#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DDX20	11218	hgsc.bcm.edu	37	1	112303729	112303729	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:112303729T>G	ENST00000369702.4	+	6	1564	c.944T>G	c.(943-945)tTt>tGt	p.F315C	DDX20_ENST00000475700.1_5'UTR|DDX20_ENST00000536167.1_3'UTR	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	315	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCTTTAGTCTTTTCTAATTTG	0.353																																					p.F315C		Atlas-SNP	.											.	DDX20	50	.	0			c.T944G						PASS	.						111.0	114.0	113.0					1																	112303729		2203	4300	6503	SO:0001583	missense	11218	exon6			TAGTCTTTTCTAA	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.944T>G	chr1.hg19:g.112303729T>G	ENSP00000358716:p.Phe315Cys	97.0	0.0	.		96.0	39.0	.	NM_007204	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	ENST00000369702.4	hg19	CCDS842.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.962407	0.74016	.	.	ENSG00000064703	ENST00000369702	T	0.11063	2.81	5.62	5.62	0.85841	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43344	0.1243	H	0.98178	4.165	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66106	-0.6006	10	0.87932	D	0	-23.1854	15.4768	0.75489	0.0:0.0:0.0:1.0	.	315	Q9UHI6	DDX20_HUMAN	C	315	ENSP00000358716:F315C	ENSP00000358716:F315C	F	+	2	0	DDX20	112105252	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.586000	0.82596	2.152000	0.67230	0.459000	0.35465	TTT	.	.	.	none		0.353	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
DSTYK	25778	hgsc.bcm.edu	37	1	205132071	205132071	+	Silent	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr1:205132071G>A	ENST00000367162.3	-	5	1651	c.1621C>T	c.(1621-1623)Cta>Tta	p.L541L	DSTYK_ENST00000367160.4_Intron|DSTYK_ENST00000367161.3_Silent_p.L541L	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	541					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TGCTCCCATAGCATCCTTGTA	0.418																																					p.L541L		Atlas-SNP	.											.	DSTYK	87	.	0			c.C1621T						PASS	.						205.0	191.0	196.0					1																	205132071		2203	4300	6503	SO:0001819	synonymous_variant	25778	exon5			CCCATAGCATCCT	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1621C>T	chr1.hg19:g.205132071G>A		147.0	0.0	.		154.0	67.0	.	NM_199462	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	ENST00000367162.3	hg19	CCDS1451.1																																																																																			.	.	.	none		0.418	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
ZFYVE20	64145	hgsc.bcm.edu	37	3	15116216	15116216	+	Silent	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr3:15116216C>A	ENST00000253699.3	-	14	2041	c.1428G>T	c.(1426-1428)gcG>gcT	p.A476A	ZFYVE20_ENST00000476527.2_Silent_p.A476A	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	476	Necessary for the interaction with EHD1.|Necessary for the interaction with RAB4A.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						CCATGCGGCCCGCGGCCTTGG	0.617																																					p.A476A		Atlas-SNP	.											.	ZFYVE20	61	.	0			c.G1428T						PASS	.						74.0	69.0	70.0					3																	15116216		2203	4300	6503	SO:0001819	synonymous_variant	64145	exon14			GCGGCCCGCGGCC	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.1428G>T	chr3.hg19:g.15116216C>A		158.0	0.0	.		132.0	6.0	.	NM_022340	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Silent	SNP	ENST00000253699.3	hg19	CCDS2623.1																																																																																			.	.	.	none		0.617	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340	
CTDSPL	10217	hgsc.bcm.edu	37	3	38009318	38009318	+	Splice_Site	SNP	C	C	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr3:38009318C>G	ENST00000273179.5	+	5	397	c.371C>G	c.(370-372)cCt>cGt	p.P124R	MIR26A1_ENST00000362205.1_RNA|CTDSPL_ENST00000310189.3_3'UTR|CTDSPL_ENST00000443503.2_Splice_Site_p.P113R	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	124	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TTTCTCTAGCCTATTAGTAAT	0.308											OREG0015472	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P124R		Atlas-SNP	.											.	CTDSPL	17	.	0			c.C371G						PASS	.						64.0	61.0	62.0					3																	38009318		2199	4299	6498	SO:0001630	splice_region_variant	10217	exon5			TCTAGCCTATTAG	D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.370-1C>G	chr3.hg19:g.38009318C>G		63.0	0.0	.	874	54.0	13.0	.	NM_001008392	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	ENST00000273179.5	hg19	CCDS33734.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625293	0.87560	.	.	ENSG00000144677	ENST00000443503;ENST00000273179;ENST00000447745	T;T;T	0.17213	2.29;2.29;2.29	5.15	5.15	0.70609	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.049311	0.85682	D	0.000000	T	0.46756	0.1409	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.49133	-0.8971	10	0.62326	D	0.03	-20.9054	19.0018	0.92837	0.0:1.0:0.0:0.0	.	113;124	O15194-2;O15194	.;CTDSL_HUMAN	R	113;124;13	ENSP00000398288:P113R;ENSP00000273179:P124R;ENSP00000407443:P13R	ENSP00000273179:P124R	P	+	2	0	CTDSPL	37984322	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.720000	0.84759	2.571000	0.86741	0.655000	0.94253	CCT	.	.	.	none		0.308	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	Missense_Mutation
FYCO1	79443	hgsc.bcm.edu	37	3	46008824	46008824	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr3:46008824C>T	ENST00000296137.2	-	8	2207	c.2002G>A	c.(2002-2004)Gcc>Acc	p.A668T	FYCO1_ENST00000535325.1_Missense_Mutation_p.A668T	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	668					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CGGATGCTGGCCTGCTCGGCC	0.632																																					p.A668T		Atlas-SNP	.											.	FYCO1	115	.	0			c.G2002A						PASS	.						48.0	53.0	52.0					3																	46008824		2203	4299	6502	SO:0001583	missense	79443	exon8			TGCTGGCCTGCTC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2002G>A	chr3.hg19:g.46008824C>T	ENSP00000296137:p.Ala668Thr	173.0	0.0	.		150.0	62.0	.	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644029	0.47258	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.21932	1.98;1.98	5.77	3.98	0.46160	.	0.365546	0.30492	N	0.009502	T	0.29355	0.0731	M	0.62723	1.935	0.25407	N	0.988398	D;D	0.60575	0.988;0.983	P;P	0.57204	0.815;0.766	T	0.12016	-1.0564	10	0.19147	T	0.46	-9.0348	5.1628	0.15070	0.0:0.5992:0.1506:0.2502	.	668;668	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	T	668	ENSP00000296137:A668T;ENSP00000441178:A668T	ENSP00000296137:A668T	A	-	1	0	FYCO1	45983828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.289000	0.33307	0.786000	0.33708	0.655000	0.94253	GCC	.	.	.	none		0.632	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
FNIP2	57600	hgsc.bcm.edu	37	4	159825696	159825696	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr4:159825696A>G	ENST00000264433.6	+	17	3420	c.3345A>G	c.(3343-3345)taA>taG	p.*1115*	C4orf45_ENST00000434826.2_Intron|FNIP2_ENST00000379346.3_Silent_p.*1138*|C4orf45_ENST00000508011.1_Intron	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	0					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TACTCTTATAAGCTAAAGCTC	0.388																																					p.X1115X		Atlas-SNP	.											.	FNIP2	90	.	0			c.A3345G						PASS	.						141.0	133.0	136.0					4																	159825696		1847	4095	5942	SO:0001819	synonymous_variant	57600	exon17			CTTATAAGCTAAA	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.3345A>G	chr4.hg19:g.159825696A>G		172.0	0.0	.		121.0	46.0	.	NM_020840	Q05DC3|Q96I31|Q9H994	Silent	SNP	ENST00000264433.6	hg19	CCDS47155.1																																																																																			.	.	.	none		0.388	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
RBM27	54439	hgsc.bcm.edu	37	5	145610424	145610424	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:145610424C>A	ENST00000265271.5	+	6	960	c.794C>A	c.(793-795)tCt>tAt	p.S265Y	RBM27_ENST00000506502.1_Missense_Mutation_p.S265Y	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	265					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATCATAGCTCTTCCAATTCT	0.428																																					p.S265Y		Atlas-SNP	.											.	RBM27	119	.	0			c.C794A						PASS	.						124.0	108.0	113.0					5																	145610424		1568	3582	5150	SO:0001583	missense	54439	exon6			ATAGCTCTTCCAA	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.794C>A	chr5.hg19:g.145610424C>A	ENSP00000265271:p.Ser265Tyr	118.0	0.0	.		97.0	37.0	.	NM_018989	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	hg19	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690372	0.48097	.	.	ENSG00000091009	ENST00000265271	T	0.48201	0.82	5.56	5.56	0.83823	.	0.344763	0.28332	N	0.015722	T	0.36496	0.0969	N	0.22421	0.69	0.35199	D	0.774129	P;P	0.51653	0.454;0.947	B;B	0.41374	0.064;0.355	T	0.53514	-0.8428	10	0.59425	D	0.04	-7.8615	15.2609	0.73621	0.1489:0.8511:0.0:0.0	.	265;265	Q9P2N5;B3KY61	RBM27_HUMAN;.	Y	265	ENSP00000265271:S265Y	ENSP00000265271:S265Y	S	+	2	0	RBM27	145590617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.339000	0.43965	2.614000	0.88457	0.563000	0.77884	TCT	.	.	.	none		0.428	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
ARSI	340075	hgsc.bcm.edu	37	5	149677576	149677576	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr5:149677576G>A	ENST00000328668.7	-	2	1490	c.911C>T	c.(910-912)tCg>tTg	p.S304L		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	304					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTGCCCCCCGAGAAAGTCTG	0.587																																					p.S304L		Atlas-SNP	.											.	ARSI	65	.	0			c.C911T						PASS	.						36.0	32.0	34.0					5																	149677576		2199	4292	6491	SO:0001583	missense	340075	exon2			CCCCCCGAGAAAG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.911C>T	chr5.hg19:g.149677576G>A	ENSP00000333395:p.Ser304Leu	94.0	0.0	.		71.0	28.0	.	NM_001012301	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	hg19	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361900	0.61403	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.96745	-4.11;-4.11	4.46	4.46	0.54185	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.059421	0.64402	D	0.000001	D	0.92473	0.7610	N	0.25426	0.745	0.54753	D	0.999982	B	0.18166	0.026	B	0.18263	0.021	D	0.89036	0.3445	10	0.22109	T	0.4	.	17.6599	0.88189	0.0:0.0:1.0:0.0	.	304	Q5FYB1	ARSI_HUMAN	L	304;161	ENSP00000333395:S304L;ENSP00000426879:S161L	ENSP00000333395:S304L	S	-	2	0	ARSI	149657769	1.000000	0.71417	0.961000	0.40146	0.945000	0.59286	7.738000	0.84966	2.460000	0.83146	0.561000	0.74099	TCG	.	.	.	none		0.587	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
NDUFAF4	29078	hgsc.bcm.edu	37	6	97344647	97344647	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr6:97344647A>G	ENST00000316149.7	-	2	292	c.213T>C	c.(211-213)gaT>gaC	p.D71D	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	71					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)				large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						GATCTTTGGAATCAACATACA	0.358																																					p.D71D		Atlas-SNP	.											.	NDUFAF4	16	.	0			c.T213C						PASS	.						148.0	149.0	149.0					6																	97344647		2203	4300	6503	SO:0001819	synonymous_variant	29078	exon2			TTTGGAATCAACA	AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.213T>C	chr6.hg19:g.97344647A>G		128.0	0.0	.		114.0	32.0	.	NM_014165	B2R4J5	Silent	SNP	ENST00000316149.7	hg19	CCDS5037.1																																																																																			.	.	.	none		0.358	NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
PABPC1	26986	hgsc.bcm.edu	37	8	101719226	101719226	+	Splice_Site	SNP	C	C	G	rs112580522		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr8:101719226C>G	ENST00000318607.5	-	10	2465		c.e10-1		PABPC1_ENST00000519004.1_Splice_Site|PABPC1_ENST00000522387.1_Splice_Site|PABPC1_ENST00000519596.1_Intron|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)	p.?(1)		breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TTTTGGAATGCTGCATTTTAA	0.413																																					.		Atlas-SNP	.											PABPC1,NS,carcinoma,0,1	PABPC1	76	.	1	Unknown(1)	lung(1)	c.1337-1G>C						PASS	.						39.0	41.0	40.0					8																	101719226		2203	4300	6503	SO:0001630	splice_region_variant	26986	exon11			GGAATGCTGCATT	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1337-1G>C	chr8.hg19:g.101719226C>G		63.0	1.0	.		54.0	6.0	.	NM_002568	Q15097|Q93004	Splice_Site	SNP	ENST00000318607.5	hg19	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096182	0.76870	.	.	ENSG00000070756	ENST00000318607;ENST00000519004;ENST00000522387;ENST00000517403	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5891	0.99427	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PABPC1	101788402	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	5.388000	0.66249	2.876000	0.98609	0.650000	0.86243	.	.	G|1.000;|0.000	1.000	weak		0.413	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	Intron
TG	7038	hgsc.bcm.edu	37	8	133931710	133931710	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr8:133931710T>G	ENST00000220616.4	+	21	4508	c.4468T>G	c.(4468-4470)Tgt>Ggt	p.C1490G	TG_ENST00000542445.1_5'UTR|TG_ENST00000377869.1_Missense_Mutation_p.C1490G	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1490					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GAGCTTGGCCTGTGTCCCATG	0.478																																					p.C1490G		Atlas-SNP	.											.	TG	416	.	0			c.T4468G						PASS	.						141.0	112.0	122.0					8																	133931710		2203	4300	6503	SO:0001583	missense	7038	exon21			TTGGCCTGTGTCC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4468T>G	chr8.hg19:g.133931710T>G	ENSP00000220616:p.Cys1490Gly	102.0	0.0	.		109.0	41.0	.	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.60|16.60	3.168293|3.168293	0.57584|0.57584	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616|ENST00000519178	D;D|.	0.86865|.	-2.18;-2.18|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Tyrosine-protein kinase ephrin type A/B receptor-like (1);|.	0.194939|.	0.36703|.	N|.	0.002444|.	T|T	0.80374|0.80374	0.4611|0.4611	H|H	0.97516|0.97516	4.02|4.02	0.28752|0.28752	N|N	0.90136|0.90136	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.80527|0.80527	-0.1343|-0.1343	10|5	0.87932|.	D|.	0|.	.|.	12.3216|12.3216	0.54987|0.54987	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1490|.	P01266|.	THYG_HUMAN|.	G|R	1490;296;1490|9	ENSP00000367100:C1490G;ENSP00000220616:C1490G|.	ENSP00000220616:C1490G|.	C|L	+|+	1|2	0|0	TG|TG	134000892|134000892	1.000000|1.000000	0.71417|0.71417	0.890000|0.890000	0.34922|0.34922	0.588000|0.588000	0.36517|0.36517	5.096000|5.096000	0.64535|0.64535	2.225000|2.225000	0.72522|0.72522	0.533000|0.533000	0.62120|0.62120	TGT|CTG	.	.	.	none		0.478	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
ERLIN1	10613	hgsc.bcm.edu	37	10	101911987	101911987	+	Silent	SNP	A	A	G			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr10:101911987A>G	ENST00000421367.2	-	11	3655	c.948T>C	c.(946-948)taT>taC	p.Y316Y	ERLIN1_ENST00000407654.3_Silent_p.Y316Y	NM_001100626.1|NM_006459.3	NP_001094096.1|NP_006450.2	O75477	ERLN1_HUMAN	ER lipid raft associated 1	314					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)							Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)		TAATATCTGAATATTTCAAAG	0.443																																					p.Y316Y		Atlas-SNP	.											.	.	.	.	0			c.T948C						PASS	.						119.0	115.0	116.0					10																	101911987		2203	4300	6503	SO:0001819	synonymous_variant	10613	exon11			ATCTGAATATTTC	AF064093	CCDS7487.2	10q24.31	2014-03-03	2007-01-26	2007-01-26	ENSG00000107566	ENSG00000107566			16947	protein-coding gene	gene with protein product	"""Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9"""	611604	"""chromosome 10 open reading frame 69"", ""SPFH domain family, member 1"""	C10orf69, SPFH1		11118313, 16835267, 24482476	Standard	NM_006459		Approved	KE04, Erlin-1, SPG62	uc001kqo.4	O75477	OTTHUMG00000018900	ENST00000421367.2:c.948T>C	chr10.hg19:g.101911987A>G		127.0	0.0	.		132.0	50.0	.	NM_006459	B0QZ42|Q53HV0	Silent	SNP	ENST00000421367.2	hg19	CCDS7487.2																																																																																			.	.	.	none		0.443	ERLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049840.2	NM_006459	
PPFIBP2	8495	hgsc.bcm.edu	37	11	7669667	7669667	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr11:7669667T>C	ENST00000299492.4	+	18	2084	c.1696T>C	c.(1696-1698)Tgg>Cgg	p.W566R	PPFIBP2_ENST00000533792.1_Missense_Mutation_p.W408R|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.W423R|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000528883.1_Missense_Mutation_p.W454R	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	566	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TGTGTGTGCATGGCTGGAGGA	0.547																																					p.W566R		Atlas-SNP	.											.	PPFIBP2	87	.	0			c.T1696C						PASS	.						165.0	124.0	138.0					11																	7669667		2201	4296	6497	SO:0001583	missense	8495	exon18			TGTGCATGGCTGG	AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1696T>C	chr11.hg19:g.7669667T>C	ENSP00000299492:p.Trp566Arg	140.0	0.0	.		117.0	44.0	.	NM_003621	B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	ENST00000299492.4	hg19	CCDS31419.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451254	0.84209	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.74	5.74	0.90152	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.64402	D	0.000001	D	0.82660	0.5085	H	0.95114	3.625	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.87696	0.2557	10	0.87932	D	0	-9.1173	13.9867	0.64339	0.0:0.0:0.0:1.0	.	454;454;489;408;423;566	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.;.;.;.;.;LIPB2_HUMAN	R	566;408;489;454;423	ENSP00000299492:W566R;ENSP00000436498:W408R;ENSP00000435469:W454R;ENSP00000437321:W423R	ENSP00000299492:W566R	W	+	1	0	PPFIBP2	7626243	1.000000	0.71417	0.926000	0.36857	0.995000	0.86356	8.040000	0.89188	2.194000	0.70268	0.459000	0.35465	TGG	.	.	.	none		0.547	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385345.2	NM_003621	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751585	+	Splice_Site	SNP	T	T	C	rs11292199		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr11:76751585T>C	ENST00000354301.5	+	4	1076	c.988T>C	c.(988-990)Tgg>Cgg	p.W330R	B3GNT6_ENST00000421061.1_Splice_Site|B3GNT6_ENST00000533140.1_Silent_p.P330P	NM_138706.3	NP_619651.3	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGG	0.697																																					.		Atlas-SNP	.											.,2	B3GNT6	27	.	0			c.988+1T>C						PASS	.						6.0	5.0	6.0					11																	76751585		1175	2610	3785	SO:0001630	splice_region_variant	192134	exon3			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000354301.5:c.988-1T>C	chr11.hg19:g.76751585T>C		0.0	0.0	.		5.0	3.0	.	NM_138706	Q4TTN0	Splice_Site	SNP	ENST00000354301.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	0.007|0.007	-1.936685|-1.936685	0.00484|0.00484	.|.	.|.	ENSG00000198488|ENSG00000198488	ENST00000354301;ENST00000421061|ENST00000354301	.|T	.|0.24538	.|1.85	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.11024	.|0.0269	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.26916	.|-1.0089	.|4	.|0.02654	.|T	.|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|R	-1|330	.|ENSP00000346256:W330R	.|ENSP00000346256:W330R	.|W	+|+	.|1	.|0	B3GNT6|B3GNT6	76429233|76429233	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	0.000000|0.000000	0.12993|0.12993	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|TGG	.	.	.	none		0.697	B3GNT6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_138706	Missense_Mutation
KLRK1	22914	hgsc.bcm.edu	37	12	10539567	10539567	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:10539567C>T	ENST00000240618.6	-	3	223	c.83G>A	c.(82-84)aGt>aAt	p.S28N	KLRK1_ENST00000540818.1_Missense_Mutation_p.S28N|RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	28					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TGAAAAATCACTCTTCTTCAG	0.363																																					p.S28N		Atlas-SNP	.											.	.	.	.	0			c.G83A						PASS	.						171.0	159.0	163.0					12																	10539567		2203	4299	6502	SO:0001583	missense	0	exon8			AAATCACTCTTCT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.83G>A	chr12.hg19:g.10539567C>T	ENSP00000240618:p.Ser28Asn	70.0	0.0	.		56.0	18.0	.	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.506590	0.00992	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01430	4.9;4.9	4.09	-8.18	0.01053	.	2.508350	0.01286	N	0.009885	T	0.00998	0.0033	L	0.29908	0.895	0.09310	N	1	B;B;B	0.21520	0.0;0.0;0.057	B;B;B	0.15870	0.0;0.001;0.014	T	0.48958	-0.8988	10	0.11794	T	0.64	.	1.9441	0.03353	0.1238:0.2263:0.3731:0.2768	.	28;9;28	Q8WZ67;Q1HEA1;P26718	.;.;NKG2D_HUMAN	N	28	ENSP00000240618:S28N;ENSP00000446003:S28N	ENSP00000240618:S28N	S	-	2	0	KLRK1	10430834	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.256000	0.00538	-1.778000	0.01282	-1.161000	0.01788	AGT	.	.	.	none		0.363	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
KRR1	11103	hgsc.bcm.edu	37	12	75895546	75895546	+	Silent	SNP	T	T	C			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:75895546T>C	ENST00000229214.4	-	9	983	c.960A>G	c.(958-960)gcA>gcG	p.A320A	GLIPR1_ENST00000266659.3_3'UTR|KRR1_ENST00000438169.2_Silent_p.A263A	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	320	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						GTGGAATAAATGCTTTGTTTC	0.279																																					p.A320A		Atlas-SNP	.											.	KRR1	37	.	0			c.A960G						PASS	.						125.0	123.0	124.0					12																	75895546		2203	4299	6502	SO:0001819	synonymous_variant	11103	exon9			AATAAATGCTTTG	U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.960A>G	chr12.hg19:g.75895546T>C		87.0	0.0	.		73.0	21.0	.	NM_007043	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Silent	SNP	ENST00000229214.4	hg19	CCDS9012.1																																																																																			.	.	.	none		0.279	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	
ACACB	32	hgsc.bcm.edu	37	12	109692084	109692084	+	Silent	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:109692084C>T	ENST00000338432.7	+	44	6230	c.6111C>T	c.(6109-6111)ctC>ctT	p.L2037L	ACACB_ENST00000543201.1_Silent_p.L703L|ACACB_ENST00000377848.3_Silent_p.L2037L|ACACB_ENST00000377854.5_Silent_p.L1967L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2037	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TTGAATTCCTCCCATCCAGAG	0.488																																					p.L2037L		Atlas-SNP	.											.	ACACB	330	.	0			c.C6111T						PASS	.						206.0	202.0	203.0					12																	109692084		2203	4300	6503	SO:0001819	synonymous_variant	32	exon43			ATTCCTCCCATCC	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6111C>T	chr12.hg19:g.109692084C>T		321.0	0.0	.		240.0	95.0	.	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	hg19	CCDS31898.1																																																																																			.	.	.	none		0.488	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
CDAN1	146059	hgsc.bcm.edu	37	15	43024004	43024004	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr15:43024004C>T	ENST00000356231.3	-	11	1576	c.1553G>A	c.(1552-1554)gGt>gAt	p.G518D		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	518					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GCCCCCAGCACCACCAGGGCT	0.532																																					p.G518D		Atlas-SNP	.											.	CDAN1	70	.	0			c.G1553A						PASS	.						34.0	38.0	36.0					15																	43024004		2203	4299	6502	SO:0001583	missense	146059	exon11			CCAGCACCACCAG	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.1553G>A	chr15.hg19:g.43024004C>T	ENSP00000348564:p.Gly518Asp	80.0	0.0	.		94.0	26.0	.	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	hg19	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	c	17.73	3.462735	0.63513	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.86694	-2.16	5.85	4.9	0.64082	.	0.352932	0.32785	N	0.005652	D	0.88526	0.6460	L	0.41236	1.265	0.37581	D	0.919811	D	0.63046	0.992	P	0.57101	0.813	D	0.89548	0.3797	10	0.46703	T	0.11	-7.4334	16.3622	0.83271	0.1325:0.8675:0.0:0.0	.	518	Q8IWY9	CDAN1_HUMAN	D	518;516	ENSP00000348564:G518D	ENSP00000267892:G516D	G	-	2	0	CDAN1	40811296	0.601000	0.26907	0.996000	0.52242	0.629000	0.37895	3.677000	0.54619	2.773000	0.95371	0.651000	0.88453	GGT	.	.	.	none		0.532	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
TMPRSS9	360200	hgsc.bcm.edu	37	19	2421953	2421953	+	Silent	SNP	G	G	T	rs537200343		TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr19:2421953G>T	ENST00000332578.3	+	13	2154	c.2154G>T	c.(2152-2154)ccG>ccT	p.P718P		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	718	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTAAGAAGCCGGGCGTGTACA	0.632																																					p.P718P		Atlas-SNP	.											.	TMPRSS9	79	.	0			c.G2154T						PASS	.						77.0	71.0	73.0					19																	2421953		2203	4300	6503	SO:0001819	synonymous_variant	360200	exon13			GAAGCCGGGCGTG	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.2154G>T	chr19.hg19:g.2421953G>T		178.0	0.0	.		120.0	7.0	.	NM_182973	Q6ZND6|Q7Z411	Silent	SNP	ENST00000332578.3	hg19	CCDS12088.1																																																																																			.	.	.	none		0.632	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451330.3	NM_182973	
CST9L	128821	hgsc.bcm.edu	37	20	23548869	23548869	+	Silent	SNP	G	G	T			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr20:23548869G>T	ENST00000376979.3	-	1	517	c.219C>A	c.(217-219)atC>atA	p.I73I		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	73						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					AGGAATTCAAGATGTGCCCCA	0.547																																					p.I73I		Atlas-SNP	.											.	CST9L	25	.	0			c.C219A						PASS	.						155.0	122.0	133.0					20																	23548869		2203	4300	6503	SO:0001819	synonymous_variant	128821	exon1			ATTCAAGATGTGC		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.219C>A	chr20.hg19:g.23548869G>T		81.0	0.0	.		66.0	19.0	.	NM_080610	B2R5A1	Silent	SNP	ENST00000376979.3	hg19	CCDS13157.1																																																																																			.	.	.	none		0.547	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
EPG5	57724	hgsc.bcm.edu	37	18	43464597	43464598	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr18:43464597_43464598insAA	ENST00000282041.5	-	30	5322_5323	c.5288_5289insTT	c.(5287-5289)ttcfs	p.F1763fs	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1763					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TTAGCAGCATGAAAATCATATC	0.421																																					p.F1763fs		Atlas-INDEL	.											.	EPG5	199	.	0			c.5289_5290insTT						PASS	.																																			SO:0001589	frameshift_variant	57724	exon30			.	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5287_5288dupTT	chr18.hg19:g.43464600_43464601dupAA	ENSP00000282041:p.Phe1763fs	143.0	0.0	0		121.0	39.0	0.322314	NM_020964	A2BDF3|Q9H8C8	Frame_Shift_Ins	INS	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.	.	none		0.421	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
GNPTAB	79158	hgsc.bcm.edu	37	12	102159058	102159058	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr12:102159058delA	ENST00000299314.7	-	13	1899	c.1637delT	c.(1636-1638)gtgfs	p.V546fs	RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	546					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GAGAAGGATCACTTTATACAA	0.358																																					p.V546fs		Atlas-INDEL	.											.	GNPTAB	120	.	0			c.1638delG						PASS	.						77.0	77.0	77.0					12																	102159058		2203	4300	6503	SO:0001589	frameshift_variant	79158	exon13			.	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1637delT	chr12.hg19:g.102159058delA	ENSP00000299314:p.Val546fs	101.0	0.0	0		100.0	33.0	0.33	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Frame_Shift_Del	DEL	ENST00000299314.7	hg19	CCDS9088.1																																																																																			.	.	.	none		0.358	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
LACTB	114294	hgsc.bcm.edu	37	15	63414861	63414861	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6792-01A-21D-1961-08	TCGA-G7-6792-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcb71dd8-5625-4d0c-9148-b70199b7f6f3	381c414c-def1-4d55-95b5-9071eaf29fa6	g.chr15:63414861delG	ENST00000261893.4	+	2	456	c.384delG	c.(382-384)gtgfs	p.V129fs	LACTB_ENST00000413507.2_Frame_Shift_Del_p.V129fs	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	129						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						CGGGCATAGTGGTTGGAGTTT	0.488																																					p.V128fs	Melanoma(85;443 1381 6215 27308 35583)	Atlas-INDEL	.											.	LACTB	29	.	0			c.383delT						PASS	.						169.0	148.0	155.0					15																	63414861		2203	4300	6503	SO:0001589	frameshift_variant	114294	exon2			.	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.384delG	chr15.hg19:g.63414861delG	ENSP00000261893:p.Val129fs	107.0	0.0	0		106.0	35.0	0.330189	NM_032857	P83096	Frame_Shift_Del	DEL	ENST00000261893.4	hg19	CCDS10182.1																																																																																			.	.	.	none		0.488	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
