#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
JAK1	3716	hgsc.bcm.edu	37	1	65330541	65330541	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:65330541A>T	ENST00000342505.4	-	8	1353	c.1105T>A	c.(1105-1107)Ttc>Atc	p.F369I		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	369	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ATTTCAGGGAAGTAAGAAAAA	0.368			Mis		ALL																																p.F369I		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	209	.	0			c.T1105A						PASS	.						156.0	150.0	152.0					1																	65330541		1885	4123	6008	SO:0001583	missense	3716	exon8			CAGGGAAGTAAGA	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1105T>A	chr1.hg19:g.65330541A>T	ENSP00000343204:p.Phe369Ile	74.0	0.0	.		68.0	22.0	.	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.861730	0.91433	.	.	ENSG00000162434	ENST00000342505	T	0.21191	2.02	5.55	5.55	0.83447	FERM domain (1);	.	.	.	.	T	0.25382	0.0617	M	0.85462	2.755	0.52099	D	0.999945	D	0.53619	0.961	P	0.47206	0.541	T	0.10042	-1.0647	9	0.28530	T	0.3	-5.6269	16.0013	0.80294	1.0:0.0:0.0:0.0	.	369	P23458	JAK1_HUMAN	I	369	ENSP00000343204:F369I	ENSP00000343204:F369I	F	-	1	0	JAK1	65103129	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.607000	0.90891	2.247000	0.74100	0.528000	0.53228	TTC	.	.	.	none		0.368	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
SLC6A17	388662	hgsc.bcm.edu	37	1	110738291	110738291	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:110738291T>A	ENST00000331565.4	+	10	2061	c.1576T>A	c.(1576-1578)Tac>Aac	p.Y526N		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	526					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GTTCGATGACTACTCGGCCAC	0.537																																					p.Y526N		Atlas-SNP	.											.	SLC6A17	86	.	0			c.T1576A						PASS	.						107.0	88.0	94.0					1																	110738291		2203	4300	6503	SO:0001583	missense	388662	exon10			GATGACTACTCGG		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1576T>A	chr1.hg19:g.110738291T>A	ENSP00000330199:p.Tyr526Asn	73.0	0.0	.		75.0	32.0	.	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	hg19	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	T	32	5.131369	0.94473	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	D	0.81996	-1.56	5.65	5.65	0.86999	.	0.056027	0.64402	D	0.000001	D	0.92492	0.7616	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94407	0.7628	10	0.87932	D	0	.	15.8499	0.78921	0.0:0.0:0.0:1.0	.	526	Q9H1V8	S6A17_HUMAN	N	526	ENSP00000330199:Y526N	ENSP00000330199:Y526N	Y	+	1	0	SLC6A17	110539814	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.934000	0.87649	2.146000	0.66826	0.533000	0.62120	TAC	.	.	.	none		0.537	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
SIKE1	80143	hgsc.bcm.edu	37	1	115323170	115323170	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:115323170C>A	ENST00000060969.5	-	1	128	c.59G>T	c.(58-60)cGg>cTg	p.R20L	SIKE1_ENST00000506320.1_5'UTR|SIKE1_ENST00000369528.5_Missense_Mutation_p.R20L			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1	20					innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						ATCGTGCTCCCGTAGCCTCTC	0.687																																					p.R20L		Atlas-SNP	.											.	SIKE1	12	.	0			c.G59T						PASS	.						22.0	24.0	23.0					1																	115323170		2200	4298	6498	SO:0001583	missense	80143	exon1			TGCTCCCGTAGCC	AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.59G>T	chr1.hg19:g.115323170C>A	ENSP00000060969:p.Arg20Leu	53.0	0.0	.		57.0	5.0	.	NM_025073	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	Missense_Mutation	SNP	ENST00000060969.5	hg19	CCDS878.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946346	0.92593	.	.	ENSG00000052723	ENST00000369528;ENST00000060969	.	.	.	5.39	5.39	0.77823	.	0.052522	0.64402	D	0.000001	T	0.24586	0.0596	L	0.39898	1.24	0.38578	D	0.950123	P;P	0.47191	0.891;0.8	B;B	0.41764	0.331;0.366	T	0.16247	-1.0409	9	0.48119	T	0.1	-15.9215	6.8936	0.24243	0.0:0.7981:0.0:0.2019	.	20;20	Q9BRV8-2;Q9BRV8	.;SIKE1_HUMAN	L	20	.	ENSP00000060969:R20L	R	-	2	0	SIKE1	115124693	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.668000	0.46816	2.791000	0.96007	0.655000	0.94253	CGG	.	.	.	none		0.687	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033401.1	NM_025073	
TRIM46	80128	hgsc.bcm.edu	37	1	155148034	155148034	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:155148034C>G	ENST00000334634.4	+	2	236	c.236C>G	c.(235-237)tCt>tGt	p.S79C	TRIM46_ENST00000368382.1_Missense_Mutation_p.S56C|KRTCAP2_ENST00000490672.1_5'Flank|TRIM46_ENST00000368385.4_Missense_Mutation_p.S79C|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000545012.1_Intron|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000543729.1_Missense_Mutation_p.S86C|TRIM46_ENST00000392451.2_Missense_Mutation_p.S79C|TRIM46_ENST00000368383.3_Missense_Mutation_p.S79C	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	79						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGCCCACCTCTCCTGCCTCC	0.677																																					p.S79C		Atlas-SNP	.											.	TRIM46	79	.	0			c.C236G						PASS	.						56.0	55.0	55.0					1																	155148034		2203	4300	6503	SO:0001583	missense	80128	exon2			CCACCTCTCCTGC		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.236C>G	chr1.hg19:g.155148034C>G	ENSP00000334657:p.Ser79Cys	118.0	0.0	.		97.0	19.0	.	NM_025058	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	hg19	CCDS1097.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448430	0.84101	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T	0.60672	0.75;0.5;0.69;0.42;0.17;0.23	4.53	4.53	0.55603	Zinc finger, RING-type (1);	0.348037	0.29205	N	0.012829	T	0.60856	0.2301	L	0.51422	1.61	0.47547	D	0.999457	D;B;D;D;B;D	0.89917	0.998;0.014;1.0;0.999;0.014;0.999	P;B;D;P;B;D	0.68765	0.889;0.033;0.96;0.867;0.033;0.924	T	0.58567	-0.7614	10	0.33141	T	0.24	.	15.1434	0.72630	0.0:1.0:0.0:0.0	.	66;79;66;56;79;79	F5H5Z2;Q5VT61;B7Z3S2;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;.;TRI46_HUMAN;.	C	86;66;79;79;79;56;79	ENSP00000442719:S86C;ENSP00000357369:S79C;ENSP00000376245:S79C;ENSP00000357367:S79C;ENSP00000357366:S56C;ENSP00000334657:S79C	ENSP00000334657:S79C	S	+	2	0	TRIM46	153414658	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.676000	0.74498	2.222000	0.72286	0.650000	0.86243	TCT	.	.	.	none		0.677	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058	
NBAS	51594	hgsc.bcm.edu	37	2	15691634	15691634	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:15691634A>G	ENST00000281513.5	-	6	387	c.362T>C	c.(361-363)aTt>aCt	p.I121T	NBAS_ENST00000441750.1_Missense_Mutation_p.I121T	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	121					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TTTCCCAATAATGGATGTAAA	0.299																																					p.I121T		Atlas-SNP	.											.	NBAS	246	.	0			c.T362C						PASS	.						41.0	40.0	41.0					2																	15691634		2201	4297	6498	SO:0001583	missense	51594	exon6			CCAATAATGGATG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.362T>C	chr2.hg19:g.15691634A>G	ENSP00000281513:p.Ile121Thr	16.0	0.0	.		20.0	6.0	.	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	A	9.005	0.980968	0.18812	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.52526	0.66;0.66	5.66	5.66	0.87406	Quinoprotein amine dehydrogenase, beta chain-like (1);	0.283763	0.33854	N	0.004482	T	0.36026	0.0952	N	0.21448	0.665	0.23657	N	0.997182	B	0.06786	0.001	B	0.06405	0.002	T	0.36065	-0.9763	10	0.87932	D	0	.	13.4276	0.61035	1.0:0.0:0.0:0.0	.	121	A2RRP1	NBAS_HUMAN	T	121	ENSP00000413201:I121T;ENSP00000281513:I121T	ENSP00000281513:I121T	I	-	2	0	NBAS	15609085	1.000000	0.71417	0.995000	0.50966	0.472000	0.32918	4.934000	0.63491	2.144000	0.66660	0.477000	0.44152	ATT	.	.	.	none		0.299	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
SMEK2	57223	hgsc.bcm.edu	37	2	55812212	55812212	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:55812212A>G	ENST00000345102.5	-	7	1509	c.1208T>C	c.(1207-1209)aTg>aCg	p.M403T	SMEK2_ENST00000407823.3_Missense_Mutation_p.M403T|SMEK2_ENST00000272313.5_Missense_Mutation_p.M403T	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	403					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGCTTCTTGCATTACAAACTC	0.368																																					p.M403T		Atlas-SNP	.											.	SMEK2	86	.	0			c.T1208C						PASS	.						114.0	111.0	112.0					2																	55812212		2203	4300	6503	SO:0001583	missense	57223	exon7			TCTTGCATTACAA	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1208T>C	chr2.hg19:g.55812212A>G	ENSP00000339769:p.Met403Thr	77.0	0.0	.		134.0	29.0	.	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	hg19	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.325891	0.60743	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.40225	1.04;1.04;1.04	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	M	0.66939	2.045	0.80722	D	1	B;B;B;B	0.25850	0.018;0.136;0.002;0.136	B;B;B;B	0.30782	0.071;0.082;0.005;0.12	T	0.40979	-0.9534	10	0.44086	T	0.13	-11.8434	16.134	0.81465	1.0:0.0:0.0:0.0	.	403;403;403;403	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	T	403	ENSP00000272313:M403T;ENSP00000385912:M403T;ENSP00000339769:M403T	ENSP00000272313:M403T	M	-	2	0	SMEK2	55665716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.216000	0.71823	0.528000	0.53228	ATG	.	.	.	none		0.368	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
ADD2	119	hgsc.bcm.edu	37	2	70903901	70903901	+	Intron	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:70903901G>C	ENST00000264436.4	-	13	2038				ADD2_ENST00000413157.2_Silent_p.G540G|ADD2_ENST00000355733.3_Intron|ADD2_ENST00000430656.1_Silent_p.G556G|ADD2_ENST00000407644.2_Intron	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						ACGTTTCCCCGCCAGTCAGGG	0.632																																					p.G556G		Atlas-SNP	.											ADD2_ENST00000430656,NS,carcinoma,0,1	ADD2	261	.	0			c.C1668G						PASS	.						36.0	39.0	38.0					2																	70903901		2203	4300	6503	SO:0001627	intron_variant	119	exon12			TTCCCCGCCAGTC	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1593+26C>G	chr2.hg19:g.70903901G>C		55.0	0.0	.		47.0	2.0	.	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	hg19	CCDS1906.1																																																																																			.	.	.	none		0.632	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
GAD1	2571	hgsc.bcm.edu	37	2	171687570	171687570	+	Silent	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:171687570C>T	ENST00000358196.3	+	5	965	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000375272.1_Silent_p.L139L|GAD1_ENST00000344257.5_Silent_p.L139L	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	139					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CACCAAGGTGCTGGACTTTCA	0.547																																					p.L139L		Atlas-SNP	.											.	GAD1	79	.	0			c.C415T						PASS	.						114.0	99.0	104.0					2																	171687570		2203	4300	6503	SO:0001819	synonymous_variant	2571	exon5			AAGGTGCTGGACT		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.415C>T	chr2.hg19:g.171687570C>T		137.0	0.0	.		128.0	63.0	.	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Silent	SNP	ENST00000358196.3	hg19	CCDS2239.1																																																																																			.	.	.	none		0.547	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
TTN	7273	hgsc.bcm.edu	37	2	179419674	179419674	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:179419674A>G	ENST00000591111.1	-	281	83813	c.83589T>C	c.(83587-83589)gaT>gaC	p.D27863D	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.D20631D|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.D29504D|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Silent_p.D26936D|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.D20564D|TTN_ENST00000460472.2_Silent_p.D20439D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27863	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTAAGGCGATCGGCATCTT	0.423																																					p.D29504D		Atlas-SNP	.											.	TTN	18412	.	0			c.T88512C						PASS	.						90.0	86.0	87.0					2																	179419674		1936	4131	6067	SO:0001819	synonymous_variant	7273	exon331			AAGGCGATCGGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83589T>C	chr2.hg19:g.179419674A>G		50.0	0.0	.		64.0	37.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179650834	179650834	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:179650834G>C	ENST00000591111.1	-	14	2335	c.2111C>G	c.(2110-2112)aCa>aGa	p.T704R	TTN_ENST00000360870.5_Missense_Mutation_p.T704R|TTN_ENST00000342175.6_Missense_Mutation_p.T658R|TTN_ENST00000589042.1_Missense_Mutation_p.T704R|TTN_ENST00000342992.6_Missense_Mutation_p.T704R|TTN_ENST00000359218.5_Missense_Mutation_p.T658R|TTN_ENST00000460472.2_Missense_Mutation_p.T658R			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAACAACTGTTGCTACAGC	0.493																																					p.T704R		Atlas-SNP	.											.	TTN	18412	.	0			c.C2111G						PASS	.						53.0	55.0	54.0					2																	179650834		2203	4300	6503	SO:0001583	missense	7273	exon14			ACAACTGTTGCTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2111C>G	chr2.hg19:g.179650834G>C	ENSP00000465570:p.Thr704Arg	66.0	0.0	.		110.0	56.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.74	3.207756	0.58343	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.70399	-0.48;-0.26;-0.26;-0.27;0.29;0.24	5.99	5.99	0.97316	Ribonuclease H-like (1);	.	.	.	.	T	0.80303	0.4598	L	0.36672	1.1	0.43574	D	0.995901	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.999	T	0.80732	-0.1251	9	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	658;658;658;704;704	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	R	704;658;658;658;658;704;208	ENSP00000343764:T704R;ENSP00000434586:T658R;ENSP00000340554:T658R;ENSP00000352154:T658R;ENSP00000354117:T704R;ENSP00000405517:T208R	ENSP00000340554:T658R	T	-	2	0	TTN	179359079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.402000	0.79972	2.840000	0.97914	0.655000	0.94253	ACA	.	.	.	none		0.493	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu	37	2	185801068	185801068	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:185801068A>G	ENST00000302277.6	+	4	1539	c.945A>G	c.(943-945)caA>caG	p.Q315Q		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	315							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCAAGTTTCAACTTCAGTTAT	0.333																																					p.Q315Q		Atlas-SNP	.											.	ZNF804A	322	.	0			c.A945G						PASS	.						33.0	32.0	33.0					2																	185801068		2203	4296	6499	SO:0001819	synonymous_variant	91752	exon4			GTTTCAACTTCAG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.945A>G	chr2.hg19:g.185801068A>G		47.0	0.0	.		67.0	41.0	.	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	hg19	CCDS2291.1																																																																																			.	.	.	none		0.333	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
PODXL2	50512	hgsc.bcm.edu	37	3	127379599	127379599	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr3:127379599T>A	ENST00000342480.6	+	3	767	c.728T>A	c.(727-729)tTg>tAg	p.L243*		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	243					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						GGGCCCAGCTTGCTGCTGCCT	0.647																																					p.L243X		Atlas-SNP	.											.	PODXL2	53	.	0			c.T728A						PASS	.						51.0	57.0	55.0					3																	127379599		2203	4300	6503	SO:0001587	stop_gained	50512	exon3			CCAGCTTGCTGCT	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.728T>A	chr3.hg19:g.127379599T>A	ENSP00000345359:p.Leu243*	95.0	0.0	.		88.0	18.0	.	NM_015720	Q6UVY4|Q8WUV6	Nonsense_Mutation	SNP	ENST00000342480.6	hg19	CCDS3044.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.198338	0.38806	.	.	ENSG00000114631	ENST00000342480;ENST00000302192	.	.	.	4.67	-0.49	0.12049	.	0.719396	0.11780	N	0.530317	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0789	7.8382	0.29382	0.0:0.3596:0.0:0.6404	.	.	.	.	X	243	.	ENSP00000304498:L243X	L	+	2	0	PODXL2	128862289	0.001000	0.12720	0.001000	0.08648	0.181000	0.23173	0.600000	0.24104	-0.256000	0.09473	0.402000	0.26972	TTG	.	.	.	none		0.647	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
XRN1	54464	hgsc.bcm.edu	37	3	142123863	142123863	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr3:142123863C>G	ENST00000264951.4	-	16	1886	c.1769G>C	c.(1768-1770)aGg>aCg	p.R590T	RNU6-1294P_ENST00000515995.1_RNA|XRN1_ENST00000392981.2_Missense_Mutation_p.R590T	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	590					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						GTTTCTTTTCCTCTCTTCCTT	0.408																																					p.R590T		Atlas-SNP	.											.	XRN1	138	.	0			c.G1769C						PASS	.						162.0	148.0	152.0					3																	142123863		2203	4300	6503	SO:0001583	missense	54464	exon16			CTTTTCCTCTCTT	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1769G>C	chr3.hg19:g.142123863C>G	ENSP00000264951:p.Arg590Thr	76.0	0.0	.		82.0	35.0	.	NM_001042604	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	hg19	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363718	0.41902	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.26373	1.74;1.74	5.53	2.35	0.29111	.	0.408805	0.27109	N	0.020895	T	0.15825	0.0381	L	0.31664	0.95	0.80722	D	1	B;P;B	0.34800	0.067;0.469;0.417	B;B;B	0.33121	0.024;0.158;0.142	T	0.05599	-1.0875	10	0.40728	T	0.16	-9.364	7.0395	0.25013	0.0:0.5382:0.0:0.4618	.	451;590;590	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	T	590	ENSP00000264951:R590T;ENSP00000376707:R590T	ENSP00000264951:R590T	R	-	2	0	XRN1	143606553	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	1.245000	0.32790	0.691000	0.31592	-0.145000	0.13849	AGG	.	.	.	none		0.408	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
FRYL	285527	hgsc.bcm.edu	37	4	48578146	48578146	+	Silent	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:48578146T>C	ENST00000503238.1	-	21	2621	c.2622A>G	c.(2620-2622)gcA>gcG	p.A874A	FRYL_ENST00000537810.1_Silent_p.A874A|FRYL_ENST00000358350.4_Silent_p.A874A|FRYL_ENST00000507711.1_Silent_p.A874A|RNU5E-3P_ENST00000515913.1_RNA|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	874					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACGATGTTGCTGCACTGCAGC	0.473																																					p.A874A		Atlas-SNP	.											.	FRYL	242	.	0			c.A2622G						PASS	.						125.0	127.0	126.0					4																	48578146		1946	4149	6095	SO:0001819	synonymous_variant	285527	exon24			TGTTGCTGCACTG	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2622A>G	chr4.hg19:g.48578146T>C		152.0	0.0	.		97.0	29.0	.	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	hg19	CCDS43227.1																																																																																			.	.	.	none		0.473	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FRYL	285527	hgsc.bcm.edu	37	4	48578148	48578148	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:48578148C>T	ENST00000503238.1	-	21	2619	c.2620G>A	c.(2620-2622)Gca>Aca	p.A874T	FRYL_ENST00000537810.1_Missense_Mutation_p.A874T|FRYL_ENST00000358350.4_Missense_Mutation_p.A874T|FRYL_ENST00000507711.1_Missense_Mutation_p.A874T|RNU5E-3P_ENST00000515913.1_RNA|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	874					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GATGTTGCTGCACTGCAGCAA	0.468																																					p.A874T		Atlas-SNP	.											.	FRYL	242	.	0			c.G2620A						PASS	.						122.0	124.0	124.0					4																	48578148		1943	4148	6091	SO:0001583	missense	285527	exon24			TTGCTGCACTGCA	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2620G>A	chr4.hg19:g.48578148C>T	ENSP00000426064:p.Ala874Thr	148.0	0.0	.		97.0	27.0	.	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875024	0.51695	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.34859	2.35;2.35;2.35;1.34	5.14	5.14	0.70334	.	0.163703	0.41001	U	0.000974	T	0.19685	0.0473	N	0.08118	0	0.80722	D	1	B;B	0.25441	0.043;0.126	B;B	0.24701	0.011;0.055	T	0.09707	-1.0662	10	0.02654	T	1	.	18.6027	0.91255	0.0:1.0:0.0:0.0	.	874;874	F2Z2S2;O94915	.;FRYL_HUMAN	T	874	ENSP00000426064:A874T;ENSP00000351113:A874T;ENSP00000441114:A874T;ENSP00000421584:A874T	ENSP00000351113:A874T	A	-	1	0	FRYL	48272905	1.000000	0.71417	0.894000	0.35097	0.417000	0.31264	4.730000	0.62015	2.370000	0.80446	0.467000	0.42956	GCA	.	.	.	none		0.468	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
SHROOM3	57619	hgsc.bcm.edu	37	4	77675996	77675996	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:77675996C>A	ENST00000296043.6	+	7	5313	c.4360C>A	c.(4360-4362)Ctg>Atg	p.L1454M	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1454					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			TTTTGCAAACCTGAAGCACTA	0.567																																					p.L1454M		Atlas-SNP	.											.	SHROOM3	134	.	0			c.C4360A						PASS	.						52.0	54.0	54.0					4																	77675996		2203	4300	6503	SO:0001583	missense	57619	exon7			GCAAACCTGAAGC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4360C>A	chr4.hg19:g.77675996C>A	ENSP00000296043:p.Leu1454Met	73.0	0.0	.		57.0	21.0	.	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	hg19	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358823	0.24598	.	.	ENSG00000138771	ENST00000296043	T	0.22743	1.94	5.23	5.23	0.72850	.	1.171820	0.06113	N	0.667490	T	0.22820	0.0551	N	0.24115	0.695	0.09310	N	1	D	0.56521	0.976	P	0.47744	0.556	T	0.17837	-1.0356	10	0.33141	T	0.24	-1.3606	12.5341	0.56133	0.0:0.9214:0.0:0.0786	.	1454	Q8TF72	SHRM3_HUMAN	M	1454	ENSP00000296043:L1454M	ENSP00000296043:L1454M	L	+	1	2	SHROOM3	77895020	0.251000	0.23961	0.544000	0.28141	0.006000	0.05464	2.227000	0.42972	2.716000	0.92895	0.655000	0.94253	CTG	.	.	.	none		0.567	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SLC39A8	64116	hgsc.bcm.edu	37	4	103225511	103225511	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr4:103225511T>C	ENST00000394833.2	-	5	1279	c.803A>G	c.(802-804)cAt>cGt	p.H268R	SLC39A8_ENST00000356736.4_Missense_Mutation_p.H268R|SLC39A8_ENST00000510255.1_5'Flank|SLC39A8_ENST00000424970.2_Missense_Mutation_p.H268R	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	268					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AAAATGGATATGTCCATTAGC	0.363																																					p.H268R		Atlas-SNP	.											.	SLC39A8	24	.	0			c.A803G						PASS	.						158.0	138.0	145.0					4																	103225511		2203	4300	6503	SO:0001583	missense	64116	exon5			TGGATATGTCCAT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.803A>G	chr4.hg19:g.103225511T>C	ENSP00000378310:p.His268Arg	68.0	0.0	.		68.0	23.0	.	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	hg19	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	T	9.588	1.125353	0.20959	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.44881	0.91;0.91;0.91	4.81	4.81	0.61882	.	0.460729	0.18153	U	0.150001	T	0.25938	0.0632	L	0.27053	0.805	0.33924	D	0.641179	B;B;B	0.32350	0.366;0.002;0.016	B;B;B	0.28385	0.089;0.003;0.048	T	0.32640	-0.9899	10	0.16896	T	0.51	-3.0995	9.2864	0.37760	0.1605:0.0:0.0:0.8395	.	268;268;201	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	R	268	ENSP00000394548:H268R;ENSP00000349174:H268R;ENSP00000378310:H268R	ENSP00000349174:H268R	H	-	2	0	SLC39A8	103444534	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.339000	0.43965	1.930000	0.55929	0.528000	0.53228	CAT	.	.	.	none		0.363	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
CTNNA1	1495	hgsc.bcm.edu	37	5	138266342	138266342	+	Splice_Site	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr5:138266342C>T	ENST00000302763.7	+	15	2281	c.2191C>T	c.(2191-2193)Cga>Tga	p.R731*	CTNNA1_ENST00000518825.1_Splice_Site_p.R731*|CTNNA1_ENST00000540387.1_Splice_Site_p.R361*|CTNNA1_ENST00000355078.5_Splice_Site_p.R628*	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	731					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.R731R(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGACTTTACCCGGTGAGCAGC	0.582																																					p.R731X		Atlas-SNP	.											.	CTNNA1	114	.	1	Substitution - coding silent(1)	lung(1)	c.C2191T						PASS	.						134.0	129.0	130.0					5																	138266342		2203	4300	6503	SO:0001630	splice_region_variant	1495	exon15			TTTACCCGGTGAG	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2192+1C>T	chr5.hg19:g.138266342C>T		191.0	0.0	.		195.0	75.0	.	NM_001903	Q12795|Q8N1C0	Nonsense_Mutation	SNP	ENST00000302763.7	hg19	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	C	36	5.632988	0.96682	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387;ENST00000520520	.	.	.	5.77	3.89	0.44902	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7916	13.7731	0.63038	0.4172:0.5828:0.0:0.0	.	.	.	.	X	628;731;731;716;731;361;6	.	ENSP00000304669:R731X	R	+	1	2	CTNNA1	138294241	1.000000	0.71417	1.000000	0.80357	0.408000	0.30992	4.424000	0.59868	1.565000	0.49641	0.655000	0.94253	CGA	.	.	.	none		0.582	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	Nonsense_Mutation
FAM71B	153745	hgsc.bcm.edu	37	5	156590094	156590094	+	Silent	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr5:156590094T>A	ENST00000302938.4	-	2	1277	c.1182A>T	c.(1180-1182)gcA>gcT	p.A394A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	394						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGGTCCCACTGCTGGTCCTT	0.552																																					p.A394A		Atlas-SNP	.											.	FAM71B	145	.	0			c.A1182T						PASS	.						62.0	65.0	64.0					5																	156590094		2203	4300	6503	SO:0001819	synonymous_variant	153745	exon2			TCCCACTGCTGGT		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1182A>T	chr5.hg19:g.156590094T>A		103.0	0.0	.		92.0	36.0	.	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	ENST00000302938.4	hg19	CCDS4335.1																																																																																			.	.	.	none		0.552	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
CMTR1	23070	hgsc.bcm.edu	37	6	37442389	37442389	+	Silent	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:37442389A>G	ENST00000373451.4	+	18	2075	c.1911A>G	c.(1909-1911)ctA>ctG	p.L637L		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	637					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										ACACTCTGCTATCTGTGGAAA	0.572																																					p.L637L		Atlas-SNP	.											.	FTSJD2	64	.	0			c.A1911G						PASS	.						105.0	100.0	102.0					6																	37442389		2203	4300	6503	SO:0001819	synonymous_variant	23070	exon18			TCTGCTATCTGTG	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.1911A>G	chr6.hg19:g.37442389A>G		109.0	0.0	.		101.0	31.0	.	NM_015050	A8K949|Q14670|Q96FJ9	Silent	SNP	ENST00000373451.4	hg19	CCDS4835.1																																																																																			.	.	.	none		0.572	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
RUNX2	860	hgsc.bcm.edu	37	6	45390445	45390445	+	Silent	SNP	A	A	G	rs563987595	byFrequency	TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:45390445A>G	ENST00000371438.1	+	2	532	c.174A>G	c.(172-174)caA>caG	p.Q58Q	RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371432.3_Silent_p.Q44Q|RUNX2_ENST00000371436.6_Silent_p.Q58Q|RUNX2_ENST00000541979.1_Silent_p.Q126Q|RUNX2_ENST00000465038.2_Silent_p.Q58Q|RUNX2_ENST00000359524.5_Silent_p.Q44Q|RUNX2_ENST00000576263.1_Silent_p.Q58Q|RUNX2_ENST00000352853.5_Silent_p.Q126Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	58	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	6	0.00119808	0.0015	0.0	5008	,	,		8050	0.002		0.0	False		,,,				2504	0.002				p.Q58Q		Atlas-SNP	.											RUNX2_ENST00000352853,lower_third,carcinoma,0,2	RUNX2	128	.	0			c.A174G						PASS	.						16.0	24.0	21.0					6																	45390445		1589	3298	4887	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.174A>G	chr6.hg19:g.45390445A>G		93.0	0.0	.		85.0	4.0	.	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.	.	none		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
ADCY1	107	hgsc.bcm.edu	37	7	45747951	45747951	+	Silent	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr7:45747951T>C	ENST00000297323.7	+	18	2842	c.2820T>C	c.(2818-2820)gcT>gcC	p.A940A		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	940			A -> T (in dbSNP:rs45444695).		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACACCTAGGCTAAGAAGTCCA	0.522																																					p.A940A		Atlas-SNP	.											.	ADCY1	187	.	0			c.T2820C						PASS	.						179.0	135.0	150.0					7																	45747951		2203	4300	6503	SO:0001819	synonymous_variant	107	exon18			CTAGGCTAAGAAG	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2820T>C	chr7.hg19:g.45747951T>C		83.0	0.0	.		104.0	56.0	.	NM_021116	A4D2L8|Q75MI1	Silent	SNP	ENST00000297323.7	hg19	CCDS34631.1																																																																																			.	.	.	none		0.522	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
KMT2E	55904	hgsc.bcm.edu	37	7	104717426	104717426	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr7:104717426T>G	ENST00000311117.3	+	10	1330	c.785T>G	c.(784-786)aTt>aGt	p.I262S	KMT2E_ENST00000257745.4_Missense_Mutation_p.I262S|KMT2E_ENST00000334877.4_Missense_Mutation_p.I262S|KMT2E_ENST00000334914.7_De_novo_Start_InFrame|KMT2E_ENST00000476671.1_Missense_Mutation_p.I262S	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	262					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GCTCCAGAGATTGATCCTTCA	0.418																																					p.I262S		Atlas-SNP	.											.	MLL5	173	.	0			c.T785G						PASS	.						89.0	88.0	88.0					7																	104717426		2203	4300	6503	SO:0001583	missense	55904	exon9			CAGAGATTGATCC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.785T>G	chr7.hg19:g.104717426T>G	ENSP00000312379:p.Ile262Ser	41.0	0.0	.		59.0	25.0	.	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.456010	0.26161	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000478990;ENST00000476671;ENST00000537308	D;D;D;D;D	0.95482	-2.85;-2.47;-2.85;-3.72;-3.22	6.07	4.92	0.64577	.	0.471220	0.25735	N	0.028644	D	0.92639	0.7661	L	0.44542	1.39	0.80722	D	1	D;B	0.54207	0.965;0.372	P;B	0.46758	0.526;0.083	D	0.89734	0.3928	10	0.08837	T	0.75	.	12.0897	0.53719	0.0:0.0668:0.0:0.9332	.	262;262	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	S	262;262;262;262;262;120;262;196	ENSP00000312379:I262S;ENSP00000335599:I262S;ENSP00000257745:I262S;ENSP00000419883:I120S;ENSP00000417888:I262S	ENSP00000257745:I262S	I	+	2	0	MLL5	104504662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.809000	0.38922	1.114000	0.41781	0.533000	0.62120	ATT	.	.	.	none		0.418	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
SMO	6608	hgsc.bcm.edu	37	7	128845571	128845571	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr7:128845571C>A	ENST00000249373.3	+	4	1148	c.868C>A	c.(868-870)Cgc>Agc	p.R290S		NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	290					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R290S(1)		biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	GGATGGTGCCCGCCGAGAGAT	0.587			Mis		skin basal cell																																p.R290S		Atlas-SNP	.		Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	SMO,NS,malignant_melanoma,-1,2	SMO	145	.	1	Substitution - Missense(1)	lung(1)	c.C868A						PASS	.						58.0	58.0	58.0					7																	128845571		2203	4300	6503	SO:0001583	missense	6608	exon4			GGTGCCCGCCGAG	U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.868C>A	chr7.hg19:g.128845571C>A	ENSP00000249373:p.Arg290Ser	90.0	0.0	.		115.0	5.0	.	NM_005631	A4D1K5	Missense_Mutation	SNP	ENST00000249373.3	hg19	CCDS5811.1	.	.	.	.	.	.	.	.	.	.	C	34	5.372657	0.95923	.	.	ENSG00000128602	ENST00000249373	D	0.82167	-1.58	5.57	5.57	0.84162	GPCR, family 2-like (1);	0.097576	0.64402	D	0.000001	D	0.91355	0.7273	M	0.78637	2.42	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.92044	0.5643	10	0.87932	D	0	.	18.5223	0.90958	0.0:1.0:0.0:0.0	.	290	Q99835	SMO_HUMAN	S	290	ENSP00000249373:R290S	ENSP00000249373:R290S	R	+	1	0	SMO	128632807	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.997000	0.70646	2.620000	0.88729	0.491000	0.48974	CGC	.	.	.	none		0.587	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1	NM_005631	
COL14A1	7373	hgsc.bcm.edu	37	8	121237425	121237425	+	Silent	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr8:121237425A>T	ENST00000297848.3	+	15	2106	c.1836A>T	c.(1834-1836)tcA>tcT	p.S612S	COL14A1_ENST00000247781.3_Silent_p.S517S|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Silent_p.S612S|COL14A1_ENST00000537875.1_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AAGGACAGTCAGAGCCTCTGA	0.418																																					p.S612S		Atlas-SNP	.											.	COL14A1	292	.	0			c.A1836T						PASS	.						76.0	75.0	76.0					8																	121237425		2203	4300	6503	SO:0001819	synonymous_variant	7373	exon15			ACAGTCAGAGCCT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1836A>T	chr8.hg19:g.121237425A>T		99.0	0.0	.		78.0	20.0	.	NM_021110		Silent	SNP	ENST00000297848.3	hg19	CCDS34938.1																																																																																			.	.	.	none		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
CNTLN	54875	hgsc.bcm.edu	37	9	17332674	17332674	+	Silent	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:17332674G>A	ENST00000380647.3	+	10	1674	c.1590G>A	c.(1588-1590)aaG>aaA	p.K530K	CNTLN_ENST00000262360.5_Silent_p.K530K|CNTLN_ENST00000425824.1_Silent_p.K530K			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	530					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AGCTACAGAAGCTGAGAAAAG	0.378																																					p.K530K		Atlas-SNP	.											.	CNTLN	128	.	0			c.G1590A						PASS	.						74.0	70.0	71.0					9																	17332674		1836	4082	5918	SO:0001819	synonymous_variant	54875	exon10			ACAGAAGCTGAGA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1590G>A	chr9.hg19:g.17332674G>A		69.0	0.0	.		71.0	17.0	.	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	ENST00000380647.3	hg19	CCDS43789.1																																																																																			.	.	.	none		0.378	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
ACO1	48	hgsc.bcm.edu	37	9	32448942	32448942	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:32448942A>T	ENST00000309951.6	+	20	2557	c.2419A>T	c.(2419-2421)Aac>Tac	p.N807Y	ACO1_ENST00000379923.1_Missense_Mutation_p.N807Y|ACO1_ENST00000541043.1_Missense_Mutation_p.N708Y	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	807					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TCACCGCAGTAACCTGGTTGG	0.478																																					p.N807Y		Atlas-SNP	.											.	ACO1	149	.	0			c.A2419T						PASS	.						131.0	111.0	117.0					9																	32448942		2203	4300	6503	SO:0001583	missense	48	exon20			CGCAGTAACCTGG	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.2419A>T	chr9.hg19:g.32448942A>T	ENSP00000309477:p.Asn807Tyr	93.0	0.0	.		74.0	29.0	.	NM_002197	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	hg19	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.351925	0.82132	.	.	ENSG00000122729	ENST00000309951;ENST00000379923;ENST00000541043	T;T;T	0.61392	0.11;0.11;1.13	5.83	5.83	0.93111	Aconitase/3-isopropylmalate dehydratase, swivel (2);Aconitase A/isopropylmalate dehydratase small subunit, swivel (1);	0.000000	0.85682	D	0.000000	D	0.86711	0.5998	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92343	0.5883	10	0.87932	D	0	-31.6045	15.1831	0.72975	1.0:0.0:0.0:0.0	.	807	P21399	ACOC_HUMAN	Y	807;807;708	ENSP00000309477:N807Y;ENSP00000369255:N807Y;ENSP00000438733:N708Y	ENSP00000309477:N807Y	N	+	1	0	ACO1	32438942	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.996000	0.63914	2.227000	0.72691	0.528000	0.53228	AAC	.	.	.	none		0.478	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
HNRNPK	3190	hgsc.bcm.edu	37	9	86585225	86585225	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:86585225T>A	ENST00000376264.2	-	16	1471	c.1213A>T	c.(1213-1215)Aaa>Taa	p.K405*	HNRNPK_ENST00000351839.3_Nonsense_Mutation_p.K405*|RP11-575L7.8_ENST00000448389.1_RNA|MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000376263.3_Nonsense_Mutation_p.K405*|HNRNPK_ENST00000360384.5_Nonsense_Mutation_p.K405*|HNRNPK_ENST00000376281.4_Nonsense_Mutation_p.K405*	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	405	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						TGACCACCTTTGCCAATAATA	0.368																																					p.K405X		Atlas-SNP	.											.	HNRNPK	49	.	0			c.A1213T						PASS	.						60.0	58.0	59.0					9																	86585225		2203	4300	6503	SO:0001587	stop_gained	3190	exon16			CACCTTTGCCAAT		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.1213A>T	chr9.hg19:g.86585225T>A	ENSP00000365440:p.Lys405*	60.0	0.0	.		71.0	24.0	.	NM_031262	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Nonsense_Mutation	SNP	ENST00000376264.2	hg19	CCDS6667.1	.	.	.	.	.	.	.	.	.	.	T	38	7.091735	0.98059	.	.	ENSG00000165119	ENST00000376281;ENST00000376264;ENST00000376263;ENST00000376268;ENST00000351839;ENST00000435158;ENST00000360384;ENST00000376258	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1915	15.5864	0.76485	0.0:0.0:0.0:1.0	.	.	.	.	X	405;405;405;405;405;370;405;400	.	ENSP00000317788:K405X	K	-	1	0	HNRNPK	85775045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.510000	0.81708	2.142000	0.66516	0.482000	0.46254	AAA	.	.	.	none		0.368	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
ADAMTS13	11093	hgsc.bcm.edu	37	9	136305491	136305491	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr9:136305491G>C	ENST00000371929.3	+	16	2257	c.1813G>C	c.(1813-1815)Gtg>Ctg	p.V605L	ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.V605L|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.V574L|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.V277L	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	605	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCGCTATGTCGTGGCTGGGAA	0.627																																					p.V605L		Atlas-SNP	.											.	ADAMTS13	113	.	0			c.G1813C						PASS	.						139.0	98.0	112.0					9																	136305491		2203	4300	6503	SO:0001583	missense	11093	exon16			TATGTCGTGGCTG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1813G>C	chr9.hg19:g.136305491G>C	ENSP00000360997:p.Val605Leu	70.0	0.0	.		77.0	27.0	.	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	hg19	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663418	0.47572	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.62788	0.04;0.0;0.06;0.49	5.21	4.31	0.51392	.	.	.	.	.	T	0.61912	0.2385	N	0.25825	0.765	0.41780	D	0.989816	D;D;D;D	0.89917	1.0;1.0;1.0;0.992	D;D;D;P	0.91635	0.997;0.999;0.99;0.742	T	0.59241	-0.7491	9	0.02654	T	1	.	12.261	0.54651	0.0833:0.0:0.9167:0.0	.	605;574;605;277	Q76LX8;Q76LX8-3;Q76LX8-2;Q9UGQ1	ATS13_HUMAN;.;.;.	L	605;605;574;277	ENSP00000360997:V605L;ENSP00000347927:V605L;ENSP00000348997:V574L;ENSP00000444504:V277L	ENSP00000347927:V605L	V	+	1	0	ADAMTS13	135295312	1.000000	0.71417	0.300000	0.25030	0.035000	0.12851	5.003000	0.63959	1.191000	0.43056	0.561000	0.74099	GTG	.	.	.	none		0.627	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
JMJD1C	221037	hgsc.bcm.edu	37	10	64968980	64968980	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr10:64968980A>T	ENST00000399262.2	-	9	2928	c.2710T>A	c.(2710-2712)Tgg>Agg	p.W904R	JMJD1C_ENST00000399251.1_Missense_Mutation_p.W685R|JMJD1C_ENST00000542921.1_Missense_Mutation_p.W722R|JMJD1C_ENST00000402544.1_Missense_Mutation_p.W685R	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	904					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGATGTAGCCAAGGACTGGGA	0.433																																					p.W904R		Atlas-SNP	.											.	JMJD1C	347	.	0			c.T2710A						PASS	.						65.0	59.0	61.0					10																	64968980		1882	4108	5990	SO:0001583	missense	221037	exon9			GTAGCCAAGGACT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.2710T>A	chr10.hg19:g.64968980A>T	ENSP00000382204:p.Trp904Arg	57.0	0.0	.		46.0	19.0	.	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	hg19	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480118	0.84747	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.77624	0.4158	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79105	-0.1940	10	0.66056	D	0.02	-4.4645	16.5655	0.84588	1.0:0.0:0.0:0.0	.	904;722	Q15652;A0T124	JHD2C_HUMAN;.	R	904;685;685;722	ENSP00000382204:W904R;ENSP00000384990:W685R;ENSP00000382195:W685R;ENSP00000444682:W722R	ENSP00000382195:W685R	W	-	1	0	JMJD1C	64638986	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.372000	0.90127	2.302000	0.77476	0.533000	0.62120	TGG	.	.	.	none		0.433	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
LRRC4C	57689	hgsc.bcm.edu	37	11	40136275	40136275	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:40136275A>C	ENST00000278198.2	-	2	3531	c.1568T>G	c.(1567-1569)aTg>aGg	p.M523R	LRRC4C_ENST00000530763.1_Missense_Mutation_p.M523R|LRRC4C_ENST00000528697.1_Missense_Mutation_p.M523R|LRRC4C_ENST00000527150.1_Missense_Mutation_p.M523R			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	523					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGTAGTCTTCATGACCTCATC	0.478																																					p.M523R		Atlas-SNP	.											.	LRRC4C	190	.	0			c.T1568G						PASS	.						174.0	145.0	155.0					11																	40136275		2203	4300	6503	SO:0001583	missense	57689	exon7			GTCTTCATGACCT	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1568T>G	chr11.hg19:g.40136275A>C	ENSP00000278198:p.Met523Arg	129.0	0.0	.		109.0	29.0	.	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	hg19	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813848	0.50527	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.63319	0.2501	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.65940	-0.6046	10	0.72032	D	0.01	.	15.6754	0.77316	1.0:0.0:0.0:0.0	.	523	Q9HCJ2	LRC4C_HUMAN	R	523	ENSP00000278198:M523R;ENSP00000436976:M523R;ENSP00000437132:M523R;ENSP00000434761:M523R	ENSP00000278198:M523R	M	-	2	0	LRRC4C	40092851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	ATG	.	.	.	none		0.478	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
ACCS	84680	hgsc.bcm.edu	37	11	44105011	44105011	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr11:44105011T>C	ENST00000263776.8	+	14	1726	c.1292T>C	c.(1291-1293)cTc>cCc	p.L431P		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	431					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GAAATGCTGCTCTGGCGCCGC	0.567																																					p.L431P	Esophageal Squamous(158;148 1889 8077 23160 41213)	Atlas-SNP	.											.	ACCS	64	.	0			c.T1292C						PASS	.						71.0	65.0	67.0					11																	44105011		2203	4300	6503	SO:0001583	missense	84680	exon14			TGCTGCTCTGGCG	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1292T>C	chr11.hg19:g.44105011T>C	ENSP00000263776:p.Leu431Pro	62.0	0.0	.		68.0	13.0	.	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	hg19	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.025435	0.54683	.	.	ENSG00000110455	ENST00000263776	D	0.93488	-3.23	5.91	5.91	0.95273	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.073130	0.56097	D	0.000026	D	0.97942	0.9323	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99297	1.0900	10	0.87932	D	0	-19.4821	16.0098	0.80391	0.0:0.0:0.0:1.0	.	431	Q96QU6	1A1L1_HUMAN	P	431	ENSP00000263776:L431P	ENSP00000263776:L431P	L	+	2	0	ACCS	44061587	0.997000	0.39634	0.041000	0.18516	0.142000	0.21351	7.315000	0.78998	2.254000	0.74563	0.533000	0.62120	CTC	.	.	.	none		0.567	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
KMT2D	8085	hgsc.bcm.edu	37	12	49434235	49434235	+	Missense_Mutation	SNP	C	C	T	rs375114492		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:49434235C>T	ENST00000301067.7	-	31	7317	c.7318G>A	c.(7318-7320)Gtt>Att	p.V2440I		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2440	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CGAGGGGTAACGGGTGATGGG	0.622																																					p.V2440I		Atlas-SNP	.											.	MLL2	1173	.	0			c.G7318A						PASS	.	C	ILE/VAL	1,4177		0,1,2088	40.0	46.0	44.0		7318	5.2	0.8	12		44	0,8456		0,0,4228	no	missense	MLL2	NM_003482.3	29	0,1,6316	TT,TC,CC		0.0,0.0239,0.0079	probably-damaging	2440/5538	49434235	1,12633	2089	4228	6317	SO:0001583	missense	8085	exon31			GGGTAACGGGTGA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7318G>A	chr12.hg19:g.49434235C>T	ENSP00000301067:p.Val2440Ile	96.0	0.0	.		101.0	35.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	12.39	1.924285	0.34002	2.39E-4	0.0	ENSG00000167548	ENST00000301067	T	0.80033	-1.33	5.21	5.21	0.72293	.	0.000000	0.34002	N	0.004349	T	0.77136	0.4086	L	0.36672	1.1	0.26063	N	0.981323	D	0.57899	0.981	P	0.44772	0.46	T	0.74553	-0.3627	10	0.87932	D	0	.	17.9117	0.88936	0.0:1.0:0.0:0.0	.	2440	O14686	MLL2_HUMAN	I	2440	ENSP00000301067:V2440I	ENSP00000301067:V2440I	V	-	1	0	MLL2	47720502	0.544000	0.26441	0.785000	0.31869	0.974000	0.67602	3.934000	0.56553	2.596000	0.87737	0.591000	0.81541	GTT	.	.	.	weak		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		47.0	0.0	.		46.0	3.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
HNF1A	6927	hgsc.bcm.edu	37	12	121437343	121437343	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr12:121437343C>T	ENST00000257555.6	+	9	1907	c.1681C>T	c.(1681-1683)Cag>Tag	p.Q561*	HNF1A_ENST00000544413.1_Nonsense_Mutation_p.Q568*|HNF1A_ENST00000541395.1_Nonsense_Mutation_p.Q592*|RP11-216P16.2_ENST00000606238.1_RNA			P20823	HNF1A_HUMAN	HNF1 homeobox A	561					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCGGCATCTCAGGCCACCAC	0.701									Hepatic Adenoma, Familial Clustering of																												p.Q561X		Atlas-SNP	.											.	HNF1A	302	.	0			c.C1681T	GRCh37	CM056410	HNF1A	M		PASS	.						28.0	28.0	28.0					12																	121437343		2201	4300	6501	SO:0001587	stop_gained	6927	exon9	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	GCATCTCAGGCCA	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1681C>T	chr12.hg19:g.121437343C>T	ENSP00000257555:p.Gln561*	42.0	0.0	.		37.0	10.0	.	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Nonsense_Mutation	SNP	ENST00000257555.6	hg19	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	37	6.366855	0.97511	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000537424;ENST00000543027;ENST00000541395;ENST00000544413	.	.	.	5.8	5.8	0.92144	.	0.246461	0.28754	N	0.014249	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-4.9172	17.2189	0.86952	0.0:1.0:0.0:0.0	.	.	.	.	X	561;453;561;382;592;568	.	ENSP00000257555:Q561X	Q	+	1	0	HNF1A	119921726	0.929000	0.31497	0.953000	0.39169	0.944000	0.59088	3.336000	0.52113	2.741000	0.93983	0.650000	0.86243	CAG	.	.	.	none		0.701	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
EPSTI1	94240	hgsc.bcm.edu	37	13	43463356	43463357	+	Intron	DNP	CT	CT	TA			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C|T	C|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:43463356_43463357CT>TA	ENST00000398762.3	-	12	948				EPSTI1_ENST00000313624.7_Intron|EPSTI1_ENST00000313640.7_Nonsense_Mutation_p.R324*			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)											endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CCTTAGGTGCCTCGAAAAAACT	0.292																																					p.R324K|p.R324W		Atlas-SNP	.											.	EPSTI1	47	.	0			c.G971A|c.A970T						PASS	.																																			SO:0001627	intron_variant	94240	exon12			AGGTGCCTCGAAA|GGTGCCTCGAAAA	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.949_949delinsTA	chr13.hg19:g.43463356_43463357delinsTA		47.0	0.0	.		27.0	16.0	.	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	hg19	CCDS9387.1																																																																																			.	.	.	none		0.292	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
CCDC70	83446	hgsc.bcm.edu	37	13	52439743	52439743	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:52439743C>T	ENST00000242819.4	+	2	525	c.229C>T	c.(229-231)Cat>Tat	p.H77Y		NM_031290.2	NP_112580.2	Q6NSX1	CCD70_HUMAN	coiled-coil domain containing 70	77						extracellular region (GO:0005576)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(7)|skin(2)|urinary_tract(1)	15		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.0107)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;2.4e-08)		AGGCAAGATCCATGCTTTCCG	0.463																																					p.H77Y		Atlas-SNP	.											.	CCDC70	31	.	0			c.C229T						PASS	.						58.0	65.0	62.0					13																	52439743		2203	4300	6503	SO:0001583	missense	83446	exon2			AAGATCCATGCTT		CCDS9431.1	13q14.3	2006-02-07			ENSG00000123171	ENSG00000123171			25303	protein-coding gene	gene with protein product						11230166	Standard	NM_031290		Approved	DKFZP434K1172, FLJ25853	uc001vfu.4	Q6NSX1	OTTHUMG00000016950	ENST00000242819.4:c.229C>T	chr13.hg19:g.52439743C>T	ENSP00000242819:p.His77Tyr	95.0	0.0	.		127.0	59.0	.	NM_031290	Q8N7A8|Q9H097	Missense_Mutation	SNP	ENST00000242819.4	hg19	CCDS9431.1	.	.	.	.	.	.	.	.	.	.	C	4.558	0.103562	0.08731	.	.	ENSG00000123171	ENST00000242819	T	0.20463	2.07	5.19	-0.626	0.11544	.	0.950993	0.08647	N	0.914676	T	0.13670	0.0331	N	0.22421	0.69	0.09310	N	1	B	0.18013	0.025	B	0.21708	0.036	T	0.35674	-0.9779	10	0.62326	D	0.03	-14.9052	6.1269	0.20184	0.4441:0.3965:0.0:0.1594	.	77	Q6NSX1	CCD70_HUMAN	Y	77	ENSP00000242819:H77Y	ENSP00000242819:H77Y	H	+	1	0	CCDC70	51337744	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.815000	0.04481	-0.051000	0.13334	-0.311000	0.09066	CAT	.	.	.	none		0.463	CCDC70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045033.2	NM_031290	
PCDH8	5100	hgsc.bcm.edu	37	13	53418949	53418949	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr13:53418949A>T	ENST00000377942.3	-	3	3162	c.2959T>A	c.(2959-2961)Ttc>Atc	p.F987I	PCDH8_ENST00000338862.4_Missense_Mutation_p.F890I	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	987					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CTCTTACAGAAGGTTGACATC	0.602																																					p.F987I	GBM(36;25 841 9273 49207)	Atlas-SNP	.											.	PCDH8	95	.	0			c.T2959A						PASS	.						163.0	95.0	118.0					13																	53418949		2203	4300	6503	SO:0001583	missense	5100	exon3			TACAGAAGGTTGA	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2959T>A	chr13.hg19:g.53418949A>T	ENSP00000367177:p.Phe987Ile	122.0	0.0	.		112.0	48.0	.	NM_002590	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	hg19	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.419256	0.62622	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.56444	0.46;0.47	5.95	5.95	0.96441	.	0.000000	0.46442	D	0.000291	T	0.62816	0.2459	L	0.34521	1.04	0.52501	D	0.999954	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.994	T	0.59731	-0.7399	10	0.31617	T	0.26	.	16.4069	0.83677	1.0:0.0:0.0:0.0	.	890;987	O95206-2;O95206	.;PCDH8_HUMAN	I	987;890;513;830	ENSP00000367177:F987I;ENSP00000341350:F890I	ENSP00000341350:F890I	F	-	1	0	PCDH8	52316950	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.730000	0.91510	2.272000	0.75746	0.460000	0.39030	TTC	.	.	.	none		0.602	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
ITGA11	22801	hgsc.bcm.edu	37	15	68631978	68631978	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr15:68631978C>G	ENST00000315757.7	-	11	1222	c.1136G>C	c.(1135-1137)gGg>gCg	p.G379A	ITGA11_ENST00000423218.2_Missense_Mutation_p.G379A	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	379					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)	p.G379V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						CAGCAGAACCCCATCCTGGCA	0.597																																					p.G379A		Atlas-SNP	.											.	ITGA11	110	.	1	Substitution - Missense(1)	kidney(1)	c.G1136C						PASS	.						61.0	65.0	63.0					15																	68631978		2028	4187	6215	SO:0001583	missense	22801	exon11			AGAACCCCATCCT	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1136G>C	chr15.hg19:g.68631978C>G	ENSP00000327290:p.Gly379Ala	100.0	0.0	.		84.0	19.0	.	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	hg19	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049868	0.75846	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	T;T	0.77750	-1.12;-1.12	5.09	5.09	0.68999	.	0.141219	0.64402	D	0.000005	D	0.86690	0.5993	M	0.84511	2.7	0.54753	D	0.999988	D;D	0.59357	0.985;0.984	P;P	0.55871	0.786;0.736	D	0.87055	0.2149	10	0.38643	T	0.18	.	17.5593	0.87901	0.0:1.0:0.0:0.0	.	379;379	A8K8T0;Q9UKX5	.;ITA11_HUMAN	A	379;379;14;379	ENSP00000327290:G379A;ENSP00000403392:G379A	ENSP00000327290:G379A	G	-	2	0	ITGA11	66419032	1.000000	0.71417	0.983000	0.44433	0.842000	0.47809	7.818000	0.86416	2.391000	0.81399	0.555000	0.69702	GGG	.	.	.	none		0.597	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
SCAPER	49855	hgsc.bcm.edu	37	15	76673781	76673781	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr15:76673781C>T	ENST00000563290.1	-	28	3738	c.3643G>A	c.(3643-3645)Gtg>Atg	p.V1215M	SCAPER_ENST00000538941.2_Missense_Mutation_p.V969M|SCAPER_ENST00000324767.7_Missense_Mutation_p.V1215M			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	1215						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TGAATGGCCACTTGGATGGTA	0.443																																					p.V1215M		Atlas-SNP	.											.	SCAPER	160	.	0			c.G3643A						PASS	.						92.0	88.0	89.0					15																	76673781		1939	4133	6072	SO:0001583	missense	49855	exon27			TGGCCACTTGGAT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.3643G>A	chr15.hg19:g.76673781C>T	ENSP00000454973:p.Val1215Met	59.0	0.0	.		50.0	11.0	.	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.481299	0.63849	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.32023	1.5;1.47	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	M	0.67953	2.075	0.51767	D	0.999932	D;D	0.65815	0.975;0.995	P;D	0.67231	0.793;0.95	T	0.53599	-0.8416	10	0.87932	D	0	.	15.5231	0.75881	0.0:0.8625:0.1375:0.0	.	1214;969	Q9BY12;F5H7X8	SCAPE_HUMAN;.	M	1215;969;1237	ENSP00000326924:V1215M;ENSP00000442190:V969M	ENSP00000303560:V1237M	V	-	1	0	SCAPER	74460836	1.000000	0.71417	0.920000	0.36463	0.589000	0.36550	5.651000	0.67951	2.740000	0.93945	0.650000	0.86243	GTG	.	.	.	none		0.443	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
MYH13	8735	hgsc.bcm.edu	37	17	10227379	10227379	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:10227379A>T	ENST00000418404.3	-	22	3057	c.2894T>A	c.(2893-2895)tTg>tAg	p.L965*	MYH13_ENST00000252172.4_Nonsense_Mutation_p.L965*|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	965					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						AACTTTCGTCAAGGTCAGCTC	0.463																																					p.L965X		Atlas-SNP	.											.	MYH13	533	.	0			c.T2894A						PASS	.						106.0	105.0	106.0					17																	10227379		2195	4300	6495	SO:0001587	stop_gained	8735	exon23			TTCGTCAAGGTCA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2894T>A	chr17.hg19:g.10227379A>T	ENSP00000404570:p.Leu965*	70.0	0.0	.		105.0	68.0	.	NM_003802	O95252|Q9P0U8	Nonsense_Mutation	SNP	ENST00000418404.3	hg19	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	A	42	9.641822	0.99227	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0394	0.64665	1.0:0.0:0.0:0.0	.	.	.	.	X	965;591	.	ENSP00000252172:L965X	L	-	2	0	MYH13	10168104	1.000000	0.71417	0.965000	0.40720	0.705000	0.40729	8.981000	0.93465	1.950000	0.56595	0.533000	0.62120	TTG	.	.	.	none		0.463	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MYH8	4626	hgsc.bcm.edu	37	17	10309460	10309460	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:10309460T>C	ENST00000403437.2	-	21	2424	c.2330A>G	c.(2329-2331)gAa>gGa	p.E777G	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	777	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCTCATTTCTTCCAGAAGACC	0.413									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.E777G		Atlas-SNP	.											.	MYH8	346	.	0			c.A2330G						PASS	.						113.0	108.0	110.0					17																	10309460		2203	4300	6503	SO:0001583	missense	4626	exon21	Familial Cancer Database	Carney Complex Variant	ATTTCTTCCAGAA		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2330A>G	chr17.hg19:g.10309460T>C	ENSP00000384330:p.Glu777Gly	90.0	0.0	.		101.0	54.0	.	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	hg19	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.512766	0.85389	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.75260	-0.92	5.22	5.22	0.72569	Myosin head, motor domain (1);	0.000000	0.42420	U	0.000719	D	0.92182	0.7521	H	0.99415	4.555	0.58432	D	0.999999	D	0.71674	0.998	D	0.74674	0.984	D	0.95289	0.8393	10	0.66056	D	0.02	.	15.2675	0.73672	0.0:0.0:0.0:1.0	.	777	P13535	MYH8_HUMAN	G	777	ENSP00000384330:E777G	ENSP00000252173:E777G	E	-	2	0	MYH8	10250185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.825000	0.86693	2.205000	0.71048	0.528000	0.53228	GAA	.	.	.	none		0.413	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
STAC2	342667	hgsc.bcm.edu	37	17	37368584	37368584	+	Silent	SNP	C	C	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr17:37368584C>T	ENST00000333461.5	-	11	1566	c.1197G>A	c.(1195-1197)aaG>aaA	p.K399K		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	399					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						CCAGGCCCCGCTTCTTGCCAC	0.622																																					p.K399K		Atlas-SNP	.											.	STAC2	47	.	0			c.G1197A						PASS	.						58.0	52.0	54.0					17																	37368584		2203	4300	6503	SO:0001819	synonymous_variant	342667	exon11			GCCCCGCTTCTTG	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.1197G>A	chr17.hg19:g.37368584C>T		35.0	0.0	.		60.0	14.0	.	NM_198993	Q32MA3	Silent	SNP	ENST00000333461.5	hg19	CCDS11335.1																																																																																			.	.	.	none		0.622	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444533.2	NM_198993	
RANBP3	8498	hgsc.bcm.edu	37	19	5914495	5914495	+	IGR	SNP	G	G	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:5914495G>T	ENST00000340578.6	-	0	3233				AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000222125.5_Silent_p.L26L|CAPS_ENST00000452990.2_Silent_p.L26L|CAPS_ENST00000588776.1_Silent_p.L112L|AC104532.4_ENST00000591109.1_RNA	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						TCCAGGGCCTGGCCAGGTGAG	0.667																																					p.L26L		Atlas-SNP	.											.	CAPS	14	.	0			c.G78T						PASS	.						38.0	42.0	41.0					19																	5914495		2203	4300	6503	SO:0001628	intergenic_variant	828	exon2			GGGCCTGGCCAGG	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			chr19.hg19:g.5914495G>T		72.0	0.0	.		57.0	22.0	.	NM_080590	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	ENST00000340578.6	hg19	CCDS42478.1																																																																																			.	.	.	none		0.667	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
C3	718	hgsc.bcm.edu	37	19	6709834	6709834	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:6709834T>G	ENST00000245907.6	-	14	1798	c.1706A>C	c.(1705-1707)cAg>cCg	p.Q569P		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	569					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	GTCTTCTGACTGGCCGCTTTT	0.637																																					p.Q569P		Atlas-SNP	.											C3,NS,carcinoma,0,1	C3	192	.	0			c.A1706C						PASS	.						51.0	52.0	52.0					19																	6709834		2203	4300	6503	SO:0001583	missense	718	exon14			TCTGACTGGCCGC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.1706A>C	chr19.hg19:g.6709834T>G	ENSP00000245907:p.Gln569Pro	101.0	1.0	.		72.0	18.0	.	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	7.093	0.572475	0.13623	.	.	ENSG00000125730	ENST00000245907	T	0.60548	0.18	5.15	-4.43	0.03568	Alpha-2-macroglobulin, N-terminal 2 (1);	1.754940	0.02473	N	0.087708	T	0.26991	0.0661	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09143	-1.0688	10	0.15066	T	0.55	.	2.5674	0.04786	0.1135:0.1705:0.2356:0.4803	.	569	P01024	CO3_HUMAN	P	569	ENSP00000245907:Q569P	ENSP00000245907:Q569P	Q	-	2	0	C3	6660834	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.671000	0.01954	-0.737000	0.04824	-0.382000	0.06688	CAG	.	.	.	none		0.637	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
FCER2	2208	hgsc.bcm.edu	37	19	7755293	7755293	+	Splice_Site	SNP	T	T	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:7755293T>A	ENST00000346664.5	-	9	832	c.620A>T	c.(619-621)cAg>cTg	p.Q207L	FCER2_ENST00000597921.1_Splice_Site_p.Q207L|FCER2_ENST00000360067.4_Splice_Site_p.Q206L	NM_001220500.1|NM_002002.4	NP_001207429.1|NP_001993.2	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor for (CD23)	207	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				Notch signaling pathway (GO:0007219)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	10						CCAGCCCACCTGCTCCTCCGG	0.667																																					p.Q207L		Atlas-SNP	.											.	FCER2	19	.	0			c.A620T						PASS	.						43.0	46.0	45.0					19																	7755293		2203	4300	6503	SO:0001630	splice_region_variant	2208	exon9			CCCACCTGCTCCT	M15059	CCDS12184.1	19p13.3	2011-08-30	2006-03-09			ENSG00000104921		"""C-type lectin domain containing"", ""CD molecules"""	3612	protein-coding gene	gene with protein product		151445	"""Fc fragment of IgE, low affinity II, receptor for (CD23A)"""	CD23A, FCE2			Standard	NM_002002		Approved	CLEC4J, CD23	uc002mhm.2	P06734		ENST00000346664.5:c.621+1A>T	chr19.hg19:g.7755293T>A		105.0	0.0	.		92.0	27.0	.	NM_002002		Missense_Mutation	SNP	ENST00000346664.5	hg19	CCDS12184.1	.	.	.	.	.	.	.	.	.	.	t	14.83	2.652954	0.47362	.	.	ENSG00000104921	ENST00000346664;ENST00000360067	T;T	0.16457	2.34;2.34	4.61	4.61	0.57282	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.33477	U	0.004865	T	0.37652	0.1011	M	0.66378	2.025	0.36695	D	0.879773	D	0.76494	0.999	D	0.87578	0.998	T	0.46843	-0.9162	10	0.87932	D	0	.	10.4446	0.44486	0.0:0.0:0.0:1.0	.	207	P06734	FCER2_HUMAN	L	207;206	ENSP00000264072:Q207L;ENSP00000353178:Q206L	ENSP00000264072:Q207L	Q	-	2	0	FCER2	7661293	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	3.912000	0.56386	1.733000	0.51620	0.382000	0.24955	CAG	.	.	.	none		0.667	FCER2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461832.1	NM_002002	Missense_Mutation
SMARCA4	6597	hgsc.bcm.edu	37	19	11113781	11113781	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:11113781G>C	ENST00000429416.3	+	13	2170	c.1889G>C	c.(1888-1890)gGc>gCc	p.G630A	SMARCA4_ENST00000450717.3_Missense_Mutation_p.G630A|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G630A|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G630A|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G630A|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G630A|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G630A|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G630A|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G630A	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	630					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ATCCTCACAGGCACAGATGCC	0.597			"""F, N, Mis"""		NSCLC																																p.G630A		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G1889C						PASS	.						77.0	79.0	78.0					19																	11113781		2203	4300	6503	SO:0001583	missense	6597	exon12			TCACAGGCACAGA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1889G>C	chr19.hg19:g.11113781G>C	ENSP00000395654:p.Gly630Ala	148.0	0.0	.		111.0	28.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862182	0.91511	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	4.57	4.57	0.56435	BRK domain (2);	0.000000	0.85682	D	0.000000	T	0.79805	0.4509	L	0.58510	1.815	0.80722	D	1	P;P;P;P;D;P;P	0.54772	0.857;0.932;0.932;0.853;0.968;0.868;0.868	P;P;P;P;P;P;P	0.53760	0.597;0.708;0.708;0.734;0.699;0.708;0.708	T	0.82386	-0.0483	10	0.66056	D	0.02	-36.4878	16.6596	0.85238	0.0:0.0:1.0:0.0	.	630;630;630;630;630;630;630	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	A	630;630;694;630;630;630;630;630	ENSP00000395654:G630A;ENSP00000350720:G630A;ENSP00000343896:G630A;ENSP00000445036:G630A;ENSP00000392837:G630A;ENSP00000397783:G630A;ENSP00000414727:G630A	ENSP00000343896:G630A	G	+	2	0	SMARCA4	10974781	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.601000	0.98297	2.526000	0.85167	0.563000	0.77884	GGC	.	.	.	none		0.597	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
RYR1	6261	hgsc.bcm.edu	37	19	38990577	38990577	+	Missense_Mutation	SNP	G	G	A	rs201584482		TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:38990577G>A	ENST00000359596.3	+	45	7244	c.7244G>A	c.(7243-7245)cGg>cAg	p.R2415Q	RYR1_ENST00000355481.4_Missense_Mutation_p.R2415Q|RYR1_ENST00000360985.3_Missense_Mutation_p.R2415Q			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2415	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAAGAAAACCGGGTGCACCTG	0.632																																					p.R2415Q		Atlas-SNP	.											.	RYR1	708	.	0			c.G7244A						PASS	.						120.0	97.0	104.0					19																	38990577		2203	4300	6503	SO:0001583	missense	6261	exon45			AAAACCGGGTGCA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7244G>A	chr19.hg19:g.38990577G>A	ENSP00000352608:p.Arg2415Gln	109.0	0.0	.		105.0	35.0	.	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704736	0.48412	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97529	-4.42;-4.42;-4.42	3.99	3.99	0.46301	.	0.000000	0.64402	U	0.000007	D	0.95726	0.8610	L	0.48362	1.52	0.38108	D	0.937463	D;D	0.63046	0.992;0.985	P;B	0.48901	0.594;0.44	D	0.95492	0.8570	10	0.33141	T	0.24	.	15.0045	0.71501	0.0:0.0:1.0:0.0	.	2415;2415	P21817-2;P21817	.;RYR1_HUMAN	Q	2415	ENSP00000352608:R2415Q;ENSP00000347667:R2415Q;ENSP00000354254:R2415Q	ENSP00000347667:R2415Q	R	+	2	0	RYR1	43682417	0.992000	0.36948	1.000000	0.80357	0.705000	0.40729	2.287000	0.43505	2.045000	0.60652	0.297000	0.19635	CGG	.	.	.	weak		0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
MYH14	79784	hgsc.bcm.edu	37	19	50764757	50764757	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr19:50764757A>G	ENST00000596571.1	+	18	2327	c.2327A>G	c.(2326-2328)aAc>aGc	p.N776S	MYH14_ENST00000425460.1_Missense_Mutation_p.N784S|MYH14_ENST00000376970.2_Missense_Mutation_p.N809S|MYH14_ENST00000601313.1_Missense_Mutation_p.N817S|MYH14_ENST00000598205.1_Missense_Mutation_p.N784S|MYH14_ENST00000440075.2_Missense_Mutation_p.N817S|MYH14_ENST00000262269.8_Missense_Mutation_p.N817S			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	776	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CTGGACCCCAACCTCTACCGC	0.632																																					p.N817S		Atlas-SNP	.											.	MYH14	261	.	0			c.A2450G						PASS	.						40.0	44.0	42.0					19																	50764757		2011	4174	6185	SO:0001583	missense	79784	exon21			ACCCCAACCTCTA	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2327A>G	chr19.hg19:g.50764757A>G	ENSP00000472819:p.Asn776Ser	85.0	0.0	.		74.0	20.0	.	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	hg19	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.111012	0.56398	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	4.48	4.48	0.54585	Myosin head, motor domain (2);	.	.	.	.	D	0.82770	0.5109	L	0.47016	1.485	0.80722	D	1	B;B;B	0.29909	0.144;0.261;0.22	B;B;B	0.29176	0.03;0.099;0.06	T	0.82348	-0.0502	9	0.54805	T	0.06	.	12.0425	0.53460	1.0:0.0:0.0:0.0	.	817;776;784	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	S	776;817;809;784;776;817	ENSP00000406273:N817S;ENSP00000366169:N809S;ENSP00000407879:N784S;ENSP00000262269:N817S	ENSP00000262269:N817S	N	+	2	0	MYH14	55456569	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.830000	0.92063	2.028000	0.59812	0.454000	0.30748	AAC	.	.	.	none		0.632	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
CEP250	11190	hgsc.bcm.edu	37	20	34092361	34092361	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:34092361A>G	ENST00000397527.1	+	30	6884	c.6164A>G	c.(6163-6165)cAg>cGg	p.Q2055R	CEP250_ENST00000342580.4_Missense_Mutation_p.Q1999R	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2055	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGACATCAGCAGGAACGGGAG	0.557																																					p.Q2055R		Atlas-SNP	.											.	CEP250	141	.	0			c.A6164G						PASS	.						29.0	31.0	30.0					20																	34092361		2203	4300	6503	SO:0001583	missense	11190	exon30			ATCAGCAGGAACG	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6164A>G	chr20.hg19:g.34092361A>G	ENSP00000380661:p.Gln2055Arg	29.0	0.0	.		52.0	17.0	.	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	7.149	0.583366	0.13749	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.43688	2.96;2.95;0.94	4.83	1.33	0.21861	.	0.879228	0.09850	N	0.747749	T	0.14743	0.0356	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29792	-1.0000	10	0.19147	T	0.46	.	8.6927	0.34275	0.6701:0.0:0.3299:0.0	.	2055	Q9BV73	CP250_HUMAN	R	2055;1999;543	ENSP00000380661:Q2055R;ENSP00000341541:Q1999R;ENSP00000395992:Q543R	ENSP00000341541:Q1999R	Q	+	2	0	CEP250	33555775	0.990000	0.36364	0.012000	0.15200	0.910000	0.53928	0.903000	0.28475	0.045000	0.15804	0.533000	0.62120	CAG	.	.	.	none		0.557	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
ADNP	23394	hgsc.bcm.edu	37	20	49510230	49510230	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr20:49510230A>T	ENST00000396029.3	-	5	1588	c.1021T>A	c.(1021-1023)Tac>Aac	p.Y341N	ADNP_ENST00000349014.3_Missense_Mutation_p.Y341N|ADNP_ENST00000396032.3_Missense_Mutation_p.Y341N|ADNP_ENST00000371602.4_Missense_Mutation_p.Y341N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	341					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CCAACACTGTAACCCTGGCCT	0.443																																					p.Y341N		Atlas-SNP	.											.	ADNP	106	.	0			c.T1021A						PASS	.						137.0	123.0	128.0					20																	49510230		2203	4300	6503	SO:0001583	missense	23394	exon5			CACTGTAACCCTG	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1021T>A	chr20.hg19:g.49510230A>T	ENSP00000379346:p.Tyr341Asn	114.0	0.0	.		98.0	31.0	.	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	hg19	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072885	0.36566	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.91	5.91	0.95273	.	0.295208	0.38663	N	0.001605	T	0.74665	0.3746	L	0.55990	1.75	0.42457	D	0.992773	D	0.76494	0.999	D	0.81914	0.995	T	0.72121	-0.4386	9	0.30078	T	0.28	-7.2492	16.3436	0.83110	1.0:0.0:0.0:0.0	.	341	Q9H2P0	ADNP_HUMAN	N	341	.	ENSP00000342905:Y341N	Y	-	1	0	ADNP	48943637	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.948000	0.93006	2.269000	0.75478	0.533000	0.62120	TAC	.	.	.	none		0.443	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
ADARB1	104	hgsc.bcm.edu	37	21	46596347	46596347	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr21:46596347G>A	ENST00000360697.3	+	2	746	c.731G>A	c.(730-732)cGc>cAc	p.R244H	ADARB1_ENST00000389863.4_Missense_Mutation_p.R244H|ADARB1_ENST00000437626.1_Intron|ADARB1_ENST00000348831.4_Missense_Mutation_p.R244H|ADARB1_ENST00000539173.1_Missense_Mutation_p.R244H			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	244	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		AACGAACTGCGCCCAGGACTC	0.587																																					p.R244H		Atlas-SNP	.											ADARB1_ENST00000389863,colon,carcinoma,0,4	ADARB1	81	.	0			c.G731A						PASS	.						108.0	97.0	101.0					21																	46596347		2203	4300	6503	SO:0001583	missense	104	exon4			AACTGCGCCCAGG	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.731G>A	chr21.hg19:g.46596347G>A	ENSP00000353920:p.Arg244His	117.0	0.0	.		122.0	44.0	.	NM_001160230	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	hg19	CCDS33589.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564135	0.86335	.	.	ENSG00000197381	ENST00000539173;ENST00000539917;ENST00000389863;ENST00000348831;ENST00000360697	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.28	5.28	0.74379	Double-stranded RNA-binding (2);Double-stranded RNA-binding-like (1);	0.000000	0.85682	U	0.000000	D	0.86818	0.6024	M	0.75447	2.3	0.80722	D	1	P;D;D;B;P	0.61697	0.928;0.99;0.97;0.046;0.861	P;D;P;B;P	0.66716	0.521;0.946;0.877;0.04;0.521	D	0.85797	0.1371	10	0.38643	T	0.18	-42.4461	16.7859	0.85574	0.0:0.0:1.0:0.0	.	271;244;244;272;244	P78563-4;P78563;Q4AE77;G5E9B4;P78563-3	.;RED1_HUMAN;.;.;.	H	244	ENSP00000441897:R244H;ENSP00000374513:R244H;ENSP00000015877:R244H;ENSP00000353920:R244H	ENSP00000015877:R244H	R	+	2	0	ADARB1	45420775	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	9.347000	0.97059	2.633000	0.89246	0.655000	0.94253	CGC	.	.	.	none		0.587	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
PNCK	139728	hgsc.bcm.edu	37	X	152937464	152937464	+	Silent	SNP	A	A	T			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chrX:152937464A>T	ENST00000370150.1	-	5	463	c.285T>A	c.(283-285)ggT>ggA	p.G95G	PNCK_ENST00000393831.2_Silent_p.G95G|PNCK_ENST00000475172.1_5'UTR|PNCK_ENST00000370145.4_Silent_p.G112G|PNCK_ENST00000340888.3_Silent_p.G95G|PNCK_ENST00000447676.2_Silent_p.G178G|PNCK_ENST00000370142.1_Silent_p.G95G			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	95	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACAGCTCGCCACCCGTCACCC	0.657																																					p.G178G		Atlas-SNP	.											.	PNCK	70	.	0			c.T534A						PASS	.						39.0	35.0	36.0					X																	152937464		2203	4299	6502	SO:0001819	synonymous_variant	139728	exon5			CTCGCCACCCGTC	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.285T>A	chrX.hg19:g.152937464A>T		30.0	0.0	.		21.0	10.0	.	NM_001039582	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Silent	SNP	ENST00000370150.1	hg19																																																																																				.	.	.	none		0.657	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	
MT-ND5	4540	hgsc.bcm.edu	37	M	12756	12756	+	Silent	SNP	G	G	C			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chrM:12756G>C	ENST00000361567.2	+	1	420	c.420G>C	c.(418-420)ctG>ctC	p.L140L	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	140					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTATTCCAACTGTTCATCGGC	0.403																																					p.L140L		Atlas-SNP	.											.	.	.	.	0			c.G420C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CCAACTGTTCATC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.420G>C	chrM.hg19:g.12756G>C		1.0	0.0	.		7.0	7.0	.	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.	.	none		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
F5	2153	hgsc.bcm.edu	37	1	169510915	169510916	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:169510915_169510916insTT	ENST00000367797.3	-	13	3613_3614	c.3412_3413insAA	c.(3412-3414)atgfs	p.M1138fs	F5_ENST00000367796.3_Frame_Shift_Ins_p.M1143fs	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1138	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	AGTAGAGTGCATTTGATCAGGG	0.48																																					p.M1138fs		Atlas-INDEL	.											.	F5	301	.	0			c.3413_3414insAA						PASS	.																																			SO:0001589	frameshift_variant	2153	exon13			.	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3411_3412dupAA	chr1.hg19:g.169510916_169510917dupTT	ENSP00000356771:p.Met1138fs	289.0	0.0	0		276.0	80.0	0.289855	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Frame_Shift_Ins	INS	ENST00000367797.3	hg19	CCDS1281.1																																																																																			.	.	.	none		0.480	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
GREB1	9687	hgsc.bcm.edu	37	2	11706688	11706688	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr2:11706688delG	ENST00000381486.2	+	4	660	c.360delG	c.(358-360)gtgfs	p.V120fs	GREB1_ENST00000234142.5_Frame_Shift_Del_p.V120fs|GREB1_ENST00000381483.2_Frame_Shift_Del_p.V120fs|GREB1_ENST00000389825.3_Frame_Shift_Del_p.V10fs|GREB1_ENST00000263834.5_Frame_Shift_Del_p.V120fs	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	120						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TTCTCCTCGTGGGGGTCAAGT	0.597																																					p.V120fs	Ovarian(39;850 945 2785 23371 33093)	Atlas-INDEL	.											GREB1_ENST00000381486,NS,carcinoma,+1,2	GREB1	308	.	0			c.359delT						PASS	.						98.0	91.0	93.0					2																	11706688		2203	4300	6503	SO:0001589	frameshift_variant	9687	exon4			.		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.360delG	chr2.hg19:g.11706688delG	ENSP00000370896:p.Val120fs	101.0	0.0	0		135.0	41.0	0.303704	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Frame_Shift_Del	DEL	ENST00000381486.2	hg19	CCDS42655.1																																																																																			.	.	.	none		0.597	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
RC3H1	149041	hgsc.bcm.edu	37	1	173916659	173916660	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr1:173916659_173916660delGT	ENST00000367696.2	-	15	2935_2936	c.2584_2585delAC	c.(2584-2586)accfs	p.T862fs	RC3H1_ENST00000367694.2_Frame_Shift_Del_p.T862fs|RC3H1_ENST00000258349.4_Frame_Shift_Del_p.T862fs			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	862					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						ATCATCACTGGTTTCTGCTGCT	0.45																																					p.862_862del		Atlas-INDEL	.											.	RC3H1	110	.	0			c.2585_2586del						PASS	.																																			SO:0001589	frameshift_variant	149041	exon14			.	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2584_2585delAC	chr1.hg19:g.173916659_173916660delGT	ENSP00000356669:p.Thr862fs	153.0	0.0	0		130.0	29.0	0.223077	NM_172071	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Frame_Shift_Del	DEL	ENST00000367696.2	hg19	CCDS30940.1																																																																																			.	.	.	none		0.450	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
RPL10A	4736	hgsc.bcm.edu	37	6	35437266	35437267	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6790-01A-11D-1961-08	TCGA-G7-6790-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ef807a92-f471-4d93-8ae9-24bbb846feaa	66cbb40f-14b3-40c0-a332-e8a8e21bca11	g.chr6:35437266_35437267insA	ENST00000322203.6	+	4	297_298	c.270_271insA	c.(271-273)aaafs	p.K91fs	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	91					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						TCGAGGCGCTGAAAAAACTCAA	0.55																																					p.L90fs		Atlas-INDEL	.											.	RPL10A	13	.	0			c.270_271insA						PASS	.																																			SO:0001589	frameshift_variant	4736	exon4			.	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.276dupA	chr6.hg19:g.35437272_35437272dupA	ENSP00000363018:p.Lys91fs	52.0	0.0	0		44.0	12.0	0.272727	NM_007104	B2R801|P52859|P53025|Q5TZT6|Q8J013	Frame_Shift_Ins	INS	ENST00000322203.6	hg19	CCDS4806.1																																																																																			.	.	.	none		0.550	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104	
