#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NCDN	23154	hgsc.bcm.edu	37	1	36029001	36029001	+	Silent	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr1:36029001C>T	ENST00000373243.2	+	5	1967	c.1584C>T	c.(1582-1584)ctC>ctT	p.L528L	NCDN_ENST00000373253.3_Silent_p.L511L|NCDN_ENST00000356090.4_Silent_p.L528L	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	528					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCCTCAACCTCGTGGTCACCG	0.637																																					p.L528L		Atlas-SNP	.											.	NCDN	79	.	0			c.C1584T						PASS	.						73.0	72.0	73.0					1																	36029001		2203	4300	6503	SO:0001819	synonymous_variant	23154	exon5			CAACCTCGTGGTC	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1584C>T	chr1.hg19:g.36029001C>T		51.0	0.0	.		52.0	22.0	.	NM_014284	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Silent	SNP	ENST00000373243.2	hg19	CCDS392.1	.	.	.	.	.	.	.	.	.	.	C	8.862	0.947208	0.18356	.	.	ENSG00000020129	ENST00000423723	.	.	.	4.71	-9.43	0.00607	.	.	.	.	.	T	0.48333	0.1494	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58381	-0.7646	4	.	.	.	.	10.1742	0.42929	0.0:0.1196:0.3934:0.4871	.	.	.	.	L	122	.	.	S	+	2	0	NCDN	35801588	0.002000	0.14202	0.817000	0.32601	0.960000	0.62799	-1.658000	0.01977	-1.527000	0.01758	-1.244000	0.01528	TCG	.	.	.	none		0.637	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
KCNC4	3749	hgsc.bcm.edu	37	1	110768794	110768794	+	Missense_Mutation	SNP	C	C	T	rs200184574		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr1:110768794C>T	ENST00000369787.3	+	3	1840	c.1813C>T	c.(1813-1815)Cgg>Tgg	p.R605W	KCNC4_ENST00000438661.2_Missense_Mutation_p.R605W|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Missense_Mutation_p.R605W	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	605					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGGTAGTGTCCGGAAAGGTAT	0.647																																					p.R605W		Atlas-SNP	.											.	KCNC4	113	.	0			c.C1813T						PASS	.						52.0	58.0	56.0					1																	110768794		2203	4300	6503	SO:0001583	missense	3749	exon3			AGTGTCCGGAAAG	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1813C>T	chr1.hg19:g.110768794C>T	ENSP00000358802:p.Arg605Trp	66.0	0.0	.		77.0	36.0	.	NM_001039574	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	hg19	CCDS821.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656015	0.88056	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.98221	-4.8;-4.63;-4.69	5.19	5.19	0.71726	.	0.134642	0.30723	N	0.009019	D	0.97579	0.9207	L	0.59436	1.845	0.43073	D	0.99471	D;D	0.71674	0.997;0.998	P;P	0.50754	0.551;0.649	D	0.98158	1.0445	10	0.87932	D	0	.	18.7013	0.91621	0.0:1.0:0.0:0.0	.	605;605	Q03721;Q03721-3	KCNC4_HUMAN;.	W	605	ENSP00000358802:R605W;ENSP00000388029:R605W;ENSP00000393655:R605W	ENSP00000358802:R605W	R	+	1	2	KCNC4	110570317	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.651000	0.61447	2.430000	0.82344	0.462000	0.41574	CGG	.	C|0.999;T|0.001	0.001	weak		0.647	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
AVPR1B	553	hgsc.bcm.edu	37	1	206225073	206225073	+	Silent	SNP	G	G	T	rs150659663		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr1:206225073G>T	ENST00000367126.4	+	1	1098	c.633G>T	c.(631-633)ccG>ccT	p.P211P	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	211					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	TCGTTCTGCCGGTGACCATGC	0.617																																					p.P211P		Atlas-SNP	.											.	AVPR1B	47	.	0			c.G633T						PASS	.						57.0	55.0	56.0					1																	206225073		2202	4300	6502	SO:0001819	synonymous_variant	553	exon1			TCTGCCGGTGACC	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.633G>T	chr1.hg19:g.206225073G>T		71.0	0.0	.		93.0	4.0	.	NM_000707	B0M0J6|Q5TZ00	Silent	SNP	ENST00000367126.4	hg19	CCDS30994.1																																																																																			.	G|1.000;A|0.000	.	alt		0.617	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707	
GRHL1	29841	hgsc.bcm.edu	37	2	10126281	10126281	+	Silent	SNP	A	A	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr2:10126281A>G	ENST00000324907.9	+	9	1276	c.1140A>G	c.(1138-1140)acA>acG	p.T380T	GRHL1_ENST00000405379.2_Silent_p.T380T|GRHL1_ENST00000324883.5_Silent_p.T191T	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	380					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GCTTAAGCACAGATTTCTCTT	0.463																																					p.T380T		Atlas-SNP	.											.	GRHL1	95	.	0			c.A1140G						PASS	.						187.0	191.0	190.0					2																	10126281		2203	4300	6503	SO:0001819	synonymous_variant	29841	exon9			AAGCACAGATTTC	AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1140A>G	chr2.hg19:g.10126281A>G		67.0	0.0	.		113.0	28.0	.	NM_198182	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Silent	SNP	ENST00000324907.9	hg19	CCDS33144.2																																																																																			.	.	.	none		0.463	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323543.2	NM_014552	
MATN3	4148	hgsc.bcm.edu	37	2	20212199	20212199	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr2:20212199G>C	ENST00000407540.3	-	1	256	c.194C>G	c.(193-195)aCc>aGc	p.T65S	MATN3_ENST00000421259.2_Missense_Mutation_p.T65S	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	65					extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGCTCGCTGGTCCCGGAAGC	0.776																																					p.T65S		Atlas-SNP	.											.	MATN3	28	.	0			c.C194G						PASS	.						1.0	1.0	1.0					2																	20212199		306	662	968	SO:0001583	missense	4148	exon1			TCGCTGGTCCCGG	AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.194C>G	chr2.hg19:g.20212199G>C	ENSP00000383894:p.Thr65Ser	162.0	0.0	.		107.0	26.0	.	NM_002381	B2CPU0|Q4ZG02	Missense_Mutation	SNP	ENST00000407540.3	hg19	CCDS46226.1	.	.	.	.	.	.	.	.	.	.	G	4.047	0.006311	0.07866	.	.	ENSG00000132031	ENST00000407540;ENST00000421259	T;T	0.78003	-1.14;-1.14	3.63	-4.48	0.03515	.	2.438210	0.02024	U	0.048018	T	0.56630	0.1998	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47182	-0.9137	10	0.08381	T	0.77	.	2.3036	0.04168	0.0979:0.2754:0.2087:0.418	.	65;65	B2CPU0;O15232	.;MATN3_HUMAN	S	65	ENSP00000383894:T65S;ENSP00000398753:T65S	ENSP00000383894:T65S	T	-	2	0	MATN3	20075680	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.729000	0.04920	-0.673000	0.05259	0.650000	0.86243	ACC	.	.	.	none		0.776	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323925.1	NM_002381	
PTCD3	55037	hgsc.bcm.edu	37	2	86348656	86348656	+	Missense_Mutation	SNP	A	A	G	rs200261667		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr2:86348656A>G	ENST00000254630.7	+	8	659	c.593A>G	c.(592-594)tAt>tGt	p.Y198C	PTCD3_ENST00000409277.3_Missense_Mutation_p.M157V|PTCD3_ENST00000465560.1_3'UTR	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	198					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TTGTGTTACTATGGTGACCAG	0.378																																					p.Y198C		Atlas-SNP	.											.	PTCD3	51	.	0			c.A593G						PASS	.						121.0	115.0	117.0					2																	86348656		2203	4300	6503	SO:0001583	missense	55037	exon8			GTTACTATGGTGA		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.593A>G	chr2.hg19:g.86348656A>G	ENSP00000254630:p.Tyr198Cys	86.0	0.0	.		87.0	30.0	.	NM_017952	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	hg19	CCDS33235.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.96|10.96	1.498934|1.498934	0.26861|0.26861	.|.	.|.	ENSG00000132300|ENSG00000132300	ENST00000409783;ENST00000409277|ENST00000254630	T;T|T	0.46819|0.33438	0.92;0.86|1.41	5.14|5.14	2.71|2.71	0.32032|0.32032	.|.	.|0.110861	.|0.64402	.|D	.|0.000005	T|T	0.53658|0.53658	0.1810|0.1810	M|M	0.83603|0.83603	2.65|2.65	0.21064|0.21064	N|N	0.999791|0.999791	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.45542|0.45542	-0.9254|-0.9254	7|10	0.27082|0.38643	T|T	0.32|0.18	-13.7965|-13.7965	9.9922|9.9922	0.41879|0.41879	0.7303:0.0:0.0:0.2696|0.7303:0.0:0.0:0.2696	.|.	.|198	.|Q96EY7	.|PTCD3_HUMAN	V|C	157|198	ENSP00000386922:M157V;ENSP00000386462:M157V|ENSP00000254630:Y198C	ENSP00000386462:M157V|ENSP00000254630:Y198C	M|Y	+|+	1|2	0|0	PTCD3|PTCD3	86202167|86202167	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.853000|0.853000	0.48598|0.48598	4.855000|4.855000	0.62925|0.62925	0.348000|0.348000	0.23949|0.23949	-1.282000|-1.282000	0.01380|0.01380	ATG|TAT	.	.	.	weak		0.378	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952	
FAM178B	51252	hgsc.bcm.edu	37	2	97559675	97559675	+	Silent	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr2:97559675C>T	ENST00000417561.3	-	18	2207	c.2208G>A	c.(2206-2208)gaG>gaA	p.E736E	FAM178B_ENST00000490605.2_Silent_p.E588E|FAM178B_ENST00000470789.1_5'UTR|FAM178B_ENST00000327896.3_Silent_p.E556E|FAM178B_ENST00000393526.2_Silent_p.E28E			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	736										large_intestine(1)|ovary(1)	2						TGTGGTCTAGCTCGGCACTAG	0.627																																					p.E588E		Atlas-SNP	.											.	FAM178B	35	.	0			c.G1764A						PASS	.						107.0	91.0	97.0					2																	97559675		2203	4299	6502	SO:0001819	synonymous_variant	51252	exon14			GTCTAGCTCGGCA	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.2208G>A	chr2.hg19:g.97559675C>T		37.0	0.0	.		40.0	6.0	.	NM_001122646	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Silent	SNP	ENST00000417561.3	hg19																																																																																				.	.	.	none		0.627	FAM178B-202	KNOWN	basic	protein_coding	protein_coding		NM_016490	
CBLB	868	hgsc.bcm.edu	37	3	105459395	105459395	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr3:105459395G>T	ENST00000264122.4	-	7	1247	c.926C>A	c.(925-927)aCc>aAc	p.T309N	CBLB_ENST00000394027.3_Missense_Mutation_p.T331N|CBLB_ENST00000403724.1_Missense_Mutation_p.T309N|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000405772.1_Missense_Mutation_p.T309N	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	309	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						ATGAGGTATGGTCTGTAAGAT	0.418			Mis S		AML																																p.T309N	GBM(93;588 1337 9788 29341 43499)	Atlas-SNP	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB	118	.	0			c.C926A						PASS	.						150.0	126.0	134.0					3																	105459395		2203	4300	6503	SO:0001583	missense	868	exon7			GGTATGGTCTGTA	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.926C>A	chr3.hg19:g.105459395G>T	ENSP00000264122:p.Thr309Asn	67.0	0.0	.		72.0	17.0	.	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	hg19	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	G	30	5.050656	0.93740	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5	5.73	5.73	0.89815	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.85682	D	0.000000	D	0.91009	0.7172	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;0.998;1.0	D	0.91572	0.5272	10	0.87932	D	0	-17.5729	19.9155	0.97058	0.0:0.0:1.0:0.0	.	331;309;309	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	N	309;331;309;309	ENSP00000264122:T309N;ENSP00000377595:T331N;ENSP00000384816:T309N;ENSP00000384938:T309N	ENSP00000264122:T309N	T	-	2	0	CBLB	106942085	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.465000	0.97660	2.699000	0.92147	0.650000	0.86243	ACC	.	.	.	none		0.418	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
HNRNPDL	9987	hgsc.bcm.edu	37	4	83350691	83350691	+	Silent	SNP	C	C	T	rs370944367		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr4:83350691C>T	ENST00000295470.5	-	1	328	c.153G>A	c.(151-153)cgG>cgA	p.R51R	HNRNPDL_ENST00000602300.1_5'Flank|HNRNPDL_ENST00000514511.1_5'Flank|ENOPH1_ENST00000509635.1_5'Flank|HNRNPDL_ENST00000502762.1_Silent_p.R51R|HNRNPDL_ENST00000349655.4_5'Flank|ENOPH1_ENST00000273920.3_5'Flank	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	51					regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										GCGCCCCCTGCCGGGCGGAGC	0.771													C|||	1	0.000199681	0.0008	0.0	5008	,	,		8953	0.0		0.0	False		,,,				2504	0.0				p.R51R		Atlas-SNP	.											.	HNRPDL	35	.	0			c.G153A						PASS	.	C	,	4,3044		0,4,1520	4.0	5.0	5.0		153,153	1.2	1.0	4		5	0,6810		0,0,3405	no	coding-synonymous,coding-synonymous	HNRPDL	NM_001207000.1,NM_031372.3	,	0,4,4925	TT,TC,CC		0.0,0.1312,0.0406	,	51/364,51/421	83350691	4,9854	1524	3405	4929	SO:0001819	synonymous_variant	9987	exon1			CCCCTGCCGGGCG	D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.153G>A	chr4.hg19:g.83350691C>T		71.0	0.0	.		55.0	8.0	.	NM_031372	Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Silent	SNP	ENST00000295470.5	hg19	CCDS3593.1																																																																																			.	.	.	weak		0.771	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252644.1	NM_005463	
TRIML2	205860	hgsc.bcm.edu	37	4	189020257	189020257	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr4:189020257G>A	ENST00000512729.1	-	4	777	c.403C>T	c.(403-405)Cgc>Tgc	p.R135C	TRIML2_ENST00000326754.3_Missense_Mutation_p.R135C|TRIML2_ENST00000536972.1_Missense_Mutation_p.R185C	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	135					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		AGGAGGCTGCGGACCTGTTCA	0.483																																					p.R135C		Atlas-SNP	.											.	TRIML2	80	.	0			c.C403T						PASS	.						107.0	104.0	105.0					4																	189020257		2203	4300	6503	SO:0001583	missense	205860	exon4			GGCTGCGGACCTG	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.403C>T	chr4.hg19:g.189020257G>A	ENSP00000422581:p.Arg135Cys	89.0	0.0	.		73.0	26.0	.	NM_173553	B7Z6J6	Missense_Mutation	SNP	ENST00000512729.1	hg19	CCDS3850.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862400	0.32884	.	.	ENSG00000179046	ENST00000512729;ENST00000326754;ENST00000536972	T;T;T	0.58060	3.51;0.36;3.75	4.72	-6.47	0.01902	.	0.361572	0.20462	N	0.091871	T	0.18130	0.0435	N	0.04508	-0.205	0.09310	N	0.999996	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.03761	-1.1006	10	0.44086	T	0.13	.	1.092	0.01665	0.2696:0.1336:0.3359:0.2609	.	185;135;135	B7Z6J6;B7ZLC3;Q8N7C3	.;.;TRIMM_HUMAN	C	135;135;185	ENSP00000422581:R135C;ENSP00000317498:R135C;ENSP00000441236:R185C	ENSP00000317498:R135C	R	-	1	0	TRIML2	189257251	0.000000	0.05858	0.006000	0.13384	0.172000	0.22775	-3.194000	0.00563	-0.991000	0.03476	-0.295000	0.09555	CGC	.	.	.	none		0.483	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140745680	140745680	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr5:140745680G>A	ENST00000518069.1	+	1	1783	c.1783G>A	c.(1783-1785)Gac>Aac	p.D595N	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	595	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTAGCGGTGGACAAAGATTC	0.657																																					p.D595N		Atlas-SNP	.											.	PCDHGA5	215	.	0			c.G1783A						PASS	.						76.0	86.0	83.0					5																	140745680		2203	4300	6503	SO:0001583	missense	56110	exon1			GCGGTGGACAAAG	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.1783G>A	chr5.hg19:g.140745680G>A	ENSP00000429834:p.Asp595Asn	104.0	0.0	.		103.0	36.0	.	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	hg19	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	18.72	3.685011	0.68157	.	.	ENSG00000253485	ENST00000518069	T	0.33654	1.4	4.58	4.58	0.56647	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.80253	0.4589	H	0.99946	5.015	0.40492	D	0.980553	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91185	0.4979	9	0.87932	D	0	.	17.3301	0.87259	0.0:0.0:1.0:0.0	.	595;595	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	N	595	ENSP00000429834:D595N	ENSP00000429834:D595N	D	+	1	0	PCDHGA5	140725864	1.000000	0.71417	1.000000	0.80357	0.395000	0.30598	9.598000	0.98277	2.266000	0.75297	0.563000	0.77884	GAC	.	.	.	none		0.657	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
CUL9	23113	hgsc.bcm.edu	37	6	43193850	43193850	+	IGR	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr6:43193850C>T	ENST00000252050.4	+	0	7780				DNPH1_ENST00000230431.6_Silent_p.L99L|DNPH1_ENST00000393987.2_Silent_p.L99L|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGCCTACACCCAAGGATGGCT	0.607																																					p.L99L		Atlas-SNP	.											.	.	.	.	0			c.G297A						PASS	.						34.0	27.0	30.0					6																	43193850		2190	4285	6475	SO:0001628	intergenic_variant	10591	exon3			TACACCCAAGGAT	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		chr6.hg19:g.43193850C>T		33.0	0.0	.		41.0	16.0	.	NM_006443	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	hg19	CCDS4890.1																																																																																			.	.	.	none		0.607	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
CDC5L	988	hgsc.bcm.edu	37	6	44355567	44355567	+	Nonsense_Mutation	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr6:44355567C>T	ENST00000371477.3	+	1	306	c.7C>T	c.(7-9)Cga>Tga	p.R3*		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	3	HTH myb-type 1. {ECO:0000255|PROSITE- ProRule:PRU00625}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CAAGATGCCTCGAATTATGAT	0.607																																					p.R3X		Atlas-SNP	.											.	CDC5L	86	.	0			c.C7T						PASS	.						29.0	29.0	29.0					6																	44355567		2200	4286	6486	SO:0001587	stop_gained	988	exon1			ATGCCTCGAATTA	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.7C>T	chr6.hg19:g.44355567C>T	ENSP00000360532:p.Arg3*	50.0	0.0	.		45.0	10.0	.	NM_001253	Q76N46|Q99974	Nonsense_Mutation	SNP	ENST00000371477.3	hg19	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	C	42	9.432704	0.99169	.	.	ENSG00000096401	ENST00000371477	.	.	.	5.69	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.9078	15.0684	0.72014	0.0:0.9308:0.0:0.0692	.	.	.	.	X	3	.	ENSP00000360532:R3X	R	+	1	2	CDC5L	44463545	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.562000	0.67346	2.674000	0.91012	0.650000	0.86243	CGA	.	.	.	none		0.607	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1		
MAP3K4	4216	hgsc.bcm.edu	37	6	161512563	161512563	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr6:161512563T>G	ENST00000392142.4	+	12	3274	c.3126T>G	c.(3124-3126)ttT>ttG	p.F1042L	MAP3K4_ENST00000348824.7_Missense_Mutation_p.F1042L|MAP3K4_ENST00000366919.2_Missense_Mutation_p.F1042L|MAP3K4_ENST00000366920.2_Missense_Mutation_p.F1042L	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1042					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GGTACAATTTTGGATTTGAGG	0.363																																					p.F1042L		Atlas-SNP	.											.	MAP3K4	364	.	0			c.T3126G						PASS	.						144.0	146.0	145.0					6																	161512563		2203	4300	6503	SO:0001583	missense	4216	exon12			CAATTTTGGATTT	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3126T>G	chr6.hg19:g.161512563T>G	ENSP00000375986:p.Phe1042Leu	151.0	0.0	.		140.0	6.0	.	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.593287	0.66219	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.74421	-0.81;-0.84;-0.82;-0.79	5.17	-0.3	0.12804	.	0.000000	0.85682	D	0.000000	T	0.70360	0.3215	L	0.55834	1.745	0.58432	D	0.999996	P;P;D;D	0.76494	0.933;0.533;0.999;0.999	P;B;D;D	0.77557	0.85;0.083;0.99;0.986	T	0.67898	-0.5551	10	0.29301	T	0.29	-24.6745	9.7428	0.40429	0.0:0.2696:0.0:0.7304	.	1042;32;1042;1042	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	L	1042	ENSP00000355886:F1042L;ENSP00000375986:F1042L;ENSP00000355887:F1042L;ENSP00000297332:F1042L	ENSP00000297332:F1042L	F	+	3	2	MAP3K4	161432553	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	0.902000	0.28459	-0.197000	0.10350	-0.263000	0.10527	TTT	.	.	.	none		0.363	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
PPP1R9A	55607	hgsc.bcm.edu	37	7	94540403	94540403	+	Silent	SNP	T	T	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr7:94540403T>G	ENST00000433881.1	+	2	1510	c.978T>G	c.(976-978)gcT>gcG	p.A326A	PPP1R9A_ENST00000424654.1_Silent_p.A326A|PPP1R9A_ENST00000433360.1_Silent_p.A326A|PPP1R9A_ENST00000456331.2_Silent_p.A326A|PPP1R9A_ENST00000340694.4_Silent_p.A326A|PPP1R9A_ENST00000289495.5_Silent_p.A326A			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	326					actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			AACCTTGTGCTGAAAGTAAGG	0.483										HNSCC(28;0.073)																											p.A326A		Atlas-SNP	.											.	PPP1R9A	264	.	0			c.T978G						PASS	.						75.0	76.0	76.0					7																	94540403		2203	4300	6503	SO:0001819	synonymous_variant	55607	exon2			TTGTGCTGAAAGT	AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.978T>G	chr7.hg19:g.94540403T>G		121.0	0.0	.		188.0	57.0	.	NM_017650	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Silent	SNP	ENST00000433881.1	hg19	CCDS34683.1																																																																																			.	.	.	none		0.483	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340662.1	NM_001166160	
LAMB4	22798	hgsc.bcm.edu	37	7	107743597	107743597	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr7:107743597C>T	ENST00000388781.3	-	10	1155	c.1072G>A	c.(1072-1074)Gtg>Atg	p.V358M	LAMB4_ENST00000418464.1_Missense_Mutation_p.V358M|LAMB4_ENST00000414450.2_Missense_Mutation_p.V358M|LAMB4_ENST00000205386.4_Missense_Mutation_p.V358M|LAMB4_ENST00000388780.3_Missense_Mutation_p.V358M	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	358	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TCTTCACACACGCCCCCGCTG	0.592																																					p.V358M		Atlas-SNP	.											.	LAMB4	253	.	0			c.G1072A						PASS	.						52.0	42.0	45.0					7																	107743597		2203	4300	6503	SO:0001583	missense	22798	exon10			CACACACGCCCCC	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1072G>A	chr7.hg19:g.107743597C>T	ENSP00000373433:p.Val358Met	56.0	0.0	.		67.0	29.0	.	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857613	0.71834	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	4.3	3.4	0.38934	EGF-like, laminin (3);	0.302038	0.23387	N	0.048736	T	0.66567	0.2802	M	0.74546	2.27	0.80722	D	1	D	0.57571	0.98	P	0.48089	0.566	T	0.71856	-0.4466	10	0.51188	T	0.08	.	12.9825	0.58572	0.0:0.9164:0.0:0.0835	.	358	A4D0S4	LAMB4_HUMAN	M	358	ENSP00000205386:V358M;ENSP00000373433:V358M;ENSP00000373432:V358M;ENSP00000402353:V358M;ENSP00000402265:V358M	ENSP00000205386:V358M	V	-	1	0	LAMB4	107530833	0.996000	0.38824	0.190000	0.23270	0.611000	0.37282	3.550000	0.53691	2.368000	0.80403	0.655000	0.94253	GTG	.	.	.	none		0.592	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
CNOT4	4850	hgsc.bcm.edu	37	7	135095338	135095338	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr7:135095338T>C	ENST00000315544.5	-	7	1027	c.748A>G	c.(748-750)Aat>Gat	p.N250D	CNOT4_ENST00000451834.1_Missense_Mutation_p.N250D|CNOT4_ENST00000356162.4_Missense_Mutation_p.N250D|CNOT4_ENST00000361528.4_Missense_Mutation_p.N250D|CNOT4_ENST00000541284.1_Missense_Mutation_p.N250D|CNOT4_ENST00000428680.2_Missense_Mutation_p.N250D|CNOT4_ENST00000423368.2_Missense_Mutation_p.N250D|CNOT4_ENST00000414802.1_Missense_Mutation_p.N250D	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	250					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TGAAGAAAATTGGGATTTAAT	0.343																																					p.N250D	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.A748G						PASS	.						104.0	105.0	104.0					7																	135095338		1808	4070	5878	SO:0001583	missense	4850	exon7			GAAAATTGGGATT	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.748A>G	chr7.hg19:g.135095338T>C	ENSP00000326731:p.Asn250Asp	52.0	0.0	.		94.0	32.0	.	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000315544.5	hg19	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.988872	0.53934	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000414802;ENST00000356162;ENST00000428680;ENST00000315544	T;T;T;T;T;T;T;T	0.44083	0.95;0.94;0.96;0.94;0.96;0.96;0.93;0.95	5.52	5.52	0.82312	.	0.128185	0.64402	D	0.000001	T	0.28962	0.0719	N	0.19112	0.55	0.54753	D	0.999982	B;B;B;B;B;B	0.31817	0.031;0.053;0.031;0.023;0.187;0.341	B;B;B;B;B;B	0.27500	0.004;0.008;0.006;0.006;0.08;0.08	T	0.07462	-1.0771	10	0.30078	T	0.28	-6.89	15.644	0.77033	0.0:0.0:0.0:1.0	.	250;250;250;250;250;250	E7ET38;F8VQP3;O95628;O95628-2;O95628-4;O95628-8	.;.;CNOT4_HUMAN;.;.;.	D	250	ENSP00000445508:N250D;ENSP00000388491:N250D;ENSP00000406777:N250D;ENSP00000354673:N250D;ENSP00000416532:N250D;ENSP00000348485:N250D;ENSP00000399108:N250D;ENSP00000326731:N250D	ENSP00000262563:N250D	N	-	1	0	CNOT4	134745878	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.679000	0.68160	2.101000	0.63845	0.533000	0.62120	AAT	.	.	.	none		0.343	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
TG	7038	hgsc.bcm.edu	37	8	133899367	133899367	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr8:133899367G>T	ENST00000220616.4	+	9	1790	c.1750G>T	c.(1750-1752)Gct>Tct	p.A584S	TG_ENST00000377869.1_Missense_Mutation_p.A584S	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	584					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTTGCAACATGCTATCTCTGT	0.453																																					p.A584S		Atlas-SNP	.											.	TG	416	.	0			c.G1750T						PASS	.						113.0	108.0	110.0					8																	133899367		2203	4300	6503	SO:0001583	missense	7038	exon9			CAACATGCTATCT	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1750G>T	chr8.hg19:g.133899367G>T	ENSP00000220616:p.Ala584Ser	132.0	0.0	.		165.0	42.0	.	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022056	0.35701	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.66638	-0.22;-0.21	5.03	4.15	0.48705	.	0.194839	0.35615	N	0.003081	T	0.56688	0.2002	N	0.24115	0.695	0.21416	N	0.999696	D	0.53151	0.958	P	0.45276	0.475	T	0.55755	-0.8091	10	0.87932	D	0	.	14.0112	0.64498	0.0:0.0:0.8478:0.1522	.	584	P01266	THYG_HUMAN	S	584	ENSP00000367100:A584S;ENSP00000220616:A584S	ENSP00000220616:A584S	A	+	1	0	TG	133968549	0.995000	0.38212	0.618000	0.29105	0.017000	0.09413	3.676000	0.54612	1.326000	0.45319	-0.182000	0.12963	GCT	.	.	.	none		0.453	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TRAPPC9	83696	hgsc.bcm.edu	37	8	140743457	140743457	+	Silent	SNP	G	G	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr8:140743457G>T	ENST00000438773.2	-	23	3427	c.3294C>A	c.(3292-3294)ggC>ggA	p.G1098G	TRAPPC9_ENST00000522504.1_5'UTR|TRAPPC9_ENST00000389328.4_Silent_p.G1196G|TRAPPC9_ENST00000389327.3_Silent_p.G1089G	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	1098					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						AGGCCGACTGGCCGGACGGCT	0.632																																					p.G1196G		Atlas-SNP	.											.	TRAPPC9	114	.	0			c.C3588A						PASS	.						42.0	41.0	42.0					8																	140743457		2203	4300	6503	SO:0001819	synonymous_variant	83696	exon23			CGACTGGCCGGAC	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.3294C>A	chr8.hg19:g.140743457G>T		68.0	0.0	.		111.0	22.0	.	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Silent	SNP	ENST00000438773.2	hg19	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	G	6.675	0.493107	0.12702	.	.	ENSG00000167632	ENST00000520857	.	.	.	4.93	0.802	0.18686	.	.	.	.	.	T	0.54967	0.1891	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48175	-0.9058	4	.	.	.	.	8.0787	0.30731	0.0:0.2238:0.4519:0.3243	.	.	.	.	T	942	.	.	P	-	1	0	TRAPPC9	140812639	0.997000	0.39634	0.970000	0.41538	0.693000	0.40251	0.337000	0.19841	0.442000	0.26555	0.655000	0.94253	CCA	.	.	.	none		0.632	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
UHRF2	115426	hgsc.bcm.edu	37	9	6420922	6420922	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr9:6420922G>T	ENST00000276893.5	+	2	332	c.164G>T	c.(163-165)gGa>gTa	p.G55V	RP11-307L3.4_ENST00000411561.1_RNA|UHRF2_ENST00000381373.3_Missense_Mutation_p.G55V	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	55	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TTGGAAAATGGATATACCTTA	0.343																																					p.G55V		Atlas-SNP	.											.	UHRF2	50	.	0			c.G164T						PASS	.						74.0	73.0	73.0					9																	6420922		2203	4300	6503	SO:0001583	missense	115426	exon2			AAAATGGATATAC	AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.164G>T	chr9.hg19:g.6420922G>T	ENSP00000276893:p.Gly55Val	65.0	0.0	.		57.0	4.0	.	NM_152896	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	ENST00000276893.5	hg19	CCDS6469.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287390	0.80803	.	.	ENSG00000147854	ENST00000276893;ENST00000381373	T;T	0.74002	-0.8;-0.8	5.46	5.46	0.80206	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.88647	0.6493	M	0.87328	2.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90237	0.4283	10	0.87932	D	0	-16.5314	19.296	0.94122	0.0:0.0:1.0:0.0	.	55	Q96PU4	UHRF2_HUMAN	V	55	ENSP00000276893:G55V;ENSP00000370778:G55V	ENSP00000276893:G55V	G	+	2	0	UHRF2	6410922	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.448000	0.90335	2.548000	0.85928	0.467000	0.42956	GGA	.	.	.	none		0.343	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051665.3	NM_152306	
DDX31	64794	hgsc.bcm.edu	37	9	135545507	135545507	+	Missense_Mutation	SNP	T	T	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr9:135545507T>A	ENST00000372159.3	-	1	281	c.130A>T	c.(130-132)Agt>Tgt	p.S44C	GTF3C4_ENST00000483873.2_5'UTR|DDX31_ENST00000310532.2_Missense_Mutation_p.S44C|DDX31_ENST00000372153.1_Missense_Mutation_p.S44C|GTF3C4_ENST00000372146.4_5'UTR|DDX31_ENST00000544003.1_5'Flank|DDX31_ENST00000480876.1_5'UTR	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	44						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		GGGACAAGACTACCGCGCGTG	0.701																																					p.S44C		Atlas-SNP	.											.	DDX31	76	.	0			c.A130T						PASS	.						8.0	8.0	8.0					9																	135545507		2143	4213	6356	SO:0001583	missense	64794	exon1			CAAGACTACCGCG	AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.130A>T	chr9.hg19:g.135545507T>A	ENSP00000361232:p.Ser44Cys	62.0	0.0	.		69.0	31.0	.	NM_022779	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	ENST00000372159.3	hg19	CCDS6951.1	.	.	.	.	.	.	.	.	.	.	T	6.961	0.547182	0.13312	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000310532	T;T;T	0.06768	4.12;3.66;3.26	0.235	-0.47	0.12131	.	.	.	.	.	T	0.03305	0.0096	N	0.08118	0	0.20403	N	0.999909	B;B;B	0.29341	0.242;0.037;0.022	B;B;B	0.12156	0.007;0.003;0.001	T	0.38908	-0.9639	8	0.72032	D	0.01	.	.	.	.	.	44;44;44	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	C	44	ENSP00000361232:S44C;ENSP00000361226:S44C;ENSP00000310539:S44C	ENSP00000310539:S44C	S	-	1	0	DDX31	134535328	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.031000	0.01427	-0.750000	0.04740	-0.755000	0.03482	AGT	.	.	.	none		0.701	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054794.1	NM_138620	
PNPLA7	375775	hgsc.bcm.edu	37	9	140356049	140356049	+	Silent	SNP	G	G	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr9:140356049G>T	ENST00000277531.4	-	32	3891	c.3705C>A	c.(3703-3705)tcC>tcA	p.S1235S	NSMF_ENST00000371474.3_5'Flank|PNPLA7_ENST00000406427.1_Silent_p.S1260S|NSMF_ENST00000371472.2_5'Flank|NSMF_ENST00000265663.7_5'Flank|NSMF_ENST00000371475.3_5'Flank|PNPLA7_ENST00000371457.1_Silent_p.S841S|PNPLA7_ENST00000492278.1_5'UTR|NSMF_ENST00000371473.3_5'Flank|NSMF_ENST00000392812.4_5'Flank|NSMF_ENST00000437259.1_5'Flank	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1235					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GGTCCGTGAAGGAGGCGTTGG	0.647																																					p.S1260S		Atlas-SNP	.											.	PNPLA7	124	.	0			c.C3780A						PASS	.						92.0	66.0	75.0					9																	140356049		2202	4299	6501	SO:0001819	synonymous_variant	375775	exon33			CGTGAAGGAGGCG	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3705C>A	chr9.hg19:g.140356049G>T		50.0	0.0	.		41.0	15.0	.	NM_001098537	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	ENST00000277531.4	hg19	CCDS7045.1																																																																																			.	.	.	none		0.647	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
LCOR	84458	hgsc.bcm.edu	37	10	98715228	98715228	+	Missense_Mutation	SNP	C	C	T	rs145573126		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr10:98715228C>T	ENST00000371097.4	+	8	1397	c.851C>T	c.(850-852)aCg>aTg	p.T284M	LCOR_ENST00000498444.1_Intron|LCOR_ENST00000356016.3_Missense_Mutation_p.T284M|LCOR_ENST00000540664.1_Missense_Mutation_p.T284M|LCOR_ENST00000371103.3_Missense_Mutation_p.T284M			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	284					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GGTTCACAAACGGAGAGCGCG	0.433																																					p.T284M		Atlas-SNP	.											.	LCOR	32	.	0			c.C851T						PASS	.	C	MET/THR,MET/THR,MET/THR	1,4405		0,1,2202	68.0	70.0	70.0		851,851,851	5.2	1.0	10	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	LCOR	NM_001170765.1,NM_001170766.1,NM_032440.3	81,81,81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,	284/434,284/407,284/434	98715228	2,13004	2203	4300	6503	SO:0001583	missense	84458	exon8			CACAAACGGAGAG		CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.851C>T	chr10.hg19:g.98715228C>T	ENSP00000360138:p.Thr284Met	138.0	0.0	.		216.0	12.0	.	NM_001170766	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	ENST00000371097.4	hg19	CCDS7451.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843438	0.51057	2.27E-4	1.16E-4	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.24	5.24	0.73138	.	0.213748	0.48286	D	0.000197	T	0.59878	0.2226	N	0.08118	0	0.40355	D	0.979177	D;D	0.89917	0.999;1.0	D;D	0.70227	0.93;0.968	T	0.69558	-0.5113	9	0.59425	D	0.04	-2.5696	19.1864	0.93645	0.0:1.0:0.0:0.0	.	284;284	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	M	284	.	ENSP00000348298:T284M	T	+	2	0	LCOR	98705218	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.913000	0.48790	2.606000	0.88127	0.650000	0.86243	ACG	.	C|1.000;T|0.000	0.000	weak		0.433	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		
MUC2	4583	hgsc.bcm.edu	37	11	1093105	1093105	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr11:1093105C>G	ENST00000441003.2	+	30	4951	c.4924C>G	c.(4924-4926)Cca>Gca	p.P1642A	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.P1609A	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gaccccaaccccaacacccac	0.632																																					p.P1642A		Atlas-SNP	.											.	MUC2	614	.	0			c.C4924G						PASS	.						61.0	114.0	96.0					11																	1093105		1798	3404	5202	SO:0001583	missense	4583	exon30			CCAACCCCAACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4924C>G	chr11.hg19:g.1093105C>G	ENSP00000415183:p.Pro1642Ala	20.0	0.0	.		19.0	4.0	.	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	C	4.060	0.008863	0.07912	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13420	2.59;2.97	1.75	0.768	0.18487	.	51.722200	0.00166	U	0.000001	T	0.04048	0.0113	.	.	.	0.09310	N	1	P	0.37663	0.604	B	0.21546	0.035	T	0.28332	-1.0047	9	0.06099	T	0.92	.	4.0341	0.09722	0.0:0.7604:0.0:0.2396	.	1642	E7EUV1	.	A	1642;1609	ENSP00000415183:P1642A;ENSP00000351956:P1609A	ENSP00000351956:P1609A	P	+	1	0	MUC2	1083105	0.000000	0.05858	0.011000	0.14972	0.183000	0.23260	-0.982000	0.03762	0.104000	0.17725	0.121000	0.15741	CCA	.	.	.	none		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CAND1	55832	hgsc.bcm.edu	37	12	67675700	67675700	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr12:67675700A>G	ENST00000545606.1	+	2	516	c.79A>G	c.(79-81)Aca>Gca	p.T27A		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	27					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GTTTATGGCTACAAATGATTT	0.269																																					p.T27A		Atlas-SNP	.											.	CAND1	100	.	0			c.A79G						PASS	.						56.0	57.0	57.0					12																	67675700		2203	4300	6503	SO:0001583	missense	55832	exon2			ATGGCTACAAATG		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.79A>G	chr12.hg19:g.67675700A>G	ENSP00000442318:p.Thr27Ala	51.0	0.0	.		69.0	20.0	.	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043235	0.75732	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540525	T;T	0.61392	0.11;0.11	5.88	5.88	0.94601	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	M	0.71871	2.18	0.80722	D	1	B	0.20988	0.05	B	0.25291	0.059	T	0.55573	-0.8120	9	.	.	.	-14.6611	15.9527	0.79855	1.0:0.0:0.0:0.0	.	27	Q86VP6	CAND1_HUMAN	A	27;27;3	ENSP00000442318:T27A;ENSP00000437594:T3A	.	T	+	1	0	CAND1	65961967	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.108000	0.94275	2.243000	0.73865	0.533000	0.62120	ACA	.	.	.	none		0.269	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
PHLDA1	22822	hgsc.bcm.edu	37	12	76424606	76424606	+	Nonsense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr12:76424606G>A	ENST00000266671.5	-	1	3106	c.916C>T	c.(916-918)Cag>Tag	p.Q306*	RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Nonsense_Mutation_p.Q165*|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	306					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gAGGGGGGCTGCTGCTGGACC	0.667																																					p.Q306X		Atlas-SNP	.											.	PHLDA1	39	.	0			c.C916T						PASS	.						24.0	25.0	24.0					12																	76424606		2198	4285	6483	SO:0001587	stop_gained	22822	exon1			GGGGCTGCTGCTG	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.916C>T	chr12.hg19:g.76424606G>A	ENSP00000266671:p.Gln306*	25.0	0.0	.		37.0	11.0	.	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Nonsense_Mutation	SNP	ENST00000266671.5	hg19	CCDS31861.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	54|54	21.720412|21.720412	0.99942|0.99942	.|.	.|.	ENSG00000139289|ENSG00000139289	ENST00000421361|ENST00000266671	.|.	.|.	.|.	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|0.187649	.|0.35615	.|N	.|0.003091	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.87932	.|D	.|0	.|-18.8753	11.6242|11.6242	0.51136|0.51136	0.0818:0.0:0.9182:0.0|0.0818:0.0:0.9182:0.0	.|.	.|.	.|.	.|.	.|X	-1|306	.|.	.|ENSP00000266671:Q306X	.|Q	-|-	.|1	.|0	PHLDA1|PHLDA1	74710873|74710873	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.915000|0.915000	0.54546|0.54546	3.829000|3.829000	0.55760|0.55760	2.630000|2.630000	0.89119|0.89119	0.561000|0.561000	0.74099|0.74099	.|CAG	.	.	.	none		0.667	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
HECTD4	283450	hgsc.bcm.edu	37	12	112601434	112601434	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr12:112601434A>G	ENST00000430131.2	-	73	12688	c.11543T>C	c.(11542-11544)aTc>aCc	p.I3848T	HECTD4_ENST00000550722.1_Missense_Mutation_p.I4124T|HECTD4_ENST00000377560.5_Missense_Mutation_p.I4098T|HECTD4_ENST00000549141.1_5'Flank			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3848	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGCAGGGGGATGATGGAGCC	0.647																																					p.I4136T		Atlas-SNP	.											.	.	.	.	0			c.T12407C						PASS	.						9.0	14.0	12.0					12																	112601434		1644	3264	4908	SO:0001583	missense	283450	exon74			AGGGGGATGATGG	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11543T>C	chr12.hg19:g.112601434A>G	ENSP00000404379:p.Ile3848Thr	61.0	0.0	.		83.0	5.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	A	26.3	4.724471	0.89298	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.61627	0.09;0.09;0.09	5.73	5.73	0.89815	HECT (4);	.	.	.	.	T	0.62441	0.2428	M	0.79258	2.445	0.58432	D	0.999996	P	0.34587	0.458	B	0.35413	0.202	T	0.67480	-0.5660	9	0.87932	D	0	.	16.0193	0.80468	1.0:0.0:0.0:0.0	.	3848	Q9Y4D8	K0614_HUMAN	T	4098;3848;4124;313	ENSP00000366783:I4098T;ENSP00000404379:I3848T;ENSP00000449784:I4124T	ENSP00000366783:I4098T	I	-	2	0	C12orf51	111085817	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.747000	0.91610	2.190000	0.69967	0.533000	0.62120	ATC	.	.	.	none		0.647	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
EP400	57634	hgsc.bcm.edu	37	12	132547084	132547084	+	Silent	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr12:132547084G>A	ENST00000333577.4	+	48	8389	c.8280G>A	c.(8278-8280)caG>caA	p.Q2760Q	EP400_ENST00000332482.4_Silent_p.Q2687Q|EP400_ENST00000330386.6_Silent_p.Q2643Q|EP400_ENST00000389561.2_Silent_p.Q2724Q|EP400_ENST00000389562.2_Silent_p.Q2723Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2760	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcagcaacaac	0.557																																					p.Q2724Q		Atlas-SNP	.											.	EP400	370	.	0			c.G8172A						PASS	.						30.0	33.0	32.0					12																	132547084		2203	4298	6501	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8280G>A	chr12.hg19:g.132547084G>A		78.0	0.0	.		110.0	8.0	.	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	hg19																																																																																				.	.	.	none		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
IPO4	79711	hgsc.bcm.edu	37	14	24653966	24653966	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr14:24653966G>A	ENST00000354464.6	-	16	1702	c.1526C>T	c.(1525-1527)aCg>aTg	p.T509M	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	509					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CTGGGCAGCCGTAGCTGCAGG	0.617																																					p.T509M		Atlas-SNP	.											.	IPO4	74	.	0			c.C1526T						PASS	.						20.0	24.0	22.0					14																	24653966		2069	4195	6264	SO:0001583	missense	79711	exon16			GCAGCCGTAGCTG	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1526C>T	chr14.hg19:g.24653966G>A	ENSP00000346453:p.Thr509Met	105.0	0.0	.		130.0	42.0	.	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	hg19	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101116	0.37048	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	T	0.04862	3.54	5.28	4.36	0.52297	Armadillo-like helical (1);Armadillo-type fold (1);	0.240834	0.41097	D	0.000945	T	0.06735	0.0172	L	0.42245	1.32	0.30447	N	0.775618	B	0.21753	0.06	B	0.26202	0.067	T	0.02553	-1.1142	10	0.49607	T	0.09	-1.6031	7.7196	0.28725	0.0:0.1584:0.5713:0.2703	.	509	Q8TEX9	IPO4_HUMAN	M	509;185	ENSP00000346453:T509M	ENSP00000346453:T509M	T	-	2	0	IPO4	23723806	0.995000	0.38212	0.990000	0.47175	0.527000	0.34593	2.514000	0.45503	2.764000	0.94973	0.558000	0.71614	ACG	.	.	.	none		0.617	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
FLVCR2	55640	hgsc.bcm.edu	37	14	76107632	76107632	+	Silent	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr14:76107632C>T	ENST00000238667.4	+	8	1805	c.1449C>T	c.(1447-1449)ctC>ctT	p.L483L	FLVCR2_ENST00000553587.1_Intron|FLVCR2_ENST00000556856.1_Intron|FLVCR2_ENST00000555027.1_Silent_p.L198L|FLVCR2_ENST00000539311.1_Silent_p.L278L|FLVCR2_ENST00000556241.1_Intron	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	483					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		GAGCAGCCCTCACTGGTGAGT	0.527																																					p.L483L		Atlas-SNP	.											.	FLVCR2	39	.	0			c.C1449T						PASS	.						95.0	82.0	86.0					14																	76107632		2203	4300	6503	SO:0001819	synonymous_variant	55640	exon8			AGCCCTCACTGGT	AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.1449C>T	chr14.hg19:g.76107632C>T		54.0	0.0	.		78.0	20.0	.	NM_017791	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Silent	SNP	ENST00000238667.4	hg19	CCDS9844.1																																																																																			.	.	.	none		0.527	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413672.1	NM_017791	
ATG2B	55102	hgsc.bcm.edu	37	14	96752216	96752216	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr14:96752216G>C	ENST00000359933.4	-	42	7006	c.6113C>G	c.(6112-6114)gCa>gGa	p.A2038G		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	2038					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TTTCACCACTGCCGGAGGAAT	0.557																																					p.A2038G		Atlas-SNP	.											.	ATG2B	169	.	0			c.C6113G						PASS	.						99.0	82.0	88.0					14																	96752216		2203	4300	6503	SO:0001583	missense	55102	exon42			ACCACTGCCGGAG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.6113C>G	chr14.hg19:g.96752216G>C	ENSP00000353010:p.Ala2038Gly	84.0	0.0	.		82.0	25.0	.	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	36	5.630816	0.96682	.	.	ENSG00000066739	ENST00000359933	T	0.12984	2.63	5.76	5.76	0.90799	Autophagy-related, C-terminal (1);	0.052478	0.85682	D	0.000000	T	0.33000	0.0848	M	0.67700	2.07	0.58432	D	0.999998	P	0.51147	0.942	P	0.54544	0.755	T	0.01235	-1.1410	10	0.87932	D	0	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	2038	Q96BY7	ATG2B_HUMAN	G	2038	ENSP00000353010:A2038G	ENSP00000353010:A2038G	A	-	2	0	ATG2B	95821969	1.000000	0.71417	0.165000	0.22776	0.954000	0.61252	9.450000	0.97607	2.713000	0.92767	0.655000	0.94253	GCA	.	.	.	none		0.557	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
FRMD5	84978	hgsc.bcm.edu	37	15	44166102	44166102	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr15:44166102C>G	ENST00000417257.1	-	14	1870	c.1694G>C	c.(1693-1695)aGc>aCc	p.S565T	FRMD5_ENST00000484674.1_Missense_Mutation_p.E411D|FRMD5_ENST00000402883.1_Intron	NM_032892.3	NP_116281.2	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5	565						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		AATGAGCAGGCTCACCACTGA	0.542																																					p.S565T		Atlas-SNP	.											.	FRMD5	45	.	0			c.G1694C						PASS	.						46.0	47.0	47.0					15																	44166102		2198	4298	6496	SO:0001583	missense	84978	exon14			AGCAGGCTCACCA	BC007796	CCDS10107.2, CCDS73715.1, CCDS73716.1	15q15.3	2005-08-09			ENSG00000171877	ENSG00000171877			28214	protein-coding gene	gene with protein product							Standard	XM_005254729		Approved	MGC14161	uc001ztl.3	Q7Z6J6	OTTHUMG00000060475	ENST00000417257.1:c.1694G>C	chr15.hg19:g.44166102C>G	ENSP00000403067:p.Ser565Thr	86.0	0.0	.		103.0	41.0	.	NM_032892	Q8NBG4	Missense_Mutation	SNP	ENST00000417257.1	hg19	CCDS10107.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.92|12.92	2.082707|2.082707	0.36758|0.36758	.|.	.|.	ENSG00000171877|ENSG00000171877	ENST00000449926|ENST00000417257	D|D	0.84589|0.83163	-1.87|-1.69	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.247666	.|0.44688	.|D	.|0.000430	T|T	0.76608|0.76608	0.4011|0.4011	L|L	0.36672|0.36672	1.1|1.1	0.27650|0.27650	N|N	0.947438|0.947438	.|P;B	.|0.35272	.|0.493;0.361	.|B;B	.|0.32805	.|0.153;0.073	T|T	0.70288|0.70288	-0.4913|-0.4913	7|10	0.87932|0.34782	D|T	0|0.22	.|.	17.6986|17.6986	0.88289|0.88289	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|550;565	.|Q7Z6J6-2;Q7Z6J6	.|.;FRMD5_HUMAN	D|T	471|565	ENSP00000399684:E471D|ENSP00000403067:S565T	ENSP00000399684:E471D|ENSP00000403067:S565T	E|S	-|-	3|2	2|0	FRMD5|FRMD5	41953394|41953394	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.902000|2.902000	0.48703|0.48703	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GAG|AGC	.	.	.	none		0.542	FRMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133879.1	NM_032892	
MAN2C1	4123	hgsc.bcm.edu	37	15	75653705	75653705	+	Nonsense_Mutation	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr15:75653705C>T	ENST00000267978.5	-	11	1282	c.1236G>A	c.(1234-1236)tgG>tgA	p.W412*	MAN2C1_ENST00000563622.1_Nonsense_Mutation_p.W313*|MAN2C1_ENST00000565683.1_Nonsense_Mutation_p.W412*|MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000569482.1_Nonsense_Mutation_p.W412*	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	412					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CCAGGCCCTCCCAGAAAAATG	0.617																																					p.W412X		Atlas-SNP	.											.	MAN2C1	76	.	0			c.G1236A						PASS	.						28.0	29.0	29.0					15																	75653705		2179	4277	6456	SO:0001587	stop_gained	4123	exon11			GCCCTCCCAGAAA	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1236G>A	chr15.hg19:g.75653705C>T	ENSP00000267978:p.Trp412*	80.0	0.0	.		80.0	34.0	.	NM_001256494	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Nonsense_Mutation	SNP	ENST00000267978.5	hg19	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	C	36	5.695842	0.96802	.	.	ENSG00000140400	ENST00000267978	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.9758	17.5661	0.87920	0.0:1.0:0.0:0.0	.	.	.	.	X	412	.	ENSP00000267978:W412X	W	-	3	0	MAN2C1	73440758	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.586000	0.53950	2.491000	0.84063	0.561000	0.74099	TGG	.	.	.	none		0.617	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1		
KRT27	342574	hgsc.bcm.edu	37	17	38935785	38935785	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr17:38935785A>T	ENST00000301656.3	-	5	981	c.941T>A	c.(940-942)cTt>cAt	p.L314H	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TTCAATCTCAAGGGTTTGAAG	0.453																																					p.L314H		Atlas-SNP	.											.	KRT27	41	.	0			c.T941A						PASS	.						72.0	66.0	68.0					17																	38935785		2203	4300	6503	SO:0001583	missense	342574	exon5			ATCTCAAGGGTTT	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.941T>A	chr17.hg19:g.38935785A>T	ENSP00000301656:p.Leu314His	123.0	0.0	.		182.0	37.0	.	NM_181537		Missense_Mutation	SNP	ENST00000301656.3	hg19	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.632625	0.87660	.	.	ENSG00000171446	ENST00000301656	D	0.91464	-2.85	5.2	5.2	0.72013	Filament (1);	0.000000	0.43919	D	0.000520	D	0.96364	0.8814	M	0.93594	3.435	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	D	0.97365	0.9972	10	0.87932	D	0	.	14.5274	0.67897	1.0:0.0:0.0:0.0	.	314	Q7Z3Y8	K1C27_HUMAN	H	314	ENSP00000301656:L314H	ENSP00000301656:L314H	L	-	2	0	KRT27	36189311	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.072000	0.76777	2.092000	0.63282	0.482000	0.46254	CTT	.	.	.	none		0.453	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
KRTAP17-1	83902	hgsc.bcm.edu	37	17	39471774	39471774	+	Silent	SNP	G	G	A	rs368577794|rs386797077		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr17:39471774G>A	ENST00000334202.3	-	1	173	c.129C>T	c.(127-129)tgC>tgT	p.C43C		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	43						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			cagagcccccgcagccagagc	0.692													A|||	1	0.000199681	0.0008	0.0	5008	,	,		9728	0.0		0.0	False		,,,				2504	0.0				p.C43C		Atlas-SNP	.											KRTAP17-1,colon,carcinoma,0,3	KRTAP17-1	14	.	0			c.C129T						PASS	.						9.0	13.0	12.0					17																	39471774		2166	4238	6404	SO:0001819	synonymous_variant	83902	exon1			GCCCCCGCAGCCA	AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.129C>T	chr17.hg19:g.39471774G>A		34.0	0.0	.		70.0	8.0	.	NM_031964		Silent	SNP	ENST00000334202.3	hg19	CCDS11387.1																																																																																			.	.	.	weak		0.692	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257296.1		
CDR2L	30850	hgsc.bcm.edu	37	17	72998179	72998179	+	Missense_Mutation	SNP	G	G	A	rs139957978		TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr17:72998179G>A	ENST00000337231.5	+	4	774	c.362G>A	c.(361-363)cGc>cAc	p.R121H		NM_014603.2	NP_055418.2	Q86X02	CDR2L_HUMAN	cerebellar degeneration-related protein 2-like	121												all_lung(278;0.226)					ACCATTGAGCGCCTCCAGGCT	0.662																																					p.R121H		Atlas-SNP	.											.	.	.	.	0			c.G362A						PASS	.	G	HIS/ARG	0,4406		0,0,2203	29.0	29.0	29.0		362	5.2	1.0	17	dbSNP_134	29	1,8583		0,1,4291	no	missense	CDR2L	NM_014603.2	29	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	121/466	72998179	1,12989	2203	4292	6495	SO:0001583	missense	30850	exon4			TTGAGCGCCTCCA		CCDS11710.2	17q25.1	2006-03-28			ENSG00000109089	ENSG00000109089			29999	protein-coding gene	gene with protein product	"""paraneoplastic antigen"""						Standard	NM_014603		Approved	HUMPPA	uc002jml.4	Q86X02	OTTHUMG00000150435	ENST00000337231.5:c.362G>A	chr17.hg19:g.72998179G>A	ENSP00000336587:p.Arg121His	95.0	0.0	.		139.0	30.0	.	NM_014603	B4DFA7|Q15175	Missense_Mutation	SNP	ENST00000337231.5	hg19	CCDS11710.2	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126558	0.56721	0.0	1.16E-4	ENSG00000109089	ENST00000337231	T	0.43688	0.94	5.22	5.22	0.72569	.	0.419993	0.28414	N	0.015421	T	0.42675	0.1213	L	0.44542	1.39	0.29647	N	0.844297	D	0.61697	0.99	P	0.44732	0.459	T	0.42932	-0.9422	10	0.44086	T	0.13	-14.3941	19.155	0.93506	0.0:0.0:1.0:0.0	.	121	Q86X02	CDR2L_HUMAN	H	121	ENSP00000336587:R121H	ENSP00000336587:R121H	R	+	2	0	CDR2L	70509774	1.000000	0.71417	1.000000	0.80357	0.575000	0.36095	3.159000	0.50731	2.609000	0.88269	0.563000	0.77884	CGC	.	G|1.000;A|0.000	0.000	weak		0.662	CDR2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318080.1	NM_014603	
TLE6	79816	hgsc.bcm.edu	37	19	2987356	2987356	+	Nonsense_Mutation	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr19:2987356C>T	ENST00000246112.4	+	8	745	c.544C>T	c.(544-546)Cag>Tag	p.Q182*	TLE6_ENST00000478073.2_3'UTR|TLE6_ENST00000452088.1_Nonsense_Mutation_p.Q59*	NM_001143986.1	NP_001137458.1	Q9H808	TLE6_HUMAN	transducin-like enhancer of split 6	182					regulation of transcription, DNA-templated (GO:0006355)	cell cortex (GO:0005938)|nucleus (GO:0005634)|protein complex (GO:0043234)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGACAGAGCAGGCACCAGG	0.642																																					p.Q182X		Atlas-SNP	.											.	TLE6	68	.	0			c.C544T						PASS	.						91.0	83.0	86.0					19																	2987356		2203	4300	6503	SO:0001587	stop_gained	79816	exon8			ACAGAGCAGGCAC	AK024071	CCDS12100.1, CCDS45910.1	19p13.3	2014-03-07	2014-03-07		ENSG00000104953	ENSG00000104953		"""WD repeat domain containing"""	30788	protein-coding gene	gene with protein product		612399	"""transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)"""			11486032	Standard	NM_024760		Approved	FLJ14009, GRG6	uc002lwt.2	Q9H808	OTTHUMG00000156793	ENST00000246112.4:c.544C>T	chr19.hg19:g.2987356C>T	ENSP00000246112:p.Gln182*	56.0	0.0	.		41.0	13.0	.	NM_001143986	J3KMZ1	Nonsense_Mutation	SNP	ENST00000246112.4	hg19	CCDS45910.1	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848293	0.71603	.	.	ENSG00000104953	ENST00000246112;ENST00000452088;ENST00000441927	.	.	.	2.21	1.17	0.20885	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	4.533	0.12015	0.0:0.8078:0.0:0.1922	.	.	.	.	X	182;59;59	.	ENSP00000246112:Q182X	Q	+	1	0	TLE6	2938356	0.000000	0.05858	0.004000	0.12327	0.231000	0.25187	-0.030000	0.12308	0.493000	0.27837	0.555000	0.69702	CAG	.	.	.	none		0.642	TLE6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345996.3	NM_024760	
ELOF1	84337	hgsc.bcm.edu	37	19	11664884	11664884	+	Silent	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr19:11664884G>A	ENST00000252445.3	-	3	192	c.129C>T	c.(127-129)cgC>cgT	p.R43R	ELOF1_ENST00000591674.1_Silent_p.R50R|ELOF1_ENST00000590700.1_Silent_p.R43R|ELOF1_ENST00000586120.1_Silent_p.R43R|ELOF1_ENST00000586683.1_Silent_p.R43R|ELOF1_ENST00000591912.1_Silent_p.R43R|ELOF1_ENST00000589171.1_Silent_p.R43R|ELOF1_ENST00000587806.1_Silent_p.R64R	NM_032377.3	NP_115753.1	P60002	ELOF1_HUMAN	elongation factor 1 homolog (S. cerevisiae)	43					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(3)|lung(2)	5						CTCCGGTGTTGCGGGCACGGT	0.587																																					p.R43R		Atlas-SNP	.											.	ELOF1	10	.	0			c.C129T						PASS	.						126.0	118.0	121.0					19																	11664884		2203	4300	6503	SO:0001819	synonymous_variant	84337	exon3			GGTGTTGCGGGCA	AK001171	CCDS12264.1	19p13.2	2008-02-05	2006-02-13			ENSG00000130165			28691	protein-coding gene	gene with protein product			"""elongation factor 1 homolog (ELF1, S. cerevisiae)"""			12477932	Standard	NM_032377		Approved	MGC4549, ELF1	uc002mse.1	P60002		ENST00000252445.3:c.129C>T	chr19.hg19:g.11664884G>A		132.0	0.0	.		120.0	44.0	.	NM_032377	Q8R1J7|Q96II4	Silent	SNP	ENST00000252445.3	hg19	CCDS12264.1																																																																																			.	.	.	none		0.587	ELOF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458868.1	NM_032377	
BPIFB3	359710	hgsc.bcm.edu	37	20	31644491	31644491	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr20:31644491G>A	ENST00000375494.3	+	2	268	c.268G>A	c.(268-270)Gag>Aag	p.E90K	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	90	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGGCGTTGTCGAGGAGCTCTC	0.582																																					p.E90K		Atlas-SNP	.											.	.	.	.	0			c.G268A						PASS	.						89.0	83.0	85.0					20																	31644491		2203	4300	6503	SO:0001583	missense	359710	exon2			GTTGTCGAGGAGC	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.268G>A	chr20.hg19:g.31644491G>A	ENSP00000364643:p.Glu90Lys	37.0	0.0	.		48.0	17.0	.	NM_182658	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	hg19	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	G	0.055	-1.238200	0.01493	.	.	ENSG00000186190	ENST00000375494	T	0.04360	3.64	4.5	-5.52	0.02560	.	0.754568	0.11974	N	0.511404	T	0.03305	0.0096	L	0.51422	1.61	0.09310	N	1	B	0.21309	0.054	B	0.17979	0.02	T	0.50329	-0.8841	10	0.02654	T	1	-7.8418	7.2066	0.25911	0.247:0.4926:0.2604:0.0	.	90	P59826	BPIB3_HUMAN	K	90	ENSP00000364643:E90K	ENSP00000364643:E90K	E	+	1	0	BPIFB3	31108152	0.003000	0.15002	0.000000	0.03702	0.017000	0.09413	-0.080000	0.11339	-0.746000	0.04766	-1.099000	0.02127	GAG	.	.	.	none		0.582	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
CCT8L2	150160	hgsc.bcm.edu	37	22	17072541	17072541	+	Silent	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr22:17072541G>A	ENST00000359963.3	-	1	1159	c.900C>T	c.(898-900)gaC>gaT	p.D300D		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	300					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GGGTCTCCTCGTCGACCTCCC	0.493																																					p.D300D		Atlas-SNP	.											CCT8L2,right_upper_lobe,carcinoma,0,1	CCT8L2	150	.	0			c.C900T						PASS	.						194.0	173.0	180.0					22																	17072541		2203	4300	6503	SO:0001819	synonymous_variant	150160	exon1			CTCCTCGTCGACC	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.900C>T	chr22.hg19:g.17072541G>A		157.0	0.0	.		78.0	40.0	.	NM_014406	A4QPH3|Q9UJS3	Silent	SNP	ENST00000359963.3	hg19	CCDS13738.1																																																																																			.	.	.	none		0.493	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
HUWE1	10075	hgsc.bcm.edu	37	X	53616526	53616526	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chrX:53616526A>T	ENST00000342160.3	-	35	4899	c.4442T>A	c.(4441-4443)cTg>cAg	p.L1481Q	HUWE1_ENST00000218328.8_Missense_Mutation_p.L1481Q|HUWE1_ENST00000262854.6_Missense_Mutation_p.L1481Q			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1481					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TACTTGCTTCAGAATCATGTC	0.453																																					p.L1481Q		Atlas-SNP	.											.	HUWE1	724	.	0			c.T4442A						PASS	.						188.0	164.0	172.0					X																	53616526		2203	4300	6503	SO:0001583	missense	10075	exon36			TGCTTCAGAATCA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.4442T>A	chrX.hg19:g.53616526A>T	ENSP00000340648:p.Leu1481Gln	65.0	0.0	.		61.0	21.0	.	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.319177	0.81469	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.60548	0.43;0.43;0.18	5.74	5.74	0.90152	Armadillo-like helical (1);	0.000000	0.64402	D	0.000006	T	0.66771	0.2823	L	0.34521	1.04	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.70342	-0.4898	10	0.87932	D	0	.	13.9311	0.63996	1.0:0.0:0.0:0.0	.	1481;1481	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	Q	1481	ENSP00000340648:L1481Q;ENSP00000262854:L1481Q;ENSP00000218328:L1481Q	ENSP00000218328:L1481Q	L	-	2	0	HUWE1	53633251	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.977000	0.93446	1.935000	0.56089	0.486000	0.48141	CTG	.	.	.	none		0.453	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
AR	367	hgsc.bcm.edu	37	X	66766365	66766365	+	Silent	SNP	C	C	T			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chrX:66766365C>T	ENST00000374690.3	+	1	1901	c.1377C>T	c.(1375-1377)ggC>ggT	p.G459G	AR_ENST00000504326.1_Silent_p.G459G|AR_ENST00000396044.3_Silent_p.G459G|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	457	Modulating.|Poly-Gly.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gtggcggcggcggcggcggcg	0.756									Androgen Insensitivity Syndrome																												p.G459G		Atlas-SNP	.											.	AR	249	.	0			c.C1377T						PASS	.																																			SO:0001819	synonymous_variant	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CGGCGGCGGCGGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1377C>T	chrX.hg19:g.66766365C>T		256.0	0.0	.		181.0	20.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.	.	none		0.756	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
PGAM4	441531	hgsc.bcm.edu	37	X	77225038	77225038	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chrX:77225038G>A	ENST00000458128.1	-	1	97	c.98C>T	c.(97-99)gCg>gTg	p.A33V	ATP7A_ENST00000350425.4_Intron|ATP7A_ENST00000341514.6_Intron|ATP7A_ENST00000343533.5_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	33					glycolytic process (GO:0006096)|positive regulation of sperm motility (GO:1902093)	extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			endometrium(2)|lung(4)	6						CTCGTGGCCCGCCGGGCTCAG	0.637																																					p.A33V		Atlas-SNP	.											.	PGAM4	28	.	0			c.C98T						PASS	.						55.0	57.0	56.0					X																	77225038		2202	4294	6496	SO:0001583	missense	441531	exon1			TGGCCCGCCGGGC	AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784			21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""			11961099, 9370262	Standard	NM_001029891		Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.98C>T	chrX.hg19:g.77225038G>A	ENSP00000412189:p.Ala33Val	158.0	0.0	.		154.0	51.0	.	NM_001029891	Q5JPN2|Q8NI24|Q8NI25|Q8NI26	Missense_Mutation	SNP	ENST00000458128.1	hg19	CCDS35338.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761398	0.31228	.	.	ENSG00000226784	ENST00000458128	T	0.71579	-0.58	0.119	0.119	0.14685	Histidine phosphatase superfamily, clade-1 (2);	0.066185	0.64402	U	0.000014	T	0.40498	0.1119	N	0.05078	-0.115	0.28813	N	0.898138	B	0.06786	0.001	B	0.06405	0.002	T	0.20240	-1.0281	9	.	.	.	-18.5376	6.135	0.20227	4.0E-4:0.0:0.9996:0.0	.	33	Q8N0Y7	PGAM4_HUMAN	V	33	ENSP00000412189:A33V	.	A	-	2	0	PGAM4	77111694	0.000000	0.05858	0.426000	0.26672	0.444000	0.32077	-0.239000	0.08965	0.260000	0.21731	0.264000	0.19307	GCG	.	.	.	none		0.637	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128371.2	NM_001029891	
NRK	203447	hgsc.bcm.edu	37	X	105153848	105153848	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chrX:105153848G>C	ENST00000243300.9	+	13	2518	c.2215G>C	c.(2215-2217)Gag>Cag	p.E739Q	NRK_ENST00000428173.2_Missense_Mutation_p.E740Q	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	739					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						TAATCAGCATGAGGAAGAATT	0.393										HNSCC(51;0.14)																											p.E739Q		Atlas-SNP	.											.	NRK	321	.	0			c.G2215C						PASS	.						13.0	11.0	12.0					X																	105153848		1840	4056	5896	SO:0001583	missense	203447	exon13			CAGCATGAGGAAG	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2215G>C	chrX.hg19:g.105153848G>C	ENSP00000434830:p.Glu739Gln	390.0	0.0	.		386.0	119.0	.	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	hg19		.	.	.	.	.	.	.	.	.	.	G	12.75	2.032692	0.35893	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.79141	-1.23;-1.24	4.27	4.27	0.50696	.	0.000000	0.49305	D	0.000143	T	0.80226	0.4584	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.986	T	0.81656	-0.0834	10	0.87932	D	0	.	10.9826	0.47504	0.0:0.0:1.0:0.0	.	407;739	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	Q	739;740	ENSP00000434830:E739Q;ENSP00000438378:E740Q	ENSP00000434830:E739Q	E	+	1	0	NRK	105040504	0.998000	0.40836	0.897000	0.35233	0.099000	0.18886	3.621000	0.54210	2.358000	0.79984	0.600000	0.82982	GAG	.	.	.	none		0.393	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94668545	94668554	+	Splice_Site	DEL	CAAGTAGAGG	CAAGTAGAGG	-			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	CAAGTAGAGG	CAAGTAGAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr1:94668545_94668554delCAAGTAGAGG	ENST00000260526.6	-	10	1056_1065	c.874_883delCCTCTACTTG	c.(874-885)cctctacttgga>ga	p.PLLG292fs	ARHGAP29_ENST00000370217.3_Splice_Site_p.PLLG292fs	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	292					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTTTTCCTTCCAAGTAGAGGCTGTGAAAGG	0.286																																					p.292_295del		Atlas-INDEL	.											.	ARHGAP29	132	.	0			c.875_884del						PASS	.																																			SO:0001630	splice_region_variant	9411	exon10			.		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.874-1CCTCTACTTG>-	chr1.hg19:g.94668545_94668554delCAAGTAGAGG		71.0	0.0	0		77.0	11.0	0.142857	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Frame_Shift_Del	DEL	ENST00000260526.6	hg19	CCDS748.1																																																																																			.	.	.	none		0.286	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	Frame_Shift_Del
IVNS1ABP	10625	hgsc.bcm.edu	37	1	185267408	185267411	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	ACAA	ACAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr1:185267408_185267411delACAA	ENST00000367498.3	-	15	2307_2310	c.1685_1688delTTGT	c.(1684-1689)tttgtafs	p.FV562fs	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Frame_Shift_Del_p.FV344fs	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	562					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.F562fs*26(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						GCCACCACATACAAACAGTTTTCC	0.373																																					p.562_563del		Atlas-Indel,Pindel	.											.	IVNS1ABP	80	.	1	Deletion - Frameshift(1)	central_nervous_system(1)	c.1686_1689del						PASS	.																																			SO:0001589	frameshift_variant	10625	exon15			.	AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1685_1688delTTGT	chr1.hg19:g.185267408_185267411delACAA	ENSP00000356468:p.Phe562fs	88.0	0.0	0		104.0	30.0	0.288462	NM_006469	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Frame_Shift_Del	DEL	ENST00000367498.3	hg19	CCDS1368.1																																																																																			.	.	.	none		0.373	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469	
BICC1	80114	hgsc.bcm.edu	37	10	60566346	60566347	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chr10:60566346_60566347insTT	ENST00000373886.3	+	16	2188_2189	c.2184_2185insTT	c.(2185-2187)tttfs	p.F729fs	BICC1_ENST00000263103.1_Frame_Shift_Ins_p.F355fs	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	729					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ATTTTCAGGCATTTGACTATGA	0.342																																					p.A728fs		Atlas-Indel,Pindel	.											.	BICC1	121	.	0			c.2184_2185insTT						PASS	.																																			SO:0001589	frameshift_variant	80114	exon16			.	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2185_2186dupTT	chr10.hg19:g.60566347_60566348dupTT	ENSP00000362993:p.Phe729fs	148.0	0.0	0		196.0	43.0	0.219388	NM_001080512		Frame_Shift_Ins	INS	ENST00000373886.3	hg19	CCDS31206.1																																																																																			.	.	.	none		0.342	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
ATP2B3	492	hgsc.bcm.edu	37	X	152826209	152826211	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-F9-A8NY-01A-11D-A35Z-10	TCGA-F9-A8NY-10A-01D-A35Z-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	af2f02ad-e74d-4e56-98c2-b25edf27b998	49bd4b7d-d8c0-4ce3-adcf-81f81c37b6fd	g.chrX:152826209_152826211delTCT	ENST00000349466.2	+	18	3241_3243	c.2915_2917delTCT	c.(2914-2919)atcttc>atc	p.F973del	ATP2B3_ENST00000370181.2_In_Frame_Del_p.F959del|ATP2B3_ENST00000359149.3_In_Frame_Del_p.F973del|ATP2B3_ENST00000263519.4_In_Frame_Del_p.F973del|ATP2B3_ENST00000460549.1_3'UTR|ATP2B3_ENST00000393842.1_In_Frame_Del_p.F959del|ATP2B3_ENST00000370186.1_In_Frame_Del_p.F959del			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	973					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TACACCATCATCTTCAACACGTT	0.557																																					p.972_972del		Atlas-Indel,Pindel	.											.	ATP2B3	552	.	0			c.2914_2916del						PASS	.																																			SO:0001651	inframe_deletion	492	exon17			.	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2915_2917delTCT	chrX.hg19:g.152826209_152826211delTCT	ENSP00000343886:p.Phe973del	143.0	0.0	0		129.0	50.0	0.387597	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	In_Frame_Del	DEL	ENST00000349466.2	hg19	CCDS35440.1																																																																																			.	.	.	none		0.557	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
