Mutation	SNP	T	T	C	rs121913245		TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr7:116423474T>C	ENST00000318493.6	+	19	3990	c.3803T>C	c.(3802-3804)aTg>aCg	p.M1268T	MET_ENST00000397752.3_Missense_Mutation_p.M1250T|MET_ENST00000539704.1_Missense_Mutation_p.M120T			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.M1268T(4)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GTGAAGTGGATGGCTTTGGAA	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.M1268T		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,rectum,carcinoma,+1,5	MET	412	.	4	Substitution - Missense(4)	kidney(4)	c.T3803C	GRCh37	CM992181	MET	M	rs121913245	PASS	.						93.0	92.0	92.0					7																	116423474		1872	4102	5974	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AGTGGATGGCTTT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3803T>C	chr7.hg19:g.116423474T>C	ENSP00000317272:p.Met1268Thr	61.0	0.0	.		61.0	25.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740165	0.69304	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.37752	1.18;1.18;1.18	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61714	0.2369	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;1.0	T	0.65734	-0.6096	10	0.87932	D	0	.	16.2225	0.82267	0.0:0.0:0.0:1.0	.	1268;1250	P08581-2;P08581	.;MET_HUMAN	T	1250;1268;120	ENSP00000380860:M1250T;ENSP00000317272:M1268T;ENSP00000445020:M120T	ENSP00000317272:M1268T	M	+	2	0	MET	116210710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.289000	0.77006	0.460000	0.39030	ATG	.	.	.	weak		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
PRKAG2	51422	hgsc.bcm.edu	37	7	151372604	151372604	+	Missense_Mutation	SNP	A	A	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr7:151372604A>G	ENST00000287878.4	-	4	1090	c.586T>C	c.(586-588)Tcc>Ccc	p.S196P	PRKAG2_ENST00000392801.2_Missense_Mutation_p.S152P|PRKAG2_ENST00000492843.1_Missense_Mutation_p.S72P|PRKAG2_ENST00000433631.2_Missense_Mutation_p.S72P|PRKAG2_ENST00000461529.1_5'Flank	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	196					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TCCGGGGGGGAAGACGAGGCA	0.587																																					p.S196P		Atlas-SNP	.											.	PRKAG2	86	.	0			c.T586C						PASS	.						107.0	94.0	98.0					7																	151372604		2203	4300	6503	SO:0001583	missense	51422	exon4			GGGGGGAAGACGA	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.586T>C	chr7.hg19:g.151372604A>G	ENSP00000287878:p.Ser196Pro	125.0	0.0	.		123.0	5.0	.	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	hg19	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	A	8.526	0.869797	0.17322	.	.	ENSG00000106617	ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801	D;D;D;D	0.91295	-2.16;-2.82;-2.82;-2.56	5.21	1.48	0.22813	.	0.287492	0.34652	N	0.003782	T	0.82066	0.4956	L	0.27053	0.805	0.20926	N	0.999826	B;B;B	0.14805	0.007;0.011;0.001	B;B;B	0.13407	0.008;0.009;0.0	T	0.70385	-0.4886	10	0.51188	T	0.08	.	8.0661	0.30661	0.7474:0.0:0.2526:0.0	.	72;196;196	B7Z6X8;Q8NCK6;Q9UGJ0	.;.;AAKG2_HUMAN	P	196;72;72;152	ENSP00000287878:S196P;ENSP00000419577:S72P;ENSP00000406544:S72P;ENSP00000376549:S152P	ENSP00000287878:S196P	S	-	1	0	PRKAG2	151003537	1.000000	0.71417	0.019000	0.16419	0.005000	0.04900	2.388000	0.44398	0.019000	0.15079	-0.388000	0.06559	TCC	.	.	.	none		0.587	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
TOPORS	10210	hgsc.bcm.edu	37	9	32543270	32543270	+	Missense_Mutation	SNP	T	T	C			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr9:32543270T>C	ENST00000360538.2	-	3	1369	c.1253A>G	c.(1252-1254)gAt>gGt	p.D418G	TOPORS_ENST00000379858.1_Missense_Mutation_p.D353G	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	418					cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TGGAGTTTCATCATCCCATGG	0.423																																					p.D418G		Atlas-SNP	.											.	TOPORS	127	.	0			c.A1253G						PASS	.						126.0	126.0	126.0					9																	32543270		2203	4299	6502	SO:0001583	missense	10210	exon3			GTTTCATCATCCC	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1253A>G	chr9.hg19:g.32543270T>C	ENSP00000353735:p.Asp418Gly	156.0	0.0	.		140.0	59.0	.	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	hg19	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	T	9.322	1.058402	0.19987	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.18657	2.2;2.21	5.63	5.63	0.86233	.	0.140255	0.33199	N	0.005175	T	0.20292	0.0488	L	0.34521	1.04	0.52099	D	0.999947	P	0.47191	0.891	B	0.42522	0.39	T	0.01252	-1.1405	10	0.59425	D	0.04	-15.9255	14.84	0.70217	0.0:0.0:0.0:1.0	.	418	Q9NS56	TOPRS_HUMAN	G	418;353	ENSP00000353735:D418G;ENSP00000369187:D353G	ENSP00000353735:D418G	D	-	2	0	TOPORS	32533270	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	7.698000	0.84413	2.145000	0.66743	0.528000	0.53228	GAT	.	.	.	none		0.423	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
SPTAN1	6709	hgsc.bcm.edu	37	9	131361264	131361264	+	Splice_Site	SNP	G	G	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr9:131361264G>T	ENST00000372731.4	+	26	3652	c.3542G>T	c.(3541-3543)aGg>aTg	p.R1181M	SPTAN1_ENST00000372739.3_Splice_Site_p.R1181M|SPTAN1_ENST00000475367.1_3'UTR|SPTAN1_ENST00000358161.5_Splice_Site_p.R1181M	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1181					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						ATGATGCCCAGGGTAAGTTTC	0.398																																					p.R1181M	NSCLC(120;833 1744 2558 35612 37579)	Atlas-SNP	.											.	SPTAN1	266	.	0			c.G3542T						PASS	.						195.0	177.0	183.0					9																	131361264		2203	4300	6503	SO:0001630	splice_region_variant	6709	exon26			TGCCCAGGGTAAG	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3543+1G>T	chr9.hg19:g.131361264G>T		131.0	0.0	.		129.0	57.0	.	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	hg19	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758441	0.49468	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.51325	0.71;0.73;0.71	5.93	2.99	0.34606	.	0.237058	0.49916	D	0.000123	T	0.27419	0.0673	N	0.08118	0	0.41841	D	0.990122	B;B;P;P;P	0.37276	0.187;0.22;0.589;0.589;0.454	B;B;B;B;B	0.37047	0.121;0.188;0.24;0.24;0.121	T	0.13045	-1.0524	10	0.72032	D	0.01	.	10.0762	0.42362	0.2288:0.0:0.7712:0.0	.	1181;1161;1161;1181;1181	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	M	1181;1181;1181;1161	ENSP00000350882:R1181M;ENSP00000361816:R1181M;ENSP00000361824:R1181M	ENSP00000350882:R1181M	R	+	2	0	SPTAN1	130401085	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.468000	0.35332	0.342000	0.23796	0.555000	0.69702	AGG	.	.	.	none		0.398	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	Missense_Mutation
CHD4	1108	hgsc.bcm.edu	37	12	6711561	6711561	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr12:6711561C>G	ENST00000357008.2	-	3	366	c.203G>C	c.(202-204)aGc>aCc	p.S68T	CHD4_ENST00000309577.6_Missense_Mutation_p.S68T|CHD4_ENST00000544040.1_Missense_Mutation_p.S68T|CHD4_ENST00000544484.1_Missense_Mutation_p.S65T	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	68					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTGGCGCTTGCTCTTAGGGAT	0.478																																					p.S68T	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											.	CHD4	539	.	0			c.G203C						PASS	.						238.0	240.0	239.0					12																	6711561		2203	4300	6503	SO:0001583	missense	1108	exon3			CGCTTGCTCTTAG	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.203G>C	chr12.hg19:g.6711561C>G	ENSP00000349508:p.Ser68Thr	520.0	0.0	.		417.0	127.0	.	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	hg19	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.660131	0.29515	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942;ENST00000545584	D;D;D;D;T	0.90197	-2.63;-2.6;-2.62;-2.63;0.88	5.26	5.26	0.73747	.	0.301114	0.34879	N	0.003602	D	0.84106	0.5399	L	0.36672	1.1	0.38243	D	0.941392	B;B;B	0.31817	0.341;0.231;0.341	B;B;B	0.28011	0.085;0.027;0.059	T	0.81773	-0.0779	10	0.12766	T	0.61	-0.8518	14.1344	0.65276	0.1501:0.8499:0.0:0.0	.	68;68;68	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	T	65;68;68;68;49;68;68	ENSP00000440392:S65T;ENSP00000440542:S68T;ENSP00000312419:S68T;ENSP00000349508:S68T;ENSP00000437506:S68T	ENSP00000312419:S68T	S	-	2	0	CHD4	6581822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.832000	0.55783	2.633000	0.89246	0.555000	0.69702	AGC	.	.	.	none		0.478	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
TUBA3C	7278	hgsc.bcm.edu	37	13	19751148	19751148	+	Silent	SNP	C	C	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr13:19751148C>G	ENST00000400113.3	-	4	1079	c.975G>C	c.(973-975)ccG>ccC	p.P325P		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	325					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TGACATCTTTCGGGACCACAT	0.547																																					p.P325P		Atlas-SNP	.											TUBA3C,NS,carcinoma,0,2	TUBA3C	166	.	0			c.G975C						PASS	.						158.0	130.0	139.0					13																	19751148		2203	4300	6503	SO:0001819	synonymous_variant	7278	exon4			ATCTTTCGGGACC	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.975G>C	chr13.hg19:g.19751148C>G		180.0	2.0	.		138.0	6.0	.	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	hg19	CCDS9284.1																																																																																			.	C|1.000;|0.000	.	weak		0.547	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
LNX2	222484	hgsc.bcm.edu	37	13	28143269	28143269	+	Silent	SNP	G	G	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr13:28143269G>A	ENST00000316334.3	-	3	681	c.552C>T	c.(550-552)ggC>ggT	p.G184G		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	184					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CAGGCACTGCGCCTGTCCCCA	0.532																																					p.G184G		Atlas-SNP	.											.	LNX2	70	.	0			c.C552T						PASS	.						241.0	235.0	237.0					13																	28143269		2203	4300	6503	SO:0001819	synonymous_variant	222484	exon3			CACTGCGCCTGTC	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.552C>T	chr13.hg19:g.28143269G>A		339.0	1.0	.		346.0	119.0	.	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Silent	SNP	ENST00000316334.3	hg19	CCDS9323.1																																																																																			.	.	.	none		0.532	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
KLHL1	57626	hgsc.bcm.edu	37	13	70549759	70549759	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr13:70549759C>G	ENST00000377844.4	-	2	1432	c.673G>C	c.(673-675)Gca>Cca	p.A225P	KLHL1_ENST00000545028.1_Intron	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	225	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TACCTATGTGCAGGTATCTTT	0.403																																					p.A225P		Atlas-SNP	.											.	KLHL1	164	.	0			c.G673C						PASS	.						148.0	136.0	140.0					13																	70549759		2203	4300	6503	SO:0001583	missense	57626	exon2			TATGTGCAGGTAT	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.673G>C	chr13.hg19:g.70549759C>G	ENSP00000367075:p.Ala225Pro	136.0	0.0	.		157.0	50.0	.	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	hg19	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876217	0.72180	.	.	ENSG00000150361	ENST00000377844	T	0.78003	-1.14	5.82	5.82	0.92795	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.172430	0.41097	D	0.000941	D	0.92795	0.7709	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94480	0.7692	10	0.87932	D	0	.	20.0951	0.97834	0.0:1.0:0.0:0.0	.	225	Q9NR64	KLHL1_HUMAN	P	225	ENSP00000367075:A225P	ENSP00000367075:A225P	A	-	1	0	KLHL1	69447760	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.197000	0.77814	2.753000	0.94483	0.467000	0.42956	GCA	.	.	.	none		0.403	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
UBE3A	7337	hgsc.bcm.edu	37	15	25616649	25616649	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr15:25616649T>A	ENST00000397954.2	-	4	680	c.681A>T	c.(679-681)ttA>ttT	p.L227F	UBE3A_ENST00000566215.1_Missense_Mutation_p.L204F|UBE3A_ENST00000428984.2_Missense_Mutation_p.L204F|UBE3A_ENST00000232165.3_Missense_Mutation_p.L224F|UBE3A_ENST00000438097.1_Missense_Mutation_p.L204F|SNHG14_ENST00000554726.1_RNA			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	227					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		CATCAGGGCCTAATTTTTGCA	0.418																																					p.L227F		Atlas-SNP	.											.	UBE3A	109	.	0			c.A681T						PASS	.						179.0	174.0	176.0					15																	25616649		2203	4300	6503	SO:0001583	missense	7337	exon7			AGGGCCTAATTTT	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.681A>T	chr15.hg19:g.25616649T>A	ENSP00000381045:p.Leu227Phe	226.0	0.0	.		231.0	80.0	.	NM_000462	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	hg19	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	T	5.048	0.194522	0.09599	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.84	2.23	0.28157	.	0.385567	0.26421	N	0.024461	T	0.09992	0.0245	N	0.14661	0.345	0.47123	D	0.999328	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17684	-1.0361	10	0.09590	T	0.72	.	9.4825	0.38908	0.0:0.293:0.0:0.707	.	224;227	Q05086-3;Q05086	.;UBE3A_HUMAN	F	224;224;227;204;204	ENSP00000232165:L224F;ENSP00000381045:L227F;ENSP00000411258:L204F;ENSP00000401265:L204F	ENSP00000232165:L224F	L	-	3	2	UBE3A	23167742	0.789000	0.28775	0.833000	0.33012	0.928000	0.56348	-0.010000	0.12743	0.448000	0.26722	0.482000	0.46254	TTA	.	.	.	none		0.418	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
CCDC78	124093	hgsc.bcm.edu	37	16	775528	775528	+	Missense_Mutation	SNP	G	G	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr16:775528G>T	ENST00000293889.6	-	4	425	c.320C>A	c.(319-321)aCc>aAc	p.T107N	HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000561546.1_5'Flank|HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000564537.1_5'Flank|HAGHL_ENST00000549114.1_5'Flank|HAGHL_ENST00000389703.3_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	107					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GCCCTGGCTGGTGCCATCTCC	0.652																																					p.T107N		Atlas-SNP	.											.	CCDC78	26	.	0			c.C320A						PASS	.						55.0	53.0	53.0					16																	775528		2194	4297	6491	SO:0001583	missense	124093	exon4			TGGCTGGTGCCAT	BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.320C>A	chr16.hg19:g.775528G>T	ENSP00000293889:p.Thr107Asn	47.0	0.0	.		58.0	20.0	.	NM_001031737	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	ENST00000293889.6	hg19	CCDS32353.1	.	.	.	.	.	.	.	.	.	.	G	3.380	-0.126581	0.06795	.	.	ENSG00000162004	ENST00000293889	T	0.42900	0.96	3.03	0.647	0.17796	.	0.915341	0.09100	N	0.848716	T	0.18299	0.0439	N	0.08118	0	0.09310	N	1	P;P;P;B	0.39157	0.662;0.662;0.662;0.016	B;B;B;B	0.32624	0.149;0.106;0.149;0.015	T	0.12426	-1.0548	10	0.59425	D	0.04	-0.2556	3.877	0.09061	0.156:0.2512:0.5928:0.0	.	107;107;181;107	A2IDD5-4;A2IDD5-6;A2IDD5-5;A2IDD5	.;.;.;CCD78_HUMAN	N	107	ENSP00000293889:T107N	ENSP00000293889:T107N	T	-	2	0	CCDC78	715529	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.489000	0.06490	0.376000	0.24707	0.436000	0.28706	ACC	.	.	.	none		0.652	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241665.3	NM_173476	
SNX29	92017	hgsc.bcm.edu	37	16	12618621	12618621	+	Silent	SNP	C	C	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr16:12618621C>T	ENST00000566228.1	+	20	2310	c.2241C>T	c.(2239-2241)aaC>aaT	p.N747N	SNX29_ENST00000323433.4_Silent_p.N362N|SNX29_ENST00000306030.3_Silent_p.N362N	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	747	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GCGTCATGAACAAAGTCATCC	0.522																																					p.N747N		Atlas-SNP	.											.	SNX29	60	.	0			c.C2241T						PASS	.						94.0	101.0	99.0					16																	12618621		2049	4201	6250	SO:0001819	synonymous_variant	92017	exon20			CATGAACAAAGTC	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2241C>T	chr16.hg19:g.12618621C>T		128.0	0.0	.		110.0	40.0	.	NM_032167	B5MDW2|Q8N2X2|Q9HA26	Silent	SNP	ENST00000566228.1	hg19	CCDS10553.2																																																																																			.	.	.	none		0.522	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422622.1		
FAM83G	644815	hgsc.bcm.edu	37	17	18881233	18881233	+	Missense_Mutation	SNP	T	T	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr17:18881233T>A	ENST00000388995.6	-	5	1969	c.1746A>T	c.(1744-1746)gaA>gaT	p.E582D	SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395645.3_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.E582D|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.E582D			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	582					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						CGTCATCATCTTCTTCTTCCA	0.657																																					p.E582D		Atlas-SNP	.											.	FAM83G	51	.	0			c.A1746T						PASS	.						46.0	53.0	51.0					17																	18881233		2011	4159	6170	SO:0001583	missense	644815	exon5			ATCATCTTCTTCT	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.1746A>T	chr17.hg19:g.18881233T>A	ENSP00000373647:p.Glu582Asp	156.0	0.0	.		131.0	44.0	.	NM_001039999	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	hg19	CCDS42276.1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701515	0.68501	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.14640	2.49;2.49	5.72	-5.84	0.02318	.	0.665977	0.14951	N	0.288895	T	0.08313	0.0207	L	0.53249	1.67	0.21802	N	0.999537	B	0.21606	0.058	B	0.17098	0.017	T	0.35425	-0.9789	10	0.19590	T	0.45	-18.4782	3.4372	0.07450	0.0963:0.4161:0.1946:0.2931	.	582	A6ND36	FA83G_HUMAN	D	582	ENSP00000373647:E582D;ENSP00000343279:E582D	ENSP00000343279:E582D	E	-	3	2	FAM83G	18821958	0.010000	0.17322	0.616000	0.29078	0.890000	0.51754	-1.760000	0.01806	-0.435000	0.07264	0.533000	0.62120	GAA	.	.	.	none		0.657	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
CDK5R1	8851	hgsc.bcm.edu	37	17	30815101	30815101	+	Silent	SNP	C	C	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr17:30815101C>T	ENST00000313401.3	+	2	1152	c.463C>T	c.(463-465)Ctg>Ttg	p.L155L		NM_003885.2	NP_003876.1	Q15078	CD5R1_HUMAN	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	155					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|ephrin receptor signaling pathway (GO:0048013)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|hippocampus development (GO:0021766)|ionotropic glutamate receptor signaling pathway (GO:0035235)|layer formation in cerebral cortex (GO:0021819)|negative regulation of axon extension (GO:0030517)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of neuron differentiation (GO:0045664)|rhythmic process (GO:0048511)|serine phosphorylation of STAT3 protein (GO:0033136)|superior olivary nucleus maturation (GO:0021722)	axon (GO:0030424)|contractile fiber (GO:0043292)|cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|cyclin-dependent protein kinase 5 activator activity (GO:0016534)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)			cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	8		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.0938)			GCTTCGCTGCCTGGGTGAGTT	0.667																																					p.L155L		Atlas-SNP	.											.	CDK5R1	30	.	0			c.C463T						PASS	.						44.0	45.0	45.0					17																	30815101		2203	4300	6503	SO:0001819	synonymous_variant	8851	exon2			CGCTGCCTGGGTG	X80343	CCDS11273.1	17q12	2006-03-28			ENSG00000176749	ENSG00000176749			1775	protein-coding gene	gene with protein product		603460				8090221	Standard	NM_003885		Approved	p35nck5a, Nck5a	uc002hhn.3	Q15078	OTTHUMG00000132814	ENST00000313401.3:c.463C>T	chr17.hg19:g.30815101C>T		85.0	0.0	.		68.0	26.0	.	NM_003885	E1P664|Q5U0G3	Silent	SNP	ENST00000313401.3	hg19	CCDS11273.1																																																																																			.	.	.	none		0.667	CDK5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256264.1	NM_003885	
ZNF700	90592	hgsc.bcm.edu	37	19	12060395	12060395	+	Missense_Mutation	SNP	C	C	G			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr19:12060395C>G	ENST00000254321.5	+	4	1699	c.1556C>G	c.(1555-1557)tCt>tGt	p.S519C	ZNF700_ENST00000482090.1_Missense_Mutation_p.S501C|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						GGCTTTTATTCTGCCAAGTCA	0.383																																					p.S522C		Atlas-SNP	.											.	ZNF700	81	.	0			c.C1565G						PASS	.						59.0	63.0	62.0					19																	12060395		2203	4300	6503	SO:0001583	missense	90592	exon4			TTTATTCTGCCAA	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1556C>G	chr19.hg19:g.12060395C>G	ENSP00000254321:p.Ser519Cys	88.0	0.0	.		66.0	33.0	.	NM_001271848	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	hg19	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	c	3.218	-0.160082	0.06502	.	.	ENSG00000196757	ENST00000254321	T	0.07688	3.17	0.672	-1.34	0.09143	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05181	0.0138	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39333	-0.9619	9	0.36615	T	0.2	.	4.3948	0.11358	0.0:0.3788:0.4495:0.1717	.	519	Q9H0M5	ZN700_HUMAN	C	519	ENSP00000254321:S519C	ENSP00000254321:S519C	S	+	2	0	ZNF700	11921395	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.814000	0.04486	-1.070000	0.03149	-0.705000	0.03659	TCT	.	.	.	none		0.383	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
CHERP	10523	hgsc.bcm.edu	37	19	16640580	16640580	+	Silent	SNP	T	T	C	rs528619775	byFrequency	TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr19:16640580T>C	ENST00000198939.6	-	8	1077	c.1041A>G	c.(1039-1041)caA>caG	p.Q347Q	CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Silent_p.Q336Q					calcium homeostasis endoplasmic reticulum protein									p.Q336Q(2)		endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						gctgctgctgttgctgctgct	0.667													T|||	23	0.00459265	0.0129	0.0043	5008	,	,		16097	0.001		0.001	False		,,,				2504	0.001				p.Q336Q		Atlas-SNP	.											CHERP,NS,carcinoma,0,2	CHERP	70	.	2	Substitution - coding silent(2)	lung(2)	c.A1008G						PASS	.						21.0	29.0	26.0					19																	16640580		2193	4293	6486	SO:0001819	synonymous_variant	10523	exon8			CTGCTGTTGCTGC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.1041A>G	chr19.hg19:g.16640580T>C		46.0	2.0	.		49.0	4.0	.	NM_006387		Silent	SNP	ENST00000198939.6	hg19																																																																																				.	.	.	none		0.667	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000403372.1	NM_006387	
IL4I1	259307	hgsc.bcm.edu	37	19	50393785	50393785	+	Silent	SNP	C	C	T			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr19:50393785C>T	ENST00000391826.2	-	8	988	c.846G>A	c.(844-846)ctG>ctA	p.L282L	MIR4750_ENST00000584564.1_RNA|IL4I1_ENST00000595948.1_Silent_p.L304L|IL4I1_ENST00000341114.3_Silent_p.L304L	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	282						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	GCGCGTTCAACAGCACAAGCC	0.711											OREG0025629	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L304L		Atlas-SNP	.											.	IL4I1	50	.	0			c.G912A						PASS	.						18.0	18.0	18.0					19																	50393785		2202	4299	6501	SO:0001819	synonymous_variant	259307	exon10			GTTCAACAGCACA	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.846G>A	chr19.hg19:g.50393785C>T		42.0	0.0	.	969	50.0	21.0	.	NM_172374	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	hg19	CCDS12787.1																																																																																			.	.	.	none		0.711	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
ZNF615	284370	hgsc.bcm.edu	37	19	52496292	52496292	+	Silent	SNP	C	C	A	rs146634089		TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr19:52496292C>A	ENST00000602063.1	-	6	2386	c.2037G>T	c.(2035-2037)ccG>ccT	p.P679P	ZNF615_ENST00000391795.3_Silent_p.P684P|ZNF615_ENST00000594083.1_Silent_p.P690P|ZNF615_ENST00000598071.1_Silent_p.P690P|ZNF615_ENST00000376716.5_Silent_p.P679P			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	679					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P679P(1)|p.P690P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TGCATTTGTACGGTTTCTCTC	0.408																																					p.P690P		Atlas-SNP	.											ZNF615,colon,carcinoma,0,2	ZNF615	111	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2070T						PASS	.						160.0	155.0	157.0					19																	52496292		2203	4300	6503	SO:0001819	synonymous_variant	284370	exon7			TTTGTACGGTTTC	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.2037G>T	chr19.hg19:g.52496292C>A		205.0	2.0	.		201.0	83.0	.	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	hg19	CCDS12846.1																																																																																			.	C|1.000;T|0.000	.	alt		0.408	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
TRIM28	10155	hgsc.bcm.edu	37	19	59057198	59057198	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr19:59057198G>A	ENST00000253024.5	+	3	810	c.521G>A	c.(520-522)tGt>tAt	p.C174Y	TRIM28_ENST00000341753.6_Intron|RN7SL525P_ENST00000579267.1_RNA	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	174	RBCC domain.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GAGCCTCTGTGTGAGACCTGT	0.577																																					p.C174Y		Atlas-SNP	.											.	TRIM28	46	.	0			c.G521A						PASS	.						80.0	75.0	77.0					19																	59057198		2203	4300	6503	SO:0001583	missense	10155	exon3			CTCTGTGTGAGAC		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.521G>A	chr19.hg19:g.59057198G>A	ENSP00000253024:p.Cys174Tyr	129.0	0.0	.		94.0	37.0	.	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	hg19	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934831	0.73442	.	.	ENSG00000130726	ENST00000253024	D	0.99080	-5.4	4.89	4.89	0.63831	Zinc finger, B-box (3);	0.000000	0.64402	D	0.000017	D	0.99453	0.9806	M	0.93638	3.44	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.98378	1.0557	10	0.87932	D	0	-16.8595	15.9183	0.79539	0.0:0.0:1.0:0.0	.	174	Q13263	TIF1B_HUMAN	Y	174	ENSP00000253024:C174Y	ENSP00000253024:C174Y	C	+	2	0	TRIM28	63749010	1.000000	0.71417	0.998000	0.56505	0.414000	0.31173	9.337000	0.96545	2.432000	0.82394	0.558000	0.71614	TGT	.	.	.	none		0.577	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
KRTAP26-1	388818	hgsc.bcm.edu	37	21	31692296	31692296	+	Missense_Mutation	SNP	G	G	A			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr21:31692296G>A	ENST00000360542.3	-	1	311	c.58C>T	c.(58-60)Cgc>Tgc	p.R20C		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	20						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						GGAATATGGCGGGAGGTTCTG	0.532																																					p.R20C		Atlas-SNP	.											KRTAP26-1,colon,carcinoma,0,1	KRTAP26-1	58	.	0			c.C58T						PASS	.																																			SO:0001583	missense	388818	exon1			TATGGCGGGAGGT	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.58C>T	chr21.hg19:g.31692296G>A	ENSP00000353742:p.Arg20Cys	77.0	1.0	.		63.0	5.0	.	NM_203405	B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	hg19	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	g	0.015	-1.544573	0.00934	.	.	ENSG00000197683	ENST00000360542	T	0.02837	4.14	4.95	3.8	0.43715	.	0.425318	0.22440	N	0.060032	T	0.00815	0.0027	N	0.00413	-1.525	0.28406	N	0.918409	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	10	0.02654	T	1	-2.2098	8.113	0.30926	0.9049:0.0:0.0951:0.0	.	20	Q6PEX3	KR261_HUMAN	C	20	ENSP00000353742:R20C	ENSP00000353742:R20C	R	-	1	0	KRTAP26-1	30614167	0.900000	0.30661	0.326000	0.25389	0.313000	0.28021	0.998000	0.29744	0.963000	0.38082	-0.285000	0.09966	CGC	.	.	.	none		0.532	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
SPRED2	200734	hgsc.bcm.edu	37	2	65561771	65561771	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr2:65561771delC	ENST00000356388.4	-	3	530	c.341delG	c.(340-342)ggafs	p.G114fs	SPRED2_ENST00000443619.2_Frame_Shift_Del_p.G111fs|SPRED2_ENST00000474228.1_5'UTR	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	114	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						TTTCCTTACTCCCCTGTCAAA	0.413																																					p.G114fs		Atlas-INDEL	.											.	SPRED2	70	.	0			c.342delA						PASS	.						157.0	146.0	150.0					2																	65561771		2203	4300	6503	SO:0001589	frameshift_variant	200734	exon3			.	AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.341delG	chr2.hg19:g.65561771delC	ENSP00000348753:p.Gly114fs	198.0	0.0	0		192.0	68.0	0.354167	NM_181784	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Frame_Shift_Del	DEL	ENST00000356388.4	hg19	CCDS33211.1																																																																																			.	.	.	none		0.413	SPRED2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327632.1		
LRP2	4036	hgsc.bcm.edu	37	2	170145584	170145584	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr2:170145584delA	ENST00000263816.3	-	9	1279	c.994delT	c.(994-996)tgtfs	p.C332fs	LRP2_ENST00000443831.1_Frame_Shift_Del_p.C332fs	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	332	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCTGGGGGACAAAAACACGCT	0.483																																					p.C332fs		Atlas-INDEL	.											.	LRP2	751	.	0			c.995delG						PASS	.						107.0	105.0	106.0					2																	170145584		2203	4300	6503	SO:0001589	frameshift_variant	4036	exon9			.		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.994delT	chr2.hg19:g.170145584delA	ENSP00000263816:p.Cys332fs	136.0	0.0	0		142.0	41.0	0.288732	NM_004525	O00711|Q16215	Frame_Shift_Del	DEL	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.	.	none		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
NFE2L3	9603	hgsc.bcm.edu	37	7	26223344	26223347	+	Frame_Shift_Del	DEL	TTCT	TTCT	-	rs370809004|rs534912151	byFrequency	TCGA-DZ-6135-01A-11D-1961-08	TCGA-DZ-6135-10A-01D-1962-08	TTCT	TTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	555a55c5-0299-42ea-b192-fd3595ea0aec	0d8c5c0b-123a-491f-a521-4dfea8a0d89d	g.chr7:26223344_26223347delTTCT	ENST00000056233.3	+	3	1033_1036	c.774_777delTTCT	c.(772-777)acttctfs	p.TS258fs		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	258					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GGACAGATACTTCTTTCTCTCTGG	0.402																																					p.258_259del		Atlas-INDEL	.											.	NFE2L3	77	.	0			c.773_776del						PASS	.																																			SO:0001589	frameshift_variant	9603	exon3			.	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.774_777delTTCT	chr7.hg19:g.26223348_26223351delTTCT	ENSP00000056233:p.Thr258fs	110.0	0.0	0		129.0	39.0	0.302326	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Frame_Shift_Del	DEL	ENST00000056233.3	hg19	CCDS5396.1																																																																																			.	.	.	none		0.402	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
