#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CD	5293	hgsc.bcm.edu	37	1	9782066	9782066	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:9782066G>T	ENST00000377346.4	+	17	2284	c.2089G>T	c.(2089-2091)Gac>Tac	p.D697Y	PIK3CD_ENST00000543390.1_3'UTR|PIK3CD_ENST00000361110.2_Missense_Mutation_p.D721Y|PIK3CD_ENST00000536656.1_Missense_Mutation_p.D721Y	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	697					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GGCCCTGAATGACTTCGTCAA	0.637											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D697Y		Atlas-SNP	.											.	PIK3CD	86	.	0			c.G2089T						PASS	.						74.0	84.0	81.0					1																	9782066		2203	4300	6503	SO:0001583	missense	5293	exon17			CTGAATGACTTCG		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2089G>T	chr1.hg19:g.9782066G>T	ENSP00000366563:p.Asp697Tyr	123.0	0.0	.	659	99.0	26.0	.	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	hg19	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908660	0.33721	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	D;D;D	0.82081	-1.57;-1.57;-1.57	5.4	4.48	0.54585	Protein kinase-like domain (1);	0.151853	0.64402	D	0.000020	D	0.86339	0.5909	L	0.55990	1.75	0.80722	D	1	P;D;P	0.65815	0.939;0.995;0.939	P;P;P	0.57620	0.615;0.824;0.707	D	0.87479	0.2419	10	0.87932	D	0	-44.469	13.397	0.60858	0.0756:0.0:0.9244:0.0	.	696;721;697	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	Y	721;697;721;721	ENSP00000446444:D721Y;ENSP00000366563:D697Y;ENSP00000354410:D721Y	ENSP00000353766:D721Y	D	+	1	0	PIK3CD	9704653	1.000000	0.71417	0.063000	0.19743	0.112000	0.19704	7.859000	0.86982	1.275000	0.44379	0.561000	0.74099	GAC	.	.	.	none		0.637	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
TAS1R2	80834	hgsc.bcm.edu	37	1	19186021	19186021	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:19186021A>T	ENST00000375371.3	-	1	155	c.134T>A	c.(133-135)aTg>aAg	p.M45K	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	45					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AATGCCCTTCATGTTGGCATG	0.592																																					p.M45K		Atlas-SNP	.											.	TAS1R2	134	.	0			c.T134A						PASS	.						118.0	109.0	112.0					1																	19186021		2203	4300	6503	SO:0001583	missense	80834	exon1			CCCTTCATGTTGG		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.134T>A	chr1.hg19:g.19186021A>T	ENSP00000364520:p.Met45Lys	162.0	0.0	.		107.0	16.0	.	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	hg19	CCDS187.1	.	.	.	.	.	.	.	.	.	.	A	8.739	0.918447	0.17982	.	.	ENSG00000179002	ENST00000375371	D	0.88046	-2.33	4.47	2.07	0.26955	.	0.544004	0.13698	U	0.369069	T	0.74627	0.3741	N	0.22421	0.69	0.09310	N	0.999998	B	0.27068	0.167	B	0.18871	0.023	T	0.63093	-0.6714	10	0.52906	T	0.07	.	4.5956	0.12327	0.699:0.196:0.1051:0.0	.	45	Q8TE23	TS1R2_HUMAN	K	45	ENSP00000364520:M45K	ENSP00000364520:M45K	M	-	2	0	TAS1R2	19058608	0.239000	0.23836	0.384000	0.26145	0.776000	0.43924	1.724000	0.38064	0.201000	0.20466	0.260000	0.18958	ATG	.	.	.	none		0.592	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
LRRC8C	84230	hgsc.bcm.edu	37	1	90180336	90180336	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:90180336T>C	ENST00000370454.4	+	3	2462	c.2207T>C	c.(2206-2208)aTt>aCt	p.I736T	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	736					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		ACTCTGAAGATTGGAAAAAAC	0.353																																					p.I736T		Atlas-SNP	.											.	LRRC8C	73	.	0			c.T2207C						PASS	.						62.0	64.0	64.0					1																	90180336		2203	4300	6503	SO:0001583	missense	84230	exon3			TGAAGATTGGAAA		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2207T>C	chr1.hg19:g.90180336T>C	ENSP00000359483:p.Ile736Thr	103.0	0.0	.		88.0	7.0	.	NM_032270	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	hg19	CCDS725.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077889	0.36662	.	.	ENSG00000171488	ENST00000370454	T	0.27402	1.67	5.87	5.87	0.94306	.	0.047961	0.85682	D	0.000000	T	0.25791	0.0628	M	0.69358	2.11	0.53688	D	0.99997	B	0.21821	0.061	B	0.27715	0.082	T	0.08953	-1.0697	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	736	Q8TDW0	LRC8C_HUMAN	T	736	ENSP00000359483:I736T	ENSP00000359483:I736T	I	+	2	0	LRRC8C	89952924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.371000	0.80710	0.533000	0.62120	ATT	.	.	.	none		0.353	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
VAV3	10451	hgsc.bcm.edu	37	1	108307784	108307784	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:108307784C>A	ENST00000370056.4	-	9	1109	c.835G>T	c.(835-837)Ggg>Tgg	p.G279W	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.G279W|VAV3_ENST00000371846.4_Missense_Mutation_p.G214W	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	279	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CAGTACTGCCCGTAAATAACC	0.373																																					p.G279W		Atlas-SNP	.											.	VAV3	176	.	0			c.G835T						PASS	.						70.0	67.0	68.0					1																	108307784		2203	4300	6503	SO:0001583	missense	10451	exon9			ACTGCCCGTAAAT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.835G>T	chr1.hg19:g.108307784C>A	ENSP00000359073:p.Gly279Trp	70.0	0.0	.		100.0	8.0	.	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	hg19	CCDS785.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.420776	0.83559	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846	T;T;T	0.64618	-0.11;-0.11;-0.11	5.55	5.55	0.83447	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.82421	0.5033	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.85946	0.1461	10	0.87932	D	0	.	19.506	0.95116	0.0:1.0:0.0:0.0	.	279;279;214;279	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.;.;.;VAV3_HUMAN	W	279;279;214	ENSP00000359073:G279W;ENSP00000432540:G279W;ENSP00000360912:G214W	ENSP00000359073:G279W	G	-	1	0	VAV3	108109307	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.354000	0.79424	2.611000	0.88343	0.585000	0.79938	GGG	.	.	.	none		0.373	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
S100A3	6274	hgsc.bcm.edu	37	1	153520312	153520312	+	Missense_Mutation	SNP	C	C	A	rs566984814		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:153520312C>A	ENST00000368713.3	-	3	348	c.152G>T	c.(151-153)cGg>cTg	p.R51L	S100A4_ENST00000481009.1_5'Flank|S100A4_ENST00000368714.1_Intron|S100A3_ENST00000368712.1_Missense_Mutation_p.R51L|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000354332.4_5'Flank	NM_002960.1	NP_002951.1	P33764	S10A3_HUMAN	S100 calcium binding protein A3	51	EF-hand 2.					cytoplasm (GO:0005737)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|liver(1)|lung(1)	3	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCACATTCCCGAAACTCAGT	0.542																																					p.R51L		Atlas-SNP	.											S100A3,NS,carcinoma,0,1	S100A3	7	.	0			c.G152T						PASS	.						203.0	182.0	189.0					1																	153520312		2203	4300	6503	SO:0001583	missense	6274	exon3			CATTCCCGAAACT	BC012893	CCDS1043.1	1q21	2008-02-05	2001-11-28		ENSG00000188015	ENSG00000188015		"""S100 calcium binding proteins"""	10493	protein-coding gene	gene with protein product		176992	"""S100 calcium-binding protein A3"""	S100E		8341667	Standard	NM_002960		Approved		uc001fca.1	P33764	OTTHUMG00000013550	ENST00000368713.3:c.152G>T	chr1.hg19:g.153520312C>A	ENSP00000357702:p.Arg51Leu	245.0	0.0	.		179.0	10.0	.	NM_002960	D3DV51|Q6FGE4	Missense_Mutation	SNP	ENST00000368713.3	hg19	CCDS1043.1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222659	0.39300	.	.	ENSG00000188015	ENST00000368713;ENST00000368712	T;T	0.13420	2.59;2.59	4.85	0.804	0.18697	EF-hand-like domain (1);	0.648330	0.14896	N	0.292117	T	0.04137	0.0115	L	0.51422	1.61	0.09310	N	1	B	0.28055	0.199	B	0.20577	0.03	T	0.32375	-0.9909	10	0.72032	D	0.01	.	7.4533	0.27250	0.0:0.6319:0.0:0.3681	.	51	P33764	S10A3_HUMAN	L	51	ENSP00000357702:R51L;ENSP00000357701:R51L	ENSP00000357701:R51L	R	-	2	0	S100A3	151786936	0.010000	0.17322	0.027000	0.17364	0.562000	0.35680	0.709000	0.25734	-0.041000	0.13558	-0.136000	0.14681	CGG	.	.	.	none		0.542	S100A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037726.1	NM_002960	
PRELP	5549	hgsc.bcm.edu	37	1	203455866	203455866	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr1:203455866C>A	ENST00000343110.2	+	3	1133	c.1006C>A	c.(1006-1008)Cta>Ata	p.L336I		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	336					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCCCAACGACCTAGTGGCGTT	0.567																																					p.L336I		Atlas-SNP	.											.	PRELP	63	.	0			c.C1006A						PASS	.						110.0	100.0	103.0					1																	203455866		2203	4300	6503	SO:0001583	missense	5549	exon3			AACGACCTAGTGG	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.1006C>A	chr1.hg19:g.203455866C>A	ENSP00000343924:p.Leu336Ile	142.0	0.0	.		125.0	36.0	.	NM_201348	Q6FG38	Missense_Mutation	SNP	ENST00000343110.2	hg19	CCDS1438.1	.	.	.	.	.	.	.	.	.	.	C	1.678	-0.507353	0.04231	.	.	ENSG00000188783	ENST00000343110	T	0.49139	0.79	5.45	1.38	0.22167	.	0.097389	0.42964	N	0.000628	T	0.26557	0.0649	N	0.24115	0.695	0.19775	N	0.999957	B	0.06786	0.001	B	0.12156	0.007	T	0.15607	-1.0431	10	0.18710	T	0.47	-7.7426	5.6324	0.17518	0.2531:0.5559:0.1222:0.0687	.	336	P51888	PRELP_HUMAN	I	336	ENSP00000343924:L336I	ENSP00000343924:L336I	L	+	1	2	PRELP	201722489	0.003000	0.15002	0.003000	0.11579	0.246000	0.25737	-0.032000	0.12266	0.005000	0.14708	-0.300000	0.09419	CTA	.	.	.	none		0.567	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
CKAP2L	150468	hgsc.bcm.edu	37	2	113513875	113513875	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:113513875C>T	ENST00000302450.6	-	4	1151	c.1073G>A	c.(1072-1074)aGc>aAc	p.S358N	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.S193N	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	358						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						ACAAACTTGGCTGGACTTCTG	0.428																																					p.S358N		Atlas-SNP	.											.	CKAP2L	54	.	0			c.G1073A						PASS	.						149.0	144.0	145.0					2																	113513875		2203	4300	6503	SO:0001583	missense	150468	exon4			ACTTGGCTGGACT	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1073G>A	chr2.hg19:g.113513875C>T	ENSP00000305204:p.Ser358Asn	191.0	0.0	.		175.0	64.0	.	NM_152515	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	hg19	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	c	9.225	1.034367	0.19590	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.11821	2.74;3.39	4.69	-4.0	0.04057	.	0.732493	0.12806	N	0.437566	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34925	-0.9809	10	0.24483	T	0.36	-1.0892	0.994	0.01462	0.2342:0.3464:0.1852:0.2342	.	358	Q8IYA6	CKP2L_HUMAN	N	193;358	ENSP00000438763:S193N;ENSP00000305204:S358N	ENSP00000305204:S358N	S	-	2	0	CKAP2L	113230346	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.718000	0.04980	-0.903000	0.03881	-0.911000	0.02809	AGC	.	.	.	none		0.428	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515	
TTN	7273	hgsc.bcm.edu	37	2	179425266	179425266	+	Silent	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:179425266A>G	ENST00000591111.1	-	276	80894	c.80670T>C	c.(80668-80670)taT>taC	p.Y26890Y	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.Y19658Y|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.Y19591Y|TTN_ENST00000460472.2_Silent_p.Y19466Y|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.Y28531Y|TTN_ENST00000342992.6_Silent_p.Y25963Y|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26890	Fibronectin type-III 95. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCAACACCATATTTATTAA	0.388																																					p.Y28531Y		Atlas-SNP	.											.	TTN	18412	.	0			c.T85593C						PASS	.						57.0	56.0	56.0					2																	179425266		1865	4100	5965	SO:0001819	synonymous_variant	7273	exon326			AACACCATATTTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80670T>C	chr2.hg19:g.179425266A>G		72.0	0.0	.		60.0	20.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ITGA4	3676	hgsc.bcm.edu	37	2	182399601	182399601	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:182399601T>C	ENST00000397033.2	+	27	3372	c.2942T>C	c.(2941-2943)aTt>aCt	p.I981T		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	981					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	ATAGTGATTATTTCAAGTAGC	0.313																																					p.I981T		Atlas-SNP	.											.	ITGA4	142	.	0			c.T2942C						PASS	.						148.0	140.0	143.0					2																	182399601		1850	4088	5938	SO:0001583	missense	3676	exon27			TGATTATTTCAAG		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2942T>C	chr2.hg19:g.182399601T>C	ENSP00000380227:p.Ile981Thr	116.0	0.0	.		103.0	29.0	.	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	hg19	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035378	0.75617	.	.	ENSG00000115232	ENST00000397033	T	0.74737	-0.87	6.17	6.17	0.99709	.	0.088153	0.85682	D	0.000000	T	0.78735	0.4330	M	0.78049	2.395	0.58432	D	0.999995	P	0.52577	0.954	P	0.45310	0.476	T	0.82464	-0.0444	10	0.87932	D	0	.	15.3933	0.74767	0.0:0.0:0.0:1.0	.	981	P13612	ITA4_HUMAN	T	981	ENSP00000380227:I981T	ENSP00000380227:I981T	I	+	2	0	ITGA4	182107846	1.000000	0.71417	0.171000	0.22900	0.989000	0.77384	5.141000	0.64814	2.371000	0.80710	0.533000	0.62120	ATT	.	.	.	none		0.313	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
NBEAL1	65065	hgsc.bcm.edu	37	2	204058575	204058575	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr2:204058575G>T	ENST00000449802.1	+	46	7225	c.6892G>T	c.(6892-6894)Gac>Tac	p.D2298Y		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2298										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AACCAAAATAGACACTTCAAC	0.343																																					p.D2298Y		Atlas-SNP	.											.	NBEAL1	266	.	0			c.G6892T						PASS	.						157.0	157.0	157.0					2																	204058575		1870	4098	5968	SO:0001583	missense	65065	exon46			AAAATAGACACTT	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6892G>T	chr2.hg19:g.204058575G>T	ENSP00000399903:p.Asp2298Tyr	139.0	0.0	.		149.0	42.0	.	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486179	0.63962	.	.	ENSG00000144426	ENST00000449802;ENST00000414576	T;T	0.56776	0.44;1.1	5.43	5.43	0.79202	.	0.063926	0.64402	U	0.000013	T	0.66684	0.2814	M	0.77103	2.36	0.58432	D	0.999999	P	0.49862	0.929	P	0.51487	0.671	T	0.67385	-0.5684	10	0.39692	T	0.17	.	18.8378	0.92169	0.0:0.0:1.0:0.0	.	2298	Q6ZS30	NBEL1_HUMAN	Y	2298;313	ENSP00000399903:D2298Y;ENSP00000388466:D313Y	ENSP00000388466:D313Y	D	+	1	0	NBEAL1	203766820	1.000000	0.71417	0.973000	0.42090	0.900000	0.52787	9.028000	0.93712	2.550000	0.86006	0.650000	0.86243	GAC	.	.	.	none		0.343	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
SLC9C1	285335	hgsc.bcm.edu	37	3	111918287	111918287	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:111918287C>T	ENST00000305815.5	-	20	2656	c.2404G>A	c.(2404-2406)Gct>Act	p.A802T	SLC9C1_ENST00000487372.1_Missense_Mutation_p.A754T	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	802					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ACAGTGACAGCAATTTCTGGG	0.279																																					p.A802T		Atlas-SNP	.											.	.	.	.	0			c.G2404A						PASS	.						73.0	73.0	73.0					3																	111918287		2201	4297	6498	SO:0001583	missense	285335	exon20			TGACAGCAATTTC	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2404G>A	chr3.hg19:g.111918287C>T	ENSP00000306627:p.Ala802Thr	86.0	0.0	.		89.0	45.0	.	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	hg19	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990748	0.54041	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.80480	-1.35;-1.38	5.55	2.81	0.32909	.	0.221517	0.31577	N	0.007408	T	0.81264	0.4786	M	0.65498	2.005	0.27008	N	0.96476	P;D	0.59767	0.855;0.986	P;P	0.52909	0.713;0.655	T	0.71745	-0.4500	10	0.33940	T	0.23	.	7.6697	0.28451	0.0:0.7356:0.0:0.2644	.	754;802	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	T	802;754	ENSP00000306627:A802T;ENSP00000420688:A754T	ENSP00000306627:A802T	A	-	1	0	SLC9A10	113400977	0.902000	0.30710	0.686000	0.30086	0.473000	0.32948	1.823000	0.39062	0.310000	0.22990	-0.140000	0.14226	GCT	.	.	.	none		0.279	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
TMCC1	23023	hgsc.bcm.edu	37	3	129390056	129390056	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr3:129390056A>T	ENST00000393238.3	-	4	968	c.628T>A	c.(628-630)Tcc>Acc	p.S210T	TMCC1_ENST00000426664.2_Missense_Mutation_p.S96T|TMCC1_ENST00000329333.5_Missense_Mutation_p.S31T|TMCC1_ENST00000432054.2_5'UTR	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	210						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TCGGTACTGGAGGCCACTGCA	0.522																																					p.S210T		Atlas-SNP	.											.	TMCC1	105	.	0			c.T628A						PASS	.						86.0	82.0	83.0					3																	129390056		2203	4300	6503	SO:0001583	missense	23023	exon4			TACTGGAGGCCAC	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.628T>A	chr3.hg19:g.129390056A>T	ENSP00000376930:p.Ser210Thr	145.0	0.0	.		183.0	12.0	.	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	hg19	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356489	0.61293	.	.	ENSG00000172765	ENST00000393238;ENST00000426664;ENST00000329333	T;T;T	0.45276	1.5;1.49;0.9	5.86	5.86	0.93980	.	0.163105	0.56097	D	0.000032	T	0.27134	0.0665	N	0.12182	0.205	0.43385	D	0.995495	B;B	0.13145	0.007;0.002	B;B	0.09377	0.004;0.002	T	0.08472	-1.0720	10	0.20046	T	0.44	-7.6554	16.2449	0.82437	1.0:0.0:0.0:0.0	.	31;210	B4DE04;O94876	.;TMCC1_HUMAN	T	210;96;31	ENSP00000376930:S210T;ENSP00000389892:S96T;ENSP00000327349:S31T	ENSP00000327349:S31T	S	-	1	0	TMCC1	130872746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.138000	0.77305	2.241000	0.73720	0.482000	0.46254	TCC	.	.	.	none		0.522	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
N4BP2	55728	hgsc.bcm.edu	37	4	40103811	40103811	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr4:40103811A>G	ENST00000261435.6	+	4	762	c.346A>G	c.(346-348)Ata>Gta	p.I116V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	116					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AGAAAGTAAAATAATGGAAAA	0.368																																					p.I116V		Atlas-SNP	.											.	N4BP2	166	.	0			c.A346G						PASS	.						92.0	90.0	91.0					4																	40103811		2203	4300	6503	SO:0001583	missense	55728	exon4			AGTAAAATAATGG	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.346A>G	chr4.hg19:g.40103811A>G	ENSP00000261435:p.Ile116Val	69.0	0.0	.		90.0	28.0	.	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	0.424	-0.906575	0.02434	.	.	ENSG00000078177	ENST00000261435;ENST00000381804;ENST00000515550	T;T	0.79247	-1.25;-1.25	6.08	1.18	0.20946	.	0.531518	0.19034	N	0.124467	T	0.52451	0.1735	N	0.12746	0.255	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.14578	0.011;0.003	T	0.37291	-0.9712	10	0.02654	T	1	-6.4549	8.9819	0.35970	0.7223:0.0:0.2777:0.0	.	116;116	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	V	116;36;36	ENSP00000261435:I116V;ENSP00000422057:I36V	ENSP00000261435:I116V	I	+	1	0	N4BP2	39780206	0.971000	0.33674	0.507000	0.27676	0.442000	0.32017	0.597000	0.24059	0.543000	0.28864	0.482000	0.46254	ATA	.	.	.	none		0.368	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
DAGLB	221955	hgsc.bcm.edu	37	7	6474439	6474439	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr7:6474439C>A	ENST00000297056.6	-	4	801	c.632G>T	c.(631-633)cGg>cTg	p.R211L	DAGLB_ENST00000436575.1_Missense_Mutation_p.R170L|DAGLB_ENST00000425398.2_Intron|DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000479922.2_5'Flank|DAGLB_ENST00000428902.2_Missense_Mutation_p.R84L	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	211					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		AAAAGCAACCCGAGTATGGTC	0.463																																					p.R211L		Atlas-SNP	.											.	DAGLB	74	.	0			c.G632T						PASS	.						160.0	154.0	156.0					7																	6474439		2203	4300	6503	SO:0001583	missense	221955	exon4			GCAACCCGAGTAT	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.632G>T	chr7.hg19:g.6474439C>A	ENSP00000297056:p.Arg211Leu	224.0	0.0	.		205.0	12.0	.	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	hg19	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898081	0.91962	.	.	ENSG00000164535	ENST00000297056;ENST00000436575;ENST00000471132;ENST00000428902	T;T	0.48836	0.81;0.8	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000001	T	0.56140	0.1965	M	0.84433	2.695	0.80722	D	1	P	0.41498	0.752	B	0.38842	0.283	T	0.64032	-0.6502	10	0.42905	T	0.14	.	18.8048	0.92032	0.0:1.0:0.0:0.0	.	211	Q8NCG7	DGLB_HUMAN	L	211;170;211;84	ENSP00000297056:R211L;ENSP00000404785:R170L	ENSP00000297056:R211L	R	-	2	0	DAGLB	6440964	1.000000	0.71417	0.088000	0.20740	0.980000	0.70556	4.539000	0.60657	2.431000	0.82371	0.491000	0.48974	CGG	.	.	.	none		0.463	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
TSGA13	114960	hgsc.bcm.edu	37	7	130353922	130353922	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr7:130353922C>A	ENST00000456951.1	-	9	1611	c.760G>T	c.(760-762)Ggg>Tgg	p.G254W	COPG2_ENST00000445977.2_5'Flank|TSGA13_ENST00000356588.3_Missense_Mutation_p.G254W			Q96PP4	TSG13_HUMAN	testis specific, 13	254										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					GCGCTCTCCCCGGGCGCGGTT	0.592																																					p.G254W		Atlas-SNP	.											.	TSGA13	35	.	0			c.G760T						PASS	.						100.0	106.0	104.0					7																	130353922		2203	4300	6503	SO:0001583	missense	114960	exon8			TCTCCCCGGGCGC	AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.760G>T	chr7.hg19:g.130353922C>A	ENSP00000406047:p.Gly254Trp	282.0	0.0	.		191.0	8.0	.	NM_052933	B3KSC9	Missense_Mutation	SNP	ENST00000456951.1	hg19	CCDS5824.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584905	0.65992	.	.	ENSG00000213265	ENST00000456951;ENST00000356588	.	.	.	5.51	5.51	0.81932	.	0.000000	0.49916	D	0.000130	T	0.66915	0.2838	L	0.34521	1.04	0.41776	D	0.989791	D	0.89917	1.0	D	0.97110	1.0	T	0.70029	-0.4984	9	0.87932	D	0	-16.3429	14.8978	0.70656	0.0:1.0:0.0:0.0	.	254	Q96PP4	TSG13_HUMAN	W	254	.	ENSP00000348996:G254W	G	-	1	0	TSGA13	130004462	0.467000	0.25831	0.776000	0.31678	0.138000	0.21146	3.831000	0.55776	2.585000	0.87301	0.561000	0.74099	GGG	.	.	.	none		0.592	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337997.1	NM_052933	
PKN3	29941	hgsc.bcm.edu	37	9	131482023	131482023	+	Silent	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr9:131482023C>A	ENST00000291906.4	+	19	2577	c.2184C>A	c.(2182-2184)ccC>ccA	p.P728P	PKN3_ENST00000485301.1_3'UTR|ZDHHC12_ENST00000467312.1_5'Flank	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	728	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCCTGGCTCCCGAGGTGCTGA	0.632																																					p.P728P		Atlas-SNP	.											.	PKN3	62	.	0			c.C2184A						PASS	.						144.0	151.0	149.0					9																	131482023		2203	4300	6503	SO:0001819	synonymous_variant	29941	exon19			GGCTCCCGAGGTG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.2184C>A	chr9.hg19:g.131482023C>A		284.0	0.0	.		195.0	8.0	.	NM_013355	Q9UM03	Silent	SNP	ENST00000291906.4	hg19	CCDS6908.1																																																																																			.	.	.	none		0.632	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
ITGA8	8516	hgsc.bcm.edu	37	10	15688933	15688933	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:15688933G>A	ENST00000378076.3	-	12	1472	c.1119C>T	c.(1117-1119)gaC>gaT	p.D373D		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	373					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GGATCTGGGGGTCTCTGAAGA	0.483																																					p.D373D		Atlas-SNP	.											.	ITGA8	230	.	0			c.C1119T						PASS	.						122.0	109.0	113.0					10																	15688933		2203	4300	6503	SO:0001819	synonymous_variant	8516	exon12			CTGGGGGTCTCTG	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1119C>T	chr10.hg19:g.15688933G>A		130.0	0.0	.		106.0	21.0	.	NM_003638	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	hg19	CCDS31155.1																																																																																			.	.	.	none		0.483	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
CUBN	8029	hgsc.bcm.edu	37	10	16916468	16916468	+	Silent	SNP	G	G	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:16916468G>T	ENST00000377833.4	-	58	9206	c.9141C>A	c.(9139-9141)atC>atA	p.I3047I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3047	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GACTTGTGATGATTCCAGAAG	0.433																																					p.I3047I		Atlas-SNP	.											.	CUBN	515	.	0			c.C9141A						PASS	.						168.0	135.0	146.0					10																	16916468		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon58			TGTGATGATTCCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9141C>A	chr10.hg19:g.16916468G>T		101.0	0.0	.		89.0	24.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.	.	none		0.433	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
UBTD1	80019	hgsc.bcm.edu	37	10	99327795	99327795	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:99327795G>A	ENST00000370664.3	+	2	531	c.195G>A	c.(193-195)aaG>aaA	p.K65K		NM_024954.3	NP_079230.1	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	65										central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)		AGGGCCGCAAGGAGATCTGGG	0.632																																					p.K65K	Pancreas(100;169 2668 32720)	Atlas-SNP	.											.	UBTD1	19	.	0			c.G195A						PASS	.						87.0	86.0	86.0					10																	99327795		2203	4300	6503	SO:0001819	synonymous_variant	80019	exon2			CCGCAAGGAGATC	BC007331	CCDS7465.1	10q24.2	2005-09-22			ENSG00000165886	ENSG00000165886			25683	protein-coding gene	gene with protein product						12477932	Standard	NM_024954		Approved	FLJ11807	uc001knv.1	Q9HAC8	OTTHUMG00000018856	ENST00000370664.3:c.195G>A	chr10.hg19:g.99327795G>A		195.0	0.0	.		155.0	24.0	.	NM_024954	D3DR57|Q53HI3	Silent	SNP	ENST00000370664.3	hg19	CCDS7465.1																																																																																			.	.	.	none		0.632	UBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049701.1	NM_024954	
TCF7L2	6934	hgsc.bcm.edu	37	10	114912175	114912175	+	Silent	SNP	C	C	A	rs149820593		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:114912175C>A	ENST00000355995.4	+	11	1752	c.1245C>A	c.(1243-1245)ccC>ccA	p.P415P	TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000534894.1_Silent_p.P415P|TCF7L2_ENST00000352065.5_Silent_p.P392P|TCF7L2_ENST00000545257.1_Silent_p.P415P|TCF7L2_ENST00000369389.1_Silent_p.P126P|TCF7L2_ENST00000538897.1_Silent_p.P415P|TCF7L2_ENST00000542695.1_Silent_p.P131P|TCF7L2_ENST00000536810.1_Silent_p.P415P|TCF7L2_ENST00000355717.4_Silent_p.P439P|TCF7L2_ENST00000369397.4_Silent_p.P392P|TCF7L2_ENST00000369386.1_Silent_p.P58P|TCF7L2_ENST00000543371.1_Silent_p.P415P			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	415					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		AACTGTACCCCGGCTGGTCCG	0.542			T	VTI1A	colorectal																																p.P439P		Atlas-SNP	.		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2	298	.	0			c.C1317A						PASS	.						128.0	134.0	132.0					10																	114912175		2203	4300	6503	SO:0001819	synonymous_variant	6934	exon11			GTACCCCGGCTGG	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1245C>A	chr10.hg19:g.114912175C>A		258.0	0.0	.		204.0	9.0	.	NM_001146283	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Silent	SNP	ENST00000355995.4	hg19																																																																																				.	C|1.000;T|0.000	.	alt		0.542	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
CNIH2	254263	hgsc.bcm.edu	37	11	66049735	66049735	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr11:66049735A>G	ENST00000311445.6	+	2	345	c.87A>G	c.(85-87)atA>atG	p.I29M	CNIH2_ENST00000528852.1_Missense_Mutation_p.I29M|YIF1A_ENST00000526497.1_5'Flank|CNIH2_ENST00000530519.1_3'UTR	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	29					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						CCCAGATCATAGCCTTTGATG	0.597																																					p.I29M		Atlas-SNP	.											.	CNIH2	15	.	0			c.A87G						PASS	.						72.0	66.0	68.0					11																	66049735		2200	4295	6495	SO:0001583	missense	254263	exon2			GATCATAGCCTTT	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.87A>G	chr11.hg19:g.66049735A>G	ENSP00000310003:p.Ile29Met	86.0	0.0	.		42.0	10.0	.	NM_182553		Missense_Mutation	SNP	ENST00000311445.6	hg19	CCDS8131.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634157	0.47049	.	.	ENSG00000174871	ENST00000528852;ENST00000311445	T;T	0.55760	0.5;0.5	5.33	1.49	0.22878	.	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	M	0.89478	3.035	0.58432	D	0.999998	D;D	0.71674	0.961;0.998	P;D	0.68483	0.791;0.958	T	0.68221	-0.5466	10	0.59425	D	0.04	-24.0482	4.9261	0.13894	0.3807:0.2295:0.0:0.3897	.	29;29	Q6PI25;E9PS15	CNIH2_HUMAN;.	M	29	ENSP00000432177:I29M;ENSP00000310003:I29M	ENSP00000310003:I29M	I	+	3	3	CNIH2	65806311	0.998000	0.40836	1.000000	0.80357	0.547000	0.35210	1.267000	0.33050	0.919000	0.36945	0.460000	0.39030	ATA	.	.	.	none		0.597	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391892.1	NM_182553	
EXPH5	23086	hgsc.bcm.edu	37	11	108380880	108380880	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr11:108380880C>T	ENST00000265843.4	-	6	5464	c.5354G>A	c.(5353-5355)tGg>tAg	p.W1785*	EXPH5_ENST00000428840.1_Nonsense_Mutation_p.W1709*|EXPH5_ENST00000443411.1_Nonsense_Mutation_p.W1597*|EXPH5_ENST00000525344.1_Nonsense_Mutation_p.W1778*	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1785					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTCAGGTTCCCACTCCAGAGA	0.483																																					p.W1785X		Atlas-SNP	.											.	EXPH5	193	.	0			c.G5354A						PASS	.						89.0	96.0	94.0					11																	108380880		2201	4298	6499	SO:0001587	stop_gained	23086	exon6			GGTTCCCACTCCA		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5354G>A	chr11.hg19:g.108380880C>T	ENSP00000265843:p.Trp1785*	188.0	0.0	.		107.0	46.0	.	NM_015065	Q2KHM1|Q9Y4D6	Nonsense_Mutation	SNP	ENST00000265843.4	hg19	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	41	8.551547	0.98859	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312	.	.	.	6.17	4.26	0.50523	.	0.766008	0.12354	N	0.476287	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	1.7662	10.3652	0.44019	0.0:0.497:0.431:0.0721	.	.	.	.	X	1785;1709;1597;1778;615;1709	.	ENSP00000265843:W1785X	W	-	2	0	EXPH5	107886090	0.060000	0.20803	0.159000	0.22649	0.035000	0.12851	0.897000	0.28390	0.883000	0.36040	0.655000	0.94253	TGG	.	.	.	none		0.483	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
NCAPD2	9918	hgsc.bcm.edu	37	12	6637024	6637024	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr12:6637024C>A	ENST00000315579.5	+	23	3788	c.2989C>A	c.(2989-2991)Cgt>Agt	p.R997S	NCAPD2_ENST00000542492.1_3'UTR|NCAPD2_ENST00000545962.1_Missense_Mutation_p.R952S	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	997					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.R997C(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AGAACTAATCCGTGGCATCTG	0.493																																					p.R997S		Atlas-SNP	.											NCAPD2,NS,carcinoma,0,1	NCAPD2	99	.	1	Substitution - Missense(1)	endometrium(1)	c.C2989A						PASS	.						132.0	132.0	132.0					12																	6637024		2203	4300	6503	SO:0001583	missense	9918	exon23			CTAATCCGTGGCA	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2989C>A	chr12.hg19:g.6637024C>A	ENSP00000325017:p.Arg997Ser	238.0	0.0	.		224.0	9.0	.	NM_014865	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	hg19	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385823	0.61956	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.12672	2.66;2.66;2.66	5.95	5.95	0.96441	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30103	0.0754	L	0.60455	1.87	0.58432	D	0.999997	D;B;D	0.57899	0.981;0.021;0.968	P;B;P	0.60886	0.88;0.051;0.66	T	0.00126	-1.2020	10	0.34782	T	0.22	-16.4149	15.1469	0.72662	0.1412:0.8588:0.0:0.0	.	952;958;997	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	S	997;869;952;869	ENSP00000325017:R997S;ENSP00000371895:R869S;ENSP00000444417:R952S	ENSP00000325017:R997S	R	+	1	0	NCAPD2	6507285	1.000000	0.71417	0.954000	0.39281	0.127000	0.20565	3.691000	0.54720	2.824000	0.97209	0.655000	0.94253	CGT	.	.	.	none		0.493	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
OR4N4	283694	hgsc.bcm.edu	37	15	22382930	22382930	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr15:22382930T>C	ENST00000328795.4	+	1	549	c.458T>C	c.(457-459)tTt>tCt	p.F153S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTTGGGGGTTTTGTCCACTCC	0.527																																					p.F153S		Atlas-SNP	.											.	OR4N4	108	.	0			c.T458C						PASS	.						100.0	87.0	91.0					15																	22382930		2187	4254	6441	SO:0001583	missense	283694	exon1			GGGGTTTTGTCCA	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.458T>C	chr15.hg19:g.22382930T>C	ENSP00000332500:p.Phe153Ser	432.0	0.0	.		312.0	41.0	.	NM_001005241	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	hg19	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	10.03	1.238759	0.22711	.	.	ENSG00000183706	ENST00000328795	T	0.00216	8.53	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000117	T	0.00412	0.0013	M	0.62723	1.935	0.09310	N	1	D	0.67145	0.996	D	0.74348	0.983	T	0.47873	-0.9083	10	0.87932	D	0	-8.9888	10.041	0.42158	0.0:0.0:0.0:1.0	.	153	Q8N0Y3	OR4N4_HUMAN	S	153	ENSP00000332500:F153S	ENSP00000332500:F153S	F	+	2	0	OR4N4	19884294	0.006000	0.16342	0.918000	0.36340	0.103000	0.19146	1.078000	0.30754	1.522000	0.49001	0.332000	0.21555	TTT	.	.	.	none		0.527	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
HERC1	8925	hgsc.bcm.edu	37	15	63955402	63955402	+	Splice_Site	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr15:63955402C>A	ENST00000443617.2	-	44	8769	c.8682G>T	c.(8680-8682)gcG>gcT	p.A2894A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2894					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GGTATAATCCCGCTCAGAACA	0.408																																					p.A2894A		Atlas-SNP	.											.	HERC1	624	.	0			c.G8682T						PASS	.						113.0	110.0	111.0					15																	63955402		1844	4089	5933	SO:0001630	splice_region_variant	8925	exon44			TAATCCCGCTCAG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8681-1G>T	chr15.hg19:g.63955402C>A		297.0	0.0	.		228.0	10.0	.	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	hg19	CCDS45277.1																																																																																			.	.	.	none		0.408	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	Silent
SMG1	23049	hgsc.bcm.edu	37	16	18856756	18856756	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:18856756T>C	ENST00000446231.2	-	39	6626	c.6214A>G	c.(6214-6216)Aaa>Gaa	p.K2072E	SMG1_ENST00000389467.3_Missense_Mutation_p.K2072E			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2072					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGTACCTCTTTAAATGGAATC	0.408																																					p.K2072E		Atlas-SNP	.											.	SMG1	401	.	0			c.A6214G						PASS	.						57.0	52.0	54.0					16																	18856756		1866	4105	5971	SO:0001583	missense	23049	exon39			CCTCTTTAAATGG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6214A>G	chr16.hg19:g.18856756T>C	ENSP00000402515:p.Lys2072Glu	58.0	0.0	.		62.0	33.0	.	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.237482	0.79800	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.80824	-1.42;-1.42	5.79	5.79	0.91817	Protein kinase-like domain (1);Armadillo-type fold (1);	0.080055	0.53938	D	0.000055	D	0.90249	0.6951	M	0.86178	2.8	0.80722	D	1	D;P	0.56035	0.974;0.743	D;B	0.67725	0.953;0.305	D	0.91308	0.5072	10	0.59425	D	0.04	.	16.1343	0.81471	0.0:0.0:0.0:1.0	.	1932;2072	Q96Q15-2;Q96Q15	.;SMG1_HUMAN	E	2072	ENSP00000402515:K2072E;ENSP00000374118:K2072E	ENSP00000374118:K2072E	K	-	1	0	SMG1	18764257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.155000	0.71833	2.209000	0.71365	0.533000	0.62120	AAA	.	.	.	none		0.408	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
PDILT	204474	hgsc.bcm.edu	37	16	20376785	20376785	+	Silent	SNP	G	G	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr16:20376785G>A	ENST00000302451.4	-	9	1442	c.1194C>T	c.(1192-1194)aaC>aaT	p.N398N		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	398	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AGACGACTACGTTGAAGTTCT	0.448																																					p.N398N		Atlas-SNP	.											.	PDILT	120	.	0			c.C1194T						PASS	.						175.0	164.0	168.0					16																	20376785		2203	4300	6503	SO:0001819	synonymous_variant	204474	exon9			GACTACGTTGAAG		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1194C>T	chr16.hg19:g.20376785G>A		176.0	0.0	.		163.0	39.0	.	NM_174924	Q8IVQ5	Silent	SNP	ENST00000302451.4	hg19	CCDS10584.1																																																																																			.	.	.	none		0.448	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
AXIN2	8313	hgsc.bcm.edu	37	17	63533065	63533065	+	Missense_Mutation	SNP	C	C	A	rs376248072		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr17:63533065C>A	ENST00000307078.5	-	7	2142	c.1829G>T	c.(1828-1830)cGg>cTg	p.R610L	AXIN2_ENST00000375702.5_Intron	NM_004655.3	NP_004646.3	Q9Y2T1	AXIN2_HUMAN	axin 2	610				Missing (in Ref. 2; AAF22799). {ECO:0000305}.	bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TCCTTCCTCCCGGGGAAGCTG	0.687									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.R610L		Atlas-SNP	.											AXIN2,NS,carcinoma,0,1	AXIN2	92	.	0			c.G1829T						PASS	.						63.0	62.0	63.0					17																	63533065		2203	4300	6503	SO:0001583	missense	8313	exon7	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	TCCTCCCGGGGAA	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000307078.5:c.1829G>T	chr17.hg19:g.63533065C>A	ENSP00000302625:p.Arg610Leu	177.0	0.0	.		166.0	8.0	.	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000307078.5	hg19	CCDS11662.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679471	0.29783	.	.	ENSG00000168646	ENST00000307078	T	0.62232	0.04	5.24	3.07	0.35406	.	0.703317	0.14743	N	0.301042	T	0.43743	0.1261	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.39583	-0.9607	10	0.48119	T	0.1	-6.532	15.2767	0.73748	0.0:0.5155:0.4845:0.0	.	610	Q9Y2T1	AXIN2_HUMAN	L	610	ENSP00000302625:R610L	ENSP00000302625:R610L	R	-	2	0	AXIN2	60963527	0.021000	0.18746	0.945000	0.38365	0.886000	0.51366	1.270000	0.33086	1.153000	0.42468	0.561000	0.74099	CGG	.	.	.	alt		0.687	AXIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445900.1	NM_004655	
SLC26A11	284129	hgsc.bcm.edu	37	17	78219988	78219988	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr17:78219988C>A	ENST00000361193.3	+	12	1413	c.1133C>A	c.(1132-1134)cCg>cAg	p.P378Q	SLC26A11_ENST00000411502.3_Missense_Mutation_p.P378Q|SLC26A11_ENST00000546047.2_Missense_Mutation_p.P378Q|SLC26A11_ENST00000572725.1_Missense_Mutation_p.P378Q	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GTGTGCACCCCGGCGGGGGGC	0.667																																					p.P378Q		Atlas-SNP	.											SLC26A11,colon,carcinoma,0,1	SLC26A11	60	.	0			c.C1133A						PASS	.						49.0	59.0	56.0					17																	78219988		2200	4296	6496	SO:0001583	missense	284129	exon12			GCACCCCGGCGGG		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.1133C>A	chr17.hg19:g.78219988C>A	ENSP00000355384:p.Pro378Gln	232.0	0.0	.		223.0	11.0	.	NM_173626		Missense_Mutation	SNP	ENST00000361193.3	hg19	CCDS11771.2	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562831	0.45694	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.92858	-3.12;-3.12;-3.12	4.12	4.12	0.48240	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.93307	0.7867	L	0.49778	1.585	0.58432	D	0.999999	D	0.89917	1.0	D	0.69654	0.965	D	0.92074	0.5667	10	0.40728	T	0.16	-23.4884	10.8479	0.46753	0.0:0.9073:0.0:0.0927	.	378	Q86WA9	S2611_HUMAN	Q	378	ENSP00000403998:P378Q;ENSP00000440724:P378Q;ENSP00000355384:P378Q	ENSP00000355384:P378Q	P	+	2	0	SLC26A11	75834583	0.955000	0.32602	0.990000	0.47175	0.148000	0.21650	2.113000	0.41902	2.270000	0.75569	0.491000	0.48974	CCG	.	.	.	none		0.667	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
SYT5	6861	hgsc.bcm.edu	37	19	55685920	55685920	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:55685920C>T	ENST00000354308.3	-	8	1294	c.925G>A	c.(925-927)Gct>Act	p.A309T	CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000590851.1_Missense_Mutation_p.A305T|SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000537500.1_Missense_Mutation_p.A309T	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	309	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		AAGCTGAAAGCTTCGTTGTAA	0.527																																					p.A309T		Atlas-SNP	.											.	SYT5	45	.	0			c.G925A						PASS	.						190.0	182.0	185.0					19																	55685920		2203	4300	6503	SO:0001583	missense	6861	exon8			TGAAAGCTTCGTT	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.925G>A	chr19.hg19:g.55685920C>T	ENSP00000346265:p.Ala309Thr	282.0	0.0	.		248.0	62.0	.	NM_003180	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	hg19	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144796	0.57044	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.67345	-0.26;-0.26	3.42	1.23	0.21249	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.175642	0.49305	D	0.000147	T	0.38401	0.1039	N	0.03071	-0.42	0.38441	D	0.946694	B;B;B	0.27594	0.081;0.102;0.182	B;B;B	0.32465	0.146;0.026;0.092	T	0.23048	-1.0199	10	0.66056	D	0.02	.	5.0538	0.14522	0.4913:0.4025:0.0:0.1062	.	305;308;309	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	T	309;309;305	ENSP00000442896:A309T;ENSP00000346265:A309T	ENSP00000346265:A309T	A	-	1	0	SYT5	60377732	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.882000	0.28186	0.442000	0.26555	0.561000	0.74099	GCT	.	.	.	none		0.527	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
ZNF549	256051	hgsc.bcm.edu	37	19	58049607	58049607	+	Missense_Mutation	SNP	C	C	G	rs531934209		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:58049607C>G	ENST00000376233.3	+	4	1416	c.1235C>G	c.(1234-1236)aCg>aGg	p.T412R	ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.T399R	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AGAATCCACACGGGAGAAAGG	0.433																																					p.T412R		Atlas-SNP	.											.	ZNF549	118	.	0			c.C1235G						PASS	.						58.0	59.0	59.0					19																	58049607		2203	4300	6503	SO:0001583	missense	256051	exon4			TCCACACGGGAGA	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.1235C>G	chr19.hg19:g.58049607C>G	ENSP00000365407:p.Thr412Arg	97.0	0.0	.		49.0	8.0	.	NM_001199295	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	hg19	CCDS56106.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153855	0.57259	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.25749	1.78;1.78	2.35	-0.274	0.12910	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37489	0.1005	L	0.46885	1.475	0.31073	N	0.712839	D;D	0.89917	1.0;1.0	D;D	0.87578	0.987;0.998	T	0.39683	-0.9602	9	0.72032	D	0.01	.	6.4994	0.22160	0.0:0.6894:0.1838:0.1268	.	412;399	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	R	399;412	ENSP00000240719:T399R;ENSP00000365407:T412R	ENSP00000240719:T399R	T	+	2	0	ZNF549	62741419	0.892000	0.30473	0.923000	0.36655	0.989000	0.77384	2.036000	0.41165	0.319000	0.23209	0.585000	0.79938	ACG	.	.	.	none		0.433	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
ZIK1	284307	hgsc.bcm.edu	37	19	58101980	58101980	+	Missense_Mutation	SNP	G	G	C	rs577749417		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr19:58101980G>C	ENST00000597850.1	+	4	1016	c.801G>C	c.(799-801)tgG>tgC	p.W267C	ZIK1_ENST00000536878.2_Missense_Mutation_p.W254C|ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000599456.1_Missense_Mutation_p.W212C	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AAAGGCCTTGGGAGTGCAATG	0.473																																					p.W267C		Atlas-SNP	.											.	ZIK1	94	.	0			c.G801C						PASS	.						58.0	59.0	58.0					19																	58101980		2203	4300	6503	SO:0001583	missense	284307	exon4			GCCTTGGGAGTGC	AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.801G>C	chr19.hg19:g.58101980G>C	ENSP00000472867:p.Trp267Cys	78.0	0.0	.		63.0	11.0	.	NM_001010879	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	hg19	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	14.31	2.497409	0.44455	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.17691	2.26	3.37	-2.36	0.06663	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09992	0.0245	N	0.01438	-0.865	0.09310	N	0.999996	D;D	0.69078	0.997;0.993	P;P	0.60173	0.821;0.87	T	0.15178	-1.0446	9	0.87932	D	0	.	2.8351	0.05512	0.1183:0.0948:0.3259:0.4609	.	254;267	F5H435;Q3SY52	.;ZIK1_HUMAN	C	254;248;267	ENSP00000438487:W254C	ENSP00000303820:W267C	W	+	3	0	ZIK1	62793792	0.000000	0.05858	0.000000	0.03702	0.547000	0.35210	-1.932000	0.01554	-0.690000	0.05142	-0.182000	0.12963	TGG	.	.	.	none		0.473	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879	
USP25	29761	hgsc.bcm.edu	37	21	17138432	17138432	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr21:17138432C>G	ENST00000285679.6	+	3	609	c.240C>G	c.(238-240)taC>taG	p.Y80*	USP25_ENST00000285681.2_Nonsense_Mutation_p.Y80*|USP25_ENST00000351097.5_Nonsense_Mutation_p.Y80*|USP25_ENST00000400183.2_Nonsense_Mutation_p.Y80*	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	80	SUMO interaction domain (SIM).				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ATGATAGATACATCAGTGTGG	0.368																																					p.Y80X		Atlas-SNP	.											.	USP25	156	.	0			c.C240G						PASS	.						108.0	98.0	101.0					21																	17138432		2203	4300	6503	SO:0001587	stop_gained	29761	exon3			TAGATACATCAGT	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.240C>G	chr21.hg19:g.17138432C>G	ENSP00000285679:p.Tyr80*	80.0	0.0	.		97.0	4.0	.	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Nonsense_Mutation	SNP	ENST00000285679.6	hg19	CCDS33515.1	.	.	.	.	.	.	.	.	.	.	c	36	5.933887	0.97122	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	.	.	.	5.42	0.564	0.17302	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7186	0.40289	0.0:0.6591:0.0:0.3409	.	.	.	.	X	80	.	ENSP00000285679:Y80X	Y	+	3	2	USP25	16060303	0.926000	0.31397	0.996000	0.52242	0.828000	0.46876	0.110000	0.15437	0.035000	0.15519	-0.993000	0.02533	TAC	.	.	.	none		0.368	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
RBBP7	5931	hgsc.bcm.edu	37	X	16864059	16864059	+	Silent	SNP	A	A	G			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:16864059A>G	ENST00000380087.2	-	11	1461	c.1101T>C	c.(1099-1101)ttT>ttC	p.F367F	RBBP7_ENST00000404022.1_Silent_p.F358F|RBBP7_ENST00000380084.4_Silent_p.F411F			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	367					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					CTCCATGAATAAACTGTTACA	0.363																																					p.F411F		Atlas-SNP	.											.	RBBP7	58	.	0			c.T1233C						PASS	.						59.0	54.0	56.0					X																	16864059		2203	4300	6503	SO:0001819	synonymous_variant	5931	exon11			ATGAATAAACTGT	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.1101T>C	chrX.hg19:g.16864059A>G		69.0	0.0	.		70.0	20.0	.	NM_001198719	Q5JP00	Silent	SNP	ENST00000380087.2	hg19	CCDS14179.1																																																																																			.	.	.	none		0.363	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
ARHGEF6	9459	hgsc.bcm.edu	37	X	135825892	135825892	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chrX:135825892A>T	ENST00000250617.6	-	5	1718	c.513T>A	c.(511-513)ttT>ttA	p.F171L	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.F17L|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.F17L|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.F17L	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	171	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					TAGTCTGCTTAAAGTTGAATC	0.413																																					p.F171L		Atlas-SNP	.											.	ARHGEF6	111	.	0			c.T513A						PASS	.						193.0	158.0	170.0					X																	135825892		2203	4300	6503	SO:0001583	missense	9459	exon5			CTGCTTAAAGTTG	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.513T>A	chrX.hg19:g.135825892A>T	ENSP00000250617:p.Phe171Leu	189.0	0.0	.		171.0	50.0	.	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	hg19	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.525856	0.85600	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	6.08	2.47	0.30058	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.60869	0.2302	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	T	0.58763	-0.7579	10	0.72032	D	0.01	.	8.7263	0.34471	0.7085:0.0:0.2915:0.0	.	17;171	B7Z3C7;Q15052	.;ARHG6_HUMAN	L	171;17;17;17;17	ENSP00000250617:F171L;ENSP00000359654:F17L;ENSP00000359656:F17L;ENSP00000439483:F17L	ENSP00000250617:F171L	F	-	3	2	ARHGEF6	135653558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.119000	0.50422	0.071000	0.16664	0.486000	0.48141	TTT	.	.	.	none		0.413	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
ATE1	11101	hgsc.bcm.edu	37	10	123658376	123658376	+	Intron	DEL	C	C	-	rs150970157		TCGA-G7-6793-01A-11D-1961-08	TCGA-G7-6793-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7ab802f1-4c29-4c65-9073-b2b17d3a7bba	33f384e6-bc1d-4ef9-8886-7319f51cd68b	g.chr10:123658376delC	ENST00000224652.6	-	7	1028				ATE1_ENST00000540606.1_Frame_Shift_Del_p.D301fs|ATE1_ENST00000543447.1_Intron|ATE1_ENST00000481784.1_Intron|ATE1_ENST00000369040.3_Frame_Shift_Del_p.D212fs|ATE1_ENST00000369043.3_Frame_Shift_Del_p.D308fs|ATE1_ENST00000535655.1_Intron	NM_001001976.1	NP_001001976.1	O95260	ATE1_HUMAN	arginyltransferase 1						protein arginylation (GO:0016598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginyltransferase activity (GO:0004057)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)				CCACATTCATCGGGTGGATCC	0.423																																					p.D308fs		Atlas-INDEL	.											.	ATE1	67	.	0			c.923delA						PASS	.						189.0	157.0	168.0					10																	123658376		2203	4300	6503	SO:0001627	intron_variant	11101	exon7			.	AF079098	CCDS31299.1, CCDS31300.1, CCDS73211.1, CCDS73212.1, CCDS73213.1	10q26	2013-05-08			ENSG00000107669	ENSG00000107669	2.3.2.8		782	protein-coding gene	gene with protein product		607103				16002466, 16943202	Standard	XM_005269458		Approved		uc001lfq.3	O95260	OTTHUMG00000019178	ENST00000224652.6:c.942+1004G>-	chr10.hg19:g.123658376delC		82.0	0.0	0		73.0	11.0	0.150685	NM_007041	O95261|Q5SQQ3|Q8WW04	Frame_Shift_Del	DEL	ENST00000224652.6	hg19	CCDS31300.1																																																																																			.	.	.	none		0.423	ATE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001001976	
