#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSPG2	3339	hgsc.bcm.edu	37	1	22180783	22180783	+	Silent	SNP	T	T	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:22180783T>C	ENST00000374695.3	-	50	6421	c.6342A>G	c.(6340-6342)gaA>gaG	p.E2114E	HSPG2_ENST00000430507.1_Silent_p.E64E	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2114	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCACACATATTCTCCAGAAT	0.637																																					p.E2114E		Atlas-SNP	.											.	HSPG2	311	.	0			c.A6342G						PASS	.						24.0	22.0	22.0					1																	22180783		2196	4288	6484	SO:0001819	synonymous_variant	3339	exon50			CACATATTCTCCA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6342A>G	chr1.hg19:g.22180783T>C		97.0	0.0	.		73.0	33.0	.	NM_005529	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	hg19	CCDS30625.1																																																																																			.	.	.	none		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HIVEP3	59269	hgsc.bcm.edu	37	1	41976929	41976929	+	Silent	SNP	G	G	T	rs146058477		TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:41976929G>T	ENST00000372583.1	-	9	7299	c.6414C>A	c.(6412-6414)gcC>gcA	p.A2138A	HIVEP3_ENST00000247584.5_Silent_p.A2138A|HIVEP3_ENST00000429157.2_Silent_p.A2137A|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Silent_p.A2137A	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2138	6 X 4 AA tandem repeats of S-P-X-[RK].				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TTCGGGACTCGGCCTTCTGCT	0.632																																					p.A2138A		Atlas-SNP	.											.	HIVEP3	235	.	0			c.C6414A						PASS	.						36.0	38.0	37.0					1																	41976929		2200	4299	6499	SO:0001819	synonymous_variant	59269	exon9			GGACTCGGCCTTC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6414C>A	chr1.hg19:g.41976929G>T		37.0	0.0	.		33.0	17.0	.	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	G|1.000;A|0.000	.	alt		0.632	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
ZSWIM5	57643	hgsc.bcm.edu	37	1	45485775	45485775	+	Silent	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:45485775C>T	ENST00000359600.5	-	13	2863	c.2658G>A	c.(2656-2658)gaG>gaA	p.E886E		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	886						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					ATCGTACCATCTCCCTGCGTC	0.552																																					p.E886E		Atlas-SNP	.											.	ZSWIM5	72	.	0			c.G2658A						PASS	.						90.0	88.0	89.0					1																	45485775		2052	4181	6233	SO:0001819	synonymous_variant	57643	exon13			TACCATCTCCCTG	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.2658G>A	chr1.hg19:g.45485775C>T		114.0	0.0	.		85.0	33.0	.	NM_020883	Q5SXQ9	Silent	SNP	ENST00000359600.5	hg19	CCDS41319.1																																																																																			.	.	.	none		0.552	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	
DDX20	11218	hgsc.bcm.edu	37	1	112299342	112299342	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:112299342C>T	ENST00000369702.4	+	2	996	c.376C>T	c.(376-378)Ctt>Ttt	p.L126F	FAM212B_ENST00000412270.1_5'Flank|DDX20_ENST00000536167.1_Missense_Mutation_p.L126F|FAM212B_ENST00000444059.2_5'Flank	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	126	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCTCTTGTTCTTGAAAACTT	0.428																																					p.L126F		Atlas-SNP	.											.	DDX20	50	.	0			c.C376T						PASS	.						104.0	98.0	100.0					1																	112299342		2203	4300	6503	SO:0001583	missense	11218	exon2			CTTGTTCTTGAAA	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.376C>T	chr1.hg19:g.112299342C>T	ENSP00000358716:p.Leu126Phe	119.0	0.0	.		96.0	47.0	.	NM_007204	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	hg19	CCDS842.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729711	0.69074	.	.	ENSG00000064703	ENST00000369702;ENST00000536167	T;T	0.35048	2.45;1.33	5.6	4.68	0.58851	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.064498	0.64402	D	0.000007	T	0.36248	0.0960	L	0.35341	1.055	0.49915	D	0.999835	D	0.71674	0.998	D	0.71870	0.975	T	0.27020	-1.0086	10	0.51188	T	0.08	-12.9842	13.7769	0.63059	0.1539:0.8461:0.0:0.0	.	126	Q9UHI6	DDX20_HUMAN	F	126	ENSP00000358716:L126F;ENSP00000439026:L126F	ENSP00000358716:L126F	L	+	1	0	DDX20	112100865	0.997000	0.39634	0.976000	0.42696	0.997000	0.91878	1.848000	0.39309	1.342000	0.45619	0.555000	0.69702	CTT	.	.	.	none		0.428	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
RFX5	5993	hgsc.bcm.edu	37	1	151317225	151317225	+	Missense_Mutation	SNP	T	T	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:151317225T>A	ENST00000290524.4	-	6	510	c.332A>T	c.(331-333)cAa>cTa	p.Q111L	RFX5_ENST00000368870.2_Missense_Mutation_p.Q111L|RFX5_ENST00000478564.1_5'UTR|RFX5_ENST00000452513.2_Intron|RP11-126K1.8_ENST00000422153.1_RNA|RP11-126K1.6_ENST00000455503.1_RNA|RFX5_ENST00000452671.2_Missense_Mutation_p.Q111L	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	111					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ATAAACACTTTGCTTTGGCAG	0.542																																					p.Q111L		Atlas-SNP	.											.	RFX5	69	.	0			c.A332T						PASS	.						68.0	56.0	60.0					1																	151317225		2203	4300	6503	SO:0001583	missense	5993	exon6			ACACTTTGCTTTG		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.332A>T	chr1.hg19:g.151317225T>A	ENSP00000290524:p.Gln111Leu	124.0	0.0	.		123.0	54.0	.	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	hg19	CCDS994.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.666797	0.88251	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000436637;ENST00000452671;ENST00000392746;ENST00000422595;ENST00000450506;ENST00000458484;ENST00000430227;ENST00000412774	D;D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.43	5.43	0.79202	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.85682	D	0.000000	D	0.88683	0.6503	M	0.74881	2.28	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.90114	0.4194	10	0.72032	D	0.01	-13.3181	14.4364	0.67284	0.0:0.0:0.0:1.0	.	111	P48382	RFX5_HUMAN	L	111;111;3;111;111;111;111;111;111;111	ENSP00000290524:Q111L;ENSP00000357864:Q111L;ENSP00000390769:Q3L;ENSP00000389130:Q111L;ENSP00000376502:Q111L;ENSP00000399095:Q111L;ENSP00000398666:Q111L;ENSP00000409187:Q111L;ENSP00000387618:Q111L	ENSP00000290524:Q111L	Q	-	2	0	RFX5	149583849	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.068000	0.76748	2.279000	0.76181	0.533000	0.62120	CAA	.	.	.	none		0.542	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
FLG	2312	hgsc.bcm.edu	37	1	152284898	152284898	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:152284898G>T	ENST00000368799.1	-	3	2499	c.2464C>A	c.(2464-2466)Cat>Aat	p.H822N	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	822	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGCTCATGGTGGGATCCT	0.567									Ichthyosis																												p.H822N		Atlas-SNP	.											FLG,NS,lymphoid_neoplasm,0,1	FLG	900	.	0			c.C2464A						PASS	.						284.0	272.0	276.0					1																	152284898		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GCTCATGGTGGGA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2464C>A	chr1.hg19:g.152284898G>T	ENSP00000357789:p.His822Asn	103.0	0.0	.		95.0	33.0	.	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	4.331	0.060725	0.08339	.	.	ENSG00000143631	ENST00000368799	T	0.04015	3.73	3.3	-1.25	0.09405	.	.	.	.	.	T	0.01353	0.0044	L	0.58428	1.81	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45920	-0.9228	9	0.25106	T	0.35	.	2.5714	0.04796	0.2516:0.0:0.3484:0.3999	.	822	P20930	FILA_HUMAN	N	822	ENSP00000357789:H822N	ENSP00000357789:H822N	H	-	1	0	FLG	150551522	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	1.127000	0.31357	0.134000	0.18681	-0.415000	0.06103	CAT	.	.	.	none		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
F5	2153	hgsc.bcm.edu	37	1	169519125	169519125	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr1:169519125C>T	ENST00000367797.3	-	10	1726	c.1525G>A	c.(1525-1527)Gtg>Atg	p.V509M	F5_ENST00000367796.3_Missense_Mutation_p.V509M|F5_ENST00000546081.1_3'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	509	F5/8 type A 2.|Plastocyanin-like 3.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ATGATGTCCACGTCACTGTAG	0.438																																					p.V509M		Atlas-SNP	.											.	F5	301	.	0			c.G1525A						PASS	.						217.0	193.0	201.0					1																	169519125		2203	4300	6503	SO:0001583	missense	2153	exon10			TGTCCACGTCACT	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1525G>A	chr1.hg19:g.169519125C>T	ENSP00000356771:p.Val509Met	152.0	0.0	.		120.0	43.0	.	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	hg19	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	31	5.096857	0.94197	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98567	-5.0;-5.0	5.71	5.71	0.89125	Cupredoxin (2);	0.124889	0.53938	D	0.000051	D	0.99354	0.9773	H	0.94582	3.555	0.40561	D	0.981212	D	0.89917	1.0	D	0.87578	0.998	D	0.98965	1.0799	9	0.87932	D	0	-6.2486	19.8398	0.96678	0.0:1.0:0.0:0.0	.	509	P12259	FA5_HUMAN	M	509	ENSP00000356771:V509M;ENSP00000356770:V509M	ENSP00000356770:V509M	V	-	1	0	F5	167785749	1.000000	0.71417	0.995000	0.50966	0.961000	0.63080	7.451000	0.80668	2.697000	0.92050	0.655000	0.94253	GTG	.	.	.	none		0.438	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
BAZ2B	29994	hgsc.bcm.edu	37	2	160206448	160206448	+	Missense_Mutation	SNP	T	T	C	rs200214529	byFrequency	TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr2:160206448T>C	ENST00000392783.2	-	28	5129	c.4634A>G	c.(4633-4635)aAt>aGt	p.N1545S	BAZ2B_ENST00000355831.2_Missense_Mutation_p.N1511S|BAZ2B_ENST00000343439.5_Missense_Mutation_p.N1445S|BAZ2B_ENST00000392782.1_Missense_Mutation_p.N1509S	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TAACTGGTCATTGGGGAGAGG	0.428													T|||	2	0.000399361	0.0	0.0	5008	,	,		20692	0.002		0.0	False		,,,				2504	0.0				p.N1545S		Atlas-SNP	.											.	BAZ2B	196	.	0			c.A4634G						PASS	.						159.0	154.0	156.0					2																	160206448		2019	4187	6206	SO:0001583	missense	29994	exon28			TGGTCATTGGGGA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4634A>G	chr2.hg19:g.160206448T>C	ENSP00000376534:p.Asn1545Ser	117.0	0.0	.		120.0	47.0	.	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	T	7.084	0.570841	0.13623	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.58060	0.43;0.42;0.43;0.36	6.17	3.83	0.44106	.	0.183181	0.25680	N	0.029005	T	0.40595	0.1123	L	0.41824	1.3	0.26418	N	0.976147	B;B	0.23377	0.081;0.084	B;B	0.20184	0.028;0.021	T	0.21930	-1.0231	10	0.15952	T	0.53	-11.6915	11.3102	0.49360	0.0:0.2045:0.0:0.7955	.	1509;1545	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	S	1509;1545;1511;1445	ENSP00000376533:N1509S;ENSP00000376534:N1545S;ENSP00000348087:N1511S;ENSP00000339670:N1445S	ENSP00000339670:N1445S	N	-	2	0	BAZ2B	159914694	1.000000	0.71417	0.998000	0.56505	0.774000	0.43823	1.563000	0.36364	0.200000	0.20447	-1.139000	0.01908	AAT	.	.	.	weak		0.428	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
XIRP2	129446	hgsc.bcm.edu	37	2	168105464	168105464	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr2:168105464C>T	ENST00000409195.1	+	9	7651	c.7562C>T	c.(7561-7563)tCt>tTt	p.S2521F	XIRP2_ENST00000409273.1_Missense_Mutation_p.S2299F|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S2521F	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2346					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTTATAAAATCTCATTCATTT	0.348																																					p.S2521F		Atlas-SNP	.											XIRP2,axilla,malignant_melanoma,0,1	XIRP2	914	.	0			c.C7562T						PASS	.						95.0	91.0	92.0					2																	168105464		1817	4068	5885	SO:0001583	missense	129446	exon9			TAAAATCTCATTC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7562C>T	chr2.hg19:g.168105464C>T	ENSP00000386840:p.Ser2521Phe	240.0	0.0	.		234.0	80.0	.	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683539	0.68157	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02890	4.12;4.12;4.13	6.07	5.15	0.70609	.	0.303615	0.35349	N	0.003270	T	0.05686	0.0149	M	0.65975	2.015	0.36927	D	0.891702	P;P;P	0.43287	0.702;0.802;0.802	B;B;B	0.36719	0.116;0.231;0.231	T	0.18272	-1.0342	10	0.72032	D	0.01	-15.1299	18.0572	0.89366	0.0:0.8695:0.1305:0.0	.	2346;2346;2299	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	F	2521;2521;2299	ENSP00000386840:S2521F;ENSP00000295237:S2521F;ENSP00000387255:S2299F	ENSP00000295237:S2521F	S	+	2	0	XIRP2	167813710	0.995000	0.38212	0.990000	0.47175	0.943000	0.58893	3.010000	0.49559	2.884000	0.98904	0.655000	0.94253	TCT	.	.	.	none		0.348	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu	37	2	179460381	179460381	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr2:179460381C>T	ENST00000591111.1	-	245	53001	c.52777G>A	c.(52777-52779)Gtg>Atg	p.V17593M	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V10361M|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V10169M|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V16666M|TTN_ENST00000359218.5_Missense_Mutation_p.V10294M|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V19234M|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17593	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATATGTCACTGGGGTCCAT	0.453																																					p.V19234M		Atlas-SNP	.											.	TTN	18412	.	0			c.G57700A						PASS	.						73.0	67.0	69.0					2																	179460381		1902	4127	6029	SO:0001583	missense	7273	exon295			ATGTCACTGGGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52777G>A	chr2.hg19:g.179460381C>T	ENSP00000465570:p.Val17593Met	194.0	0.0	.		171.0	66.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.99	2.996350	0.54147	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.9	5.9	0.94986	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77765	0.4179	M	0.85630	2.765	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.79829	-0.1638	9	0.87932	D	0	.	20.2768	0.98488	0.0:1.0:0.0:0.0	.	10169;10294;10361;17593	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	16666;10169;10361;10294;10167	ENSP00000343764:V16666M;ENSP00000434586:V10169M;ENSP00000340554:V10361M;ENSP00000352154:V10294M	ENSP00000340554:V10361M	V	-	1	0	TTN	179168627	1.000000	0.71417	0.993000	0.49108	0.616000	0.37450	7.770000	0.85390	2.808000	0.96608	0.650000	0.86243	GTG	.	.	.	none		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC150	284992	hgsc.bcm.edu	37	2	197576887	197576887	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr2:197576887G>C	ENST00000389175.4	+	16	1849	c.1714G>C	c.(1714-1716)Gaa>Caa	p.E572Q	CCDC150_ENST00000409270.1_5'Flank|CCDC150_ENST00000272831.7_Missense_Mutation_p.E240Q	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	572										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TAAACAGCTAGAAGAACAAGT	0.259																																					p.E572Q		Atlas-SNP	.											.	CCDC150	96	.	0			c.G1714C						PASS	.						46.0	40.0	42.0					2																	197576887		1807	4062	5869	SO:0001583	missense	284992	exon16			CAGCTAGAAGAAC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1714G>C	chr2.hg19:g.197576887G>C	ENSP00000373827:p.Glu572Gln	165.0	0.0	.		167.0	65.0	.	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	ENST00000389175.4	hg19	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658115	0.29425	.	.	ENSG00000144395	ENST00000272831;ENST00000389175	T	0.44881	0.91	4.56	3.64	0.41730	.	0.347815	0.23865	N	0.043807	T	0.26882	0.0658	L	0.31294	0.92	0.80722	D	1	B;B	0.33318	0.154;0.408	B;B	0.31751	0.135;0.077	T	0.03922	-1.0992	10	0.18710	T	0.47	.	9.6745	0.40032	0.0:0.2311:0.7689:0.0	.	240;572	B4DZ03;Q8NCX0	.;CC150_HUMAN	Q	240;572	ENSP00000373827:E572Q	ENSP00000272831:E240Q	E	+	1	0	CCDC150	197285132	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.097000	0.50251	2.372000	0.80975	0.591000	0.81541	GAA	.	.	.	none		0.259	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
SCG2	7857	hgsc.bcm.edu	37	2	224463934	224463934	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr2:224463934A>G	ENST00000305409.2	-	2	299	c.67T>C	c.(67-69)Tct>Cct	p.S23P		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCAGCCCCAGAGATGAGGAAA	0.423																																					p.S23P		Atlas-SNP	.											.	SCG2	99	.	0			c.T67C						PASS	.						64.0	70.0	68.0					2																	224463934		2203	4299	6502	SO:0001583	missense	7857	exon2			CCCCAGAGATGAG	M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.67T>C	chr2.hg19:g.224463934A>G	ENSP00000304133:p.Ser23Pro	225.0	0.0	.		195.0	75.0	.	NM_003469	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000305409.2	hg19	CCDS2457.1	.	.	.	.	.	.	.	.	.	.	A	7.472	0.646956	0.14516	.	.	ENSG00000171951	ENST00000305409;ENST00000450330;ENST00000421386;ENST00000433889	T;T;T	0.48522	2.64;0.81;0.82	5.59	4.4	0.53042	.	0.593410	0.18763	N	0.131840	T	0.29783	0.0744	N	0.12182	0.205	0.28756	N	0.901182	B	0.06786	0.001	B	0.06405	0.002	T	0.14811	-1.0459	10	0.32370	T	0.25	.	11.9761	0.53091	0.9309:0.0:0.0691:0.0	.	23	P13521	SCG2_HUMAN	P	23	ENSP00000304133:S23P;ENSP00000394702:S23P;ENSP00000415468:S23P	ENSP00000304133:S23P	S	-	1	0	SCG2	224172178	0.728000	0.28080	0.064000	0.19789	0.246000	0.25737	2.472000	0.45136	1.008000	0.39264	0.528000	0.53228	TCT	.	.	.	none		0.423	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256870.2	NM_003469	
IL17RC	84818	hgsc.bcm.edu	37	3	9962215	9962215	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:9962215G>A	ENST00000295981.3	+	6	937	c.719G>A	c.(718-720)aGt>aAt	p.S240N	IL17RC_ENST00000383812.4_Missense_Mutation_p.S169N|IL17RC_ENST00000455057.1_Missense_Mutation_p.S169N|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000416074.2_Missense_Mutation_p.S40N|IL17RC_ENST00000403601.3_Missense_Mutation_p.S169N|IL17RC_ENST00000413608.1_Missense_Mutation_p.S169N|IL17RC_ENST00000498214.1_3'UTR	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	240					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GCCCTAGGGAGTGAGGTACGA	0.597																																					p.S240N		Atlas-SNP	.											.	IL17RC	55	.	0			c.G719A						PASS	.						76.0	64.0	68.0					3																	9962215		2203	4299	6502	SO:0001583	missense	84818	exon6			TAGGGAGTGAGGT	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.719G>A	chr3.hg19:g.9962215G>A	ENSP00000295981:p.Ser240Asn	75.0	0.0	.		99.0	50.0	.	NM_153461	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	ENST00000295981.3	hg19	CCDS2590.1	.	.	.	.	.	.	.	.	.	.	G	9.495	1.101637	0.20632	.	.	ENSG00000163702	ENST00000383812;ENST00000438091;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51	5.5	2.71	0.32032	.	0.731779	0.12494	N	0.463996	T	0.09949	0.0244	L	0.29908	0.895	0.19300	N	0.999978	B;P;B;B;B;B;B;B;P	0.36315	0.435;0.547;0.148;0.148;0.231;0.231;0.231;0.255;0.547	B;B;B;B;B;B;B;B;B	0.33121	0.08;0.076;0.018;0.018;0.048;0.048;0.056;0.071;0.158	T	0.20338	-1.0278	10	0.49607	T	0.09	-1.0928	8.8918	0.35439	0.1168:0.5055:0.3777:0.0	.	169;40;169;169;169;169;169;240;169	Q8NAC3-4;F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;.;I17RC_HUMAN;.	N	169;144;240;144;169;40;169;169	ENSP00000373323:S169N;ENSP00000414609:S144N;ENSP00000295981:S240N;ENSP00000401128:S144N;ENSP00000384969:S169N;ENSP00000395315:S40N;ENSP00000407894:S169N;ENSP00000396064:S169N	ENSP00000295981:S240N	S	+	2	0	IL17RC	9937215	0.721000	0.28007	0.812000	0.32479	0.594000	0.36715	0.413000	0.21148	0.810000	0.34279	0.563000	0.77884	AGT	.	.	.	none		0.597	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
ATP2B2	491	hgsc.bcm.edu	37	3	10442753	10442753	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:10442753A>T	ENST00000352432.4	-	4	734	c.665T>A	c.(664-666)cTc>cAc	p.L222H	ATP2B2_ENST00000360273.2_Missense_Mutation_p.L222H|ATP2B2_ENST00000343816.4_Missense_Mutation_p.L222H|ATP2B2_ENST00000397077.1_Missense_Mutation_p.L222H|ATP2B2_ENST00000383800.4_Missense_Mutation_p.L222H			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	222					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GTCGGCAGGGAGGAGGTCACC	0.567																																					p.L222H	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.T665A						PASS	.						70.0	66.0	67.0					3																	10442753		2203	4300	6503	SO:0001583	missense	491	exon5			GCAGGGAGGAGGT	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.665T>A	chr3.hg19:g.10442753A>T	ENSP00000324172:p.Leu222His	86.0	0.0	.		88.0	22.0	.	NM_001683	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495893	0.85069	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.96278	0.8786	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.97158	0.9836	10	0.87932	D	0	-32.0976	15.7913	0.78367	1.0:0.0:0.0:0.0	.	222;234;222	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	H	222;222;222;222;222;188;109;222	ENSP00000324172:L222H;ENSP00000373311:L222H;ENSP00000380267:L222H;ENSP00000353414:L222H;ENSP00000344677:L222H;ENSP00000414854:L109H	ENSP00000342954:L222H	L	-	2	0	ATP2B2	10417753	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.313000	0.96297	2.124000	0.65301	0.528000	0.53228	CTC	.	.	.	none		0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
ATG7	10533	hgsc.bcm.edu	37	3	11374553	11374553	+	Missense_Mutation	SNP	T	T	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:11374553T>A	ENST00000354449.3	+	9	900	c.875T>A	c.(874-876)aTg>aAg	p.M292K	ATG7_ENST00000446450.2_Missense_Mutation_p.M253K|ATG7_ENST00000354956.5_Missense_Mutation_p.M292K	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	292					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CTTCCAGAAATGGCATTTAGC	0.433																																					p.M292K		Atlas-SNP	.											.	ATG7	56	.	0			c.T875A						PASS	.						97.0	86.0	89.0					3																	11374553		2203	4300	6503	SO:0001583	missense	10533	exon9			CAGAAATGGCATT	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.875T>A	chr3.hg19:g.11374553T>A	ENSP00000346437:p.Met292Lys	91.0	0.0	.		110.0	27.0	.	NM_001136031	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	hg19	CCDS2605.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222160	0.39300	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	T;T;T	0.39787	1.07;1.07;1.06	5.46	5.46	0.80206	.	0.482455	0.22908	N	0.054170	T	0.22513	0.0543	N	0.16903	0.455	0.31387	N	0.678283	B;B;B	0.15930	0.015;0.012;0.007	B;B;B	0.20577	0.008;0.03;0.008	T	0.24476	-1.0159	10	0.06236	T	0.91	-9.8661	8.0007	0.30295	0.0:0.0725:0.1379:0.7896	.	253;292;292	E9PB95;O95352-2;O95352	.;.;ATG7_HUMAN	K	253;292;292	ENSP00000412580:M253K;ENSP00000347042:M292K;ENSP00000346437:M292K	ENSP00000346437:M292K	M	+	2	0	ATG7	11349553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.115000	0.50391	2.063000	0.61619	0.482000	0.46254	ATG	.	.	.	none		0.433	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395	
RBM15B	29890	hgsc.bcm.edu	37	3	51431071	51431071	+	Silent	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:51431071C>A	ENST00000323686.4	+	1	2341	c.2241C>A	c.(2239-2241)atC>atA	p.I747I		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	747	Interaction with Epstein-Barr virus BMLF1.|SPOC. {ECO:0000255|PROSITE- ProRule:PRU00249}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGGGGTGATCAGCAGTCTCC	0.567																																					p.I747I		Atlas-SNP	.											.	RBM15B	47	.	0			c.C2241A						PASS	.						67.0	73.0	71.0					3																	51431071		2203	4300	6503	SO:0001819	synonymous_variant	29890	exon1			GGTGATCAGCAGT	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2241C>A	chr3.hg19:g.51431071C>A		79.0	0.0	.		125.0	75.0	.	NM_013286	A4QPG7|Q6QE19|Q9BV96	Silent	SNP	ENST00000323686.4	hg19	CCDS33764.1																																																																																			.	.	.	none		0.567	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
GRAMD1C	54762	hgsc.bcm.edu	37	3	113659165	113659165	+	Silent	SNP	C	C	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:113659165C>G	ENST00000358160.4	+	17	2373	c.1881C>G	c.(1879-1881)ctC>ctG	p.L627L	GRAMD1C_ENST00000440446.2_Silent_p.L422L|GRAMD1C_ENST00000472026.1_Silent_p.L460L|GRAMD1C_ENST00000452134.2_Silent_p.L356L|GRAMD1C_ENST00000479212.1_3'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	627						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						AGGGAGTGCTCCGAGACTCCA	0.413																																					p.L627L		Atlas-SNP	.											.	GRAMD1C	71	.	0			c.C1881G						PASS	.						133.0	134.0	134.0					3																	113659165		2203	4300	6503	SO:0001819	synonymous_variant	54762	exon17			AGTGCTCCGAGAC		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.1881C>G	chr3.hg19:g.113659165C>G		112.0	0.0	.		151.0	31.0	.	NM_017577	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Silent	SNP	ENST00000358160.4	hg19	CCDS33826.1																																																																																			.	.	.	none		0.413	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
FAM43A	131583	hgsc.bcm.edu	37	3	194408012	194408012	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:194408012T>C	ENST00000329759.4	+	1	1391	c.457T>C	c.(457-459)Ttc>Ctc	p.F153L		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	153										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		GCCCAAGGTCTTCGCCTGGGT	0.706																																					p.F153L		Atlas-SNP	.											.	FAM43A	24	.	0			c.T457C						PASS	.						10.0	8.0	8.0					3																	194408012		2103	4161	6264	SO:0001583	missense	131583	exon1			AAGGTCTTCGCCT	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.457T>C	chr3.hg19:g.194408012T>C	ENSP00000371397:p.Phe153Leu	13.0	0.0	.		23.0	10.0	.	NM_153690	A3KME2|Q8IXP4|Q8WZ07	Missense_Mutation	SNP	ENST00000329759.4	hg19	CCDS33923.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.881997	0.91740	.	.	ENSG00000185112	ENST00000329759	T	0.74421	-0.84	5.07	5.07	0.68467	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.82568	0.5065	L	0.53671	1.685	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.83631	0.0145	10	0.54805	T	0.06	-20.3017	14.0316	0.64619	0.0:0.0:0.0:1.0	.	153	Q8N2R8	FA43A_HUMAN	L	153	ENSP00000371397:F153L	ENSP00000371397:F153L	F	+	1	0	FAM43A	195889301	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.573000	0.82421	1.913000	0.55393	0.379000	0.24179	TTC	.	.	.	none		0.706	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
MAEA	10296	hgsc.bcm.edu	37	4	1305935	1305935	+	Missense_Mutation	SNP	G	G	C	rs146286709		TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:1305935G>C	ENST00000303400.4	+	2	301	c.238G>C	c.(238-240)Gtc>Ctc	p.V80L	MAEA_ENST00000505839.1_Missense_Mutation_p.V32L|MAEA_ENST00000510794.1_Missense_Mutation_p.V79L|MAEA_ENST00000505177.2_Missense_Mutation_p.V80L|MAEA_ENST00000264750.6_Missense_Mutation_p.V80L|MAEA_ENST00000514708.1_Missense_Mutation_p.V80L|MAEA_ENST00000452175.2_Missense_Mutation_p.V69L	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	80	Extracellular and involved in cell to cell contact.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	GAAGCTCAGCGTCCTCAAGAG	0.627																																					p.V80L		Atlas-SNP	.											.	MAEA	39	.	0			c.G238C						PASS	.						35.0	38.0	37.0					4																	1305935		2203	4300	6503	SO:0001583	missense	10296	exon2			CTCAGCGTCCTCA	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.238G>C	chr4.hg19:g.1305935G>C	ENSP00000302830:p.Val80Leu	122.0	0.0	.		67.0	21.0	.	NM_005882	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	hg19	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836364	0.71373	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000503653;ENST00000264750;ENST00000382947;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000514708;ENST00000510794;ENST00000512842;ENST00000505839	T;T;T;T;T;T;T;T	0.47177	0.94;0.93;0.88;0.92;0.85;0.88;0.91;0.93	5.94	5.09	0.68999	.	0.054564	0.64402	D	0.000001	T	0.46908	0.1417	M	0.64404	1.975	0.38491	D	0.947969	B;B;B;B;B;B	0.27882	0.074;0.171;0.07;0.192;0.07;0.002	B;B;B;B;B;B	0.29077	0.057;0.081;0.098;0.094;0.076;0.012	T	0.43861	-0.9365	10	0.27785	T	0.31	-17.4029	15.5456	0.76097	0.0673:0.0:0.9327:0.0	.	79;80;80;80;80;80	B4DVN3;E7ESC7;Q7L5Y9-2;D6RIB6;Q7L5Y9-3;Q7L5Y9	.;.;.;.;.;MAEA_HUMAN	L	80;80;80;80;80;59;80;69;80;79;32;32	ENSP00000302830:V80L;ENSP00000422215:V80L;ENSP00000421644:V80L;ENSP00000264750:V80L;ENSP00000426903:V80L;ENSP00000411415:V69L;ENSP00000427512:V80L;ENSP00000426807:V79L	ENSP00000264750:V80L	V	+	1	0	MAEA	1295935	1.000000	0.71417	0.927000	0.36925	0.977000	0.68977	7.630000	0.83225	2.815000	0.96918	0.650000	0.86243	GTC	.	G|1.000;A|0.000	.	alt		0.627	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
SH3TC1	54436	hgsc.bcm.edu	37	4	8229479	8229479	+	Silent	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:8229479C>T	ENST00000245105.3	+	12	2125	c.2058C>T	c.(2056-2058)ccC>ccT	p.P686P	SH3TC1_ENST00000539824.1_Silent_p.P610P	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	686										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						AGGCCCTGCCCTTCCTAGAGC	0.692																																					p.P686P	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.C2058T						PASS	.						15.0	19.0	18.0					4																	8229479		2155	4213	6368	SO:0001819	synonymous_variant	54436	exon12			CCTGCCCTTCCTA	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2058C>T	chr4.hg19:g.8229479C>T		87.0	0.0	.		42.0	13.0	.	NM_018986	Q4W5G5	Silent	SNP	ENST00000245105.3	hg19	CCDS3399.1																																																																																			.	.	.	none		0.692	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
HS3ST1	9957	hgsc.bcm.edu	37	4	11401470	11401470	+	Missense_Mutation	SNP	A	A	T	rs183663781		TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:11401470A>T	ENST00000002596.5	-	2	1334	c.160T>A	c.(160-162)Ttg>Atg	p.L54M		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	54					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GTCTGCGGCAACTGCTGGGCA	0.701																																					p.L54M		Atlas-SNP	.											.	HS3ST1	41	.	0			c.T160A						PASS	.						31.0	28.0	29.0					4																	11401470		2202	4298	6500	SO:0001583	missense	9957	exon2			GCGGCAACTGCTG	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.160T>A	chr4.hg19:g.11401470A>T	ENSP00000002596:p.Leu54Met	49.0	0.0	.		30.0	13.0	.	NM_005114	B3KUA6|Q6PEY8	Missense_Mutation	SNP	ENST00000002596.5	hg19	CCDS3408.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.132217	0.37630	.	.	ENSG00000002587	ENST00000002596;ENST00000514690;ENST00000510712	T;T;T	0.59772	0.24;0.24;0.24	5.57	4.73	0.59995	.	0.328799	0.28754	N	0.014246	T	0.80093	0.4560	H	0.94886	3.595	0.50313	D	0.999861	D	0.67145	0.996	D	0.71414	0.973	D	0.83531	0.0091	10	0.72032	D	0.01	.	9.763	0.40543	0.1558:0.0:0.8442:0.0	.	54	O14792	HS3S1_HUMAN	M	54	ENSP00000002596:L54M;ENSP00000425673:L54M;ENSP00000422629:L54M	ENSP00000002596:L54M	L	-	1	2	HS3ST1	11010568	1.000000	0.71417	0.997000	0.53966	0.117000	0.20001	4.210000	0.58500	1.371000	0.46172	-0.132000	0.14878	TTG	.	A|0.999;C|0.001	.	alt		0.701	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207073.3	NM_005114	
COQ2	27235	hgsc.bcm.edu	37	4	84185397	84185397	+	Silent	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:84185397C>T	ENST00000311469.4	-	7	1220	c.1221G>A	c.(1219-1221)aaG>aaA	p.K407K	COQ2_ENST00000439031.2_Silent_p.K370K	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	357					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				TTTTGTCTGTCTTCTTTTCTT	0.284																																					p.K407K		Atlas-SNP	.											.	COQ2	22	.	0			c.G1221A						PASS	.						57.0	51.0	53.0					4																	84185397		1776	4061	5837	SO:0001819	synonymous_variant	27235	exon7			GTCTGTCTTCTTT		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.1221G>A	chr4.hg19:g.84185397C>T		249.0	0.0	.		201.0	71.0	.	NM_015697	O95331|Q1JQ78|Q684R2	Silent	SNP	ENST00000311469.4	hg19	CCDS47090.2																																																																																			.	.	.	none		0.284	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
PCDH18	54510	hgsc.bcm.edu	37	4	138452946	138452946	+	Silent	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:138452946C>T	ENST00000344876.4	-	1	683	c.297G>A	c.(295-297)caG>caA	p.Q99Q	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Silent_p.Q99Q|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	99	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TCAAGTTTTTCTGGCACAGTT	0.428																																					p.Q99Q		Atlas-SNP	.											PCDH18,NS,carcinoma,0,1	PCDH18	229	.	0			c.G297A						PASS	.						168.0	165.0	166.0					4																	138452946		2203	4300	6503	SO:0001819	synonymous_variant	54510	exon1			GTTTTTCTGGCAC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.297G>A	chr4.hg19:g.138452946C>T		134.0	0.0	.		89.0	33.0	.	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Silent	SNP	ENST00000344876.4	hg19	CCDS34064.1																																																																																			.	.	.	none		0.428	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
PPID	5481	hgsc.bcm.edu	37	4	159634384	159634384	+	Nonsense_Mutation	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:159634384C>A	ENST00000307720.3	-	7	888	c.781G>T	c.(781-783)Gag>Tag	p.E261*		NM_005038.2	NP_005029.1	Q08752	PPID_HUMAN	peptidylprolyl isomerase D	261	Interaction with HSP90AB1. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to UV-A (GO:0071492)|chaperone-mediated protein folding (GO:0061077)|lipid particle organization (GO:0034389)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|protein transport (GO:0015031)|viral release from host cell (GO:0019076)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|estrogen receptor binding (GO:0030331)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|transcription factor binding (GO:0008134)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		TCTGCTGTCTCAATAACAGCC	0.398																																					p.E261X		Atlas-SNP	.											.	PPID	22	.	0			c.G781T						PASS	.						127.0	116.0	120.0					4																	159634384		2203	4300	6503	SO:0001587	stop_gained	5481	exon7			CTGTCTCAATAAC		CCDS3801.1	4q31.3	2013-01-10	2008-10-24		ENSG00000171497	ENSG00000171497		"""Tetratricopeptide (TTC) repeat domain containing"""	9257	protein-coding gene	gene with protein product	"""cyclophilin 40"""	601753	"""peptidylprolyl isomerase D (cyclophilin D)"""			8509368	Standard	NM_005038		Approved	CYP-40	uc003iqc.3	Q08752	OTTHUMG00000161927	ENST00000307720.3:c.781G>T	chr4.hg19:g.159634384C>A	ENSP00000303754:p.Glu261*	86.0	0.0	.		77.0	34.0	.	NM_005038	B2R9V2	Nonsense_Mutation	SNP	ENST00000307720.3	hg19	CCDS3801.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.650373	0.87958	.	.	ENSG00000171497	ENST00000307720	.	.	.	5.44	1.71	0.24356	.	0.331752	0.20962	N	0.082560	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-16.4158	8.7939	0.34868	0.0:0.6398:0.2319:0.1282	.	.	.	.	X	261	.	ENSP00000303754:E261X	E	-	1	0	PPID	159853834	0.882000	0.30256	0.005000	0.12908	0.160000	0.22226	3.156000	0.50708	0.162000	0.19483	0.650000	0.86243	GAG	.	.	.	none		0.398	PPID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366436.1	NM_005038	
PKD2L2	27039	hgsc.bcm.edu	37	5	137271569	137271569	+	Nonsense_Mutation	SNP	C	C	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr5:137271569C>G	ENST00000508883.1	+	13	1781	c.1755C>G	c.(1753-1755)taC>taG	p.Y585*	PKD2L2_ENST00000290431.5_Nonsense_Mutation_p.Y585*|PKD2L2_ENST00000502810.1_Nonsense_Mutation_p.Y563*|PKD2L2_ENST00000508638.1_Nonsense_Mutation_p.Y484*|PKD2L2_ENST00000350250.4_Nonsense_Mutation_p.Y551*			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	585					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			AAGATGACTACCAGCCTGTCA	0.388																																					p.Y585X		Atlas-SNP	.											.	PKD2L2	68	.	0			c.C1755G						PASS	.						94.0	93.0	93.0					5																	137271569		1845	4093	5938	SO:0001587	stop_gained	27039	exon13			TGACTACCAGCCT	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1755C>G	chr5.hg19:g.137271569C>G	ENSP00000424725:p.Tyr585*	62.0	0.0	.		56.0	22.0	.	NM_014386	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Nonsense_Mutation	SNP	ENST00000508883.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.5	4.302549	0.81136	.	.	ENSG00000078795	ENST00000350250;ENST00000508638;ENST00000502810;ENST00000508883;ENST00000290431	.	.	.	5.43	1.56	0.23342	.	0.252794	0.27971	N	0.017101	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-5.6504	8.3066	0.32047	0.0:0.6543:0.0:0.3457	.	.	.	.	X	551;484;563;585;585	.	ENSP00000290431:Y585X	Y	+	3	2	PKD2L2	137299468	1.000000	0.71417	0.999000	0.59377	0.954000	0.61252	0.387000	0.20718	0.347000	0.23924	0.655000	0.94253	TAC	.	.	.	none		0.388	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
F12	2161	hgsc.bcm.edu	37	5	176831557	176831557	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr5:176831557C>A	ENST00000253496.3	-	8	791	c.743G>T	c.(742-744)cGg>cTg	p.R248L	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	248	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	AGTCACGTTCCGGTAGGTGGC	0.736									Hereditary Angioedema		OREG0017088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R248L		Atlas-SNP	.											.	F12	35	.	0			c.G743T						PASS	.						11.0	14.0	13.0					5																	176831557		2173	4280	6453	SO:0001583	missense	2161	exon8	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	ACGTTCCGGTAGG	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.743G>T	chr5.hg19:g.176831557C>A	ENSP00000253496:p.Arg248Leu	42.0	0.0	.	1934	34.0	18.0	.	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	hg19	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669323	0.29604	.	.	ENSG00000131187	ENST00000253496	T	0.66995	-0.24	5.31	1.21	0.21127	Kringle (4);Kringle-like fold (1);	1.106110	0.07016	N	0.825978	T	0.58032	0.2094	L	0.48260	1.515	0.18873	N	0.999988	B	0.24258	0.1	B	0.29785	0.107	T	0.51188	-0.8737	10	0.48119	T	0.1	.	3.2323	0.06752	0.1851:0.5144:0.0:0.3005	.	248	P00748	FA12_HUMAN	L	248	ENSP00000253496:R248L	ENSP00000253496:R248L	R	-	2	0	F12	176764163	0.000000	0.05858	0.502000	0.27614	0.140000	0.21249	0.283000	0.18846	0.366000	0.24427	0.561000	0.74099	CGG	.	.	.	none		0.736	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
ITPR3	3710	hgsc.bcm.edu	37	6	33638181	33638181	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr6:33638181G>T	ENST00000374316.5	+	20	3329	c.2269G>T	c.(2269-2271)Gtg>Ttg	p.V757L	ITPR3_ENST00000605930.1_Missense_Mutation_p.V757L			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	757					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GCAGCTGGGCGTGGACCTGAT	0.612																																					p.V757L		Atlas-SNP	.											.	ITPR3	409	.	0			c.G2269T						PASS	.						137.0	123.0	128.0					6																	33638181		2203	4300	6503	SO:0001583	missense	3710	exon19			CTGGGCGTGGACC	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2269G>T	chr6.hg19:g.33638181G>T	ENSP00000363435:p.Val757Leu	67.0	0.0	.		52.0	46.0	.	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297216	0.81025	.	.	ENSG00000096433	ENST00000374316	D	0.91577	-2.87	4.81	3.94	0.45596	.	0.073011	0.56097	D	0.000033	D	0.87629	0.6225	M	0.65975	2.015	0.42224	D	0.991862	P	0.47604	0.898	P	0.47645	0.553	D	0.86865	0.2032	10	0.46703	T	0.11	-20.5941	12.6317	0.56661	0.0805:0.0:0.9195:0.0	.	757	Q14573	ITPR3_HUMAN	L	757	ENSP00000363435:V757L	ENSP00000363435:V757L	V	+	1	0	ITPR3	33746159	1.000000	0.71417	0.847000	0.33407	0.987000	0.75469	4.668000	0.61568	1.012000	0.39366	0.563000	0.77884	GTG	.	.	.	none		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
ACTB	60	hgsc.bcm.edu	37	7	5567773	5567773	+	Silent	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr7:5567773G>A	ENST00000331789.5	-	5	1037	c.846C>T	c.(844-846)atC>atT	p.I282I	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	282					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CACACTTCATGATGGAGTTGA	0.567																																					p.I282I		Atlas-SNP	.											.	ACTB	45	.	0			c.C846T						PASS	.						150.0	146.0	148.0					7																	5567773		2203	4300	6503	SO:0001819	synonymous_variant	60	exon5			CTTCATGATGGAG	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.846C>T	chr7.hg19:g.5567773G>A		68.0	0.0	.		90.0	27.0	.	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Silent	SNP	ENST00000331789.5	hg19	CCDS5341.1																																																																																			.	.	.	none		0.567	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
CFAP69	79846	hgsc.bcm.edu	37	7	89903320	89903320	+	Nonsense_Mutation	SNP	A	A	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr7:89903320A>T	ENST00000389297.4	+	9	1131	c.880A>T	c.(880-882)Aaa>Taa	p.K294*	C7orf63_ENST00000497910.1_Nonsense_Mutation_p.K276*|C7orf63_ENST00000316089.8_Nonsense_Mutation_p.K294*	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		294										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						GGAAGTATTTAAAAATCTGTT	0.294																																					p.K294X		Atlas-SNP	.											.	C7orf63	158	.	0			c.A880T						PASS	.						56.0	53.0	54.0					7																	89903320		1801	4059	5860	SO:0001587	stop_gained	79846	exon9			GTATTTAAAAATC																												ENST00000389297.4:c.880A>T	chr7.hg19:g.89903320A>T	ENSP00000373948:p.Lys294*	208.0	1.0	.		272.0	140.0	.	NM_001039706	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Nonsense_Mutation	SNP	ENST00000389297.4	hg19	CCDS43613.2	.	.	.	.	.	.	.	.	.	.	A	19.61	3.859359	0.71834	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170	.	.	.	5.33	5.33	0.75918	.	0.542673	0.17704	N	0.164814	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.0252	8.6919	0.34271	0.909:0.0:0.091:0.0	.	.	.	.	X	294;294;276;234	.	ENSP00000321753:K294X	K	+	1	0	C7orf63	89741256	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.473000	0.35387	2.234000	0.73211	0.533000	0.62120	AAA	.	.	.	none		0.294	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139891.4		
CCDC132	55610	hgsc.bcm.edu	37	7	92905642	92905642	+	Intron	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr7:92905642C>T	ENST00000305866.5	+	12	1070				CCDC132_ENST00000544910.1_Intron|CCDC132_ENST00000251739.5_Missense_Mutation_p.H323Y|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000317751.6_Intron|CCDC132_ENST00000541136.1_Intron	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132							extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AATTACTATTCATATATCTCT	0.284																																					p.H323Y		Atlas-SNP	.											.	CCDC132	136	.	0			c.C967T						PASS	.						77.0	77.0	77.0					7																	92905642		2203	4300	6503	SO:0001627	intron_variant	55610	exon12			ACTATTCATATAT	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.942+25C>T	chr7.hg19:g.92905642C>T		62.0	0.0	.		78.0	15.0	.	NM_024553	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	hg19	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	C	5.007	0.187013	0.09547	.	.	ENSG00000004766	ENST00000251739	.	.	.	4.54	-1.73	0.08081	.	.	.	.	.	T	0.36193	0.0958	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37244	-0.9714	7	0.87932	D	0	.	10.8309	0.46659	0.0:0.2665:0.0:0.7335	.	323	Q96JG6-2	.	Y	323	.	ENSP00000251739:H323Y	H	+	1	0	CCDC132	92743578	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-0.406000	0.07187	-0.297000	0.08934	-0.140000	0.14226	CAT	.	.	.	none		0.284	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
TRIM56	81844	hgsc.bcm.edu	37	7	100732116	100732116	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr7:100732116C>T	ENST00000306085.6	+	3	1820	c.1523C>T	c.(1522-1524)cCc>cTc	p.P508L		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	508					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGCGGTCCCCCCGGATCACC	0.647																																					p.P508L	Ovarian(89;1092 1379 22756 38989 39611)	Atlas-SNP	.											TRIM56_ENST00000306085,right_lower_lobe,carcinoma,0,2	TRIM56	123	.	0			c.C1523T						PASS	.						59.0	68.0	65.0					7																	100732116		2003	4161	6164	SO:0001583	missense	81844	exon3			GGTCCCCCCGGAT	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1523C>T	chr7.hg19:g.100732116C>T	ENSP00000305161:p.Pro508Leu	67.0	0.0	.		98.0	32.0	.	NM_030961	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Missense_Mutation	SNP	ENST00000306085.6	hg19	CCDS43625.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319380	0.41096	.	.	ENSG00000169871	ENST00000306085	T	0.53206	0.63	3.88	3.88	0.44766	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	T	0.49660	0.1570	N	0.19112	0.55	0.40985	D	0.984807	D	0.89917	1.0	D	0.80764	0.994	T	0.40440	-0.9563	9	0.29301	T	0.29	.	11.6346	0.51196	0.0:1.0:0.0:0.0	.	508	Q9BRZ2	TRI56_HUMAN	L	508	ENSP00000305161:P508L	ENSP00000305161:P508L	P	+	2	0	TRIM56	100518836	0.745000	0.28261	0.514000	0.27761	0.284000	0.27059	4.092000	0.57707	2.449000	0.82847	0.591000	0.81541	CCC	.	.	.	none		0.647	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961	
CHRM2	1129	hgsc.bcm.edu	37	7	136700128	136700128	+	Silent	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr7:136700128G>A	ENST00000445907.2	+	3	1044	c.516G>A	c.(514-516)gaG>gaA	p.E172E	hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Silent_p.E172E|CHRM2_ENST00000397608.3_Silent_p.E172E|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000402486.3_Silent_p.E172E|CHRM2_ENST00000401861.1_Silent_p.E172E|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000453373.1_Silent_p.E172E|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000586239.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	172					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GAACTGTGGAGGATGGGGAGT	0.493																																					p.E172E		Atlas-SNP	.											CHRM2,NS,carcinoma,0,1	CHRM2	167	.	0			c.G516A						PASS	.						114.0	107.0	109.0					7																	136700128		2203	4300	6503	SO:0001819	synonymous_variant	1129	exon3			TGTGGAGGATGGG		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.516G>A	chr7.hg19:g.136700128G>A		64.0	0.0	.		101.0	25.0	.	NM_001006632	Q4VBK6|Q9P1X9	Silent	SNP	ENST00000445907.2	hg19	CCDS5843.1																																																																																			.	.	.	none		0.493	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
PLEC	5339	hgsc.bcm.edu	37	8	144990855	144990855	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr8:144990855C>A	ENST00000322810.4	-	32	13714	c.13545G>T	c.(13543-13545)tgG>tgT	p.W4515C	PLEC_ENST00000527096.1_Missense_Mutation_p.W4401C|PLEC_ENST00000354589.3_Missense_Mutation_p.W4378C|PLEC_ENST00000356346.3_Missense_Mutation_p.W4364C|PLEC_ENST00000436759.2_Missense_Mutation_p.W4405C|PLEC_ENST00000398774.2_Missense_Mutation_p.W4346C|PLEC_ENST00000357649.2_Missense_Mutation_p.W4382C|PLEC_ENST00000345136.3_Missense_Mutation_p.W4378C|PLEC_ENST00000354958.2_Missense_Mutation_p.W4356C	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4515	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGTAGTAGAGCCAGCCCTTCT	0.687																																					p.W4515C		Atlas-SNP	.											.	PLEC	1144	.	0			c.G13545T						PASS	.						28.0	32.0	31.0					8																	144990855		2033	4179	6212	SO:0001583	missense	5339	exon32			GTAGAGCCAGCCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.13545G>T	chr8.hg19:g.144990855C>A	ENSP00000323856:p.Trp4515Cys	45.0	0.0	.		33.0	17.0	.	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	hg19	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854233	0.32791	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.19	5.19	0.71726	.	0.000000	0.64402	U	0.000007	T	0.75606	0.3872	L	0.41492	1.28	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;P;D;D;D;D	0.66084	0.941;0.941;0.941;0.875;0.941;0.941;0.941;0.941	T	0.77797	-0.2453	10	0.87932	D	0	.	18.5216	0.90954	0.0:1.0:0.0:0.0	.	4405;4364;4356;4515;4346;4378;4382;4378	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	C	4378;4382;4378;4346;4515;4356;4364;4405;4401	ENSP00000344848:W4378C;ENSP00000350277:W4382C;ENSP00000346602:W4378C;ENSP00000381756:W4346C;ENSP00000323856:W4515C;ENSP00000347044:W4356C;ENSP00000348702:W4364C;ENSP00000388180:W4405C;ENSP00000434583:W4401C	ENSP00000323856:W4515C	W	-	3	0	PLEC	145062843	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.593000	0.82686	2.693000	0.91896	0.643000	0.83706	TGG	.	.	.	none		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
GDA	9615	hgsc.bcm.edu	37	9	74828909	74828909	+	Splice_Site	SNP	T	T	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr9:74828909T>A	ENST00000358399.3	+	5	671		c.e5+2		GDA_ENST00000545168.1_Splice_Site|GDA_ENST00000477618.1_Splice_Site|GDA_ENST00000376986.1_Splice_Site|GDA_ENST00000376989.3_Splice_Site|GDA_ENST00000238018.4_Splice_Site	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase						guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		AACTGAGAGGTAAAAGGCCCA	0.438																																					.		Atlas-SNP	.											.	GDA	113	.	0			c.356+2T>A						PASS	.						106.0	100.0	102.0					9																	74828909		2203	4300	6503	SO:0001630	splice_region_variant	9615	exon5			GAGAGGTAAAAGG	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.578+2T>A	chr9.hg19:g.74828909T>A		134.0	0.0	.		106.0	45.0	.	NM_001242507	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Splice_Site	SNP	ENST00000358399.3	hg19	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	T	13.64	2.296939	0.40594	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399;ENST00000414671	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5087	0.75764	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	GDA	74018729	1.000000	0.71417	0.991000	0.47740	0.262000	0.26303	5.420000	0.66441	2.150000	0.67090	0.482000	0.46254	.	.	.	.	none		0.438	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1		Intron
PCSK5	5125	hgsc.bcm.edu	37	9	78710821	78710822	+	Missense_Mutation	DNP	GG	GG	CA			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr9:78710821_78710822GG>CA	ENST00000545128.1	+	8	1448_1449	c.910_911GG>CA	c.(910-912)GGc>CAc	p.G304H	PCSK5_ENST00000376767.3_Missense_Mutation_p.G304H|PCSK5_ENST00000376752.4_Missense_Mutation_p.G304H	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	304	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GAGAGGCCTCGGCTCTGTGTTT	0.495																																					p.G304R|p.G304D		Atlas-SNP	.											.	PCSK5	329	.	0			c.G910C|c.G911A						PASS	.																																			SO:0001583	missense	5125	exon8			GGCCTCGGCTCTG|GCCTCGGCTCTGT		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	Exception_encountered	chr9.hg19:g.78710821_78710822delinsCA	ENSP00000446280:p.Gly304His	99.0|101.0	0.0	.		81.0|82.0	32.0|31.0	.	NM_006200	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	hg19	CCDS55320.1																																																																																			.	.	.	none		0.495	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123216128	123216128	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr9:123216128C>T	ENST00000349780.4	-	21	2578	c.2399G>A	c.(2398-2400)cGg>cAg	p.R800Q	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.R768Q|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.R800Q|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.R800Q	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	800					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						AAGCAGTTCCCGTACCACTTT	0.468																																					p.R800Q		Atlas-SNP	.											.	CDK5RAP2	157	.	0			c.G2399A						PASS	.						68.0	64.0	65.0					9																	123216128		2202	4295	6497	SO:0001583	missense	55755	exon21			AGTTCCCGTACCA	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2399G>A	chr9.hg19:g.123216128C>T	ENSP00000343818:p.Arg800Gln	106.0	0.0	.		116.0	42.0	.	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	hg19	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	C	5.025	0.190284	0.09547	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.17854	3.92;3.83;3.95;3.86;2.25	5.79	3.0	0.34707	.	0.578394	0.16647	N	0.205372	T	0.09992	0.0245	N	0.17082	0.46	0.09310	N	1	B;B;B;B	0.15473	0.003;0.001;0.002;0.013	B;B;B;B	0.10450	0.005;0.001;0.002;0.003	T	0.29640	-1.0005	10	0.34782	T	0.22	.	7.8742	0.29584	0.0:0.6829:0.0:0.3171	.	569;800;800;194	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	Q	768;800;800;800;194	ENSP00000354065:R768Q;ENSP00000352258:R800Q;ENSP00000343818:R800Q;ENSP00000353317:R800Q;ENSP00000400395:R194Q	ENSP00000343818:R800Q	R	-	2	0	CDK5RAP2	122255949	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	0.005000	0.13129	0.381000	0.24851	-0.137000	0.14449	CGG	.	.	.	none		0.468	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
PRRC2B	84726	hgsc.bcm.edu	37	9	134305606	134305606	+	Missense_Mutation	SNP	T	T	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr9:134305606T>A	ENST00000357304.4	+	1	130	c.75T>A	c.(73-75)gaT>gaA	p.D25E	PRRC2B_ENST00000405995.1_Missense_Mutation_p.D25E|PRRC2B_ENST00000458550.1_Missense_Mutation_p.D25E	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	25							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCCTGTTTGATAAGTATAAAG	0.453																																					p.D25E		Atlas-SNP	.											.	PRRC2B	266	.	0			c.T75A						PASS	.						72.0	71.0	71.0					9																	134305606		1932	4130	6062	SO:0001583	missense	84726	exon1			GTTTGATAAGTAT	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.75T>A	chr9.hg19:g.134305606T>A	ENSP00000349856:p.Asp25Glu	139.0	0.0	.		135.0	64.0	.	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	hg19	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.342715	0.82022	.	.	ENSG00000130723	ENST00000405995;ENST00000541684;ENST00000357304;ENST00000458550	T;T;T	0.24151	1.87;1.87;1.87	6.17	1.26	0.21427	BAT2, N-terminal (1);	0.000000	0.41294	U	0.000904	T	0.44159	0.1280	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.22695	-1.0209	10	0.72032	D	0.01	-2.03	9.4094	0.38482	0.0:0.4505:0.0:0.5495	.	25	Q5JSZ5	PRC2B_HUMAN	E	25	ENSP00000384606:D25E;ENSP00000349856:D25E;ENSP00000398853:D25E	ENSP00000349856:D25E	D	+	3	2	PRRC2B	133295427	0.998000	0.40836	0.998000	0.56505	0.975000	0.68041	0.527000	0.22987	-0.031000	0.13781	-0.904000	0.02843	GAT	.	.	.	none		0.453	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
EBF3	253738	hgsc.bcm.edu	37	10	131757260	131757260	+	Nonsense_Mutation	SNP	G	G	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr10:131757260G>C	ENST00000355311.5	-	5	495	c.423C>G	c.(421-423)taC>taG	p.Y141*	EBF3_ENST00000368648.3_Nonsense_Mutation_p.Y141*			Q9H4W6	COE3_HUMAN	early B-cell factor 3	141					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CCTGGCCCTCGTAGACGATGG	0.726																																					p.Y141X		Atlas-SNP	.											.	EBF3	193	.	0			c.C423G						PASS	.						32.0	35.0	34.0					10																	131757260		2202	4300	6502	SO:0001587	stop_gained	253738	exon5			GCCCTCGTAGACG		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.423C>G	chr10.hg19:g.131757260G>C	ENSP00000347463:p.Tyr141*	108.0	0.0	.		94.0	45.0	.	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Nonsense_Mutation	SNP	ENST00000355311.5	hg19		.	.	.	.	.	.	.	.	.	.	G	37	6.328482	0.97476	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	.	.	.	4.32	-1.24	0.09435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.657	9.1925	0.37209	0.4955:0.0:0.5045:0.0	.	.	.	.	X	141	.	ENSP00000347463:Y141X	Y	-	3	2	EBF3	131647250	0.853000	0.29707	0.992000	0.48379	0.997000	0.91878	-0.038000	0.12144	-0.300000	0.08895	0.561000	0.74099	TAC	.	.	.	none		0.726	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
CFAP46	54777	hgsc.bcm.edu	37	10	134646865	134646865	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr10:134646865T>G	ENST00000368586.5	-	50	7214	c.7114A>C	c.(7114-7116)Aca>Cca	p.T2372P	TTC40_ENST00000263170.5_Missense_Mutation_p.T533P	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TTCCTACCTGTCTCTTCTTTA	0.383																																					p.T2372P		Atlas-SNP	.											.	TTC40	100	.	0			c.A7114C						PASS	.						93.0	93.0	93.0					10																	134646865		2203	4300	6503	SO:0001583	missense	54777	exon50			TACCTGTCTCTTC																												ENST00000368586.5:c.7114A>C	chr10.hg19:g.134646865T>G	ENSP00000357575:p.Thr2372Pro	163.0	0.0	.		124.0	51.0	.	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.785|2.785	-0.252654|-0.252654	0.05829|0.05829	.|.	.|.	ENSG00000171811|ENSG00000171811	ENST00000448925|ENST00000368586;ENST00000263170	.|T;T	.|0.28666	.|1.6;1.6	4.22|4.22	-8.43|-8.43	0.00953|0.00953	.|.	.|2.028180	.|0.02648	.|N	.|0.106096	T|T	0.19525|0.19525	0.0469|0.0469	L|L	0.38531|0.38531	1.155|1.155	0.19300|0.19300	N|N	0.999975|0.999975	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.09684|0.09684	-1.0663|-1.0663	5|10	.|0.30854	.|T	.|0.27	.|.	4.341|4.341	0.11110|0.11110	0.1612:0.1456:0.4855:0.2077|0.1612:0.1456:0.4855:0.2077	.|.	.|533	.|Q8IYW2	.|CJ092_HUMAN	S|P	140|2372;533	.|ENSP00000357575:T2372P;ENSP00000263170:T533P	.|ENSP00000263170:T533P	R|T	-|-	3|1	2|0	C10orf93|C10orf93	134496855|134496855	0.224000|0.224000	0.23674|0.23674	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.014000|-1.014000	0.03641|0.03641	-3.618000|-3.618000	0.00131|0.00131	-3.127000|-3.127000	0.00060|0.00060	AGA|ACA	.	.	.	none		0.383	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
SIGIRR	59307	hgsc.bcm.edu	37	11	407106	407106	+	Silent	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr11:407106A>G	ENST00000431843.2	-	7	990	c.684T>C	c.(682-684)ctT>ctC	p.L228L	SIGIRR_ENST00000531205.1_Silent_p.L228L|SIGIRR_ENST00000332725.3_Silent_p.L228L|SIGIRR_ENST00000397632.3_Silent_p.L228L|SIGIRR_ENST00000382520.2_Silent_p.L228L|SIGIRR_ENST00000529486.1_5'Flank	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	228	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGCGTCCGAAAGCACCACGA	0.751																																					p.L228L		Atlas-SNP	.											.	SIGIRR	22	.	0			c.T684C						PASS	.						10.0	12.0	12.0					11																	407106		2117	4206	6323	SO:0001819	synonymous_variant	59307	exon7			GTCCGAAAGCACC		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.684T>C	chr11.hg19:g.407106A>G		34.0	0.0	.		25.0	13.0	.	NM_001135053	Q3KQY2|Q6UXI3|Q9H733	Silent	SNP	ENST00000431843.2	hg19	CCDS31325.1																																																																																			.	.	.	none		0.751	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
OR5T2	219464	hgsc.bcm.edu	37	11	56000203	56000203	+	Silent	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr11:56000203G>A	ENST00000313264.4	-	1	534	c.459C>T	c.(457-459)ctC>ctT	p.L153L		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TTGCAGCCAAGAGAAAGCATT	0.418																																					p.L153L		Atlas-SNP	.											.	OR5T2	107	.	0			c.C459T						PASS	.						179.0	153.0	162.0					11																	56000203		2201	4296	6497	SO:0001819	synonymous_variant	219464	exon1			AGCCAAGAGAAAG	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.459C>T	chr11.hg19:g.56000203G>A		107.0	0.0	.		91.0	37.0	.	NM_001004746	B9EGX5|Q6IFC8	Silent	SNP	ENST00000313264.4	hg19	CCDS31523.1																																																																																			.	.	.	none		0.418	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
FAM86C1	55199	hgsc.bcm.edu	37	11	71507154	71507154	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr11:71507154C>A	ENST00000359244.4	+	4	376	c.353C>A	c.(352-354)tCt>tAt	p.S118Y	FAM86C1_ENST00000346333.6_Missense_Mutation_p.S84Y|FAM86C1_ENST00000426628.2_Missense_Mutation_p.S111Y	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	118										lung(1)	1						CTCCTCAATTCTACATGGCCC	0.642																																					p.S118Y		Atlas-SNP	.											.	FAM86C1	27	.	0			c.C353A						PASS	.						94.0	99.0	97.0					11																	71507154		2200	4293	6493	SO:0001583	missense	55199	exon4			TCAATTCTACATG	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.353C>A	chr11.hg19:g.71507154C>A	ENSP00000352182:p.Ser118Tyr	124.0	0.0	.		86.0	37.0	.	NM_018172	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	hg19	CCDS41686.1	.	.	.	.	.	.	.	.	.	.	.	12.26	1.883348	0.33255	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.25912	1.82;2.16;1.81;1.77	1.49	1.49	0.22878	.	.	.	.	.	T	0.29684	0.0741	N	0.24115	0.695	0.09310	N	0.999996	D;P;P	0.58970	0.984;0.952;0.952	D;B;B	0.63877	0.919;0.348;0.348	T	0.08411	-1.0723	9	0.87932	D	0	.	6.4456	0.21875	0.0:1.0:0.0:0.0	.	111;84;118	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	Y	84;118;111;84	ENSP00000325662:S84Y;ENSP00000352182:S118Y;ENSP00000391329:S111Y;ENSP00000436598:S84Y	ENSP00000325662:S84Y	S	+	2	0	FAM86C1	71184802	0.927000	0.31430	0.015000	0.15790	0.002000	0.02628	0.741000	0.26202	1.136000	0.42199	0.184000	0.17185	TCT	.	.	.	none		0.642	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
GIT2	9815	hgsc.bcm.edu	37	12	110390969	110390969	+	Silent	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr12:110390969G>A	ENST00000355312.3	-	13	1169	c.1170C>T	c.(1168-1170)ccC>ccT	p.P390P	GIT2_ENST00000547815.1_Silent_p.P390P|GIT2_ENST00000343646.5_Intron|GIT2_ENST00000338373.5_Silent_p.P390P|GIT2_ENST00000551209.1_Silent_p.P389P|GIT2_ENST00000553118.1_Silent_p.P390P|GIT2_ENST00000356259.4_Silent_p.P390P|GIT2_ENST00000354574.4_Silent_p.P392P|GIT2_ENST00000320063.9_Silent_p.P390P|GIT2_ENST00000361006.5_Silent_p.P390P|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000457474.2_Silent_p.P392P|GIT2_ENST00000360185.4_Silent_p.P390P	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	390					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.P390P(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						TGTCATAGTCGGGCTGATCGT	0.468																																					p.P392P		Atlas-SNP	.											.	GIT2	81	.	2	Substitution - coding silent(2)	lung(2)	c.C1176T						PASS	.						259.0	209.0	226.0					12																	110390969		2203	4300	6503	SO:0001819	synonymous_variant	9815	exon14			ATAGTCGGGCTGA	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1170C>T	chr12.hg19:g.110390969G>A		84.0	0.0	.		90.0	46.0	.	NM_001135213	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Silent	SNP	ENST00000355312.3	hg19	CCDS9138.1																																																																																			.	.	.	none		0.468	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
MYCBP2	23077	hgsc.bcm.edu	37	13	77732194	77732194	+	Silent	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr13:77732194A>G	ENST00000544440.2	-	45	6551	c.6534T>C	c.(6532-6534)caT>caC	p.H2178H	MYCBP2_ENST00000357337.6_Silent_p.H2178H|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Silent_p.H2216H					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TAGTTGGTGAATGAGAAAGAG	0.333																																					p.H2216H		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.T6648C						PASS	.						86.0	87.0	87.0					13																	77732194		2203	4300	6503	SO:0001819	synonymous_variant	23077	exon45			TGGTGAATGAGAA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6534T>C	chr13.hg19:g.77732194A>G		100.0	0.0	.		101.0	36.0	.	NM_015057		Silent	SNP	ENST00000544440.2	hg19																																																																																				.	.	.	none		0.333	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
OR11H4	390442	hgsc.bcm.edu	37	14	20711302	20711302	+	Nonsense_Mutation	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr14:20711302G>T	ENST00000315409.2	+	1	405	c.352G>T	c.(352-354)Gga>Tga	p.G118*		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		CTTTTCACTGGGAACAACTGA	0.468																																					p.G118X		Atlas-SNP	.											.	OR11H4	63	.	0			c.G352T						PASS	.						103.0	106.0	105.0					14																	20711302		2203	4300	6503	SO:0001587	stop_gained	390442	exon1			TCACTGGGAACAA		CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.352G>T	chr14.hg19:g.20711302G>T	ENSP00000318997:p.Gly118*	91.0	0.0	.		68.0	4.0	.	NM_001004479	B2RNQ4|Q6IF07	Nonsense_Mutation	SNP	ENST00000315409.2	hg19	CCDS32034.1	.	.	.	.	.	.	.	.	.	.	G	34	5.411171	0.96072	.	.	ENSG00000176198	ENST00000315409	.	.	.	4.75	4.75	0.60458	.	0.000000	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.5741	15.2747	0.73732	0.0:0.0:1.0:0.0	.	.	.	.	X	118	.	ENSP00000318997:G118X	G	+	1	0	OR11H4	19781142	0.003000	0.15002	1.000000	0.80357	0.997000	0.91878	1.341000	0.33907	2.465000	0.83290	0.650000	0.86243	GGA	.	.	.	none		0.468	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410678.1		
MYH7	4625	hgsc.bcm.edu	37	14	23900190	23900190	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr14:23900190C>T	ENST00000355349.3	-	10	977	c.815G>A	c.(814-816)aGa>aAa	p.R272K		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	272	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GAAAATAACTCTGGATTTTTC	0.423																																					p.R272K		Atlas-SNP	.											.	MYH7	349	.	0			c.G815A						PASS	.						77.0	84.0	82.0					14																	23900190		2203	4300	6503	SO:0001583	missense	4625	exon10			ATAACTCTGGATT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.815G>A	chr14.hg19:g.23900190C>T	ENSP00000347507:p.Arg272Lys	36.0	0.0	.		29.0	15.0	.	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409375	0.62399	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.96716	-4.1	3.62	3.62	0.41486	Myosin head, motor domain (2);	.	.	.	.	D	0.98560	0.9519	H	0.99609	4.655	0.58432	D	0.999999	B	0.17038	0.02	B	0.39503	0.301	D	0.99930	1.1311	9	0.87932	D	0	.	15.4652	0.75394	0.0:1.0:0.0:0.0	.	272	P12883	MYH7_HUMAN	K	272	ENSP00000347507:R272K	ENSP00000347507:R272K	R	-	2	0	MYH7	22970030	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.395000	0.79876	1.862000	0.54008	0.305000	0.20034	AGA	.	.	.	none		0.423	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
ADCY4	196883	hgsc.bcm.edu	37	14	24798392	24798392	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr14:24798392G>A	ENST00000310677.4	-	11	1512	c.1399C>T	c.(1399-1401)Ctt>Ttt	p.L467F	ADCY4_ENST00000418030.2_Missense_Mutation_p.L467F|ADCY4_ENST00000554068.2_Missense_Mutation_p.L467F|ADCY4_ENST00000396747.3_Missense_Mutation_p.L160F	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	467					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		AGGCCCTCAAGCGAGGACAGC	0.602																																					p.L467F		Atlas-SNP	.											.	ADCY4	86	.	0			c.C1399T						PASS	.						132.0	115.0	121.0					14																	24798392		2203	4300	6503	SO:0001583	missense	196883	exon11			CCTCAAGCGAGGA	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.1399C>T	chr14.hg19:g.24798392G>A	ENSP00000312126:p.Leu467Phe	96.0	0.0	.		64.0	27.0	.	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	hg19	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396149	0.25205	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030;ENST00000396747	T;T;T;T	0.79749	-1.07;-1.07;-1.07;-1.3	4.75	3.86	0.44501	.	0.185106	0.26560	N	0.023685	T	0.60663	0.2286	N	0.08118	0	0.32417	N	0.549897	B	0.19706	0.038	B	0.23150	0.044	T	0.61840	-0.6980	10	0.46703	T	0.11	.	6.473	0.22020	0.0974:0.1841:0.7185:0.0	.	467	Q8NFM4	ADCY4_HUMAN	F	467;467;467;160	ENSP00000312126:L467F;ENSP00000452250:L467F;ENSP00000393177:L467F;ENSP00000379971:L160F	ENSP00000312126:L467F	L	-	1	0	ADCY4	23868232	0.755000	0.28372	0.993000	0.49108	0.802000	0.45316	0.530000	0.23036	1.223000	0.43536	0.655000	0.94253	CTT	.	.	.	none		0.602	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
HEATR5A	25938	hgsc.bcm.edu	37	14	31771694	31771694	+	Silent	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr14:31771694G>A	ENST00000389961.3	-	32	5252	c.5253C>T	c.(5251-5253)taC>taT	p.Y1751Y	HEATR5A_ENST00000439727.1_Silent_p.Y1464Y|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000543095.2_Silent_p.Y1757Y|HEATR5A_ENST00000439348.1_Intron			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1751										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		CGATTGTGAGGTACAATATAG	0.388																																					p.Y1757Y		Atlas-SNP	.											.	HEATR5A	181	.	0			c.C5271T						PASS	.						28.0	30.0	30.0					14																	31771694		1835	4085	5920	SO:0001819	synonymous_variant	25938	exon33			TGTGAGGTACAAT	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5253C>T	chr14.hg19:g.31771694G>A		107.0	0.0	.		87.0	33.0	.	NM_015473	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Silent	SNP	ENST00000389961.3	hg19																																																																																				.	.	.	none		0.388	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
CALM1	801	hgsc.bcm.edu	37	14	90870770	90870770	+	Silent	SNP	A	A	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr14:90870770A>C	ENST00000356978.4	+	5	581	c.333A>C	c.(331-333)acA>acC	p.T111T	CALM1_ENST00000447653.3_Silent_p.T112T|RP11-471B22.2_ENST00000555853.1_RNA|CALM1_ENST00000553542.1_Silent_p.T75T|CALM1_ENST00000544280.2_Silent_p.T75T	NM_006888.4	NP_008819.1	P62158	CALM_HUMAN	calmodulin 1 (phosphorylase kinase, delta)	111	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	10		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	ACGTCATGACAAACTTAGGAG	0.383																																					p.T111T		Atlas-SNP	.											.	CALM1	16	.	0			c.A333C						PASS	.						136.0	125.0	129.0					14																	90870770		2203	4300	6503	SO:0001819	synonymous_variant	801	exon5			CATGACAAACTTA		CCDS9892.1	14q32.11	2013-02-25			ENSG00000198668	ENSG00000198668	2.7.11.19	"""EF-hand domain containing"", ""Endogenous ligands"""	1442	protein-coding gene	gene with protein product	"""prepro-calmodulin 1"""	114180		CALML2		6385987	Standard	NM_006888		Approved	CAMI, PHKD, DD132	uc001xyl.2	P62158	OTTHUMG00000171044	ENST00000356978.4:c.333A>C	chr14.hg19:g.90870770A>C		213.0	0.0	.		197.0	96.0	.	NM_006888	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Silent	SNP	ENST00000356978.4	hg19	CCDS9892.1																																																																																			.	.	.	none		0.383	CALM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411346.1		
HERC2	8924	hgsc.bcm.edu	37	15	28380665	28380665	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr15:28380665C>G	ENST00000261609.7	-	79	12297	c.12189G>C	c.(12187-12189)tgG>tgC	p.W4063C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTGCCTCACCCCAAGAGTAAA	0.393																																					p.W4063C		Atlas-SNP	.											.	HERC2	501	.	0			c.G12189C						PASS	.						170.0	175.0	174.0					15																	28380665		2203	4300	6503	SO:0001583	missense	8924	exon79			CTCACCCCAAGAG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12189G>C	chr15.hg19:g.28380665C>G	ENSP00000261609:p.Trp4063Cys	156.0	0.0	.		134.0	54.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203842	0.79127	.	.	ENSG00000128731	ENST00000261609	D	0.92348	-3.02	5.08	5.08	0.68730	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.96494	0.8856	M	0.87097	2.86	0.80722	D	1	D	0.65815	0.995	D	0.69307	0.963	D	0.96907	0.9664	10	0.66056	D	0.02	.	18.8522	0.92237	0.0:1.0:0.0:0.0	.	4063	O95714	HERC2_HUMAN	C	4063	ENSP00000261609:W4063C	ENSP00000261609:W4063C	W	-	3	0	HERC2	26054260	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.762000	0.85270	2.515000	0.84797	0.557000	0.71058	TGG	.	.	.	none		0.393	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
RNF111	54778	hgsc.bcm.edu	37	15	59350658	59350658	+	Silent	SNP	T	T	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr15:59350658T>A	ENST00000557998.1	+	5	1562	c.1275T>A	c.(1273-1275)acT>acA	p.T425T	RNF111_ENST00000434298.1_Silent_p.T425T|RNF111_ENST00000559209.1_Silent_p.T425T|RNF111_ENST00000348370.4_Silent_p.T425T|RNF111_ENST00000561186.1_Silent_p.T425T	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	425	Ser-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CCTCTGATACTGCTTCAGCTG	0.448																																					p.T425T	NSCLC(72;983 1365 10746 34387 47081)	Atlas-SNP	.											.	RNF111	179	.	0			c.T1275A						PASS	.						257.0	256.0	256.0					15																	59350658		2192	4291	6483	SO:0001819	synonymous_variant	54778	exon5			TGATACTGCTTCA	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.1275T>A	chr15.hg19:g.59350658T>A		99.0	0.0	.		80.0	27.0	.	NM_017610	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Silent	SNP	ENST00000557998.1	hg19	CCDS58366.1																																																																																			.	.	.	none		0.448	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
LACTB	114294	hgsc.bcm.edu	37	15	63419075	63419075	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr15:63419075G>T	ENST00000261893.4	+	3	514	c.442G>T	c.(442-444)Gtt>Ttt	p.V148F	LACTB_ENST00000413507.2_Missense_Mutation_p.V148F|RPS27L_ENST00000559763.1_Intron	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	148						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						TTATGCTGATGTTGAGAACCG	0.403																																					p.V148F	Melanoma(85;443 1381 6215 27308 35583)	Atlas-SNP	.											.	LACTB	29	.	0			c.G442T						PASS	.						112.0	105.0	107.0					15																	63419075		2203	4300	6503	SO:0001583	missense	114294	exon3			GCTGATGTTGAGA	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.442G>T	chr15.hg19:g.63419075G>T	ENSP00000261893:p.Val148Phe	142.0	0.0	.		90.0	42.0	.	NM_171846	P83096	Missense_Mutation	SNP	ENST00000261893.4	hg19	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393503	0.62066	.	.	ENSG00000103642	ENST00000261893;ENST00000413507	T;T	0.45668	0.89;0.89	5.44	3.56	0.40772	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.190607	0.46758	D	0.000272	T	0.49847	0.1581	L	0.58925	1.835	0.80722	D	1	P	0.48407	0.91	P	0.55161	0.77	T	0.43376	-0.9395	10	0.48119	T	0.1	-7.0724	8.4616	0.32931	0.2365:0.0:0.7635:0.0	.	148	P83111	LACTB_HUMAN	F	148	ENSP00000261893:V148F;ENSP00000392956:V148F	ENSP00000261893:V148F	V	+	1	0	LACTB	61206128	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.182000	0.42556	0.667000	0.31107	0.563000	0.77884	GTT	.	.	.	none		0.403	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
TRAP1	10131	hgsc.bcm.edu	37	16	3727498	3727498	+	Splice_Site	SNP	C	C	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr16:3727498C>G	ENST00000246957.5	-	6	793		c.e6+1		TRAP1_ENST00000573872.1_Splice_Site|TRAP1_ENST00000538171.1_Splice_Site|TRAP1_ENST00000575671.1_Splice_Site	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1						chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				TCGTCACTCACCCATCTGAAA	0.552																																					.		Atlas-SNP	.											.	TRAP1	53	.	0			c.545+1G>C						PASS	.						67.0	63.0	65.0					16																	3727498		2197	4300	6497	SO:0001630	splice_region_variant	10131	exon6			CACTCACCCATCT	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.704+1G>C	chr16.hg19:g.3727498C>G		67.0	0.0	.		79.0	29.0	.	NM_001272049	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Splice_Site	SNP	ENST00000246957.5	hg19	CCDS10508.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137763	0.37728	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9543	0.92653	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRAP1	3667499	1.000000	0.71417	1.000000	0.80357	0.115000	0.19883	7.385000	0.79763	2.714000	0.92807	0.655000	0.94253	.	.	.	.	none		0.552	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	Intron
IL4R	3566	hgsc.bcm.edu	37	16	27375041	27375041	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr16:27375041A>G	ENST00000395762.2	+	11	2627	c.2368A>G	c.(2368-2370)Aaa>Gaa	p.K790E	IL4R_ENST00000170630.2_Missense_Mutation_p.K790E|IL4R_ENST00000380922.3_Missense_Mutation_p.K775E|IL4R_ENST00000543915.2_Missense_Mutation_p.K790E	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	790	Poly-Ser.				defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						AGAGAAGAGTAAATCCTCATC	0.597																																					p.K790E		Atlas-SNP	.											.	IL4R	70	.	0			c.A2368G						PASS	.						75.0	76.0	76.0					16																	27375041		2197	4300	6497	SO:0001583	missense	3566	exon11			AAGAGTAAATCCT	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2368A>G	chr16.hg19:g.27375041A>G	ENSP00000379111:p.Lys790Glu	39.0	0.0	.		40.0	12.0	.	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	hg19	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128742	0.56721	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	5.0	1.38	0.22167	.	8.071550	0.00166	N	0.000000	T	0.28699	0.0711	M	0.62723	1.935	0.09310	N	1	D;D;D	0.52996	0.957;0.957;0.957	P;P;P	0.50537	0.643;0.643;0.643	T	0.08806	-1.0704	10	0.72032	D	0.01	.	5.1314	0.14913	0.5404:0.3644:0.0952:0.0	.	775;790;790	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	E	790;790;775;790	ENSP00000379111:K790E;ENSP00000441667:K790E;ENSP00000370309:K775E;ENSP00000170630:K790E	ENSP00000170630:K790E	K	+	1	0	IL4R	27282542	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	0.178000	0.16820	0.297000	0.22615	0.533000	0.62120	AAA	.	.	.	none		0.597	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
HAS3	3038	hgsc.bcm.edu	37	16	69148783	69148783	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr16:69148783T>C	ENST00000306560.1	+	4	1432	c.1276T>C	c.(1276-1278)Tac>Cac	p.Y426H	HAS3_ENST00000569188.1_Missense_Mutation_p.Y426H|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	426					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		CAAGGCCACCTACGCCTGCTT	0.547																																					p.Y426H		Atlas-SNP	.											.	HAS3	61	.	0			c.T1276C						PASS	.						120.0	111.0	114.0					16																	69148783		2198	4300	6498	SO:0001583	missense	3038	exon4			GCCACCTACGCCT	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1276T>C	chr16.hg19:g.69148783T>C	ENSP00000304440:p.Tyr426His	77.0	0.0	.		82.0	37.0	.	NM_005329	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	hg19	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.196679	0.79015	.	.	ENSG00000103044	ENST00000306560	T	0.50001	0.76	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.66587	0.2804	M	0.74647	2.275	0.58432	D	0.999992	D	0.67145	0.996	D	0.63381	0.914	T	0.65861	-0.6065	10	0.37606	T	0.19	-4.479	16.3021	0.82825	0.0:0.0:0.0:1.0	.	426	O00219	HAS3_HUMAN	H	426	ENSP00000304440:Y426H	ENSP00000304440:Y426H	Y	+	1	0	HAS3	67706284	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.991000	0.88244	2.326000	0.78906	0.533000	0.62120	TAC	.	.	.	none		0.547	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
TRPV1	7442	hgsc.bcm.edu	37	17	3480920	3480920	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:3480920A>G	ENST00000571088.1	-	11	1898	c.1685T>C	c.(1684-1686)aTg>aCg	p.M562T	TRPV1_ENST00000310522.5_Missense_Mutation_p.M502T|TRPV1_ENST00000425167.2_Missense_Mutation_p.M573T|TRPV1_ENST00000399759.3_Missense_Mutation_p.M562T|RP11-235E17.3_ENST00000573568.1_RNA|TRPV1_ENST00000399756.4_Missense_Mutation_p.M562T|TRPV1_ENST00000576351.1_Missense_Mutation_p.M552T|SHPK_ENST00000572705.1_Missense_Mutation_p.M562T|TRPV1_ENST00000174621.6_Missense_Mutation_p.M560T	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	562					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	ATAGATGCCCATCTGCTGGAA	0.572																																					p.M562T	Melanoma(38;962 1762 15789)	Atlas-SNP	.											.	TRPV1	99	.	0			c.T1685C						PASS	.						39.0	43.0	42.0					17																	3480920		1999	4150	6149	SO:0001583	missense	7442	exon11			ATGCCCATCTGCT	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.1685T>C	chr17.hg19:g.3480920A>G	ENSP00000461007:p.Met562Thr	129.0	0.0	.		129.0	39.0	.	NM_018727	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	ENST00000571088.1	hg19	CCDS45576.1	.	.	.	.	.	.	.	.	.	.	a	7.422	0.636933	0.14386	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7	5.22	5.22	0.72569	Ion transport (1);	0.035966	0.85682	D	0.000000	T	0.81908	0.4922	N	0.21508	0.67	0.58432	D	0.999998	B;B;B;B	0.22146	0.001;0.045;0.04;0.065	B;B;B;B	0.18871	0.006;0.008;0.023;0.015	T	0.76399	-0.2973	10	0.05833	T	0.94	-0.0301	14.5881	0.68342	1.0:0.0:0.0:0.0	.	562;560;502;573	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	T	562;562;560;573;502	ENSP00000382661:M562T;ENSP00000382659:M562T;ENSP00000174621:M560T;ENSP00000409627:M573T;ENSP00000311692:M502T	ENSP00000174621:M560T	M	-	2	0	TRPV1	3427669	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	3.471000	0.53107	2.103000	0.63969	0.456000	0.33151	ATG	.	.	.	none		0.572	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
SLC6A4	6532	hgsc.bcm.edu	37	17	28534784	28534784	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:28534784A>T	ENST00000401766.2	-	12	2128	c.1616T>A	c.(1615-1617)aTc>aAc	p.I539N	RP11-354P11.4_ENST00000581633.1_RNA|SLC6A4_ENST00000261707.3_Missense_Mutation_p.I539N			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	539					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CACCCAGCAGATCCTCCAGAA	0.567																																					p.I539N		Atlas-SNP	.											.	SLC6A4	60	.	0			c.T1616A						PASS	.						86.0	73.0	77.0					17																	28534784		2203	4300	6503	SO:0001583	missense	6532	exon13			CAGCAGATCCTCC	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1616T>A	chr17.hg19:g.28534784A>T	ENSP00000385822:p.Ile539Asn	110.0	0.0	.		141.0	87.0	.	NM_001045	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	hg19	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.792743	0.90453	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T;T	0.76448	-1.02;-0.93;-0.93	5.64	5.64	0.86602	.	0.176744	0.50627	D	0.000118	D	0.86851	0.6032	M	0.88512	2.96	0.51233	D	0.999916	B	0.30542	0.284	P	0.45037	0.467	D	0.87665	0.2537	10	0.87932	D	0	.	15.0294	0.71694	1.0:0.0:0.0:0.0	.	539	P31645	SC6A4_HUMAN	N	581;539;539	ENSP00000378298:I581N;ENSP00000385822:I539N;ENSP00000261707:I539N	ENSP00000261707:I539N	I	-	2	0	SLC6A4	25558910	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.531000	0.81973	2.153000	0.67306	0.482000	0.46254	ATC	.	.	.	none		0.567	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
DDX5	1655	hgsc.bcm.edu	37	17	62499923	62499923	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:62499923T>C	ENST00000225792.5	-	5	906	c.505A>G	c.(505-507)Att>Gtt	p.I169V	DDX5_ENST00000450599.2_Missense_Mutation_p.I90V|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.I169V|CEP95_ENST00000556440.2_5'Flank|DDX5_ENST00000580026.1_5'Flank|MIR3064_ENST00000581130.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	169	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			ATACTTACAATAGGCCCATCG	0.353			T	ETV4	prostate																																p.I169V	NSCLC(22;406 813 4871 19580 40307)	Atlas-SNP	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	101	.	0			c.A505G						PASS	.						63.0	65.0	64.0					17																	62499923		2203	4300	6503	SO:0001583	missense	1655	exon5			TTACAATAGGCCC	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.505A>G	chr17.hg19:g.62499923T>C	ENSP00000225792:p.Ile169Val	205.0	0.0	.		222.0	85.0	.	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	ENST00000225792.5	hg19	CCDS11659.1	.	.	.	.	.	.	.	.	.	.	T	13.09	2.133981	0.37630	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.63	5.63	0.86233	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.085601	0.64402	D	0.000001	T	0.52468	0.1736	L	0.29908	0.895	0.80722	D	1	B;P;P	0.39831	0.036;0.69;0.69	B;B;B	0.42827	0.095;0.346;0.399	T	0.56559	-0.7959	9	0.56958	D	0.05	-15.0797	15.87	0.79108	0.0:0.0:0.0:1.0	.	90;169;169	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	V	169;99;158	.	ENSP00000225792:I158V	I	-	1	0	DDX5	59930385	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	7.374000	0.79633	2.145000	0.66743	0.533000	0.62120	ATT	.	.	.	none		0.353	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
PRKAR1A	5573	hgsc.bcm.edu	37	17	66511650	66511650	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:66511650A>G	ENST00000589228.1	+	2	238	c.110A>G	c.(109-111)cAg>cGg	p.Q37R	PRKAR1A_ENST00000392711.1_Missense_Mutation_p.Q37R|PRKAR1A_ENST00000536854.2_Missense_Mutation_p.Q37R|PRKAR1A_ENST00000586397.1_Missense_Mutation_p.Q37R|PRKAR1A_ENST00000588188.2_Missense_Mutation_p.Q37R|PRKAR1A_ENST00000358598.2_Missense_Mutation_p.Q37R	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	37	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					TCTATTGTGCAGTTGTGCACT	0.502			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.Q37R	Ovarian(167;637 1670 33025 39608 46699 51856)	Atlas-SNP	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A	48	.	0			c.A110G						PASS	.						84.0	68.0	73.0					17																	66511650		2203	4300	6503	SO:0001583	missense	5573	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	TTGTGCAGTTGTG		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.110A>G	chr17.hg19:g.66511650A>G	ENSP00000464977:p.Gln37Arg	55.0	0.0	.		68.0	37.0	.	NM_001276290	K7ER48|Q567S7	Missense_Mutation	SNP	ENST00000589228.1	hg19	CCDS11678.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.353606	0.61293	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.11	5.11	0.69529	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (3);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	M	0.71206	2.165	0.58432	D	0.999999	B;B	0.22604	0.072;0.072	B;B	0.29176	0.099;0.099	T	0.76553	-0.2917	10	0.48119	T	0.1	-23.4732	14.8899	0.70600	1.0:0.0:0.0:0.0	.	37;37	B2R5T5;P10644	.;KAP0_HUMAN	R	37	ENSP00000351410:Q37R;ENSP00000376475:Q37R;ENSP00000376474:Q37R;ENSP00000445625:Q37R	ENSP00000351410:Q37R	Q	+	2	0	PRKAR1A	64023245	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.339000	0.96797	1.917000	0.55516	0.533000	0.62120	CAG	.	.	.	none		0.502	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
EXOC7	23265	hgsc.bcm.edu	37	17	74097811	74097812	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:74097811_74097812AC>CA	ENST00000335146.7	-	3	312_313	c.259_260GT>TG	c.(259-261)GTc>TGc	p.V87C	EXOC7_ENST00000406660.3_Missense_Mutation_p.V87C|EXOC7_ENST00000607838.1_Missense_Mutation_p.V87C|EXOC7_ENST00000589210.1_Missense_Mutation_p.V87C|EXOC7_ENST00000332065.5_Missense_Mutation_p.V87C|EXOC7_ENST00000411744.2_Missense_Mutation_p.V87C|EXOC7_ENST00000467929.2_Missense_Mutation_p.V46C|EXOC7_ENST00000405575.4_Missense_Mutation_p.V87C			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	87					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			GTAGCTGATGACATGGTCCAGG	0.54																																					p.V87G|p.V87F		Atlas-SNP	.											.	EXOC7	47	.	0			c.T260G|c.G259T						PASS	.																																			SO:0001583	missense	23265	exon3			CTGATGACATGGT|TGATGACATGGTC	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.259_260delinsCA	chr17.hg19:g.74097811_74097812delinsCA	ENSP00000334100:p.Val87Cys	61.0|63.0	0.0	.		90.0|86.0	24.0|22.0	.	NM_001145298	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	hg19	CCDS45782.1																																																																																			.	.	.	none		0.540	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
HKR1	284459	hgsc.bcm.edu	37	19	37853726	37853726	+	Silent	SNP	C	C	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr19:37853726C>T	ENST00000324411.4	+	6	1298	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	HKR1_ENST00000392153.3_Silent_p.N324N|HKR1_ENST00000541583.2_Silent_p.N282N|HKR1_ENST00000591471.1_Silent_p.N70N|HKR1_ENST00000544914.1_Silent_p.N70N|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000589392.1_Silent_p.N325N	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	343					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAAGTCGAACCTCTTTACAC	0.488																																					p.N343N		Atlas-SNP	.											.	HKR1	74	.	0			c.C1029T						PASS	.						102.0	91.0	95.0					19																	37853726		2203	4300	6503	SO:0001819	synonymous_variant	284459	exon6			GTCGAACCTCTTT	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1029C>T	chr19.hg19:g.37853726C>T		81.0	0.0	.		72.0	32.0	.	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Silent	SNP	ENST00000324411.4	hg19	CCDS12502.1																																																																																			.	.	.	none		0.488	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
IGFL3	388555	hgsc.bcm.edu	37	19	46623600	46623601	+	Missense_Mutation	DNP	AC	AC	GA			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr19:46623600_46623601AC>GA	ENST00000341415.2	-	4	388_389	c.364_365GT>TC	c.(364-366)GTc>TCc	p.V122S	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	122						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		tgggtacaggacgTGCCTCCTG	0.455																																					p.V122A|p.V122F		Atlas-SNP	.											.	IGFL3	17	.	0			c.T365C|c.G364T						PASS	.																																			SO:0001583	missense	388555	exon4			TACAGGACGTGCC|ACAGGACGTGCCT	AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.364_365delinsGA	chr19.hg19:g.46623600_46623601delinsGA	ENSP00000344860:p.Val122Ser	93.0	0.0	.		71.0	32.0	.	NM_207393		Missense_Mutation	SNP	ENST00000341415.2	hg19	CCDS33058.1																																																																																			.	.	.	none		0.455	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421323.1	NM_207393	
MAVS	57506	hgsc.bcm.edu	37	20	3842062	3842062	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr20:3842062C>A	ENST00000428216.2	+	4	504	c.376C>A	c.(376-378)Cac>Aac	p.H126N	MAVS_ENST00000358134.6_Intron|MAVS_ENST00000416600.2_5'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	126	Pro-rich.				activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						TGCTGCGGCCCACAGCATCCC	0.637																																					p.H126N		Atlas-SNP	.											.	MAVS	34	.	0			c.C376A						PASS	.						73.0	73.0	73.0					20																	3842062		2203	4300	6503	SO:0001583	missense	57506	exon4			GCGGCCCACAGCA	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.376C>A	chr20.hg19:g.3842062C>A	ENSP00000401980:p.His126Asn	223.0	0.0	.		257.0	147.0	.	NM_020746	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	hg19	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309235	0.40895	.	.	ENSG00000088888	ENST00000428216	T	0.11604	2.76	3.84	3.84	0.44239	.	1.394380	0.04729	N	0.420774	T	0.18341	0.0440	L	0.43152	1.355	0.46061	D	0.998849	D	0.52996	0.957	P	0.51701	0.677	T	0.16897	-1.0387	10	0.17369	T	0.5	-2.9594	11.4651	0.50235	0.0:1.0:0.0:0.0	.	126	Q7Z434	MAVS_HUMAN	N	126	ENSP00000401980:H126N	ENSP00000401980:H126N	H	+	1	0	MAVS	3790062	0.078000	0.21339	0.024000	0.17045	0.017000	0.09413	1.020000	0.30027	2.148000	0.66965	0.591000	0.81541	CAC	.	.	.	none		0.637	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
SLC13A3	64849	hgsc.bcm.edu	37	20	45216777	45216777	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr20:45216777G>T	ENST00000279027.4	-	8	1060	c.1042C>A	c.(1042-1044)Ctt>Att	p.L348I	SLC13A3_ENST00000413164.2_Missense_Mutation_p.L298I|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000495082.1_Missense_Mutation_p.L301I|SLC13A3_ENST00000372121.1_Missense_Mutation_p.L298I|SLC13A3_ENST00000472148.1_Intron|SLC13A3_ENST00000464518.1_5'Flank|SLC13A3_ENST00000290317.5_Missense_Mutation_p.L301I|SLC13A3_ENST00000396360.1_Intron	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	348					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ATGCAGAAAAGGATGAAAACA	0.592																																					p.L348I		Atlas-SNP	.											.	SLC13A3	88	.	0			c.C1042A						PASS	.						89.0	80.0	83.0					20																	45216777		2203	4300	6503	SO:0001583	missense	64849	exon8			AGAAAAGGATGAA	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1042C>A	chr20.hg19:g.45216777G>T	ENSP00000279027:p.Leu348Ile	74.0	0.0	.		130.0	28.0	.	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	hg19	CCDS13400.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.89|11.89	1.774382|1.774382	0.31411|0.31411	.|.	.|.	ENSG00000158296|ENSG00000158296	ENST00000290317;ENST00000279027;ENST00000413164;ENST00000495082;ENST00000468915;ENST00000420568;ENST00000372121|ENST00000450298	T;T;T;T;T;T;T|.	0.12672|.	3.89;3.89;3.89;3.89;3.89;2.67;2.66|.	5.77|5.77	3.61|3.61	0.41365|0.41365	.|.	0.147589|.	0.64402|.	D|.	0.000011|.	T|T	0.29458|0.29458	0.0734|0.0734	N|N	0.05199|0.05199	-0.095|-0.095	0.80722|0.80722	D|D	1|1	B;B;B|.	0.26147|.	0.107;0.118;0.143|.	B;B;B|.	0.30943|.	0.053;0.075;0.122|.	T|T	0.06267|0.06267	-1.0836|-1.0836	10|5	0.28530|.	T|.	0.3|.	-5.8147|-5.8147	6.3165|6.3165	0.21194|0.21194	0.3814:0.0:0.6186:0.0|0.3814:0.0:0.6186:0.0	.|.	298;301;348|.	B4DIR8;F6WI18;Q8WWT9|.	.;.;S13A3_HUMAN|.	I|H	301;348;298;301;301;261;298|177	ENSP00000290317:L301I;ENSP00000279027:L348I;ENSP00000415852:L298I;ENSP00000419621:L301I;ENSP00000417784:L301I;ENSP00000395095:L261I;ENSP00000361193:L298I|.	ENSP00000279027:L348I|.	L|P	-|-	1|2	0|0	SLC13A3|SLC13A3	44650184|44650184	1.000000|1.000000	0.71417|0.71417	0.931000|0.931000	0.37212|0.37212	0.394000|0.394000	0.30568|0.30568	1.529000|1.529000	0.35996|0.35996	1.429000|1.429000	0.47314|0.47314	0.543000|0.543000	0.68304|0.68304	CTT|CCT	.	.	.	none		0.592	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
BCAS1	8537	hgsc.bcm.edu	37	20	52612540	52612540	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr20:52612540T>G	ENST00000395961.3	-	5	939	c.773A>C	c.(772-774)gAt>gCt	p.D258A	BCAS1_ENST00000371440.3_Missense_Mutation_p.D258A|BCAS1_ENST00000371435.2_Missense_Mutation_p.D258A|BCAS1_ENST00000434986.2_5'UTR	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	258						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			GACAGAGCAATCCGCAGTTCC	0.473																																					p.D258A		Atlas-SNP	.											.	BCAS1	77	.	0			c.A773C						PASS	.						148.0	122.0	131.0					20																	52612540		2203	4300	6503	SO:0001583	missense	8537	exon5			GAGCAATCCGCAG	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.773A>C	chr20.hg19:g.52612540T>G	ENSP00000379290:p.Asp258Ala	60.0	0.0	.		85.0	14.0	.	NM_003657	A0AVG5|Q68CZ3	Missense_Mutation	SNP	ENST00000395961.3	hg19	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	T	5.880	0.346478	0.11126	.	.	ENSG00000064787	ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435	T;T;T;T	0.05081	3.5;3.5;3.5;3.5	6.03	-4.34	0.03666	.	0.949018	0.08921	N	0.874390	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.14012	0.009;0.009;0.003;0.008;0.008	B;B;B;B;B	0.13407	0.009;0.009;0.006;0.008;0.008	T	0.45542	-0.9254	10	0.37606	T	0.19	1.3367	7.6768	0.28490	0.1118:0.3398:0.0:0.5484	.	258;258;258;258;258	B2RCQ5;O75363-2;G3XAF7;A0AVG7;O75363	.;.;.;.;BCAS1_HUMAN	A	120;258;136;258;258	ENSP00000396361:D120A;ENSP00000360495:D258A;ENSP00000379290:D258A;ENSP00000360490:D258A	ENSP00000360490:D258A	D	-	2	0	BCAS1	52045947	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.527000	0.06200	-0.559000	0.06110	-0.912000	0.02778	GAT	.	.	.	none		0.473	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
HSPA13	6782	hgsc.bcm.edu	37	21	15746238	15746238	+	Silent	SNP	G	G	T			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr21:15746238G>T	ENST00000285667.3	-	5	1183	c.1116C>A	c.(1114-1116)acC>acA	p.T372T	HSPA13_ENST00000544452.1_Silent_p.T164T	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	372						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CTTCATTAAGGGTATCAAAGA	0.403																																					p.T372T		Atlas-SNP	.											.	HSPA13	44	.	0			c.C1116A						PASS	.						143.0	154.0	150.0					21																	15746238		2203	4300	6503	SO:0001819	synonymous_variant	6782	exon5			ATTAAGGGTATCA		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1116C>A	chr21.hg19:g.15746238G>T		107.0	0.0	.		113.0	42.0	.	NM_006948	B2R616|Q8NE40	Silent	SNP	ENST00000285667.3	hg19	CCDS13567.1																																																																																			.	.	.	none		0.403	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
FIGF	2277	hgsc.bcm.edu	37	X	15364334	15364334	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chrX:15364334T>G	ENST00000297904.3	-	7	1415	c.986A>C	c.(985-987)aAa>aCa	p.K329T	FIGF_ENST00000488351.1_5'UTR	NM_004469.4	NP_004460.1	O43915	VEGFD_HUMAN	c-fos induced growth factor (vascular endothelial growth factor D)	329					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|induction of positive chemotaxis (GO:0050930)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell chemotaxis (GO:0060754)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor binding (GO:0005172)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17	Hepatocellular(33;0.183)					ACATGCTGTTTTGCCACTTGC	0.473																																					p.K329T		Atlas-SNP	.											.	FIGF	39	.	0			c.A986C						PASS	.						106.0	92.0	97.0					X																	15364334		2203	4300	6503	SO:0001583	missense	2277	exon7			GCTGTTTTGCCAC	AJ000185	CCDS14166.1	Xp22.31	2008-02-05			ENSG00000165197	ENSG00000165197			3708	protein-coding gene	gene with protein product		300091		VEGFD		9479493	Standard	NM_004469		Approved	VEGF-D	uc004cwt.2	O43915	OTTHUMG00000021175	ENST00000297904.3:c.986A>C	chrX.hg19:g.15364334T>G	ENSP00000297904:p.Lys329Thr	176.0	0.0	.		79.0	55.0	.	NM_004469	B2R7Z3	Missense_Mutation	SNP	ENST00000297904.3	hg19	CCDS14166.1	.	.	.	.	.	.	.	.	.	.	T	3.622	-0.077390	0.07184	.	.	ENSG00000165197	ENST00000297904	.	.	.	5.41	4.23	0.50019	.	0.098803	0.45606	N	0.000358	T	0.43567	0.1253	L	0.46157	1.445	0.33518	D	0.591948	P	0.52577	0.954	P	0.46452	0.517	T	0.54827	-0.8235	9	0.29301	T	0.29	-9.5606	9.854	0.41075	0.0:0.0817:0.0:0.9183	.	329	O43915	VEGFD_HUMAN	T	329	.	ENSP00000297904:K329T	K	-	2	0	FIGF	15274255	0.994000	0.37717	0.285000	0.24819	0.068000	0.16541	2.218000	0.42889	0.777000	0.33496	0.486000	0.48141	AAA	.	.	.	none		0.473	FIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055859.1	NM_004469	
MT-ND2	4536	hgsc.bcm.edu	37	M	5226	5226	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chrM:5226G>A	ENST00000361453.3	+	1	757	c.757G>A	c.(757-759)Ggc>Agc	p.G253S	MT-TM_ENST00000387377.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	253					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TCTCCCTAGGAGGCCTGCCCC	0.488																																					p.G253S		Atlas-SNP	.											.	.	.	.	0			c.G757A						PASS	.																																			SO:0001583	missense	0	exon1			CTAGGAGGCCTGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.757G>A	chrM.hg19:g.5226G>A	ENSP00000355046:p.Gly253Ser	19.0	0.0	.		199.0	191.0	.	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.	.	none		0.488	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
MT-ND4	4538	hgsc.bcm.edu	37	M	11150	11150	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chrM:11150G>A	ENST00000361381.2	+	1	391	c.391G>A	c.(391-393)Gct>Act	p.A131T	MT-ND5_ENST00000361567.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	131					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TCCCCACCTTGGCTATCATCA	0.448																																					p.A131T		Atlas-SNP	.											.	.	.	.	0			c.G391A						PASS	.																																			SO:0001583	missense	0	exon1			ACCTTGGCTATCA			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.391G>A	chrM.hg19:g.11150G>A	ENSP00000354961:p.Ala131Thr	14.0	0.0	.		250.0	233.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MID1	4281	hgsc.bcm.edu	37	X	10535072	10535072	+	Frame_Shift_Del	DEL	C	C	-			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chrX:10535072delC	ENST00000317552.4	-	2	916	c.516delG	c.(514-516)gggfs	p.G172fs	MID1_ENST00000380787.1_Frame_Shift_Del_p.G172fs|MID1_ENST00000453318.2_Frame_Shift_Del_p.G172fs|MID1_ENST00000380785.1_Frame_Shift_Del_p.G172fs|MID1_ENST00000380782.2_Frame_Shift_Del_p.G172fs|MID1_ENST00000380779.1_Frame_Shift_Del_p.G172fs|MID1_ENST00000380780.1_Frame_Shift_Del_p.G172fs	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	172					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						AGCACATCAGCCCCCGGATGT	0.522																																					p.L173X		Atlas-Indel,Pindel	.											.	MID1	72	.	0			c.517delC						PASS	.						112.0	94.0	100.0					X																	10535072		2203	4300	6503	SO:0001589	frameshift_variant	4281	exon2			.	Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.516delG	chrX.hg19:g.10535072delC	ENSP00000312678:p.Gly172fs	150.0	0.0	0		68.0	45.0	0.661765	NM_033289	B2RCG2|O75361|Q9BZX5	Frame_Shift_Del	DEL	ENST00000317552.4	hg19	CCDS14138.1																																																																																			.	.	.	none		0.522	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1		
ZZEF1	23140	hgsc.bcm.edu	37	17	3947660	3947660	+	Frame_Shift_Del	DEL	T	T	-			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:3947660delT	ENST00000381638.2	-	38	6148	c.6024delA	c.(6022-6024)agafs	p.R2008fs		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2008							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CATGAACAGCTCTCTTTCCCT	0.338																																					p.A2009fs		Atlas-Indel,Pindel	.											.	ZZEF1	195	.	0			c.6025delG						PASS	.						159.0	148.0	152.0					17																	3947660		2203	4300	6503	SO:0001589	frameshift_variant	23140	exon38			.	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.6024delA	chr17.hg19:g.3947660delT	ENSP00000371051:p.Arg2008fs	66.0	0.0	0		96.0	55.0	0.572917	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Frame_Shift_Del	DEL	ENST00000381638.2	hg19	CCDS11043.1																																																																																			.	.	.	none		0.338	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
LAMP2	3920	hgsc.bcm.edu	37	X	119565189	119565190	+	Frame_Shift_Ins	INS	-	-	AT			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chrX:119565189_119565190insAT	ENST00000200639.4	-	9	1357_1358	c.1221_1222insAT	c.(1219-1224)tatgagfs	p.E408fs	LAMP2_ENST00000434600.2_Intron|LAMP2_ENST00000538785.1_Intron			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	408					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						TAAAATTGCTCATATCCAGCAT	0.381																																					p.E408fs		Atlas-Indel,Pindel	.											.	LAMP2	101	.	0			c.1222_1223insAT						PASS	.																																			SO:0001589	frameshift_variant	3920	exon9			.	X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.1220_1221dupAT	chrX.hg19:g.119565192_119565193dupAT	ENSP00000200639:p.Glu408fs	340.0	0.0	0		182.0	138.0	0.758242	NM_002294	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Frame_Shift_Ins	INS	ENST00000200639.4	hg19	CCDS14599.1																																																																																			.	.	.	none		0.381	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058099.1		
PCDH18	54510	hgsc.bcm.edu	37	4	138452939	138452940	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr4:138452939_138452940insCT	ENST00000344876.4	-	1	689_690	c.303_304insAG	c.(301-306)aacttgfs	p.L102fs	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000412923.2_Frame_Shift_Ins_p.L102fs|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000507846.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	102	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GAACAGTTCAAGTTTTTCTGGC	0.426																																					p.L102fs		Atlas-INDEL	.											.	PCDH18	229	.	0			c.304_305insAG						PASS	.																																			SO:0001589	frameshift_variant	54510	exon1			.	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.303_304insAG	chr4.hg19:g.138452939_138452940insCT	ENSP00000355082:p.Leu102fs	136.0	0.0	0		87.0	29.0	0.333333	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Frame_Shift_Ins	INS	ENST00000344876.4	hg19	CCDS34064.1																																																																																			.	.	.	none		0.426	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ABCC9	10060	hgsc.bcm.edu	37	12	21962796	21962797	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr12:21962796_21962797delAG	ENST00000261201.4	-	35	4303_4304	c.4304_4305delCT	c.(4303-4305)cctfs	p.P1435fs	ABCC9_ENST00000261200.4_Frame_Shift_Del_p.P1435fs|ABCC9_ENST00000345162.2_Frame_Shift_Del_p.P1399fs	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1435	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CTAGACCTCCAGGTAGAGATTT	0.342																																					p.1435_1436del		Atlas-INDEL	.											.	ABCC9	411	.	0			c.4305_4306del						PASS	.																																			SO:0001589	frameshift_variant	10060	exon35			.	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4304_4305delCT	chr12.hg19:g.21962796_21962797delAG	ENSP00000261201:p.Pro1435fs	35.0	0.0	0		32.0	13.0	0.40625	NM_020297	O60707	Frame_Shift_Del	DEL	ENST00000261201.4	hg19	CCDS8694.1																																																																																			.	.	.	none		0.342	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
STAT5B	6777	hgsc.bcm.edu	37	17	40369252	40369259	+	Frame_Shift_Del	DEL	TCACCGAC	TCACCGAC	-			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	TCACCGAC	TCACCGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr17:40369252_40369259delTCACCGAC	ENST00000293328.3	-	11	1467_1474	c.1299_1306delGTCGGTGA	c.(1297-1308)gagtcggtgacafs	p.ESVT433fs		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	433					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.S434L(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TTTTCTTCTGTCACCGACTCTGCCCCAC	0.438																																					p.434_436del		Atlas-Indel,Pindel	.											.	STAT5B	89	.	1	Substitution - Missense(1)	large_intestine(1)	c.1300_1307del						PASS	.																																			SO:0001589	frameshift_variant	6777	exon11			.	BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1299_1306delGTCGGTGA	chr17.hg19:g.40369252_40369259delTCACCGAC	ENSP00000293328:p.Glu433fs	132.0	0.0	0		172.0	73.0	0.424419	NM_012448	Q8WWS8	Frame_Shift_Del	DEL	ENST00000293328.3	hg19	CCDS11423.1																																																																																			.	.	.	none		0.438	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	
DVL3	1857	hgsc.bcm.edu	37	3	183888399	183888400	+	Frame_Shift_Ins	INS	-	-	C			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:183888399_183888400insC	ENST00000313143.3	+	15	2255_2256	c.2007_2008insC	c.(2008-2010)cccfs	p.P670fs	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Frame_Shift_Ins_p.P653fs	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	670					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			TGCTGATGATGCCCCCGCCGCC	0.723																																					p.M669fs		Atlas-INDEL	.											.	DVL3	68	.	0			c.2007_2008insC						PASS	.																																			SO:0001589	frameshift_variant	1857	exon15			.	D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.2012dupC	chr3.hg19:g.183888404_183888404dupC	ENSP00000316054:p.Pro670fs	73.0	0.0	0		55.0	11.0	0.2	NM_004423	B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Frame_Shift_Ins	INS	ENST00000313143.3	hg19	CCDS3253.1																																																																																			.	.	.	none		0.723	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423	
STAB1	23166	hgsc.bcm.edu	37	3	52555381	52555381	+	Frame_Shift_Del	DEL	C	C	-			TCGA-F9-A7VF-01A-11D-A33Q-10	TCGA-F9-A7VF-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6f35b843-6207-45fa-b18f-ad0f104f9651	491d7fcd-e412-4f53-a19a-d5d51744cd81	g.chr3:52555381delC	ENST00000321725.6	+	56	5989	c.5913delC	c.(5911-5913)tgcfs	p.C1971fs		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1971	Laminin EGF-like 2. {ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCCCAGCTTGCCCTGGCGGCC	0.637																																					p.C1971fs		Atlas-Indel,Pindel	.											.	STAB1	178	.	0			c.5912delG						PASS	.						98.0	95.0	96.0					3																	52555381		2203	4300	6503	SO:0001589	frameshift_variant	23166	exon56			.	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5913delC	chr3.hg19:g.52555381delC	ENSP00000312946:p.Cys1971fs	41.0	0.0	0		55.0	30.0	0.545455	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Frame_Shift_Del	DEL	ENST00000321725.6	hg19	CCDS33768.1																																																																																			.	.	.	none		0.637	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
