#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTN	7273	hgsc.bcm.edu	37	2	179612896	179612896	+	Intron	SNP	T	T	C			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr2:179612896T>C	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.E4744G|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCAGTTTCTTCTATATCTGC	0.363																																					p.E4744G		Atlas-SNP	.											.	TTN	18412	.	0			c.A14231G						PASS	.						65.0	66.0	66.0					2																	179612896		2201	4297	6498	SO:0001627	intron_variant	7273	exon46			GTTTCTTCTATAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4954A>G	chr2.hg19:g.179612896T>C		141.0	0.0	.		98.0	39.0	.	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.89	1.478131	0.26511	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.57107	0.42	5.54	-2.93	0.05598	.	.	.	.	.	T	0.23171	0.0560	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22765	-1.0207	9	0.66056	D	0.02	.	13.0978	0.59202	0.0:0.2102:0.0:0.7898	.	4744	Q8WZ42-6	.	G	4744;58	ENSP00000354117:E4744G	ENSP00000304714:E58G	E	-	2	0	TTN	179321141	0.004000	0.15560	0.000000	0.03702	0.008000	0.06430	0.313000	0.19415	-0.565000	0.06061	-0.248000	0.11899	GAA	.	.	.	none		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
QARS	5859	hgsc.bcm.edu	37	3	49137278	49137278	+	Missense_Mutation	SNP	T	T	C	rs143462532		TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr3:49137278T>C	ENST00000306125.6	-	15	1641	c.1304A>G	c.(1303-1305)tAt>tGt	p.Y435C	QARS_ENST00000414533.1_Missense_Mutation_p.Y424C|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	435					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GTAGGTGGGATAGATGCACCT	0.627																																					p.Y435C		Atlas-SNP	.											.	QARS	55	.	0			c.A1304G						PASS	.	T	CYS/TYR	0,4406		0,0,2203	174.0	160.0	165.0		1304	5.2	1.0	3	dbSNP_134	165	1,8599	1.2+/-3.3	0,1,4299	no	missense	QARS	NM_005051.1	194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	435/776	49137278	1,13005	2203	4300	6503	SO:0001583	missense	5859	exon15			GTGGGATAGATGC	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1304A>G	chr3.hg19:g.49137278T>C	ENSP00000307567:p.Tyr435Cys	77.0	0.0	.		63.0	22.0	.	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	hg19	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.669713	0.67814	0.0	1.16E-4	ENSG00000172053	ENST00000306125;ENST00000414533	T;T	0.26067	1.76;1.76	5.17	5.17	0.71159	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	H	0.99565	4.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84542	0.0639	10	0.87932	D	0	-16.4213	15.0382	0.71767	0.0:0.0:0.0:1.0	.	424;435	B4DWJ2;P47897	.;SYQ_HUMAN	C	435;424	ENSP00000307567:Y435C;ENSP00000390015:Y424C	ENSP00000307567:Y435C	Y	-	2	0	QARS	49112282	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.593000	0.82686	1.948000	0.56530	0.533000	0.62120	TAT	.	T|1.000;C|0.000	0.000	weak		0.627	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
CLDN11	5010	hgsc.bcm.edu	37	3	170150353	170150353	+	Missense_Mutation	SNP	G	G	A	rs549752354		TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr3:170150353G>A	ENST00000064724.3	+	3	635	c.433G>A	c.(433-435)Gcc>Acc	p.A145T	CLDN11_ENST00000489485.1_3'UTR|CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_005602.5	NP_005593.2	O75508	CLD11_HUMAN	claudin 11	145					axon ensheathment (GO:0008366)|calcium-independent cell-cell adhesion (GO:0016338)|spermatogenesis (GO:0007283)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.A145T(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|liver(2)|lung(3)|ovary(2)	12	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			CCCTGTGTGCGCCCACCGTGA	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17627	0.0		0.0	False		,,,				2504	0.0				p.A145T		Atlas-SNP	.											CLDN11,NS,carcinoma,0,1	CLDN11	28	.	1	Substitution - Missense(1)	lung(1)	c.G433A						PASS	.						164.0	147.0	153.0					3																	170150353		2203	4300	6503	SO:0001583	missense	5010	exon3			GTGTGCGCCCACC	AF068863	CCDS3213.1	3q26.2-q26.3	2008-08-01	2008-08-01		ENSG00000013297	ENSG00000013297		"""Claudins"""	8514	protein-coding gene	gene with protein product		601326	"""oligodendrocyte transmembrane protein"""	OTM		8661061, 8797478	Standard	NM_005602		Approved	OSP	uc003fgx.3	O75508	OTTHUMG00000158940	ENST00000064724.3:c.433G>A	chr3.hg19:g.170150353G>A	ENSP00000064724:p.Ala145Thr	106.0	0.0	.		88.0	36.0	.	NM_005602	B2R7C1|D3DNQ5|Q5U0P3	Missense_Mutation	SNP	ENST00000064724.3	hg19	CCDS3213.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146380	0.77888	.	.	ENSG00000013297	ENST00000064724	D	0.88586	-2.4	5.74	5.74	0.90152	.	0.051247	0.85682	D	0.000000	T	0.80210	0.4581	L	0.31157	0.91	0.80722	D	1	P	0.41214	0.742	B	0.31191	0.125	T	0.80852	-0.1197	10	0.39692	T	0.17	.	13.1577	0.59527	0.0728:0.0:0.9272:0.0	.	145	O75508	CLD11_HUMAN	T	145	ENSP00000064724:A145T	ENSP00000064724:A145T	A	+	1	0	CLDN11	171633047	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	5.137000	0.64789	2.723000	0.93209	0.655000	0.94253	GCC	.	.	.	none		0.607	CLDN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352403.1	NM_005602	
PCDHB2	56133	hgsc.bcm.edu	37	5	140476411	140476411	+	Silent	SNP	A	A	C			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr5:140476411A>C	ENST00000194155.4	+	1	2185	c.2037A>C	c.(2035-2037)gcA>gcC	p.A679A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	679					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A679A(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCACCGGCCCAGG	0.687																																					p.A679A		Atlas-SNP	.											PCDHB2,NS,carcinoma,0,1	PCDHB2	163	.	1	Substitution - coding silent(1)	lung(1)	c.A2037C						PASS	.						65.0	67.0	66.0					5																	140476411		2178	4247	6425	SO:0001819	synonymous_variant	56133	exon1			GGCGGCACCGGCC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2037A>C	chr5.hg19:g.140476411A>C		123.0	2.0	.		131.0	7.0	.	NM_018936	Q4KMU1	Silent	SNP	ENST00000194155.4	hg19	CCDS4244.1																																																																																			.	.	.	none		0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
KIF4B	285643	hgsc.bcm.edu	37	5	154395607	154395607	+	Nonsense_Mutation	SNP	G	G	T	rs267600506		TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr5:154395607G>T	ENST00000435029.4	+	1	2348	c.2188G>T	c.(2188-2190)Gag>Tag	p.E730*		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	730	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TAAGCGGAAAGAGACTCAGAG	0.493																																					p.E730X		Atlas-SNP	.											.	KIF4B	307	.	0			c.G2188T						PASS	.						96.0	95.0	95.0					5																	154395607		2203	4300	6503	SO:0001587	stop_gained	285643	exon1			CGGAAAGAGACTC	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2188G>T	chr5.hg19:g.154395607G>T	ENSP00000387875:p.Glu730*	628.0	0.0	.		531.0	104.0	.	NM_001099293		Nonsense_Mutation	SNP	ENST00000435029.4	hg19	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	g	21.2	4.119569	0.77323	.	.	ENSG00000226650	ENST00000435029	.	.	.	2.54	1.63	0.23807	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	9.0371	0.36293	0.0:0.2298:0.7702:0.0	.	.	.	.	X	730	.	ENSP00000387875:E730X	E	+	1	0	KIF4B	154375800	1.000000	0.71417	0.092000	0.20876	0.077000	0.17291	2.376000	0.44292	0.185000	0.20105	-0.257000	0.10917	GAG	.	.	.	none		0.493	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
WNT2	7472	hgsc.bcm.edu	37	7	116937828	116937828	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr7:116937828C>T	ENST00000265441.3	-	4	990	c.691G>A	c.(691-693)Ggc>Agc	p.G231S		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	231					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		AGATAATCGCCCGTTTTCCTG	0.532																																					p.G231S		Atlas-SNP	.											.	WNT2	56	.	0			c.G691A						PASS	.						107.0	98.0	101.0					7																	116937828		2203	4300	6503	SO:0001583	missense	7472	exon4			AATCGCCCGTTTT	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.691G>A	chr7.hg19:g.116937828C>T	ENSP00000265441:p.Gly231Ser	98.0	0.0	.		86.0	41.0	.	NM_003391	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	hg19	CCDS5771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.00|15.00	2.704256|2.704256	0.48412|0.48412	.|.	.|.	ENSG00000105989|ENSG00000105989	ENST00000491214|ENST00000265441	T|T	0.64618|0.80824	-0.11|-1.42	5.58|5.58	4.7|4.7	0.59300|0.59300	.|.	0.048024|0.048024	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.90700|0.90700	0.7082|0.7082	M|M	0.86651|0.86651	2.83|2.83	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.65815	.|0.995;0.995	.|D;D	.|0.76575	.|0.988;0.988	D|D	0.92513|0.92513	0.6018|0.6018	8|10	0.87932|0.87932	D|D	0|0	.|.	15.8497|15.8497	0.78921|0.78921	0.0:0.864:0.136:0.0|0.0:0.864:0.136:0.0	.|.	.|231;231	.|A4D0V1;P09544	.|.;WNT2_HUMAN	E|S	138|231	ENSP00000419466:G138E|ENSP00000265441:G231S	ENSP00000419466:G138E|ENSP00000265441:G231S	G|G	-|-	2|1	0|0	WNT2|WNT2	116725064|116725064	1.000000|1.000000	0.71417|0.71417	0.911000|0.911000	0.35937|0.35937	0.478000|0.478000	0.33099|0.33099	7.776000|7.776000	0.85560|0.85560	1.479000|1.479000	0.48272|0.48272	0.561000|0.561000	0.74099|0.74099	GGG|GGC	.	.	.	none		0.532	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
INCENP	3619	hgsc.bcm.edu	37	11	61914249	61914249	+	Silent	SNP	G	G	C	rs113959967	byFrequency	TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr11:61914249G>C	ENST00000394818.3	+	15	2281	c.2079G>C	c.(2077-2079)cgG>cgC	p.R693R	INCENP_ENST00000278849.4_Silent_p.R689R	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	693					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						aggagcggcgggagcaggagc	0.721													G|||	23	0.00459265	0.0045	0.0	5008	,	,		11611	0.004		0.005	False		,,,				2504	0.0082				p.R693R		Atlas-SNP	.											.	INCENP	122	.	0			c.G2079C						PASS	.																																			SO:0001819	synonymous_variant	3619	exon15			GCGGCGGGAGCAG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2079G>C	chr11.hg19:g.61914249G>C		132.0	0.0	.		119.0	44.0	.	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	hg19	CCDS44624.1																																																																																			.	G|0.500;C|0.500	0.500	weak		0.721	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
INCENP	3619	hgsc.bcm.edu	37	11	61914279	61914279	+	Silent	SNP	C	C	G	rs371735595	byFrequency	TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr11:61914279C>G	ENST00000394818.3	+	15	2311	c.2109C>G	c.(2107-2109)cgC>cgG	p.R703R	INCENP_ENST00000278849.4_Silent_p.R699R	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	703					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						aggagcggcgcgagcaggagc	0.751																																					p.R703R		Atlas-SNP	.											.	INCENP	122	.	0			c.C2109G						PASS	.						3.0	5.0	4.0					11																	61914279		1777	3550	5327	SO:0001819	synonymous_variant	3619	exon15			GCGGCGCGAGCAG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2109C>G	chr11.hg19:g.61914279C>G		118.0	0.0	.		84.0	19.0	.	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	hg19	CCDS44624.1																																																																																			.	.	.	alt		0.751	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
Unknown	0	hgsc.bcm.edu	37	14	20181514	20181514	+	IGR	SNP	T	T	C			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr14:20181514T>C								RP11-597A11.2 (28616 upstream) : OR4Q3 (34072 downstream)																							TGGTCAATAATGTTTGGGCCA	0.458																																					p.I188V		Atlas-SNP	.											.	.	.	.	0			c.A562G						PASS	.																																			SO:0001628	intergenic_variant	79334	exon2			CAATAATGTTTGG																													chr14.hg19:g.20181514T>C		353.0	0.0	.		203.0	116.0	.	NM_001197287		Missense_Mutation	SNP		hg19																																																																																				.	.	.	none	0	0.458								
SAV1	60485	hgsc.bcm.edu	37	14	51101991	51101991	+	Nonsense_Mutation	SNP	A	A	T			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr14:51101991A>T	ENST00000324679.4	-	5	1425	c.1062T>A	c.(1060-1062)taT>taA	p.Y354*	RN7SL452P_ENST00000482923.2_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	354	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					TGTATGCTTCATACATTTTAA	0.413																																					p.Y354X		Atlas-SNP	.											.	SAV1	18	.	0			c.T1062A						PASS	.						126.0	119.0	122.0					14																	51101991		2203	4300	6503	SO:0001587	stop_gained	60485	exon5			TGCTTCATACATT	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.1062T>A	chr14.hg19:g.51101991A>T	ENSP00000324729:p.Tyr354*	129.0	0.0	.		78.0	56.0	.	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Nonsense_Mutation	SNP	ENST00000324679.4	hg19	CCDS9701.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.47|15.47	2.841904|2.841904	0.51057|0.51057	.|.	.|.	ENSG00000151748|ENSG00000151748	ENST00000557458|ENST00000555720;ENST00000324679;ENST00000535862	.|.	.|.	.|.	5.77|5.77	3.38|3.38	0.38709|0.38709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.02654	.|T	.|1	-11.6598|-11.6598	7.6945|7.6945	0.28587|0.28587	0.7701:0.0:0.2299:0.0|0.7701:0.0:0.2299:0.0	.|.	.|.	.|.	.|.	R|X	60|286;354;321	.|.	.|ENSP00000324729:Y354X	X|Y	-|-	1|3	0|2	SAV1|SAV1	50171741|50171741	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.493000|0.493000	0.33554|0.33554	0.704000|0.704000	0.25661|0.25661	0.966000|0.966000	0.38159|0.38159	0.533000|0.533000	0.62120|0.62120	TGA|TAT	.	.	.	none		0.413	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
ZNF19	7567	hgsc.bcm.edu	37	16	71509777	71509777	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr16:71509777C>T	ENST00000288177.5	-	6	928	c.673G>A	c.(673-675)Gcc>Acc	p.A225T	ZNF19_ENST00000565637.1_Missense_Mutation_p.A183T|ZNF19_ENST00000565100.2_Missense_Mutation_p.A155T|ZNF19_ENST00000564230.1_Missense_Mutation_p.A225T|AC010547.9_ENST00000561908.1_Intron|ZNF19_ENST00000567225.1_Intron	NM_006961.3	NP_008892.2	P17023	ZNF19_HUMAN	zinc finger protein 19	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|prostate(1)|stomach(1)	22		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		TCATTAAAGGCTCGCCCACAC	0.453																																					p.A225T		Atlas-SNP	.											.	ZNF19	46	.	0			c.G673A						PASS	.						69.0	77.0	75.0					16																	71509777		2198	4300	6498	SO:0001583	missense	7567	exon6			TAAAGGCTCGCCC	X52343	CCDS10901.1	16q22	2013-01-08	2006-05-10		ENSG00000157429	ENSG00000157429		"""Zinc fingers, C2H2-type"", ""-"""	12981	protein-coding gene	gene with protein product		194525	"""zinc finger protein 19 (KOX 12)"""			1505991, 1946370	Standard	NM_006961		Approved	KOX12, MGC51021	uc002fam.1	P17023	OTTHUMG00000137593	ENST00000288177.5:c.673G>A	chr16.hg19:g.71509777C>T	ENSP00000288177:p.Ala225Thr	154.0	0.0	.		137.0	45.0	.	NM_006961	A8K895|Q86Y66|Q8NDE2|Q96M79|Q96NE5	Missense_Mutation	SNP	ENST00000288177.5	hg19	CCDS10901.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350126	0.61183	.	.	ENSG00000157429	ENST00000288177	T	0.16897	2.31	3.4	3.4	0.38934	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35495	N	0.003161	T	0.07683	0.0193	N	0.04880	-0.145	0.27067	N	0.963422	B	0.25351	0.124	B	0.28385	0.089	T	0.19745	-1.0296	10	0.33141	T	0.24	.	6.7551	0.23510	0.0:0.8751:0.0:0.1248	.	225	P17023	ZNF19_HUMAN	T	225	ENSP00000288177:A225T	ENSP00000288177:A225T	A	-	1	0	ZNF19	70067278	0.000000	0.05858	0.946000	0.38457	0.873000	0.50193	0.356000	0.20181	2.202000	0.70862	0.655000	0.94253	GCC	.	.	.	none		0.453	ZNF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268993.2	NM_006961	
RFFL	117584	hgsc.bcm.edu	37	17	33348798	33348798	+	Silent	SNP	C	C	T			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr17:33348798C>T	ENST00000315249.7	-	3	405	c.183G>A	c.(181-183)caG>caA	p.Q61Q	RFFL_ENST00000584655.1_Silent_p.Q61Q|RFFL_ENST00000378516.2_Silent_p.Q61Q|RFFL_ENST00000447669.2_Silent_p.Q61Q|RAD51L3-RFFL_ENST00000593039.1_Intron|RFFL_ENST00000268850.7_Silent_p.Q61Q|RFFL_ENST00000413582.2_Silent_p.Q61Q|RFFL_ENST00000415395.2_Silent_p.Q61Q|RFFL_ENST00000394597.2_Silent_p.Q61Q					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CCAAGCAGGTCTGCTGCTTAG	0.517																																					p.Q61Q		Atlas-SNP	.											.	RFFL	27	.	0			c.G183A						PASS	.						52.0	52.0	52.0					17																	33348798		2203	4299	6502	SO:0001819	synonymous_variant	117584	exon3			GCAGGTCTGCTGC	AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.183G>A	chr17.hg19:g.33348798C>T		167.0	0.0	.		122.0	50.0	.	NM_001017368		Silent	SNP	ENST00000315249.7	hg19	CCDS11286.1																																																																																			.	.	.	none		0.517	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256460.2	NM_057178	
MUC16	94025	hgsc.bcm.edu	37	19	9008207	9008207	+	Silent	SNP	G	G	A			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr19:9008207G>A	ENST00000397910.4	-	41	39548	c.39345C>T	c.(39343-39345)ccC>ccT	p.P13115P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13117	SEA 7. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAGGGTGTAGGGGCCCAGCT	0.547																																					p.P13115P		Atlas-SNP	.											.	MUC16	4315	.	0			c.C39345T						PASS	.						210.0	191.0	197.0					19																	9008207		2018	4185	6203	SO:0001819	synonymous_variant	94025	exon41			GGTGTAGGGGCCC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39345C>T	chr19.hg19:g.9008207G>A		133.0	0.0	.		122.0	9.0	.	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.547	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DNM2	1785	hgsc.bcm.edu	37	19	10886526	10886526	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr19:10886526A>G	ENST00000355667.6	+	4	613	c.533A>G	c.(532-534)aAc>aGc	p.N178S	DNM2_ENST00000591819.1_3'UTR|DNM2_ENST00000408974.4_Missense_Mutation_p.N178S|DNM2_ENST00000314646.5_Missense_Mutation_p.N178S|DNM2_ENST00000359692.6_Missense_Mutation_p.N178S|DNM2_ENST00000585892.1_Missense_Mutation_p.N178S|DNM2_ENST00000389253.4_Missense_Mutation_p.N178S	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	178	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			ACGCCCGCCAACATGGACCTG	0.607			"""F, N, Splice, Mis, O"""		ETP ALL																																p.N178S		Atlas-SNP	.		Rec	yes		19	19p13.2	1785	dynamin 2		L	.	DNM2	175	.	0			c.A533G						PASS	.						74.0	68.0	70.0					19																	10886526		2203	4300	6503	SO:0001583	missense	1785	exon4			CCGCCAACATGGA		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.533A>G	chr19.hg19:g.10886526A>G	ENSP00000347890:p.Asn178Ser	87.0	0.0	.		77.0	37.0	.	NM_001005361	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	hg19	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.224596	0.79576	.	.	ENSG00000079805	ENST00000389252;ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	D;D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36;-4.36	5.38	5.38	0.77491	Dynamin, GTPase domain (2);	0.000000	0.85682	D	0.000000	D	0.98298	0.9436	M	0.83852	2.665	0.80722	D	1	D;D;D;D	0.89917	1.0;0.992;1.0;0.988	D;P;D;P	0.71656	0.974;0.693;0.974;0.678	D	0.99334	1.0910	10	0.87932	D	0	.	14.3763	0.66879	1.0:0.0:0.0:0.0	.	178;178;178;178	A8K1B6;P50570-2;P50570;E9PEQ4	.;.;DYN2_HUMAN;.	S	167;178;178;178;178;178	ENSP00000386192:N178S;ENSP00000347890:N178S;ENSP00000352721:N178S;ENSP00000373905:N178S;ENSP00000313164:N178S	ENSP00000313164:N178S	N	+	2	0	DNM2	10747526	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	9.339000	0.96797	2.046000	0.60703	0.459000	0.35465	AAC	.	.	.	none		0.607	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
CYP2A7	1549	hgsc.bcm.edu	37	19	41386516	41386516	+	Missense_Mutation	SNP	C	C	A	rs376282662		TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr19:41386516C>A	ENST00000301146.4	-	3	902	c.361G>T	c.(361-363)Ggg>Tgg	p.G121W	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Missense_Mutation_p.G70W	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	121						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GCGCGCTCCCCGTTGCTGAAC	0.701																																					p.G121W		Atlas-SNP	.											.	CYP2A7	71	.	0			c.G361T						PASS	.						17.0	16.0	16.0					19																	41386516		2159	4179	6338	SO:0001583	missense	1549	exon3			GCTCCCCGTTGCT	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.361G>T	chr19.hg19:g.41386516C>A	ENSP00000301146:p.Gly121Trp	147.0	0.0	.		144.0	8.0	.	NM_000764	Q13121	Missense_Mutation	SNP	ENST00000301146.4	hg19	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	c	13.70	2.314842	0.40996	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.20200	4.45;2.09	2.16	2.16	0.27623	.	0.059304	0.64402	N	0.000003	T	0.45296	0.1335	H	0.94385	3.53	0.40331	D	0.978924	D;D;P	0.56521	0.976;0.965;0.772	P;P;B	0.52386	0.697;0.674;0.286	T	0.63800	-0.6555	10	0.72032	D	0.01	.	11.4345	0.50060	0.0:1.0:0.0:0.0	.	121;70;121	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	W	121;70	ENSP00000301146:G121W;ENSP00000291764:G70W	ENSP00000291764:G70W	G	-	1	0	CYP2A7	46078356	0.463000	0.25799	0.369000	0.25952	0.023000	0.10783	1.564000	0.36375	1.211000	0.43351	0.175000	0.17021	GGG	.	.	.	alt		0.701	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
BPIFB2	80341	hgsc.bcm.edu	37	20	31608183	31608183	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr20:31608183G>A	ENST00000170150.3	+	12	1325	c.1130G>A	c.(1129-1131)gGg>gAg	p.G377E		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	377						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										AAGCTTCAGGGGACCACGTCT	0.602																																					p.G377E		Atlas-SNP	.											.	.	.	.	0			c.G1130A						PASS	.						115.0	100.0	105.0					20																	31608183		2203	4300	6503	SO:0001583	missense	80341	exon12			TTCAGGGGACCAC	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.1130G>A	chr20.hg19:g.31608183G>A	ENSP00000170150:p.Gly377Glu	102.0	0.0	.		115.0	53.0	.	NM_025227	Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	hg19	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904186	0.52333	.	.	ENSG00000078898	ENST00000170150	T	0.16897	2.31	4.24	2.23	0.28157	.	0.263443	0.27039	N	0.021235	T	0.25865	0.0630	M	0.66939	2.045	0.40553	D	0.981136	P	0.45634	0.863	P	0.48738	0.588	T	0.06679	-1.0813	10	0.66056	D	0.02	-12.3476	10.618	0.45462	0.0:0.3805:0.6195:0.0	.	377	Q8N4F0	BPIB2_HUMAN	E	377	ENSP00000170150:G377E	ENSP00000170150:G377E	G	+	2	0	BPIFB2	31071844	0.925000	0.31364	0.836000	0.33094	0.727000	0.41649	1.133000	0.31430	0.703000	0.31848	0.561000	0.74099	GGG	.	.	.	none		0.602	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
AURKA	6790	hgsc.bcm.edu	37	20	54963211	54963211	+	Splice_Site	SNP	C	C	G			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chr20:54963211C>G	ENST00000347343.2	-	2	310		c.e2+1		AURKA_ENST00000395909.4_Splice_Site|AURKA_ENST00000395915.3_Splice_Site|AURKA_ENST00000395913.3_Splice_Site|AURKA_ENST00000371356.2_Splice_Site|AURKA_ENST00000395911.1_Splice_Site|AURKA_ENST00000395914.1_Splice_Site|AURKA_ENST00000395907.1_Splice_Site|AURKA_ENST00000312783.6_Splice_Site	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.?(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			ATTCAATTTACCTTAACAGGT	0.358																																					.	Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)	Atlas-SNP	.											AURKA,NS,carcinoma,0,1	AURKA	42	.	1	Unknown(1)	lung(1)	c.42+1G>C						PASS	.						110.0	116.0	114.0					20																	54963211		2203	4300	6503	SO:0001630	splice_region_variant	6790	exon4			AATTTACCTTAAC	BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.42+1G>C	chr20.hg19:g.54963211C>G		123.0	1.0	.		125.0	8.0	.	NM_198434	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Splice_Site	SNP	ENST00000347343.2	hg19	CCDS13451.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843515	0.51057	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907;ENST00000441357;ENST00000420474;ENST00000422322;ENST00000456249;ENST00000451915	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6225	0.56612	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AURKA	54396618	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	3.235000	0.51328	2.329000	0.79093	0.585000	0.79938	.	.	.	.	none		0.358	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079804.3	NM_003600	Intron
MT-ND3	4537	hgsc.bcm.edu	37	M	10197	10197	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A7Q0-01A-11D-A35Z-10	TCGA-F9-A7Q0-10B-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a8a7f344-08bd-4b20-bbdd-94915425f00f	dfc4913f-381a-4897-828e-6f8666d652ef	g.chrM:10197G>C	ENST00000361227.2	+	1	139	c.139G>C	c.(139-141)Gcc>Ccc	p.A47P	MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	47			A -> T (in LS and MT-C1D). {ECO:0000269|PubMed:17152068, ECO:0000269|PubMed:20818383}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										CTATATCCCCCGCCCGCGTCC	0.423																																					p.A47P		Atlas-SNP	.											.	.	.	.	0			c.G139C						PASS	.																																			SO:0001583	missense	0	exon1			TCCCCCGCCCGCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.139G>C	chrM.hg19:g.10197G>C	ENSP00000355206:p.Ala47Pro	30.0	0.0	.		24.0	19.0	.	ENST00000361227		Missense_Mutation	SNP	ENST00000361227.2	hg19																																																																																				.	.	.	none		0.423	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
