#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSPG2	3339	hgsc.bcm.edu	37	1	22166446	22166446	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:22166446G>A	ENST00000374695.3	-	72	9657	c.9578C>T	c.(9577-9579)aCa>aTa	p.T3193I		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3193	Ig-like C2-type 17.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CTTCTGTGCTGTGCCTAGTGC	0.572																																					p.T3193I		Atlas-SNP	.											.	HSPG2	311	.	0			c.C9578T						PASS	.						193.0	180.0	184.0					1																	22166446		2203	4300	6503	SO:0001583	missense	3339	exon72			TGTGCTGTGCCTA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9578C>T	chr1.hg19:g.22166446G>A	ENSP00000363827:p.Thr3193Ile	92.0	0.0	.		117.0	25.0	.	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435771	0.25813	.	.	ENSG00000142798	ENST00000374695	T	0.68025	-0.3	5.69	2.83	0.33086	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.191721	0.25789	N	0.028294	T	0.57140	0.2033	L	0.48260	1.515	0.28557	N	0.911322	B;P	0.35174	0.004;0.488	B;B	0.37198	0.027;0.243	T	0.48614	-0.9020	10	0.26408	T	0.33	.	10.077	0.42366	0.2205:0.0:0.7795:0.0	.	1133;3193	Q59EG0;P98160	.;PGBM_HUMAN	I	3193	ENSP00000363827:T3193I	ENSP00000363827:T3193I	T	-	2	0	HSPG2	22039033	0.995000	0.38212	0.979000	0.43373	0.026000	0.11368	2.062000	0.41413	0.351000	0.24027	-0.251000	0.11542	ACA	.	.	.	none		0.572	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
SRRM1	10250	hgsc.bcm.edu	37	1	24972473	24972473	+	Splice_Site	SNP	A	A	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:24972473A>G	ENST00000323848.9	+	2	336		c.e2-1		SRRM1_ENST00000374389.4_Splice_Site|SRRM1_ENST00000537199.1_5'Flank|SRRM1_ENST00000479034.1_Splice_Site|SRRM1_ENST00000447431.2_Splice_Site	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CTCTTCCTGCAGGGAACAAGT	0.383																																					.	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.22-2A>G						PASS	.						116.0	117.0	116.0					1																	24972473		2203	4300	6503	SO:0001630	splice_region_variant	10250	exon2			TCCTGCAGGGAAC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.22-1A>G	chr1.hg19:g.24972473A>G		65.0	0.0	.		103.0	23.0	.	NM_005839	O60585|Q5VVN4	Splice_Site	SNP	ENST00000323848.9	hg19	CCDS255.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.815395	0.70912	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2129	0.73241	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SRRM1	24845060	1.000000	0.71417	0.984000	0.44739	0.778000	0.44026	9.261000	0.95576	2.062000	0.61559	0.482000	0.46254	.	.	.	.	none		0.383	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	Intron
DLGAP3	58512	hgsc.bcm.edu	37	1	35350632	35350632	+	Silent	SNP	G	G	A	rs143986097		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:35350632G>A	ENST00000373347.1	-	8	2215	c.1947C>T	c.(1945-1947)aaC>aaT	p.N649N	DLGAP3_ENST00000235180.4_Silent_p.N649N			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	649					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				TCCGGCTCCTGTTCTCGGTGT	0.612																																					p.N649N		Atlas-SNP	.											.	DLGAP3	107	.	0			c.C1947T						PASS	.						102.0	98.0	100.0					1																	35350632		2203	4300	6503	SO:0001819	synonymous_variant	58512	exon6			GCTCCTGTTCTCG	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1947C>T	chr1.hg19:g.35350632G>A		79.0	0.0	.		119.0	15.0	.	NM_001080418	Q5TDD5|Q9H3X7	Silent	SNP	ENST00000373347.1	hg19	CCDS30670.1																																																																																			.	G|1.000;C|0.000	.	alt		0.612	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011554.1	NM_021234	
KCNQ4	9132	hgsc.bcm.edu	37	1	41285146	41285146	+	Splice_Site	SNP	T	T	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:41285146T>G	ENST00000347132.5	+	5	916		c.e5+2		KCNQ4_ENST00000509682.2_Splice_Site|KCNQ4_ENST00000506017.1_Splice_Site	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4						inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	TGGGGGACGGTGCGTGAGGGT	0.627																																					.		Atlas-SNP	.											.	KCNQ4	58	.	0			c.834+2T>G						PASS	.						105.0	94.0	98.0					1																	41285146		2203	4300	6503	SO:0001630	splice_region_variant	9132	exon5			GGACGGTGCGTGA	AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.834+2T>G	chr1.hg19:g.41285146T>G		81.0	0.0	.		102.0	20.0	.	NM_172163	O96025	Splice_Site	SNP	ENST00000347132.5	hg19	CCDS456.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.604351	0.87157	.	.	ENSG00000117013	ENST00000347132;ENST00000509682;ENST00000443478	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.801	0.57586	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNQ4	41057733	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	1.907000	0.55213	0.460000	0.39030	.	.	.	.	none		0.627	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000020812.1	NM_004700	Intron
TBX15	6913	hgsc.bcm.edu	37	1	119427569	119427569	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:119427569G>A	ENST00000369429.3	-	8	1604	c.1595C>T	c.(1594-1596)cCg>cTg	p.P532L	TBX15_ENST00000207157.3_Missense_Mutation_p.P426L			Q96SF7	TBX15_HUMAN	T-box 15	532					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CAGTTTTTCCGGGCTTGCAGC	0.537																																					p.P426L		Atlas-SNP	.											.	TBX15	95	.	0			c.C1277T						PASS	.						92.0	85.0	87.0					1																	119427569		2203	4300	6503	SO:0001583	missense	6913	exon8			TTTTCCGGGCTTG	AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1595C>T	chr1.hg19:g.119427569G>A	ENSP00000358437:p.Pro532Leu	138.0	0.0	.		202.0	46.0	.	NM_152380	Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	ENST00000369429.3	hg19		.	.	.	.	.	.	.	.	.	.	G	22.0	4.237026	0.79800	.	.	ENSG00000092607	ENST00000344218;ENST00000207157;ENST00000369429;ENST00000449873	D;D;D	0.92099	-2.92;-2.97;-1.78	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000015	D	0.93223	0.7841	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.981;0.999	D	0.93973	0.7251	10	0.87932	D	0	.	19.143	0.93452	0.0:0.0:1.0:0.0	.	329;532	E9PCG3;Q96SF7	.;TBX15_HUMAN	L	329;426;532;260	ENSP00000207157:P426L;ENSP00000358437:P532L;ENSP00000398625:P260L	ENSP00000207157:P426L	P	-	2	0	TBX15	119229092	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.080000	0.94040	2.764000	0.94973	0.555000	0.69702	CCG	.	.	.	none		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000034351.1	NM_152380	
C2CD4D	100191040	hgsc.bcm.edu	37	1	151810577	151810577	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:151810577G>A	ENST00000454109.1	-	2	1474	c.889C>T	c.(889-891)Ccc>Tcc	p.P297S		NM_001136003.1	NP_001129475.1	B7Z1M9	C2D4D_HUMAN	C2 calcium-dependent domain containing 4D	297	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.									skin(1)	1						AGGTCCGGGGGGCCGAGCCCG	0.697																																					p.P297S		Atlas-SNP	.											.	C2CD4D	3	.	0			c.C889T						PASS	.						19.0	28.0	25.0					1																	151810577		691	1591	2282	SO:0001583	missense	100191040	exon2			CCGGGGGGCCGAG	BC171843	CCDS44224.1	1q21.3	2012-07-02			ENSG00000225556	ENSG00000225556			37210	protein-coding gene	gene with protein product	"""family with sequence similarity 148, member D"""						Standard	NM_001136003		Approved	FAM148D	uc010pdq.1	B7Z1M9	OTTHUMG00000167218	ENST00000454109.1:c.889C>T	chr1.hg19:g.151810577G>A	ENSP00000389554:p.Pro297Ser	447.0	0.0	.		494.0	96.0	.	NM_001136003	B2RXG8	Missense_Mutation	SNP	ENST00000454109.1	hg19	CCDS44224.1	.	.	.	.	.	.	.	.	.	.	G	4.441	0.081542	0.08533	.	.	ENSG00000225556	ENST00000454109	T	0.68624	-0.34	3.25	2.32	0.28847	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.23249	0.0562	N	0.25485	0.75	0.09310	N	1	B	0.15930	0.015	B	0.15484	0.013	T	0.17471	-1.0368	9	0.15066	T	0.55	.	3.737	0.08514	0.1341:0.0:0.6253:0.2406	.	297	B7Z1M9	C2D4D_HUMAN	S	297	ENSP00000389554:P297S	ENSP00000389554:P297S	P	-	1	0	C2CD4D	150077201	0.642000	0.27260	0.048000	0.18961	0.250000	0.25880	0.890000	0.28295	0.562000	0.29204	0.455000	0.32223	CCC	.	.	.	none		0.697	C2CD4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393778.1	NM_001136003	
LHX4	89884	hgsc.bcm.edu	37	1	180240574	180240575	+	Missense_Mutation	DNP	AC	AC	GT			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:180240574_180240575AC>GT	ENST00000263726.2	+	4	755_756	c.511_512AC>GT	c.(511-513)ACa>GTa	p.T171V	RP5-1180C10.2_ENST00000440959.2_RNA|RP5-1180C10.2_ENST00000415414.1_RNA	NM_033343.3	NP_203129.1	Q969G2	LHX4_HUMAN	LIM homeobox 4	171					medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)	16						GCAGCTGGAGACATTAAAGAAT	0.569																																					p.T171A|p.T171I		Atlas-SNP	.											.	LHX4	36	.	0			c.A511G|c.C512T						PASS	.																																			SO:0001583	missense	89884	exon4			CTGGAGACATTAA|TGGAGACATTAAA	AB037683	CCDS1338.1	1q25.3	2011-06-20			ENSG00000121454	ENSG00000121454		"""Homeoboxes / LIM class"""	21734	protein-coding gene	gene with protein product		602146				11844481, 11567216	Standard	NM_033343		Approved	Gsh4	uc001goe.2	Q969G2	OTTHUMG00000035115	Exception_encountered	chr1.hg19:g.180240574_180240575delinsGT	ENSP00000263726:p.Thr171Val	222.0|220.0	0.0	.		278.0|275.0	61.0|58.0	.	NM_033343	Q8NHE0|Q8NHM1|Q8TCJ1|Q8WWX2|Q969W2	Missense_Mutation	SNP	ENST00000263726.2	hg19	CCDS1338.1																																																																																			.	.	.	none		0.569	LHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084995.2	NM_033343	
CNOT11	55571	hgsc.bcm.edu	37	2	101883275	101883275	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr2:101883275T>C	ENST00000289382.3	+	5	1335	c.1172T>C	c.(1171-1173)aTc>aCc	p.I391T		NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	391					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)											TCAAGCCAGATCACTGAGTAT	0.403																																					p.I391T		Atlas-SNP	.											.	.	.	.	0			c.T1172C						PASS	.						184.0	175.0	178.0					2																	101883275		2203	4300	6503	SO:0001583	missense	55571	exon5			GCCAGATCACTGA	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.1172T>C	chr2.hg19:g.101883275T>C	ENSP00000289382:p.Ile391Thr	119.0	0.0	.		165.0	36.0	.	NM_017546	Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	hg19	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.749354	0.89753	.	.	ENSG00000158435	ENST00000289382	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.83741	0.5320	M	0.87456	2.885	0.80722	D	1	D	0.67145	0.996	D	0.68192	0.956	D	0.86389	0.1734	9	0.66056	D	0.02	-28.9136	16.4237	0.83790	0.0:0.0:0.0:1.0	.	391	Q9UKZ1	CB029_HUMAN	T	391	.	ENSP00000289382:I391T	I	+	2	0	C2orf29	101249707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.930000	0.87610	2.279000	0.76181	0.533000	0.62120	ATC	.	.	.	none		0.403	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546	
LRP1B	53353	hgsc.bcm.edu	37	2	141272299	141272299	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr2:141272299T>G	ENST00000389484.3	-	51	9163	c.8192A>C	c.(8191-8193)aAa>aCa	p.K2731T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2731	LDL-receptor class A 16. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGAAATACATTTTTGTGCGGA	0.378										TSP Lung(27;0.18)																											p.K2731T	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A8192C						PASS	.						110.0	103.0	105.0					2																	141272299		2203	4300	6503	SO:0001583	missense	53353	exon51			ATACATTTTTGTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8192A>C	chr2.hg19:g.141272299T>G	ENSP00000374135:p.Lys2731Thr	126.0	0.0	.		226.0	57.0	.	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.994775	0.74703	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.40225	1.04	5.53	5.53	0.82687	.	0.000000	0.85682	U	0.000000	T	0.42698	0.1214	L	0.41573	1.285	0.42388	D	0.992517	P	0.43938	0.822	P	0.50270	0.636	T	0.19745	-1.0296	10	0.21014	T	0.42	.	11.074	0.48021	0.0:0.0724:0.0:0.9276	.	2731	Q9NZR2	LRP1B_HUMAN	T	2731;2669	ENSP00000374135:K2731T	ENSP00000374135:K2731T	K	-	2	0	LRP1B	140988769	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	3.870000	0.56070	2.219000	0.72066	0.533000	0.62120	AAA	.	.	.	none		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
UNC80	285175	hgsc.bcm.edu	37	2	210818950	210818950	+	Silent	SNP	G	G	A	rs371393316		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr2:210818950G>A	ENST00000439458.1	+	47	7295	c.7215G>A	c.(7213-7215)gcG>gcA	p.A2405A	UNC80_ENST00000272845.6_Silent_p.A2400A	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2405					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTGCTCTTGCGACGTCCCTAC	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		16625	0.001		0.0	False		,,,				2504	0.0				p.A2405A		Atlas-SNP	.											.	UNC80	280	.	0			c.G7215A						PASS	.	G	,	0,1384		0,0,692	116.0	120.0	119.0		7215,7200	-9.9	0.0	2		119	1,3181		0,1,1590	no	coding-synonymous,coding-synonymous	UNC80	NM_032504.1,NM_182587.3	,	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	,	2405/3259,2400/3235	210818950	1,4565	692	1591	2283	SO:0001819	synonymous_variant	285175	exon47			TCTTGCGACGTCC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.7215G>A	chr2.hg19:g.210818950G>A		90.0	0.0	.		151.0	31.0	.	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	ENST00000439458.1	hg19	CCDS46504.1																																																																																			.	.	.	weak		0.493	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
RQCD1	9125	hgsc.bcm.edu	37	2	219449436	219449436	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr2:219449436G>C	ENST00000273064.6	+	4	797	c.422G>C	c.(421-423)gGa>gCa	p.G141A	RQCD1_ENST00000295701.5_Missense_Mutation_p.G141A|RQCD1_ENST00000509807.2_Missense_Mutation_p.G141A|RQCD1_ENST00000542068.1_Missense_Mutation_p.G141A	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	141					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCAGCCTTGGAGTTATTGGT	0.428																																					p.G141A		Atlas-SNP	.											.	RQCD1	32	.	0			c.G422C						PASS	.						179.0	184.0	182.0					2																	219449436		2203	4300	6503	SO:0001583	missense	9125	exon4			GCCTTGGAGTTAT	D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.422G>C	chr2.hg19:g.219449436G>C	ENSP00000273064:p.Gly141Ala	114.0	0.0	.		172.0	39.0	.	NM_001271634	B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Missense_Mutation	SNP	ENST00000273064.6	hg19	CCDS33379.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123662	0.94429	.	.	ENSG00000144580	ENST00000273064;ENST00000509807;ENST00000542068;ENST00000295701	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	5.22	5.22	0.72569	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91918	0.7441	H	0.98133	4.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.997	D	0.94738	0.7916	10	0.87932	D	0	-1.8573	19.1489	0.93479	0.0:0.0:1.0:0.0	.	141;141;141	B7Z1E5;Q92600;B5MDQ4	.;RCD1_HUMAN;.	A	141	ENSP00000273064:G141A;ENSP00000441357:G141A;ENSP00000443687:G141A;ENSP00000295701:G141A	ENSP00000273064:G141A	G	+	2	0	RQCD1	219157680	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.613000	0.98350	2.587000	0.87381	0.563000	0.77884	GGA	.	.	.	none		0.428	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336920.1	NM_005444	
FLNB	2317	hgsc.bcm.edu	37	3	58107208	58107208	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr3:58107208C>T	ENST00000295956.4	+	20	3269	c.3104C>T	c.(3103-3105)tCg>tTg	p.S1035L	FLNB_ENST00000429972.2_Missense_Mutation_p.S1035L|FLNB_ENST00000490882.1_Missense_Mutation_p.S1035L|FLNB_ENST00000493452.1_Missense_Mutation_p.S866L|FLNB_ENST00000348383.5_Missense_Mutation_p.S1035L|FLNB_ENST00000358537.3_Missense_Mutation_p.S1035L|FLNB_ENST00000357272.4_Missense_Mutation_p.S1035L|FLNB_ENST00000419752.2_Missense_Mutation_p.S866L	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1035					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GTGGAGGCCTCGCTGCCACCA	0.567																																					p.S1035L		Atlas-SNP	.											.	FLNB	430	.	0			c.C3104T						PASS	.						95.0	100.0	98.0					3																	58107208		2203	4300	6503	SO:0001583	missense	2317	exon20			AGGCCTCGCTGCC	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.3104C>T	chr3.hg19:g.58107208C>T	ENSP00000295956:p.Ser1035Leu	67.0	0.0	.		89.0	17.0	.	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	hg19	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069850	0.36566	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.87	5.87	0.94306	Immunoglobulin E-set (2);	0.492477	0.22519	N	0.058991	T	0.22742	0.0549	N	0.02368	-0.58	0.33978	D	0.647678	B;B;B;B;B;B	0.31290	0.26;0.002;0.205;0.0;0.318;0.318	B;B;B;B;B;B	0.28465	0.039;0.001;0.09;0.002;0.028;0.028	T	0.23048	-1.0199	10	0.25106	T	0.35	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	1035;1035;866;866;1035;1035	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	L	1035;1035;1035;1035;1035;1035;866;866	ENSP00000295956:S1035L;ENSP00000420213:S1035L;ENSP00000351339:S1035L;ENSP00000415599:S1035L;ENSP00000232447:S1035L;ENSP00000349819:S1035L;ENSP00000418510:S866L;ENSP00000414532:S866L	ENSP00000295956:S1035L	S	+	2	0	FLNB	58082248	0.587000	0.26791	0.985000	0.45067	0.891000	0.51852	1.928000	0.40104	2.780000	0.95670	0.655000	0.94253	TCG	.	.	.	none		0.567	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
MAATS1	89876	hgsc.bcm.edu	37	3	119449132	119449132	+	Missense_Mutation	SNP	A	A	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr3:119449132A>C	ENST00000273390.5	+	8	1003	c.926A>C	c.(925-927)gAa>gCa	p.E309A		NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	309						mitochondrion (GO:0005739)											AATCAGAATGAAGTGAATATG	0.413																																					p.E309A		Atlas-SNP	.											.	.	.	.	0			c.A926C						PASS	.						183.0	187.0	185.0					3																	119449132		2203	4300	6503	SO:0001583	missense	89876	exon8			AGAATGAAGTGAA	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.926A>C	chr3.hg19:g.119449132A>C	ENSP00000273390:p.Glu309Ala	204.0	0.0	.		226.0	41.0	.	NM_033364	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	ENST00000273390.5	hg19	CCDS2994.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.266006	0.80358	.	.	ENSG00000183833	ENST00000273390	T	0.23348	1.91	5.2	4.04	0.47022	.	0.399793	0.31821	N	0.007011	T	0.43500	0.1250	M	0.64676	1.99	0.80722	D	1	D;D;D;D;D	0.76494	0.986;0.991;0.967;0.999;0.998	P;D;P;D;D	0.70935	0.888;0.94;0.813;0.971;0.941	T	0.24404	-1.0161	10	0.41790	T	0.15	-18.7701	10.645	0.45615	0.9244:0.0:0.0756:0.0	.	309;70;247;309;309	Q7Z4T9;Q9UFB4;Q7Z4T9-3;Q4G0Y0;Q7Z4T9-7	AAT1_HUMAN;.;.;.;.	A	309	ENSP00000273390:E309A	ENSP00000273390:E309A	E	+	2	0	C3orf15	120931822	1.000000	0.71417	0.981000	0.43875	0.856000	0.48823	4.480000	0.60243	2.080000	0.62538	0.455000	0.32223	GAA	.	.	.	none		0.413	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
MRPL3	11222	hgsc.bcm.edu	37	3	131188617	131188617	+	Splice_Site	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr3:131188617C>T	ENST00000264995.3	-	8	886	c.739G>A	c.(739-741)Gat>Aat	p.D247N	MRPL3_ENST00000425847.2_Splice_Site_p.D274N	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	247					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						CTGCCAATATCCTAAATGAGA	0.308																																					p.D247N		Atlas-SNP	.											.	MRPL3	32	.	0			c.G739A						PASS	.						89.0	81.0	84.0					3																	131188617		2203	4300	6503	SO:0001630	splice_region_variant	11222	exon8			CAATATCCTAAAT	X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.739-1G>A	chr3.hg19:g.131188617C>T		67.0	0.0	.		93.0	11.0	.	NM_007208	Q6IBT2	Missense_Mutation	SNP	ENST00000264995.3	hg19	CCDS3071.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917664	0.73098	.	.	ENSG00000114686	ENST00000264995;ENST00000425847;ENST00000507669	T;T;T	0.44482	0.92;0.92;0.92	5.23	5.23	0.72850	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.090336	0.85682	D	0.000000	T	0.52240	0.1722	M	0.71581	2.175	0.58432	D	0.999997	B;B	0.25521	0.128;0.054	B;B	0.41174	0.349;0.245	T	0.56553	-0.7960	10	0.66056	D	0.02	-15.691	11.8044	0.52145	0.0:0.9145:0.0:0.0855	.	274;247	E7ETU7;P09001	.;RM03_HUMAN	N	247;274;142	ENSP00000264995:D247N;ENSP00000398536:D274N;ENSP00000422419:D142N	ENSP00000264995:D247N	D	-	1	0	MRPL3	132671307	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.794000	0.55492	2.435000	0.82474	0.650000	0.86243	GAT	.	.	.	none		0.308	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356471.3	NM_007208	Missense_Mutation
PLCH1	23007	hgsc.bcm.edu	37	3	155199731	155199731	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr3:155199731A>T	ENST00000340059.7	-	23	4107	c.4108T>A	c.(4108-4110)Tct>Act	p.S1370T	PLCH1_ENST00000414191.1_Missense_Mutation_p.S1332T|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.S1332T|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Missense_Mutation_p.S1332T	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1370					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GTTGTTAGAGAAAGATTTTCT	0.433																																					p.S1370T		Atlas-SNP	.											.	PLCH1	406	.	0			c.T4108A						PASS	.						44.0	48.0	47.0					3																	155199731		2203	4300	6503	SO:0001583	missense	23007	exon23			TTAGAGAAAGATT	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4108T>A	chr3.hg19:g.155199731A>T	ENSP00000345988:p.Ser1370Thr	100.0	0.0	.		150.0	34.0	.	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	hg19	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	A	6.129	0.392091	0.11581	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.47	1.81	0.25067	.	1.843090	0.02242	N	0.065897	T	0.64371	0.2592	L	0.27053	0.805	0.23386	N	0.997788	P;B	0.36837	0.571;0.435	B;B	0.35770	0.21;0.104	T	0.54029	-0.8354	10	0.33940	T	0.23	.	8.7404	0.34554	0.7078:0.0:0.2922:0.0	.	1332;1370	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	T	1332;1370;1332;1332	ENSP00000417502:S1332T;ENSP00000345988:S1370T;ENSP00000335469:S1332T;ENSP00000412977:S1332T	ENSP00000335469:S1332T	S	-	1	0	PLCH1	156682425	0.976000	0.34144	0.176000	0.23000	0.280000	0.26924	0.788000	0.26872	0.364000	0.24374	0.477000	0.44152	TCT	.	.	.	none		0.433	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
PHC3	80012	hgsc.bcm.edu	37	3	169831155	169831155	+	Silent	SNP	A	A	T	rs532102572		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr3:169831155A>T	ENST00000494943.1	-	11	2378	c.2310T>A	c.(2308-2310)atT>atA	p.I770I	PHC3_ENST00000467570.1_Silent_p.I729I|PHC3_ENST00000495893.2_Silent_p.I782I			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	770					multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AACCTTCAGCAATCATGTCTT	0.353													A|||	1	0.000199681	0.0	0.0	5008	,	,		18415	0.001		0.0	False		,,,				2504	0.0				p.I782I		Atlas-SNP	.											.	PHC3	113	.	0			c.T2346A						PASS	.						89.0	82.0	85.0					3																	169831155		1852	4098	5950	SO:0001819	synonymous_variant	80012	exon11			TTCAGCAATCATG		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.2310T>A	chr3.hg19:g.169831155A>T		148.0	0.0	.		183.0	36.0	.	NM_024947	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Silent	SNP	ENST00000494943.1	hg19																																																																																				.	.	.	none		0.353	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	
PDE6B	5158	hgsc.bcm.edu	37	4	651194	651194	+	Missense_Mutation	SNP	A	A	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr4:651194A>C	ENST00000496514.1	+	10	1333	c.1312A>C	c.(1312-1314)Atg>Ctg	p.M438L	PDE6B_ENST00000255622.6_Missense_Mutation_p.M438L|PDE6B_ENST00000429163.2_Missense_Mutation_p.M159L|RP11-1191J2.2_ENST00000489312.1_RNA|RP11-1191J2.2_ENST00000468356.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	438					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTACGACAAGATGAACAAGCT	0.612																																					p.M438L	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.A1312C						PASS	.						198.0	119.0	146.0					4																	651194		2203	4300	6503	SO:0001583	missense	5158	exon10			GACAAGATGAACA	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1312A>C	chr4.hg19:g.651194A>C	ENSP00000420295:p.Met438Leu	332.0	0.0	.		427.0	74.0	.	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629272	0.46944	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.66995	-0.24;-0.24;-0.24	4.85	4.85	0.62838	GAF (1);	0.117165	0.85682	N	0.000000	T	0.64011	0.2560	M	0.67569	2.06	0.51482	D	0.999924	B;B	0.16802	0.011;0.019	B;B	0.23275	0.02;0.045	T	0.60835	-0.7184	10	0.30078	T	0.28	.	12.3767	0.55283	1.0:0.0:0.0:0.0	.	438;438	P35913;P35913-2	PDE6B_HUMAN;.	L	438;438;159	ENSP00000255622:M438L;ENSP00000420295:M438L;ENSP00000406334:M159L	ENSP00000255622:M438L	M	+	1	0	PDE6B	641194	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.760000	0.62235	1.804000	0.52760	0.367000	0.22151	ATG	.	.	.	none		0.612	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
HGFAC	3083	hgsc.bcm.edu	37	4	3443797	3443797	+	Silent	SNP	C	C	G	rs538844201	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr4:3443797C>G	ENST00000382774.3	+	1	184	c.69C>G	c.(67-69)ctC>ctG	p.L23L	HGFAC_ENST00000511533.1_Silent_p.L23L	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	23					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TCCTCCTCCTCCTGCTGCTGC	0.716													C|||	2	0.000399361	0.0008	0.0	5008	,	,		13350	0.0		0.0	False		,,,				2504	0.001				p.L23L		Atlas-SNP	.											HGFAC,NS,carcinoma,0,2	HGFAC	69	.	0			c.C69G						PASS	.						13.0	16.0	15.0					4																	3443797		1723	3604	5327	SO:0001819	synonymous_variant	3083	exon1			CCTCCTCCTGCTG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.69C>G	chr4.hg19:g.3443797C>G		50.0	0.0	.		68.0	3.0	.	NM_001528	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	hg19	CCDS3369.1																																																																																			.	.	.	none		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
LNX1	84708	hgsc.bcm.edu	37	4	54362470	54362470	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr4:54362470C>A	ENST00000263925.7	-	6	1384	c.1070G>T	c.(1069-1071)cGt>cTt	p.R357L	FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000502373.1_RNA|LNX1_ENST00000306888.2_Missense_Mutation_p.R261L	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	357	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CTTCTGTTCACGCATCACAGT	0.577																																					p.R357L		Atlas-SNP	.											.	LNX1	139	.	0			c.G1070T						PASS	.						51.0	52.0	51.0					4																	54362470		2203	4300	6503	SO:0001583	missense	84708	exon6			TGTTCACGCATCA	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1070G>T	chr4.hg19:g.54362470C>A	ENSP00000263925:p.Arg357Leu	64.0	0.0	.		107.0	28.0	.	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	ENST00000263925.7	hg19	CCDS47057.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537618	0.85917	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.13196	2.61;4.1	5.29	5.29	0.74685	PDZ/DHR/GLGF (3);	0.070422	0.64402	D	0.000001	T	0.53417	0.1795	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.77557	0.927;0.99	T	0.68961	-0.5271	10	0.87932	D	0	.	19.1278	0.93393	0.0:1.0:0.0:0.0	.	357;261	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	L	261;195;357	ENSP00000302879:R261L;ENSP00000263925:R357L	ENSP00000263925:R357L	R	-	2	0	LNX1	54057227	1.000000	0.71417	0.941000	0.38009	0.547000	0.35210	7.320000	0.79064	2.756000	0.94617	0.561000	0.74099	CGT	.	.	.	none		0.577	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
CENPE	1062	hgsc.bcm.edu	37	4	104116296	104116296	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr4:104116296G>A	ENST00000265148.3	-	5	541	c.452C>T	c.(451-453)cCt>cTt	p.P151L	CENPE_ENST00000380026.3_Missense_Mutation_p.P151L	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	151	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AATAATTAAAGGTTTCATTTT	0.318																																					p.P151L		Atlas-SNP	.											.	CENPE	253	.	0			c.C452T						PASS	.						98.0	100.0	99.0					4																	104116296		2203	4291	6494	SO:0001583	missense	1062	exon5			ATTAAAGGTTTCA	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.452C>T	chr4.hg19:g.104116296G>A	ENSP00000265148:p.Pro151Leu	97.0	0.0	.		113.0	16.0	.	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827249	0.90955	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.75154	-0.91;-0.91;-0.91	5.94	5.94	0.96194	Kinesin, motor domain (4);	.	.	.	.	D	0.83133	0.5188	L	0.55017	1.72	0.80722	D	1	D;D	0.69078	0.991;0.997	D;D	0.72338	0.919;0.977	D	0.83582	0.0118	9	0.66056	D	0.02	.	15.5001	0.75691	0.0677:0.0:0.9323:0.0	.	151;151	Q02224-3;Q02224	.;CENPE_HUMAN	L	151	ENSP00000265148:P151L;ENSP00000369365:P151L;ENSP00000423981:P151L	ENSP00000265148:P151L	P	-	2	0	CENPE	104335745	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	8.966000	0.93397	2.820000	0.97059	0.650000	0.86243	CCT	.	.	.	none		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PCSK1	5122	hgsc.bcm.edu	37	5	95759058	95759058	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr5:95759058C>T	ENST00000311106.3	-	4	739	c.502G>A	c.(502-504)Gat>Aat	p.D168N	CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000508626.1_Missense_Mutation_p.D121N	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	168	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCCAAACCATCATCCAGTACG	0.488																																					p.D168N		Atlas-SNP	.											.	PCSK1	93	.	0			c.G502A						PASS	.						188.0	138.0	155.0					5																	95759058		2203	4300	6503	SO:0001583	missense	5122	exon4			AACCATCATCCAG		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.502G>A	chr5.hg19:g.95759058C>T	ENSP00000308024:p.Asp168Asn	188.0	0.0	.		269.0	50.0	.	NM_000439	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	hg19	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	C	36	5.765100	0.96906	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	D;D	0.88277	-2.36;-2.36	5.91	5.91	0.95273	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.95182	0.8438	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95088	0.8219	10	0.87932	D	0	-30.7254	19.8855	0.96910	0.0:1.0:0.0:0.0	.	168	P29120	NEC1_HUMAN	N	168;121	ENSP00000308024:D168N;ENSP00000421600:D121N	ENSP00000308024:D168N	D	-	1	0	PCSK1	95784814	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.442000	0.80503	2.796000	0.96246	0.655000	0.94253	GAT	.	.	.	none		0.488	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439	
EGR1	1958	hgsc.bcm.edu	37	5	137801684	137801684	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr5:137801684C>G	ENST00000239938.4	+	1	506	c.234C>G	c.(232-234)aaC>aaG	p.N78K		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	78	Gly/Ser-rich.				BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			gcggcagcaacagcagcagca	0.726																																					p.N78K		Atlas-SNP	.											.,1	EGR1	52	.	0			c.C234G						PASS	.						11.0	11.0	11.0					5																	137801684		2140	4182	6322	SO:0001583	missense	1958	exon1			CAGCAACAGCAGC	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.234C>G	chr5.hg19:g.137801684C>G	ENSP00000239938:p.Asn78Lys	88.0	0.0	.		155.0	34.0	.	NM_001964		Missense_Mutation	SNP	ENST00000239938.4	hg19	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504003	0.26949	.	.	ENSG00000120738	ENST00000535792;ENST00000411801;ENST00000239938	T	0.07908	3.15	3.78	3.78	0.43462	.	0.356279	0.23859	N	0.043878	T	0.04679	0.0127	N	0.08118	0	0.22903	N	0.99859	B;B	0.17038	0.02;0.001	B;B	0.10450	0.005;0.002	T	0.35101	-0.9802	10	0.41790	T	0.15	.	10.9732	0.47450	0.0:1.0:0.0:0.0	.	78;78	B4DNX4;P18146	.;EGR1_HUMAN	K	78	ENSP00000239938:N78K	ENSP00000239938:N78K	N	+	3	2	EGR1	137829583	0.999000	0.42202	0.971000	0.41717	0.651000	0.38670	0.504000	0.22626	1.932000	0.55993	0.561000	0.74099	AAC	.	.	.	none		0.726	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964	
GUSB	2990	hgsc.bcm.edu	37	7	65441077	65441077	+	Silent	SNP	T	T	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr7:65441077T>C	ENST00000304895.4	-	5	967	c.837A>G	c.(835-837)caA>caG	p.Q279Q	GUSB_ENST00000476486.1_5'UTR|GUSB_ENST00000421103.1_Intron|GUSB_ENST00000345660.6_Silent_p.Q279Q	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	279					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GCACCTTAAGTTGGCCCTGGG	0.527																																					p.Q279Q		Atlas-SNP	.											.	GUSB	52	.	0			c.A837G						PASS	.						82.0	68.0	73.0					7																	65441077		2203	4300	6503	SO:0001819	synonymous_variant	2990	exon5			CTTAAGTTGGCCC	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.837A>G	chr7.hg19:g.65441077T>C		47.0	0.0	.		67.0	17.0	.	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Silent	SNP	ENST00000304895.4	hg19	CCDS5530.1																																																																																			.	.	.	none		0.527	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
YWHAG	7532	hgsc.bcm.edu	37	7	75959110	75959110	+	Silent	SNP	A	A	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr7:75959110A>T	ENST00000307630.3	-	2	750	c.528T>A	c.(526-528)gcT>gcA	p.A176A		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	176					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						AGTAGTTAAGAGCCAGGCCTA	0.602																																					p.A176A		Atlas-SNP	.											.	YWHAG	24	.	0			c.T528A						PASS	.						167.0	165.0	165.0					7																	75959110		2203	4300	6503	SO:0001819	synonymous_variant	7532	exon2			GTTAAGAGCCAGG	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.528T>A	chr7.hg19:g.75959110A>T		114.0	0.0	.		154.0	21.0	.	NM_012479	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	ENST00000307630.3	hg19	CCDS5584.1																																																																																			.	.	.	none		0.602	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479	
GPR37	2861	hgsc.bcm.edu	37	7	124387082	124387082	+	Missense_Mutation	SNP	A	A	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr7:124387082A>T	ENST00000303921.2	-	2	1989	c.1339T>A	c.(1339-1341)Ttt>Att	p.F447I		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	447					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TAACAGCCAAAATACCACCAC	0.488																																					p.F447I		Atlas-SNP	.											.	GPR37	89	.	0			c.T1339A						PASS	.						163.0	137.0	146.0					7																	124387082		2203	4300	6503	SO:0001583	missense	2861	exon2			AGCCAAAATACCA		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1339T>A	chr7.hg19:g.124387082A>T	ENSP00000306449:p.Phe447Ile	56.0	0.0	.		75.0	19.0	.	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	hg19	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.631183	0.87660	.	.	ENSG00000170775	ENST00000303921	T	0.71579	-0.58	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	D	0.83403	0.5247	M	0.75615	2.305	0.58432	D	0.999999	D	0.71674	0.998	D	0.75020	0.985	D	0.85537	0.1213	10	0.87932	D	0	-24.2797	15.205	0.73173	1.0:0.0:0.0:0.0	.	447	O15354	GPR37_HUMAN	I	447	ENSP00000306449:F447I	ENSP00000306449:F447I	F	-	1	0	GPR37	124174318	1.000000	0.71417	0.817000	0.32601	0.986000	0.74619	9.339000	0.96797	2.179000	0.69175	0.533000	0.62120	TTT	.	.	.	none		0.488	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P|PODXL_ENST00000541194.1_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		Atlas-SNP	.											.	PODXL	53	.	0			c.T64C						PASS	.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	chr7.hg19:g.131241055A>G	ENSP00000367817:p.Ser22Pro	105.0	0.0	.		119.0	15.0	.	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	hg19	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.	.	.	none		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
PPP1R16A	84988	hgsc.bcm.edu	37	8	145726945	145726945	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr8:145726945G>T	ENST00000292539.4	+	11	2163	c.1246G>T	c.(1246-1248)Ggg>Tgg	p.G416W	PPP1R16A_ENST00000435887.1_Missense_Mutation_p.G416W|CTD-2517M22.14_ENST00000532766.1_RNA|GPT_ENST00000394955.2_5'Flank|CTD-2517M14.5_ENST00000569326.1_RNA|GPT_ENST00000528431.1_5'Flank			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	416						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGGCCGAGTAGGGGGCTCCCC	0.657																																					p.G416W		Atlas-SNP	.											.	PPP1R16A	25	.	0			c.G1246T						PASS	.						28.0	25.0	26.0					8																	145726945		2184	4283	6467	SO:0001583	missense	84988	exon10			CGAGTAGGGGGCT		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.1246G>T	chr8.hg19:g.145726945G>T	ENSP00000292539:p.Gly416Trp	138.0	0.0	.		193.0	34.0	.	NM_032902	D3DWM5	Missense_Mutation	SNP	ENST00000292539.4	hg19	CCDS6429.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.219768|4.219768	0.79464|0.79464	.|.	.|.	ENSG00000160972|ENSG00000160972	ENST00000292539;ENST00000435887|ENST00000528430	T;T|.	0.72615|.	-0.67;-0.67|.	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.940914|.	0.08829|.	N|.	0.887657|.	T|.	0.55226|.	0.1907|.	L|L	0.59436|0.59436	1.845|1.845	0.20403|0.20403	N|N	0.999904|0.999904	D|.	0.67145|.	0.996|.	P|.	0.61658|.	0.892|.	T|.	0.49234|.	-0.8961|.	10|.	0.72032|.	D|.	0.01|.	.|.	14.6431|14.6431	0.68739|0.68739	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	416|.	Q96I34|.	PP16A_HUMAN|.	W|Y	416|83	ENSP00000292539:G416W;ENSP00000391126:G416W|.	ENSP00000292539:G416W|.	G|X	+|+	1|3	0|2	PPP1R16A|PPP1R16A	145697753|145697753	0.824000|0.824000	0.29247|0.29247	0.005000|0.005000	0.12908|0.12908	0.336000|0.336000	0.28762|0.28762	4.023000|4.023000	0.57211|0.57211	2.035000|2.035000	0.60131|0.60131	0.462000|0.462000	0.41574|0.41574	GGG|TAG	.	.	.	none		0.657	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902	
MORN5	254956	hgsc.bcm.edu	37	9	124929084	124929084	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr9:124929084A>G	ENST00000373764.3	+	2	147	c.85A>G	c.(85-87)Aca>Gca	p.T29A	MORN5_ENST00000486801.1_3'UTR|MORN5_ENST00000536616.1_Missense_Mutation_p.T29A	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	29										endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						CCCTACCGAAACAATATATGT	0.522																																					p.T29A		Atlas-SNP	.											.	MORN5	19	.	0			c.A85G						PASS	.						69.0	54.0	59.0					9																	124929084		2203	4300	6503	SO:0001583	missense	254956	exon2			ACCGAAACAATAT	AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.85A>G	chr9.hg19:g.124929084A>G	ENSP00000362869:p.Thr29Ala	215.0	0.0	.		260.0	47.0	.	NM_198469	B7Z7I5|Q6ZQN1	Missense_Mutation	SNP	ENST00000373764.3	hg19	CCDS6836.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.688412	0.48097	.	.	ENSG00000185681	ENST00000373764;ENST00000536616;ENST00000418632	T;T;T	0.41758	0.99;0.99;0.99	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	L	0.38692	1.165	0.58432	D	0.999999	P;P;P	0.51057	0.693;0.941;0.751	B;P;P	0.51657	0.223;0.676;0.676	T	0.33650	-0.9860	10	0.44086	T	0.13	-16.1664	12.7975	0.57567	1.0:0.0:0.0:0.0	.	13;29;29	Q5T7S4;B7Z7I5;Q5VZ52	.;.;MORN5_HUMAN	A	29;29;13	ENSP00000362869:T29A;ENSP00000437483:T29A;ENSP00000409949:T13A	ENSP00000362869:T29A	T	+	1	0	MORN5	123968905	1.000000	0.71417	0.336000	0.25522	0.041000	0.13682	8.195000	0.89723	1.914000	0.55421	0.379000	0.24179	ACA	.	.	.	none		0.522	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053910.2	NM_198469	
CACNA1B	774	hgsc.bcm.edu	37	9	140918184	140918185	+	Missense_Mutation	DNP	AC	AC	GT	rs145816559|rs370787788	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr9:140918184_140918185AC>GT	ENST00000371372.1	+	19	3134_3135	c.2989_2990AC>GT	c.(2989-2991)ACg>GTg	p.T997V	CACNA1B_ENST00000277549.5_Missense_Mutation_p.T189V|CACNA1B_ENST00000371367.5_5'UTR|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T997V|CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000371355.4_Missense_Mutation_p.T998V|CACNA1B_ENST00000371357.1_Missense_Mutation_p.T998V|CACNA1B_ENST00000277551.2_Missense_Mutation_p.T997V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	997					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.T996_E1000delTTEKE(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAAGGAGACCACGGAGAAGGAG	0.718																																					p.T997A|p.T997M		Atlas-SNP	.											.	CACNA1B	266	.	1	Deletion - In frame(1)	breast(1)	c.A2989G|c.C2990T						PASS	.																																			SO:0001583	missense	774	exon19			GAGACCACGGAGA|AGACCACGGAGAA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	Exception_encountered	chr9.hg19:g.140918184_140918185delinsGT	ENSP00000360423:p.Thr997Val	0.0|1.0	0.0	.		248.0|255.0	38.0|51.0	.	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1																																																																																			.	.	.	none		0.718	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
HOGA1	112817	hgsc.bcm.edu	37	10	99361640	99361640	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr10:99361640G>A	ENST00000370646.4	+	6	1088	c.727G>A	c.(727-729)Gcc>Acc	p.A243T	PI4K2A_ENST00000370649.3_Missense_Mutation_p.A80T|HOGA1_ENST00000370647.4_Missense_Mutation_p.A80T|PI4K2A_ENST00000555577.1_Missense_Mutation_p.A80T	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	243					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						CTGCGCCCTGGCCAATGTCCT	0.637																																					p.A243T		Atlas-SNP	.											.	HOGA1	25	.	0			c.G727A						PASS	.						39.0	41.0	40.0					10																	99361640		2203	4300	6503	SO:0001583	missense	112817	exon6			GCCCTGGCCAATG	BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.727G>A	chr10.hg19:g.99361640G>A	ENSP00000359680:p.Ala243Thr	101.0	0.0	.		106.0	27.0	.	NM_138413	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Missense_Mutation	SNP	ENST00000370646.4	hg19	CCDS7467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.604805|5.604805	0.96626|0.96626	.|.	.|.	ENSG00000241935;ENSG00000241935;ENSG00000155252;ENSG00000249967|ENSG00000241935	ENST00000370647;ENST00000370646;ENST00000555577;ENST00000370649|ENST00000370642	D;D;D;D|.	0.95035|.	-3.59;-3.59;-2.51;-2.51|.	5.07|5.07	5.07|5.07	0.68467|0.68467	Aldolase-type TIM barrel (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84361|0.84361	0.5455|0.5455	M|M	0.89353|0.89353	3.025|3.025	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.993;1.0;1.0|.	D;D;D|.	0.81914|.	0.971;0.995;0.995|.	D|D	0.86967|0.86967	0.2095|0.2095	10|5	0.87932|.	D|.	0|.	-24.1425|-24.1425	18.8138|18.8138	0.92070|0.92070	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	80;80;243|.	E9PAM4;Q86XE5-3;Q86XE5|.	.;.;HOGA1_HUMAN|.	T|D	80;243;80;80|46	ENSP00000359681:A80T;ENSP00000359680:A243T;ENSP00000452243:A80T;ENSP00000359683:A80T|.	ENSP00000359680:A243T|.	A|G	+|+	1|2	0|0	PI4K2A;HOGA1;RP11-548K23.11|HOGA1	99351630|99351630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.387000|7.387000	0.79785|0.79785	2.530000|2.530000	0.85305|0.85305	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.	.	.	none		0.637	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049726.1	NM_138413	
ATRNL1	26033	hgsc.bcm.edu	37	10	117221517	117221517	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr10:117221517C>T	ENST00000355044.3	+	22	3515	c.3389C>T	c.(3388-3390)gCc>gTc	p.A1130V	ATRNL1_ENST00000303745.7_Intron|ATRNL1_ENST00000423111.2_Missense_Mutation_p.A181V	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1130					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CACCATACTGCCATAAACTTT	0.313																																					p.A1130V		Atlas-SNP	.											.	ATRNL1	219	.	0			c.C3389T						PASS	.						121.0	116.0	118.0					10																	117221517		2203	4299	6502	SO:0001583	missense	26033	exon22			ATACTGCCATAAA	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3389C>T	chr10.hg19:g.117221517C>T	ENSP00000347152:p.Ala1130Val	105.0	0.0	.		81.0	18.0	.	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873727	0.91664	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.53423	0.62;0.62	5.05	5.05	0.67936	.	0.103911	0.64402	D	0.000003	T	0.55878	0.1948	M	0.76433	2.335	0.80722	D	1	P;P	0.50443	0.799;0.935	B;P	0.45232	0.343;0.474	T	0.62877	-0.6761	10	0.51188	T	0.08	-10.1629	18.7909	0.91974	0.0:1.0:0.0:0.0	.	181;1130	B4DH41;Q5VV63	.;ATRN1_HUMAN	V	1130;181	ENSP00000347152:A1130V;ENSP00000409624:A181V	ENSP00000347152:A1130V	A	+	2	0	ATRNL1	117211507	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.704000	0.84595	2.522000	0.85027	0.650000	0.86243	GCC	.	.	.	none		0.313	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
PLEKHA7	144100	hgsc.bcm.edu	37	11	16812448	16812448	+	Silent	SNP	C	C	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr11:16812448C>A	ENST00000355661.3	-	21	2959	c.2949G>T	c.(2947-2949)tcG>tcT	p.S983S	PLEKHA7_ENST00000332954.4_5'UTR|PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Silent_p.S983S|PLEKHA7_ENST00000448080.2_Silent_p.S984S			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	983					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CACTGACATACGACCGCAGCT	0.642																																					p.S983S		Atlas-SNP	.											.	PLEKHA7	120	.	0			c.G2949T						PASS	.						40.0	35.0	37.0					11																	16812448		2200	4294	6494	SO:0001819	synonymous_variant	144100	exon21			GACATACGACCGC	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.2949G>T	chr11.hg19:g.16812448C>A		123.0	0.0	.		163.0	29.0	.	NM_175058	B4DK33|B4DWC3|Q86VZ7	Silent	SNP	ENST00000355661.3	hg19	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	C	8.196	0.797114	0.16327	.	.	ENSG00000166689	ENST00000530489	.	.	.	5.59	-11.2	0.00127	.	.	.	.	.	T	0.49541	0.1563	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64791	-0.6324	4	.	.	.	-11.4593	11.8426	0.52364	0.0:0.3541:0.4355:0.2105	.	.	.	.	L	615	.	.	R	-	2	0	PLEKHA7	16769024	0.000000	0.05858	0.303000	0.25071	0.923000	0.55619	-2.377000	0.01069	-2.541000	0.00485	-0.265000	0.10407	CGT	.	.	.	none		0.642	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
SYVN1	84447	hgsc.bcm.edu	37	11	64899012	64899012	+	Missense_Mutation	SNP	G	G	C	rs267603113		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr11:64899012G>C	ENST00000377190.3	-	7	681	c.587C>G	c.(586-588)tCc>tGc	p.S196C	SYVN1_ENST00000294256.8_Missense_Mutation_p.S196C|SYVN1_ENST00000307289.6_Missense_Mutation_p.S145C|SYVN1_ENST00000526060.1_Missense_Mutation_p.S196C|SYVN1_ENST00000526121.1_5'UTR	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	196					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GAGGTCCACGGAGTGCAGCAC	0.552																																					p.S196C		Atlas-SNP	.											.	SYVN1	55	.	0			c.C587G						PASS	.						113.0	92.0	99.0					11																	64899012		2201	4297	6498	SO:0001583	missense	84447	exon7			TCCACGGAGTGCA	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.587C>G	chr11.hg19:g.64899012G>C	ENSP00000366395:p.Ser196Cys	76.0	0.0	.		87.0	12.0	.	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	hg19	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118620	0.77323	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75	4.76	4.76	0.60689	.	0.061993	0.64402	D	0.000004	T	0.57504	0.2058	L	0.36672	1.1	0.49798	D	0.999825	D;D;D	0.67145	0.996;0.994;0.989	D;D;P	0.66847	0.947;0.947;0.887	T	0.58978	-0.7540	10	0.54805	T	0.06	-34.3522	15.3234	0.74141	0.0:0.0:1.0:0.0	.	145;196;196	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	C	196;196;196;145;196;136;181	ENSP00000366395:S196C;ENSP00000294256:S196C;ENSP00000302035:S145C;ENSP00000436984:S196C;ENSP00000431215:S136C;ENSP00000431720:S181C	ENSP00000294256:S196C	S	-	2	0	SYVN1	64655588	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.891000	0.63185	2.463000	0.83235	0.563000	0.77884	TCC	.	.	.	none		0.552	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
KRTAP5-8	57830	hgsc.bcm.edu	37	11	71249532	71249532	+	Missense_Mutation	SNP	C	C	G	rs532438179|rs11234084|rs369043826	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr11:71249532C>G	ENST00000398534.3	+	1	462	c.431C>G	c.(430-432)tCc>tGc	p.S144C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	144	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						CCCTGCTGTTCCCAGTCCAGC	0.612																																					p.S144C		Atlas-SNP	.											.	KRTAP5-8	28	.	0			c.C431G						PASS	.						148.0	160.0	156.0					11																	71249532		2200	4294	6494	SO:0001583	missense	57830	exon1			GCTGTTCCCAGTC	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.431C>G	chr11.hg19:g.71249532C>G	ENSP00000420723:p.Ser144Cys	73.0	0.0	.		102.0	6.0	.	NM_021046	Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	hg19	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	-	3.125	-0.179750	0.06380	.	.	ENSG00000241233	ENST00000398534	T	0.01197	5.19	1.57	-2.99	0.05497	.	.	.	.	.	T	0.00552	0.0018	N	0.02213	-0.635	0.21861	N	0.999505	B	0.02656	0.0	B	0.01281	0.0	T	0.44314	-0.9336	9	0.02654	T	1	.	12.0511	0.53507	0.0:0.7645:0.2355:0.0	rs11234084	144	O75690	KRA58_HUMAN	C	144	ENSP00000420723:S144C	ENSP00000420723:S144C	S	+	2	0	KRTAP5-8	70927180	0.000000	0.05858	0.375000	0.26029	0.014000	0.08584	-0.627000	0.05521	-0.723000	0.04915	-0.951000	0.02657	TCC	.	.	.	weak		0.612	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
PRDM10	56980	hgsc.bcm.edu	37	11	129793159	129793159	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr11:129793159C>G	ENST00000360871.3	-	13	2249	c.2018G>C	c.(2017-2019)tGt>tCt	p.C673S	PRDM10_ENST00000526082.1_Missense_Mutation_p.C591S|PRDM10_ENST00000528746.1_Missense_Mutation_p.C647S|PRDM10_ENST00000358825.5_Missense_Mutation_p.C677S|PRDM10_ENST00000423662.2_Missense_Mutation_p.C591S|PRDM10_ENST00000304538.6_Missense_Mutation_p.C587S	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	677					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TTGCTTCCCACAGGTGGAACA	0.517											OREG0021513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C677S		Atlas-SNP	.											.	PRDM10	120	.	0			c.G2030C						PASS	.						95.0	74.0	81.0					11																	129793159		2201	4297	6498	SO:0001583	missense	56980	exon14			TTCCCACAGGTGG	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2018G>C	chr11.hg19:g.129793159C>G	ENSP00000354118:p.Cys673Ser	118.0	0.0	.	1575	122.0	40.0	.	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	hg19	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.938669	0.92526	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	D;D;D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2;-10.2;-10.2	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.99981	0.9994	M	0.89715	3.055	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.996;0.997;0.996;1.0;0.996	D;D;D;D;D;D	0.87578	0.994;0.99;0.994;0.99;0.998;0.99	D	0.96873	0.9641	10	0.87932	D	0	-17.0242	20.8598	0.99761	0.0:1.0:0.0:0.0	.	587;673;677;591;587;591	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	S	677;587;673;591;647;591;390	ENSP00000351686:C677S;ENSP00000302669:C587S;ENSP00000354118:C673S;ENSP00000398431:C591S;ENSP00000431262:C647S;ENSP00000432237:C591S;ENSP00000435940:C390S	ENSP00000302669:C587S	C	-	2	0	PRDM10	129298369	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	7.311000	0.78958	2.937000	0.99478	0.650000	0.86243	TGT	.	.	.	none		0.517	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
TAS2R50	259296	hgsc.bcm.edu	37	12	11138793	11138793	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr12:11138793C>T	ENST00000506868.1	-	1	718	c.667G>A	c.(667-669)Gtc>Atc	p.V223I	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	223					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						TTTATGTGGACCTTGGTGCTG	0.438																																					p.V223I		Atlas-SNP	.											.	TAS2R50	37	.	0			c.G667A						PASS	.						157.0	154.0	155.0					12																	11138793		2203	4300	6503	SO:0001583	missense	259296	exon1			TGTGGACCTTGGT	AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.667G>A	chr12.hg19:g.11138793C>T	ENSP00000424040:p.Val223Ile	155.0	0.0	.		183.0	28.0	.	NM_176890	P59545|Q2M255|Q645Y0	Missense_Mutation	SNP	ENST00000506868.1	hg19	CCDS8638.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882933	0.33255	.	.	ENSG00000212126	ENST00000506868	T	0.00824	5.65	2.19	-1.22	0.09494	.	1.058070	0.07508	U	0.908398	T	0.02230	0.0069	L	0.58810	1.83	0.09310	N	1	P	0.50156	0.932	P	0.52758	0.708	T	0.42447	-0.9451	10	0.49607	T	0.09	.	6.3225	0.21225	0.0:0.5837:0.0:0.4163	.	223	P59544	T2R50_HUMAN	I	223	ENSP00000424040:V223I	ENSP00000424040:V223I	V	-	1	0	TAS2R50	11030060	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	0.296000	0.19083	-0.526000	0.06383	0.313000	0.20887	GTC	.	.	.	none		0.438	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370192.2	NM_176890	
ATP11A	23250	hgsc.bcm.edu	37	13	113479745	113479745	+	Splice_Site	SNP	T	T	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr13:113479745T>A	ENST00000487903.1	+	11	962	c.874T>A	c.(874-876)Tcg>Acg	p.S292T	ATP11A_ENST00000283558.8_Splice_Site_p.S292T|ATP11A_ENST00000375630.2_Splice_Site_p.S292T|ATP11A_ENST00000375645.3_Splice_Site_p.S292T			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	292					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TTGTTTTAGATCGATGAATGC	0.453																																					p.S292T		Atlas-SNP	.											.	ATP11A	225	.	0			c.T874A						PASS	.						124.0	95.0	105.0					13																	113479745		2203	4300	6503	SO:0001630	splice_region_variant	23250	exon11			TTTAGATCGATGA	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.873-1T>A	chr13.hg19:g.113479745T>A		106.0	0.0	.		153.0	31.0	.	NM_032189	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	hg19	CCDS32011.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.98|11.98	1.799891|1.799891	0.31869|0.31869	.|.	.|.	ENSG00000068650|ENSG00000068650	ENST00000418678|ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	.|D;D;D;D	.|0.90788	.|-2.73;-2.73;-2.73;-2.73	5.2|5.2	5.2|5.2	0.72013|0.72013	.|ATPase, P-type, ATPase-associated domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91975|0.91975	0.7458|0.7458	L|L	0.47190|0.47190	1.495|1.495	0.80722|0.80722	D|D	1|1	.|D;B;B	.|0.59357	.|0.985;0.107;0.004	.|P;B;B	.|0.62491	.|0.903;0.14;0.06	D|D	0.89626|0.89626	0.3852|0.3852	5|10	.|0.17832	.|T	.|0.49	.|.	15.1027|15.1027	0.72292|0.72292	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|292;292;292	.|E9PCW5;E9PEJ6;P98196	.|.;.;AT11A_HUMAN	K|T	266|292	.|ENSP00000420387:S292T;ENSP00000364781:S292T;ENSP00000364796:S292T;ENSP00000283558:S292T	.|ENSP00000283558:S292T	N|S	+|+	3|1	2|0	ATP11A|ATP11A	112527746|112527746	1.000000|1.000000	0.71417|0.71417	0.472000|0.472000	0.27241|0.27241	0.009000|0.009000	0.06853|0.06853	7.703000|7.703000	0.84585|0.84585	1.963000|1.963000	0.57068|0.57068	0.459000|0.459000	0.35465|0.35465	AAT|TCG	.	.	.	none		0.453	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	Missense_Mutation
PLEKHG3	26030	hgsc.bcm.edu	37	14	65208230	65208230	+	Silent	SNP	C	C	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr14:65208230C>G	ENST00000394691.1	+	16	2142	c.1995C>G	c.(1993-1995)ctC>ctG	p.L665L	PLEKHG3_ENST00000471182.2_Silent_p.L198L|PLEKHG3_ENST00000484731.2_Silent_p.L170L|PLEKHG3_ENST00000247226.7_Silent_p.L609L			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	665							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GCTGTCAGCTCTCCCCAGAAG	0.672																																					p.L609L		Atlas-SNP	.											.	PLEKHG3	89	.	0			c.C1827G						PASS	.						35.0	39.0	38.0					14																	65208230		2203	4299	6502	SO:0001819	synonymous_variant	26030	exon14			TCAGCTCTCCCCA	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.1995C>G	chr14.hg19:g.65208230C>G		60.0	0.0	.		85.0	18.0	.	NM_015549	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	hg19																																																																																				.	.	.	none		0.672	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
FOXN3	1112	hgsc.bcm.edu	37	14	89817056	89817056	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr14:89817056C>T	ENST00000345097.4	-	3	756	c.640G>A	c.(640-642)Gtg>Atg	p.V214M	FOXN3_ENST00000557258.1_Missense_Mutation_p.V214M|FOXN3_ENST00000555353.1_Missense_Mutation_p.V214M|RP11-356K23.1_ENST00000555407.1_RNA|FOXN3_ENST00000261302.5_Missense_Mutation_p.V214M|RP11-356K23.1_ENST00000556942.1_RNA|FOXN3_ENST00000555658.1_5'UTR	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	214					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTATTGAACACGTGTGGGTGT	0.433																																					p.V214M		Atlas-SNP	.											.	FOXN3	78	.	0			c.G640A						PASS	.						220.0	192.0	202.0					14																	89817056		2203	4300	6503	SO:0001583	missense	1112	exon3			TGAACACGTGTGG		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.640G>A	chr14.hg19:g.89817056C>T	ENSP00000343288:p.Val214Met	171.0	0.0	.		206.0	34.0	.	NM_005197	Q96II7|Q9UIE7	Missense_Mutation	SNP	ENST00000345097.4	hg19	CCDS41977.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584613	0.65992	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353;ENST00000553353	D;D;D;D	0.94828	-3.53;-3.53;-3.32;-3.32	5.03	5.03	0.67393	.	0.216604	0.37304	N	0.002141	D	0.93785	0.8013	L	0.51422	1.61	0.46901	D	0.999246	P;P	0.49783	0.624;0.928	B;P	0.47015	0.276;0.534	D	0.93504	0.6847	10	0.41790	T	0.15	.	18.3782	0.90442	0.0:1.0:0.0:0.0	.	214;214	O00409;O00409-2	FOXN3_HUMAN;.	M	214;214;214;214;65	ENSP00000343288:V214M;ENSP00000261302:V214M;ENSP00000452005:V214M;ENSP00000452227:V214M	ENSP00000261302:V214M	V	-	1	0	FOXN3	88886809	0.996000	0.38824	0.710000	0.30468	0.681000	0.39784	2.077000	0.41557	2.342000	0.79632	0.561000	0.74099	GTG	.	.	.	none		0.433	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197	
UBE3A	7337	hgsc.bcm.edu	37	15	25616011	25616011	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr15:25616011C>T	ENST00000397954.2	-	4	1318	c.1319G>A	c.(1318-1320)cGa>cAa	p.R440Q	UBE3A_ENST00000438097.1_Missense_Mutation_p.R417Q|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000232165.3_Missense_Mutation_p.R437Q|UBE3A_ENST00000566215.1_Missense_Mutation_p.R417Q|UBE3A_ENST00000428984.2_Missense_Mutation_p.R417Q			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	440	Interaction with HCV core protein.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		AAGTGGTTTTCGACAATCCAG	0.383																																					p.R440Q		Atlas-SNP	.											UBE3A,NS,adenocarcinoma,0,2	UBE3A	109	.	0			c.G1319A						PASS	.						35.0	35.0	35.0					15																	25616011		2202	4298	6500	SO:0001583	missense	7337	exon7			GGTTTTCGACAAT	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.1319G>A	chr15.hg19:g.25616011C>T	ENSP00000381045:p.Arg440Gln	80.0	0.0	.		100.0	20.0	.	NM_000462	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	hg19	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497612	0.64186	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.57	4.65	0.58169	.	0.052477	0.64402	N	0.000001	T	0.79907	0.4527	M	0.64170	1.965	0.54753	D	0.999988	D;D	0.69078	0.997;0.996	P;D	0.63033	0.747;0.91	T	0.80113	-0.1518	10	0.44086	T	0.13	.	14.5343	0.67950	0.0:0.9295:0.0:0.0705	.	437;440	Q05086-3;Q05086	.;UBE3A_HUMAN	Q	437;437;440;417;417	ENSP00000232165:R437Q;ENSP00000381045:R440Q;ENSP00000411258:R417Q;ENSP00000401265:R417Q	ENSP00000232165:R437Q	R	-	2	0	UBE3A	23167104	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	4.995000	0.63908	1.367000	0.46095	0.460000	0.39030	CGA	.	.	.	none		0.383	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
THBS1	7057	hgsc.bcm.edu	37	15	39880740	39880740	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr15:39880740G>T	ENST00000260356.5	+	10	1650	c.1485G>T	c.(1483-1485)tgG>tgT	p.W495C		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	495	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ATGGAGGCTGGGGTCCTTGGT	0.498																																					p.W495C		Atlas-SNP	.											.	THBS1	106	.	0			c.G1485T						PASS	.						65.0	64.0	64.0					15																	39880740		2200	4297	6497	SO:0001583	missense	7057	exon10			AGGCTGGGGTCCT		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1485G>T	chr15.hg19:g.39880740G>T	ENSP00000260356:p.Trp495Cys	121.0	0.0	.		155.0	34.0	.	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	hg19	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116990	0.77323	.	.	ENSG00000137801	ENST00000260356	T	0.62788	0.0	5.87	5.87	0.94306	.	0.000000	0.33792	N	0.004554	D	0.87665	0.6234	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91112	0.4923	10	0.72032	D	0.01	-18.5379	20.1976	0.98245	0.0:0.0:1.0:0.0	.	495	P07996	TSP1_HUMAN	C	495	ENSP00000260356:W495C	ENSP00000260356:W495C	W	+	3	0	THBS1	37668032	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.872000	0.87187	2.772000	0.95346	0.655000	0.94253	TGG	.	.	.	none		0.498	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
PLA2G4F	255189	hgsc.bcm.edu	37	15	42445858	42445858	+	Splice_Site	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr15:42445858C>T	ENST00000382396.4	-	5	537	c.451G>A	c.(451-453)Gat>Aat	p.D151N	PLA2G4F_ENST00000397272.3_Splice_Site_p.D151N			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	151					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		TCTTGTGAATCCTACATGGAG	0.552																																					p.D151N		Atlas-SNP	.											.	PLA2G4F	75	.	0			c.G451A						PASS	.						58.0	59.0	59.0					15																	42445858		2203	4299	6502	SO:0001630	splice_region_variant	255189	exon5			GTGAATCCTACAT		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.451-1G>A	chr15.hg19:g.42445858C>T		55.0	0.0	.		73.0	21.0	.	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	hg19	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	C	1.958	-0.439473	0.04636	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.62639	0.01;0.01	5.02	3.11	0.35812	C2 calcium/lipid-binding domain, CaLB (1);	0.308062	0.27375	N	0.019650	T	0.50531	0.1621	L	0.47716	1.5	0.34402	D	0.695385	B	0.15930	0.015	B	0.14023	0.01	T	0.53315	-0.8456	10	0.20519	T	0.43	-14.1627	9.8096	0.40815	0.0:0.8299:0.0:0.1701	.	151	Q68DD2	PA24F_HUMAN	N	147;151;151;151;151	ENSP00000380442:D151N;ENSP00000371833:D151N	ENSP00000290497:D147N	D	-	1	0	PLA2G4F	40233150	0.888000	0.30383	0.829000	0.32907	0.013000	0.08279	1.256000	0.32921	0.770000	0.33336	-0.140000	0.14226	GAT	.	.	.	none		0.552	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	Missense_Mutation
C16orf91	283951	hgsc.bcm.edu	37	16	1470405	1470405	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr16:1470405G>A	ENST00000442039.2	-	2	317	c.241C>T	c.(241-243)Ccc>Tcc	p.P81S	C16orf91_ENST00000563974.1_Missense_Mutation_p.P14S|C16orf91_ENST00000310355.1_Missense_Mutation_p.P238S	NM_001272051.1	NP_001258980.1	Q4G0I0	CSMT1_HUMAN	chromosome 16 open reading frame 91	81						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11						CAGCTGAGGGGCAGCACCTTC	0.627																																					p.P81S		Atlas-SNP	.											.	C16orf91	19	.	0			c.C241T						PASS	.						103.0	97.0	99.0					16																	1470405		2199	4300	6499	SO:0001583	missense	283951	exon2			TGAGGGGCAGCAC	BC023590	CCDS61789.1	16p13.3	2012-10-10			ENSG00000174109	ENSG00000174109			27558	protein-coding gene	gene with protein product	"""cattle cerebrum and skeletal muscle-specific protein 1 family member"""						Standard	NM_001272051		Approved	gs103, CCSMST1	uc002clr.4	Q4G0I0		ENST00000442039.2:c.241C>T	chr16.hg19:g.1470405G>A	ENSP00000413100:p.Pro81Ser	121.0	0.0	.		142.0	19.0	.	NM_001272051	Q96RZ0	Missense_Mutation	SNP	ENST00000442039.2	hg19		.	.	.	.	.	.	.	.	.	.	G	17.57	3.422356	0.62622	.	.	ENSG00000174109	ENST00000442039;ENST00000310355	.	.	.	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000005	T	0.79003	0.4373	.	.	.	0.43756	D	0.996266	D	0.89917	1.0	D	0.91635	0.999	T	0.81210	-0.1036	8	0.66056	D	0.02	-23.2505	14.4962	0.67688	0.0:0.0:1.0:0.0	.	81	Q4G0I0	CSMT1_HUMAN	S	81;238	.	ENSP00000311390:P238S	P	-	1	0	C16orf91	1410406	1.000000	0.71417	0.994000	0.49952	0.062000	0.15995	4.723000	0.61965	2.492000	0.84095	0.655000	0.94253	CCC	.	.	.	none		0.627	C16orf91-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432502.1	NM_001010878	
TMEM132E	124842	hgsc.bcm.edu	37	17	32956193	32956193	+	Silent	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr17:32956193G>A	ENST00000321639.5	+	5	1366	c.1038G>A	c.(1036-1038)cgG>cgA	p.R346R		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	346						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCATTCAGCGGGATGTGCAAG	0.592																																					p.R346R		Atlas-SNP	.											.	TMEM132E	122	.	0			c.G1038A						PASS	.						58.0	47.0	51.0					17																	32956193		2203	4300	6503	SO:0001819	synonymous_variant	124842	exon5			TCAGCGGGATGTG	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1038G>A	chr17.hg19:g.32956193G>A		83.0	0.0	.		97.0	23.0	.	NM_207313	Q8WUF4|Q8WVA5	Silent	SNP	ENST00000321639.5	hg19	CCDS11283.1																																																																																			.	.	.	none		0.592	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256440.2	NM_207313	
XYLT2	64132	hgsc.bcm.edu	37	17	48433616	48433616	+	Silent	SNP	G	G	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr17:48433616G>T	ENST00000017003.2	+	7	1525	c.1476G>T	c.(1474-1476)cgG>cgT	p.R492R	XYLT2_ENST00000507602.1_Silent_p.R492R	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	492					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					ACTTCCTCCGGCTGCAGGTGC	0.607																																					p.R492R		Atlas-SNP	.											.	XYLT2	51	.	0			c.G1476T						PASS	.						51.0	49.0	50.0					17																	48433616		2203	4300	6503	SO:0001819	synonymous_variant	64132	exon7			CCTCCGGCTGCAG	AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1476G>T	chr17.hg19:g.48433616G>T		52.0	0.0	.		80.0	18.0	.	NM_022167	Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	hg19	CCDS11563.1																																																																																			.	.	.	none		0.607	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	NM_022167	
LRRC59	55379	hgsc.bcm.edu	37	17	48472322	48472322	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr17:48472322C>G	ENST00000225972.7	-	2	368	c.133G>C	c.(133-135)Gat>Cat	p.D45H	RP1-117B12.4_ENST00000511627.1_RNA	NM_018509.3	NP_060979.2	Q96AG4	LRC59_HUMAN	leucine rich repeat containing 59	45						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CAAGACAGATCCAGGATGGTG	0.468																																					p.D45H		Atlas-SNP	.											.	LRRC59	23	.	0			c.G133C						PASS	.						114.0	95.0	101.0					17																	48472322		2203	4300	6503	SO:0001583	missense	55379	exon2			ACAGATCCAGGAT	AK025328	CCDS11566.1	17q21.33	2014-02-12	2006-01-12		ENSG00000108829	ENSG00000108829			28817	protein-coding gene	gene with protein product		614854				12477932	Standard	NM_018509		Approved	PRO1855, FLJ21675	uc002iqt.3	Q96AG4	OTTHUMG00000162079	ENST00000225972.7:c.133G>C	chr17.hg19:g.48472322C>G	ENSP00000225972:p.Asp45His	172.0	0.0	.		207.0	36.0	.	NM_018509	B2RE83|D3DTX8|Q9P189	Missense_Mutation	SNP	ENST00000225972.7	hg19	CCDS11566.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055916	0.93793	.	.	ENSG00000108829	ENST00000225972	T	0.31510	1.49	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.58538	0.2129	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60979	-0.7155	10	0.62326	D	0.03	.	19.1981	0.93698	0.0:1.0:0.0:0.0	.	45	Q96AG4	LRC59_HUMAN	H	45	ENSP00000225972:D45H	ENSP00000225972:D45H	D	-	1	0	LRRC59	45827321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.589000	0.82641	2.615000	0.88500	0.655000	0.94253	GAT	.	.	.	none		0.468	LRRC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367117.2	NM_018509	
SMAD4	4089	hgsc.bcm.edu	37	18	48575090	48575090	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr18:48575090A>G	ENST00000342988.3	+	3	822	c.284A>G	c.(283-285)tAt>tGt	p.Y95C	SMAD4_ENST00000452201.2_Missense_Mutation_p.Y95C|SMAD4_ENST00000398417.2_Missense_Mutation_p.Y95C|SMAD4_ENST00000588745.1_Missense_Mutation_p.Y95C|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	95	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)|p.Y95S(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CATGTGATCTATGCCCGTCTC	0.368																																					p.Y95C		Atlas-SNP	.											SMAD4,colon,carcinoma,+1,1	SMAD4	822	.	41	Whole gene deletion(36)|Unknown(4)|Substitution - Missense(1)	pancreas(27)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	c.A284G						PASS	.						155.0	142.0	146.0					18																	48575090		2203	4300	6503	SO:0001583	missense	4089	exon3			TGATCTATGCCCG	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.284A>G	chr18.hg19:g.48575090A>G	ENSP00000341551:p.Tyr95Cys	140.0	0.0	.		130.0	28.0	.	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	hg19	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.409676	0.83340	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	T;T;T	0.72615	-0.67;-0.67;-0.67	5.32	5.32	0.75619	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.83294	0.5223	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85571	0.1234	10	0.87932	D	0	.	14.2563	0.66053	1.0:0.0:0.0:0.0	.	95	Q13485	SMAD4_HUMAN	C	95	ENSP00000409551:Y95C;ENSP00000341551:Y95C;ENSP00000381452:Y95C	ENSP00000341551:Y95C	Y	+	2	0	SMAD4	46829088	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.309000	0.96252	1.992000	0.58205	0.477000	0.44152	TAT	.	.	.	none		0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
ST8SIA3	51046	hgsc.bcm.edu	37	18	55021740	55021740	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr18:55021740C>T	ENST00000324000.3	+	2	2321	c.287C>T	c.(286-288)gCg>gTg	p.A96V		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	96					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		AATCGGACAGCGTTTTTACAT	0.383																																					p.A96V		Atlas-SNP	.											.	ST8SIA3	73	.	0			c.C287T						PASS	.						103.0	102.0	103.0					18																	55021740		2203	4300	6503	SO:0001583	missense	51046	exon2			GGACAGCGTTTTT	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.287C>T	chr18.hg19:g.55021740C>T	ENSP00000320431:p.Ala96Val	110.0	0.0	.		98.0	27.0	.	NM_015879	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	hg19	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269186	0.23221	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.48836	0.8	4.88	4.88	0.63580	.	0.101382	0.64402	D	0.000002	T	0.38081	0.1027	L	0.52573	1.65	0.80722	D	1	P	0.41710	0.76	B	0.30251	0.113	T	0.33548	-0.9864	10	0.30078	T	0.28	-29.0489	16.1712	0.81817	0.0:1.0:0.0:0.0	.	96	O43173	SIA8C_HUMAN	V	203;96	ENSP00000320431:A96V	ENSP00000320431:A96V	A	+	2	0	ST8SIA3	53172738	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.952000	0.75989	2.409000	0.81822	0.467000	0.42956	GCG	.	.	.	none		0.383	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
ZFR2	23217	hgsc.bcm.edu	37	19	3827588	3827588	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr19:3827588C>T	ENST00000262961.4	-	6	926	c.916G>A	c.(916-918)Gtg>Atg	p.V306M		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	306							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TTGGGCTGCACGCCTGTCTTC	0.701																																					p.V306M		Atlas-SNP	.											.	ZFR2	63	.	0			c.G916A						PASS	.						18.0	20.0	19.0					19																	3827588		1963	4109	6072	SO:0001583	missense	23217	exon6			GCTGCACGCCTGT	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.916G>A	chr19.hg19:g.3827588C>T	ENSP00000262961:p.Val306Met	111.0	0.0	.		169.0	25.0	.	NM_015174		Missense_Mutation	SNP	ENST00000262961.4	hg19	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	C	4.450	0.083351	0.08533	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15017	3.23;2.46	3.12	-6.24	0.02046	.	1.917410	0.03859	U	0.273735	T	0.17959	0.0431	M	0.61703	1.905	0.26249	N	0.978759	B	0.16166	0.016	B	0.14578	0.011	T	0.17684	-1.0361	10	0.44086	T	0.13	.	8.8172	0.35002	0.0:0.5586:0.2486:0.1928	.	306	Q9UPR6	ZFR2_HUMAN	M	306	ENSP00000262961:V306M;ENSP00000388974:V306M	ENSP00000262961:V306M	V	-	1	0	ZFR2	3778588	0.000000	0.05858	0.000000	0.03702	0.414000	0.31173	-0.677000	0.05215	-2.453000	0.00541	-0.873000	0.02984	GTG	.	.	.	none		0.701	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
AP1M2	10053	hgsc.bcm.edu	37	19	10692495	10692495	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr19:10692495G>C	ENST00000250244.6	-	4	409	c.327C>G	c.(325-327)atC>atG	p.I109M	AP1M2_ENST00000590923.1_Missense_Mutation_p.I109M	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	109					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ACTCGTAGACGATGACAAAGT	0.567																																					p.I109M		Atlas-SNP	.											.	AP1M2	35	.	0			c.C327G						PASS	.						79.0	80.0	79.0					19																	10692495		2203	4300	6503	SO:0001583	missense	10053	exon4			GTAGACGATGACA	AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.327C>G	chr19.hg19:g.10692495G>C	ENSP00000250244:p.Ile109Met	59.0	0.0	.		98.0	18.0	.	NM_005498	B2RDV5|Q9BSI8	Missense_Mutation	SNP	ENST00000250244.6	hg19	CCDS45964.1	.	.	.	.	.	.	.	.	.	.	g	16.45	3.126621	0.56721	.	.	ENSG00000129354	ENST00000250244	T	0.65732	-0.17	4.94	-3.21	0.05140	Longin-like (1);AP complex, mu/sigma subunit (1);	0.058938	0.64402	D	0.000002	T	0.74997	0.3790	M	0.89534	3.04	0.42849	D	0.994078	P;P	0.51449	0.805;0.945	P;P	0.59288	0.573;0.855	T	0.78370	-0.2230	10	0.72032	D	0.01	-35.9898	10.6557	0.45673	0.7224:0.0:0.2776:0.0	.	109;109	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	M	109	ENSP00000250244:I109M	ENSP00000250244:I109M	I	-	3	3	AP1M2	10553495	0.000000	0.05858	0.895000	0.35142	0.907000	0.53573	-1.827000	0.01704	-0.263000	0.09378	-0.350000	0.07774	ATC	.	.	.	none		0.567	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452034.1		
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E		Atlas-SNP	.											PRKCSH,caecum,carcinoma,0,1	PRKCSH	55	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A						PASS	.						27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	chr19.hg19:g.11558370G>A		112.0	1.0	.		135.0	6.0	.	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.	.	weak		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
FBXW9	84261	hgsc.bcm.edu	37	19	12805525	12805525	+	Silent	SNP	G	G	T	rs10416965	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr19:12805525G>T	ENST00000380339.3	-	3	597	c.561C>A	c.(559-561)ctC>ctA	p.L187L	FBXW9_ENST00000393261.3_Silent_p.L187L|FBXW9_ENST00000587955.1_Silent_p.L177L|FBXW9_ENST00000544494.1_De_novo_Start_OutOfFrame			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	187					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						CCGACAGACAGAGTGACCCAC	0.632																																					p.L187L		Atlas-SNP	.											.	FBXW9	30	.	0			c.C561A						PASS	.						62.0	68.0	66.0					19																	12805525		2049	4197	6246	SO:0001819	synonymous_variant	84261	exon3			CAGACAGAGTGAC	BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.561C>A	chr19.hg19:g.12805525G>T		92.0	0.0	.		137.0	26.0	.	NM_032301	B3KVP7|Q9BT89	Silent	SNP	ENST00000380339.3	hg19																																																																																				.	G|0.921;C|0.079	.	alt		0.632	FBXW9-201	KNOWN	basic	protein_coding	protein_coding		NM_032301	
PRNP	5621	hgsc.bcm.edu	37	20	4680620	4680620	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr20:4680620G>T	ENST00000379440.4	+	2	1041	c.754G>T	c.(754-756)Gtg>Ttg	p.V252L	PRNP_ENST00000430350.2_Missense_Mutation_p.V252L	NM_000311.3|NM_001080121.1|NM_001080122.1|NM_001080123.1|NM_001271561.1|NM_183079.2	NP_000302.1|NP_001073590.1|NP_001073591.1|NP_001073592.1|NP_001258490.1|NP_898902.1	F7VJQ1	APRIO_HUMAN	prion protein	0						integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	14						CTTCCTGATAGTGGGATGAGG	0.502																																					p.V252L		Atlas-SNP	.											.	PRNP	31	.	0			c.G754T						PASS	.						43.0	41.0	42.0					20																	4680620		2203	4300	6503	SO:0001583	missense	5621	exon2			CTGATAGTGGGAT	M13899	CCDS13080.1	20p13	2014-06-05	2008-07-28		ENSG00000171867	ENSG00000171867		"""CD molecules"""	9449	protein-coding gene	gene with protein product	"""Creutzfeldt-Jakob disease"", ""Gerstmann-Strausler-Scheinker syndrome"", ""fatal familial insomnia"", ""p27-30"""	176640	"""prion protein (p27-30)"""	PRIP, GSS, CJD			Standard	NM_000311		Approved	CD230, PRP, AltPrP	uc002wkw.4	F7VJQ1	OTTHUMG00000031786	ENST00000379440.4:c.754G>T	chr20.hg19:g.4680620G>T	ENSP00000368752:p.Val252Leu	133.0	0.0	.		167.0	33.0	.	NM_000311		Missense_Mutation	SNP	ENST00000379440.4	hg19	CCDS13080.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424622	0.62733	.	.	ENSG00000171867	ENST00000379440;ENST00000430350;ENST00000444805	D;D	0.91894	-2.93;-2.93	5.1	5.1	0.69264	.	0.293440	0.24278	N	0.039928	D	0.94725	0.8298	L	0.57536	1.79	0.33382	D	0.575028	D;D	0.63046	0.992;0.992	D;D	0.77004	0.989;0.989	D	0.96382	0.9282	10	0.87932	D	0	-9.4323	13.8882	0.63721	0.0:0.0:1.0:0.0	.	252;284	P04156;O75942	PRIO_HUMAN;.	L	252;252;191	ENSP00000368752:V252L;ENSP00000399376:V252L	ENSP00000368752:V252L	V	+	1	0	PRNP	4628620	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.706000	0.61845	2.654000	0.90174	0.655000	0.94253	GTG	.	.	.	none		0.502	PRNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077820.2	NM_000311	
TRIOBP	11078	hgsc.bcm.edu	37	22	38119756	38119756	+	Missense_Mutation	SNP	A	A	G	rs71322688|rs67890459|rs201160789|rs77530465|rs55745992	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr22:38119756A>G	ENST00000406386.3	+	7	1448	c.1193A>G	c.(1192-1194)cAa>cGa	p.Q398R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	398					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.Q398R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGAACCACTCAACGAGAGAAT	0.552																																					p.Q398R		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,1	TRIOBP	262	.	1	Substitution - Missense(1)	lung(1)	c.A1193G						PASS	.						117.0	100.0	106.0					22																	38119756		1849	3515	5364	SO:0001583	missense	11078	exon7			CCACTCAACGAGA	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1193A>G	chr22.hg19:g.38119756A>G	ENSP00000384312:p.Gln398Arg	73.0	0.0	.		83.0	6.0	.	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	A	7.038	0.561918	0.13498	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.33216	1.42	2.53	2.53	0.30540	.	.	.	.	.	T	0.27629	0.0679	L	0.44542	1.39	0.09310	N	0.99999	P	0.47604	0.898	P	0.47402	0.546	T	0.07578	-1.0765	9	0.21540	T	0.41	.	5.6825	0.17784	0.7186:0.2814:0.0:0.0	.	398	Q9H2D6	TARA_HUMAN	R	398	ENSP00000384312:Q398R	ENSP00000384312:Q398R	Q	+	2	0	TRIOBP	36449702	0.002000	0.14202	0.064000	0.19789	0.071000	0.16799	0.831000	0.27476	1.186000	0.42985	0.165000	0.16767	CAA	.	.	.	alt		0.552	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
SHANK3	85358	hgsc.bcm.edu	37	22	51159397	51159397	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr22:51159397T>C	ENST00000414786.2	+	21	3321	c.3094T>C	c.(3094-3096)Tcc>Ccc	p.S1032P	SHANK3_ENST00000262795.3_Missense_Mutation_p.S1062P|SHANK3_ENST00000445220.2_Missense_Mutation_p.S1048P			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1046					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GGATCTGCCATCCCTACAGCC	0.761																																					p.S1032P		Atlas-SNP	.											.	SHANK3	96	.	0			c.T3094C						PASS	.						8.0	11.0	10.0					22																	51159397		1831	3948	5779	SO:0001583	missense	85358	exon21			CTGCCATCCCTAC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3094T>C	chr22.hg19:g.51159397T>C	ENSP00000464552:p.Ser1032Pro	57.0	0.0	.		49.0	14.0	.	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	T	13.67	2.306121	0.40795	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.69175	-0.38;-0.38	4.24	4.24	0.50183	.	0.119241	0.64402	D	0.000016	T	0.73225	0.3560	M	0.63428	1.95	0.25860	N	0.983833	D;B;D	0.65815	0.963;0.013;0.995	P;B;P	0.56278	0.63;0.012;0.795	T	0.67090	-0.5758	10	0.62326	D	0.03	.	11.3209	0.49421	0.0:0.0:0.0:1.0	.	1046;1047;1062	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	P	1062;1048	ENSP00000442518:S1062P;ENSP00000446078:S1048P	ENSP00000442518:S1062P	S	+	1	0	SHANK3	49506263	1.000000	0.71417	0.988000	0.46212	0.602000	0.36980	3.791000	0.55469	1.563000	0.49615	0.260000	0.18958	TCC	.	.	.	none		0.761	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SLC16A2	6567	hgsc.bcm.edu	37	X	73641736	73641736	+	Silent	SNP	C	C	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chrX:73641736C>T	ENST00000587091.1	+	1	441	c.264C>T	c.(262-264)acC>acT	p.T88T	SLC16A2_ENST00000276033.5_Silent_p.T162T	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	88					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	CCCGCGGCACCGCGCGCGGCT	0.692																																					p.T88T		Atlas-SNP	.											.	SLC16A2	54	.	0			c.C264T						PASS	.						13.0	15.0	14.0					X																	73641736		2187	4269	6456	SO:0001819	synonymous_variant	6567	exon1			CGGCACCGCGCGC		CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.264C>T	chrX.hg19:g.73641736C>T		72.0	0.0	.		110.0	37.0	.	NM_006517	Q7Z797	Silent	SNP	ENST00000587091.1	hg19	CCDS14426.2																																																																																			.	.	.	none		0.692	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057266.3		
MT-CO3	4514	hgsc.bcm.edu	37	M	9966	9966	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chrM:9966G>C	ENST00000362079.2	+	1	760	c.760G>C	c.(760-762)Gtc>Ctc	p.V254L	MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	254			V -> I. {ECO:0000269|PubMed:1757091}.		aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						TATTTCTGTATGTCTCCATCT	0.358																																					p.V254L		Atlas-SNP	.											.	.	.	.	0			c.G760C						PASS	.																																			SO:0001583	missense	5742	exon1			CTGTATGTCTCCA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.760G>C	chrM.hg19:g.9966G>C	ENSP00000354982:p.Val254Leu	22.0	0.0	.		141.0	36.0	.	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.	.	none		0.358	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
MT-ND5	4540	hgsc.bcm.edu	37	M	13466	13466	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chrM:13466G>A	ENST00000361567.2	+	1	1130	c.1130G>A	c.(1129-1131)aGc>aAc	p.S377N	MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	377					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CACCATTGGCAGCCTAGCATT	0.448																																					p.S377N		Atlas-SNP	.											.	.	.	.	0			c.G1130A						PASS	.																																			SO:0001583	missense	0	exon1			TTGGCAGCCTAGC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1130G>A	chrM.hg19:g.13466G>A	ENSP00000354813:p.Ser377Asn	22.0	0.0	.		125.0	9.0	.	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.448	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-CYB	4519	hgsc.bcm.edu	37	M	14973	14973	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chrM:14973G>A	ENST00000361789.2	+	1	227	c.227G>A	c.(226-228)gGc>gAc	p.G76D	MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	76					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CGTAAATTATGGCTGAATCAT	0.483																																					p.G76D		Atlas-SNP	.											.	.	.	.	0			c.G227A						PASS	.																																			SO:0001583	missense	0	exon1			ATTATGGCTGAAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.227G>A	chrM.hg19:g.14973G>A	ENSP00000354554:p.Gly76Asp	54.0	0.0	.		199.0	9.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.483	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SBF2	81846	hgsc.bcm.edu	37	11	10011141	10011146	+	Splice_Site	DEL	AACTAG	AACTAG	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	AACTAG	AACTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr11:10011141_10011146delAACTAG	ENST00000256190.8	-	13	1434_1435	c.1297_1298delCTAGTT	c.(1297-1299)cta>a	p.L433del		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	433					cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		AAAGGCTACCAACTAGGAAAAAGAAT	0.316																																					p.433_433del		Atlas-Indel,Pindel	.											SBF2,colon,carcinoma,0,1	SBF2	146	.	0			c.1297_1299del						PASS	.																																			SO:0001630	splice_region_variant	81846	exon13			.	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.1297-1CTAGTT>-	chr11.hg19:g.10011141_10011146delAACTAG		80.0	0.0	0		84.0	11.0	0.130952	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	In_Frame_Del	DEL	ENST00000256190.8	hg19	CCDS31427.1																																																																																			.	.	.	none		0.316	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	In_Frame_Del
PPP2R3C	55012	hgsc.bcm.edu	37	14	35554933	35554940	+	Frame_Shift_Del	DEL	GAAGAGAG	GAAGAGAG	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	GAAGAGAG	GAAGAGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr14:35554933_35554940delGAAGAGAG	ENST00000261475.5	-	13	1571_1578	c.1218_1225delCTCTCTTC	c.(1216-1227)atctctcttcagfs	p.SLQ407fs		NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	407					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.I406I(1)		central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		ATTAAATCCTGAAGAGAGATTTTCAAAG	0.351																																					p.407_409del		Atlas-Indel,Pindel	.											.	PPP2R3C	44	.	1	Substitution - coding silent(1)	large_intestine(1)	c.1219_1226del						PASS	.																																			SO:0001589	frameshift_variant	55012	exon13			.	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.1218_1225delCTCTCTTC	chr14.hg19:g.35554933_35554940delGAAGAGAG	ENSP00000261475:p.Ser407fs	107.0	0.0	0		97.0	15.0	0.154639	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Frame_Shift_Del	DEL	ENST00000261475.5	hg19	CCDS9654.1																																																																																			.	.	.	none		0.351	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
CHTF18	63922	hgsc.bcm.edu	37	16	847004	847006	+	In_Frame_Del	DEL	TTG	TTG	-	rs200430443	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	TTG	TTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr16:847004_847006delTTG	ENST00000262315.9	+	20	2708_2710	c.2645_2647delTTG	c.(2644-2649)attggg>agg	p.882_883IG>R	CHTF18_ENST00000317063.6_In_Frame_Del_p.1091_1092IG>R|CHTF18_ENST00000455171.2_In_Frame_Del_p.910_911IG>R	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	882					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CTGGGGGGCATTGGGGAGAAAGG	0.65																																					p.882_882del		Atlas-Indel,Pindel	.											.	CHTF18	52	.	0			c.2644_2646del						PASS	.																																			SO:0001651	inframe_deletion	63922	exon20			.	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2645_2647delTTG	chr16.hg19:g.847004_847006delTTG	ENSP00000262315:p.Ile882_Gly883delinsArg	120.0	0.0	0		113.0	14.0	0.123894	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	In_Frame_Del	DEL	ENST00000262315.9	hg19	CCDS45371.1																																																																																			.	.	.	none		0.650	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
SLC26A1	10861	hgsc.bcm.edu	37	4	982757	982759	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr4:982757_982759delAGA	ENST00000361661.2	-	4	2345_2347	c.1968_1970delTCT	c.(1966-1971)attctg>atg	p.656_657IL>M	IDUA_ENST00000453894.1_Intron|IDUA_ENST00000247933.4_Intron|SLC26A1_ENST00000513138.1_5'Flank|SLC26A1_ENST00000398520.2_Intron|SLC26A1_ENST00000398516.2_In_Frame_Del_p.656_657IL>M|IDUA_ENST00000509744.1_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	656	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TCCTCTGCTCAGAATGTCTCTCA	0.68																																					p.657_657del		Atlas-Indel,Pindel	.											.	SLC26A1	44	.	0			c.1969_1971del						PASS	.																																			SO:0001651	inframe_deletion	10861	exon3			.	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.1968_1970delTCT	chr4.hg19:g.982757_982759delAGA	ENSP00000354721:p.Ile656_Leu657delinsMet	178.0	0.0	0		177.0	40.0	0.225989	NM_022042	A8K9N2|Q7Z5R3|Q96BK0	In_Frame_Del	DEL	ENST00000361661.2	hg19	CCDS33934.1																																																																																			.	.	.	none		0.680	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
PIK3R3	8503	hgsc.bcm.edu	37	1	46532743	46532743	+	Frame_Shift_Del	DEL	A	A	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:46532743delA	ENST00000262741.5	-	4	1024	c.335delT	c.(334-336)ttafs	p.L112fs	PIK3R3_ENST00000372006.1_Frame_Shift_Del_p.L112fs|PIK3R3_ENST00000340332.6_Frame_Shift_Del_p.L76fs|PIK3R3_ENST00000420542.1_Frame_Shift_Del_p.L112fs|PIK3R3_ENST00000540385.1_Frame_Shift_Del_p.L158fs|PIK3R3_ENST00000354242.4_Frame_Shift_Del_p.L112fs|PIK3R3_ENST00000423209.1_Frame_Shift_Del_p.L112fs	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	112	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	GATCTTTATTAACTTATTATT	0.388																																					p.L112fs		Atlas-Indel,Pindel	.											.	PIK3R3	41	.	0			c.336delA						PASS	.						166.0	158.0	161.0					1																	46532743		2203	4300	6503	SO:0001589	frameshift_variant	8503	exon4			.	BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.335delT	chr1.hg19:g.46532743delA	ENSP00000262741:p.Leu112fs	153.0	0.0	0		185.0	38.0	0.205405	NM_003629	B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Frame_Shift_Del	DEL	ENST00000262741.5	hg19	CCDS529.1																																																																																			.	.	.	none		0.388	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022171.1	NM_003629	
KRT2	3849	hgsc.bcm.edu	37	12	53045631	53045632	+	In_Frame_Ins	INS	-	-	CGCCTCCAAAGCCGCTGC			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr12:53045631_53045632insCGCCTCCAAAGCCGCTGC	ENST00000309680.3	-	1	316_317	c.295_296insGCAGCGGCTTTGGAGGCG	c.(295-297)ggc>gGCAGCGGCTTTGGAGGCGgc	p.99_99G>GSGFGGG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	99	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		aaagctgctgccgcctccaaaa	0.619																																					p.G99delinsGSGFGGG		Atlas-INDEL	.											.	KRT2	94	.	0			c.296_297insGCAGCGGCTTTGGAGGCG						PASS	.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.295_296insGCAGCGGCTTTGGAGGCG	chr12.hg19:g.53045631_53045632insCGCCTCCAAAGCCGCTGC	Exception_encountered	186.0	0.0	0		248.0	47.0	0.189516	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.	.	none		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
HECW1	23072	hgsc.bcm.edu	37	7	43547666	43547672	+	Frame_Shift_Del	DEL	ATGGCCT	ATGGCCT	-	rs142279539	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	ATGGCCT	ATGGCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr7:43547666_43547672delATGGCCT	ENST00000395891.2	+	23	4407_4413	c.3802_3808delATGGCCT	c.(3802-3810)atggcctatfs	p.MAY1268fs	AC011738.4_ENST00000436105.1_RNA|HECW1_ENST00000453890.1_Frame_Shift_Del_p.MAY1234fs	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1268					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CAATCAGGTGATGGCCTATTCGCGGAA	0.536																																					p.1267_1269del		Atlas-INDEL	.											.	HECW1	540	.	0			c.3801_3807del						PASS	.																																			SO:0001589	frameshift_variant	23072	exon23			.	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3802_3808delATGGCCT	chr7.hg19:g.43547666_43547672delATGGCCT	ENSP00000379228:p.Met1268fs	124.0	0.0	0		112.0	16.0	0.142857	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Frame_Shift_Del	DEL	ENST00000395891.2	hg19	CCDS5469.2																																																																																			.	.	.	none		0.536	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
COL4A6	1288	hgsc.bcm.edu	37	X	107453231	107453231	+	Frame_Shift_Del	DEL	C	C	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chrX:107453231delC	ENST00000372216.4	-	8	617	c.517delG	c.(517-519)gatfs	p.D173fs	COL4A6_ENST00000394872.2_Intron|COL4A6_ENST00000538570.1_Frame_Shift_Del_p.D172fs|COL4A6_ENST00000334504.7_Frame_Shift_Del_p.D172fs|COL4A6_ENST00000545689.1_Frame_Shift_Del_p.D172fs	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	173	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGCCCAGGATCCCCCTGAGAA	0.388									Alport syndrome with Diffuse Leiomyomatosis																												p.D173fs	Melanoma(87;1895 1945 2589 7165)	Atlas-Indel,Pindel	.											.	COL4A6	270	.	0			c.518delA						PASS	.						106.0	97.0	100.0					X																	107453231		2203	4300	6503	SO:0001589	frameshift_variant	1288	exon8	Familial Cancer Database		.	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.517delG	chrX.hg19:g.107453231delC	ENSP00000361290:p.Asp173fs	522.0	0.0	0		621.0	271.0	0.436393	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Frame_Shift_Del	DEL	ENST00000372216.4	hg19	CCDS14541.1																																																																																			.	.	.	none		0.388	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
PLD5	200150	hgsc.bcm.edu	37	1	242511425	242511426	+	Frame_Shift_Ins	INS	-	-	T			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:242511425_242511426insT	ENST00000536534.2	-	2	549_550	c.308_309insA	c.(307-309)aatfs	p.N103fs	PLD5_ENST00000442594.2_Frame_Shift_Ins_p.I9fs|PLD5_ENST00000427495.1_Frame_Shift_Ins_p.N41fs			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	103						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TATTTTGGCAATTTTTTTCTGA	0.446																																					p.N103fs		Atlas-Indel,Pindel	.											.	PLD5	216	.	0			c.309_310insA						PASS	.																																			SO:0001589	frameshift_variant	200150	exon3			.	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.309dupA	chr1.hg19:g.242511432_242511432dupT	ENSP00000440896:p.Asn103fs	68.0	0.0	0		94.0	18.0	0.191489	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Frame_Shift_Ins	INS	ENST00000536534.2	hg19	CCDS1621.2																																																																																			.	.	.	none		0.446	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
FBN2	2201	hgsc.bcm.edu	37	5	127636522	127636522	+	Frame_Shift_Del	DEL	G	G	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr5:127636522delG	ENST00000508053.1	-	54	7127	c.6153delC	c.(6151-6153)agcfs	p.S2051fs	FBN2_ENST00000262464.4_Frame_Shift_Del_p.S2051fs			P35556	FBN2_HUMAN	fibrillin 2	2051	EGF-like 34; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGCAGTTCTCGCTTTTTACTT	0.463																																					p.E2052fs		Atlas-Indel,Pindel	.											.	FBN2	858	.	0			c.6154delG						PASS	.						122.0	113.0	116.0					5																	127636522		2203	4300	6503	SO:0001589	frameshift_variant	2201	exon48			.	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6153delC	chr5.hg19:g.127636522delG	ENSP00000424571:p.Ser2051fs	72.0	0.0	0		94.0	18.0	0.191489	NM_001999	B4DU01|Q59ES6	Frame_Shift_Del	DEL	ENST00000508053.1	hg19	CCDS34222.1																																																																																			.	.	.	none		0.463	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
HSD11B1	3290	hgsc.bcm.edu	37	1	209880345	209880347	+	In_Frame_Del	DEL	ATG	ATG	-	rs578197035		TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr1:209880345_209880347delATG	ENST00000367028.2	+	5	558_560	c.389_391delATG	c.(388-393)catgat>cat	p.D132del	HSD11B1_ENST00000367027.3_In_Frame_Del_p.D132del|RP1-28O10.1_ENST00000441672.1_RNA|HSD11B1_ENST00000261465.1_In_Frame_Del_p.D132del	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1	132					glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	AATCTTTTTCATGATGATATTCA	0.443																																					p.130_130del		Atlas-Indel,Pindel	.											HSD11B1,NS,malignant_melanoma,0,1	HSD11B1	35	.	0			c.388_390del						PASS	.																																			SO:0001651	inframe_deletion	3290	exon4			.	BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.389_391delATG	chr1.hg19:g.209880348_209880350delATG	ENSP00000355995:p.Asp132del	113.0	0.0	0		172.0	36.0	0.209302	NM_005525	B2R9Z1|D3DT89	In_Frame_Del	DEL	ENST00000367028.2	hg19	CCDS1489.1																																																																																			.	.	.	none		0.443	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088743.2	NM_005525	
TTF1	7270	hgsc.bcm.edu	37	9	135277608	135277625	+	In_Frame_Del	DEL	CAGAAAGCCAGGACTCCT	CAGAAAGCCAGGACTCCT	-			TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	CAGAAAGCCAGGACTCCT	CAGAAAGCCAGGACTCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr9:135277608_135277625delCAGAAAGCCAGGACTCCT	ENST00000334270.2	-	2	623_640	c.584_601delAGGAGTCCTGGCTTTCTG	c.(583-603)gaggagtcctggctttctgtg>gtg	p.EESWLS195del		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	195	N-terminal region (NRD). {ECO:0000250}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CCTGGACCCACAGAAAGCCAGGACTCCTCCTGGTGGGA	0.468																																					p.195_201del		Atlas-Indel,Pindel	.											.	TTF1	82	.	0			c.585_602del						PASS	.																																			SO:0001651	inframe_deletion	7270	exon2			.	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.584_601delAGGAGTCCTGGCTTTCTG	chr9.hg19:g.135277608_135277625delCAGAAAGCCAGGACTCCT	ENSP00000333920:p.Glu195_Ser200del	62.0	0.0	0		69.0	10.0	0.144928	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	In_Frame_Del	DEL	ENST00000334270.2	hg19	CCDS6948.1																																																																																			.	.	.	none		0.468	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
MTRR	4552	hgsc.bcm.edu	37	5	7897216	7897229	+	Frame_Shift_Del	DEL	CTCATCTAAAGGTT	CTCATCTAAAGGTT	-	rs114259126	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	CTCATCTAAAGGTT	CTCATCTAAAGGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr5:7897216_7897229delCTCATCTAAAGGTT	ENST00000264668.2	+	14	1919_1932	c.1889_1902delCTCATCTAAAGGTT	c.(1888-1902)actcatctaaaggttfs	p.THLKV630fs	MTRR_ENST00000440940.2_Frame_Shift_Del_p.THLKV603fs	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	630					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GGGATCTTAACTCATCTAAAGGTTTCCTTCTCAA	0.43																																					p.630_634del		Atlas-Indel,Pindel	.											.	MTRR	74	.	0			c.1888_1901del						PASS	.																																			SO:0001589	frameshift_variant	4552	exon14			.	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1889_1902delCTCATCTAAAGGTT	chr5.hg19:g.7897216_7897229delCTCATCTAAAGGTT	ENSP00000264668:p.Thr630fs	189.0	0.0	0		257.0	47.0	0.182879	NM_024010	O60471|Q32MA9|Q7Z4M8	Frame_Shift_Del	DEL	ENST00000264668.2	hg19	CCDS3874.1																																																																																			.	.	.	none		0.430	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493762	77493773	+	In_Frame_Del	DEL	TGCTGCTGCTGC	TGCTGCTGCTGC	-	rs553703325|rs556445214|rs200317113	byFrequency	TCGA-F9-A97G-01A-11D-A382-10	TCGA-F9-A97G-10A-01D-A385-10	TGCTGCTGCTGC	TGCTGCTGCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b01862bd-0a0c-4961-a583-54646cad74e8	2cbd3338-65da-4ceb-9181-cf4bb8c86bc9	g.chr14:77493762_77493773delTGCTGCTGCTGC	ENST00000238647.3	-	1	1261_1272	c.363_374delGCAGCAGCAGCA	c.(361-375)cagcagcagcagcaa>caa	p.121_125QQQQQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	121	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GAgctgttgttgctgctgctgctgctgctgct	0.722																																					p.122_125del		Pindel	.											.	IRF2BPL	40	.	0			c.364_375del						PASS	.																																			SO:0001651	inframe_deletion	64207	exon1			.	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.363_374delGCAGCAGCAGCA	chr14.hg19:g.77493762_77493773delTGCTGCTGCTGC	ENSP00000238647:p.Gln121_Gln124del	42.0	0.0	.		55.0	10.0	0.182	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	ENST00000238647.3	hg19	CCDS9854.1																																																																																			.	-|0.810;TGCTGC|0.190	0.810	alt		0.722	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
