#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPL22	6146	hgsc.bcm.edu	37	1	6246873	6246873	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:6246873A>T	ENST00000234875.4	-	4	284	c.246T>A	c.(244-246)taT>taA	p.Y82*	RPL22_ENST00000484532.1_Intron|RPL22_ENST00000497965.1_Nonsense_Mutation_p.Y49*	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	82					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GATATTTCAAATACCTGCAGA	0.358			T	RUNX1	"""AML, CML"""																																p.Y82X		Atlas-SNP	.		Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	.	RPL22	24	.	0			c.T246A						PASS	.						46.0	47.0	46.0					1																	6246873		2202	4300	6502	SO:0001587	stop_gained	6146	exon4			TTTCAAATACCTG	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.246T>A	chr1.hg19:g.6246873A>T	ENSP00000346088:p.Tyr82*	69.0	0.0	.		81.0	17.0	.	NM_000983	B2R495|Q6IBD1	Nonsense_Mutation	SNP	ENST00000234875.4	hg19	CCDS58.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279556	0.80692	.	.	ENSG00000116251	ENST00000234875	.	.	.	5.43	4.31	0.51392	.	0.122602	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.2758	7.3535	0.26706	0.7815:0.0:0.2185:0.0	.	.	.	.	X	82	.	ENSP00000346088:Y82X	Y	-	3	2	RPL22	6169460	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.692000	0.47018	0.906000	0.36621	0.379000	0.24179	TAT	.	.	.	none		0.358	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002830.1	NM_000983	
ARID1A	8289	hgsc.bcm.edu	37	1	27094329	27094329	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:27094329G>A	ENST00000324856.7	+	11	3408	c.3037G>A	c.(3037-3039)Gag>Aag	p.E1013K	ARID1A_ENST00000457599.2_Missense_Mutation_p.E1013K|ARID1A_ENST00000374152.2_Missense_Mutation_p.E630K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1013					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAAGTTGTATGAGCTGGGTGG	0.488			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.E1013K		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.G3037A						PASS	.						146.0	122.0	130.0					1																	27094329		2203	4300	6503	SO:0001583	missense	8289	exon11			TTGTATGAGCTGG	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3037G>A	chr1.hg19:g.27094329G>A	ENSP00000320485:p.Glu1013Lys	159.0	0.0	.		142.0	32.0	.	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703514	0.96812	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.46819	0.86;0.86;0.86	5.17	5.17	0.71159	ARID/BRIGHT DNA-binding domain (2);	0.049842	0.85682	D	0.000000	T	0.64886	0.2639	L	0.59436	1.845	0.80722	D	1	D;D;D	0.67145	0.995;0.996;0.993	D;D;P	0.65323	0.909;0.934;0.861	T	0.64601	-0.6369	10	0.51188	T	0.08	-14.8758	18.8566	0.92255	0.0:0.0:1.0:0.0	.	1013;1013;667	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	K	1013;1013;630	ENSP00000320485:E1013K;ENSP00000387636:E1013K;ENSP00000363267:E630K	ENSP00000320485:E1013K	E	+	1	0	ARID1A	26966916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.678000	0.91216	0.655000	0.94253	GAG	.	.	.	none		0.488	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ADAR	103	hgsc.bcm.edu	37	1	154574720	154574720	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:154574720A>T	ENST00000368474.4	-	2	597	c.398T>A	c.(397-399)cTg>cAg	p.L133Q	ADAR_ENST00000292205.5_Missense_Mutation_p.L176Q|ADAR_ENST00000368471.3_5'UTR|ADAR_ENST00000471068.1_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	133					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GTAGATACTCAGTTCCTGGAA	0.517																																					p.L133Q		Atlas-SNP	.											.	ADAR	113	.	0			c.T398A						PASS	.						65.0	67.0	66.0					1																	154574720		2203	4300	6503	SO:0001583	missense	103	exon2			ATACTCAGTTCCT	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.398T>A	chr1.hg19:g.154574720A>T	ENSP00000357459:p.Leu133Gln	150.0	0.0	.		102.0	25.0	.	NM_015840	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	hg19	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	A	18.97	3.736498	0.69304	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.79749	-1.3;-1.3;-1.3	4.47	4.47	0.54385	Winged helix-turn-helix transcription repressor DNA-binding (1);Double-stranded RNA-specific adenosine deaminase (DRADA) (2);	0.910334	0.09504	N	0.793175	D	0.86008	0.5830	M	0.63843	1.955	0.53688	D	0.999979	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.85130	0.972;0.992;0.997	D	0.83933	0.0307	10	0.87932	D	0	-11.1093	13.8697	0.63610	1.0:0.0:0.0:0.0	.	133;133;133	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	Q	176;133;128	ENSP00000292205:L176Q;ENSP00000357459:L133Q;ENSP00000431794:L128Q	ENSP00000292205:L176Q	L	-	2	0	ADAR	152841344	1.000000	0.71417	0.166000	0.22797	0.666000	0.39218	6.906000	0.75719	1.992000	0.58205	0.402000	0.26972	CTG	.	.	.	none		0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
FCRL4	83417	hgsc.bcm.edu	37	1	157559028	157559028	+	Silent	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:157559028T>C	ENST00000271532.1	-	3	408	c.273A>G	c.(271-273)ccA>ccG	p.P91P	FCRL4_ENST00000448509.2_5'UTR	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	91	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GGTTACTTCGTGGGGAGCCCC	0.498																																					p.P91P		Atlas-SNP	.											.	FCRL4	95	.	0			c.A273G						PASS	.						74.0	79.0	77.0					1																	157559028		2203	4300	6503	SO:0001819	synonymous_variant	83417	exon3			ACTTCGTGGGGAG	AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.273A>G	chr1.hg19:g.157559028T>C		154.0	0.0	.		165.0	32.0	.	NM_031282	Q96PJ3|Q96RE0	Silent	SNP	ENST00000271532.1	hg19	CCDS1166.1																																																																																			.	.	.	none		0.498	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086180.1	NM_031282	
MPZL1	9019	hgsc.bcm.edu	37	1	167745333	167745333	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:167745333A>C	ENST00000359523.2	+	5	840	c.638A>C	c.(637-639)aAg>aCg	p.K213T	MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000474859.1_Intron|MPZL1_ENST00000392121.3_Intron	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	213					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					TCACCAGTTAAGCAGGCTCCT	0.413																																					p.K213T		Atlas-SNP	.											.	MPZL1	25	.	0			c.A638C						PASS	.						76.0	74.0	75.0					1																	167745333		2203	4300	6503	SO:0001583	missense	9019	exon5			CAGTTAAGCAGGC	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.638A>C	chr1.hg19:g.167745333A>C	ENSP00000352513:p.Lys213Thr	99.0	0.0	.		93.0	12.0	.	NM_003953	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	ENST00000359523.2	hg19	CCDS1264.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313200	0.81358	.	.	ENSG00000197965	ENST00000359523	D	0.96365	-3.99	5.28	5.28	0.74379	.	.	.	.	.	D	0.95370	0.8497	L	0.29908	0.895	0.33196	D	0.551469	D	0.71674	0.998	D	0.78314	0.991	D	0.94904	0.8059	8	0.33141	T	0.24	.	14.4968	0.67694	1.0:0.0:0.0:0.0	.	213	O95297	MPZL1_HUMAN	T	213	ENSP00000352513:K213T	ENSP00000352513:K213T	K	+	2	0	MPZL1	166011957	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.562000	0.53777	2.307000	0.77673	0.528000	0.53228	AAG	.	.	.	none		0.413	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083655.2	NM_024569	
CACYBP	27101	hgsc.bcm.edu	37	1	174979129	174979129	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:174979129G>T	ENST00000367679.2	+	6	1049	c.601G>T	c.(601-603)Gat>Tat	p.D201Y	CACYBP_ENST00000367681.2_Missense_Mutation_p.D158Y|MRPS14_ENST00000498253.1_5'Flank|CACYBP_ENST00000405362.1_Missense_Mutation_p.D158Y	NM_014412.2	NP_055227.1	Q9HB71	CYBP_HUMAN	calcyclin binding protein	201	Interaction with S100A6. {ECO:0000250}.|Interaction with SKP1.|SGS. {ECO:0000255|PROSITE- ProRule:PRU00386}.				aging (GO:0007568)|cardiac muscle cell differentiation (GO:0055007)|cellular response to calcium ion (GO:0071277)|negative regulation of cell death (GO:0060548)|positive regulation of DNA replication (GO:0045740)|response to growth hormone (GO:0060416)	beta-catenin destruction complex (GO:0030877)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	11						AATTTATGAAGATGGAGACGA	0.383																																					p.D201Y		Atlas-SNP	.											CACYBP,NS,carcinoma,0,1	CACYBP	23	.	0			c.G601T						PASS	.						86.0	85.0	85.0					1																	174979129		2203	4300	6503	SO:0001583	missense	27101	exon6			TATGAAGATGGAG	BC022352	CCDS1315.1, CCDS30942.1	1q24-q25	2008-02-05			ENSG00000116161	ENSG00000116161			30423	protein-coding gene	gene with protein product		606186				11389839, 12421809	Standard	XM_005245092		Approved	SIP, S100A6BP	uc001gkj.1	Q9HB71	OTTHUMG00000034941	ENST00000367679.2:c.601G>T	chr1.hg19:g.174979129G>T	ENSP00000356652:p.Asp201Tyr	60.0	0.0	.		68.0	17.0	.	NM_014412	B2ZWH2|B3KSF1|O60666|Q5R370|Q5R371	Missense_Mutation	SNP	ENST00000367679.2	hg19	CCDS1315.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891415	0.91889	.	.	ENSG00000116161	ENST00000367681;ENST00000450101;ENST00000367679;ENST00000405362	T;T	0.58060	0.36;0.36	5.89	5.89	0.94794	SGS (2);HSP20-like chaperone (1);	0.132069	0.64402	D	0.000002	T	0.68091	0.2963	M	0.79258	2.445	0.80722	D	1	P	0.48589	0.912	P	0.50791	0.65	T	0.71031	-0.4710	10	0.72032	D	0.01	-24.1569	20.2561	0.98419	0.0:0.0:1.0:0.0	.	201	Q9HB71	CYBP_HUMAN	Y	158;174;201;158	ENSP00000356654:D158Y;ENSP00000385771:D158Y	ENSP00000356652:D201Y	D	+	1	0	CACYBP	173245752	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.296000	0.96104	2.797000	0.96272	0.563000	0.77884	GAT	.	.	.	none		0.383	CACYBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084583.3	NM_014412	
NAV1	89796	hgsc.bcm.edu	37	1	201762968	201762968	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:201762968C>G	ENST00000367296.4	+	14	3790	c.3370C>G	c.(3370-3372)Cgc>Ggc	p.R1124G	NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367302.1_Missense_Mutation_p.R1080G|NAV1_ENST00000367295.1_Missense_Mutation_p.R733G|NAV1_ENST00000295624.6_Missense_Mutation_p.R1124G|NAV1_ENST00000367300.3_Missense_Mutation_p.R1067G|NAV1_ENST00000367297.4_Missense_Mutation_p.R1116G|IPO9-AS1_ENST00000413035.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1124					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TATGACATCCCGCCTGCGACA	0.582																																					p.R1124G		Atlas-SNP	.											.	NAV1	143	.	0			c.C3370G						PASS	.						70.0	66.0	67.0					1																	201762968		2203	4300	6503	SO:0001583	missense	89796	exon14			ACATCCCGCCTGC	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3370C>G	chr1.hg19:g.201762968C>G	ENSP00000356265:p.Arg1124Gly	88.0	0.0	.		99.0	5.0	.	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	hg19	CCDS1414.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.5|27.5	4.841219|4.841219	0.91197|0.91197	.|.	.|.	ENSG00000134369|ENSG00000134369	ENST00000430015|ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	.|D;D;D;D;D;D	.|0.94497	.|-3.44;-3.44;-3.44;-3.44;-3.44;-3.44	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	.|0.058638	.|0.64402	.|D	.|0.000002	D|D	0.97037|0.97037	0.9032|0.9032	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999991|0.999991	.|D;D;D;D;D	.|0.89917	.|1.0;0.997;0.996;0.998;1.0	.|D;D;D;D;D	.|0.87578	.|0.998;0.932;0.948;0.991;0.998	D|D	0.97499|0.97499	1.0059|1.0059	5|10	.|0.72032	.|D	.|0.01	-24.902|-24.902	17.9873|17.9873	0.89159|0.89159	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1116;733;1124;624;1124	.|Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.|.;.;NAV1_HUMAN;.;.	R|G	673|1080;1124;1124;1116;1067;624;733	.|ENSP00000356271:R1080G;ENSP00000356265:R1124G;ENSP00000295624:R1124G;ENSP00000356266:R1116G;ENSP00000356269:R1067G;ENSP00000356264:R733G	.|ENSP00000295624:R1124G	P|R	+|+	2|1	0|0	NAV1|NAV1	200029591|200029591	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.939000|0.939000	0.58152|0.58152	5.512000|5.512000	0.67030|0.67030	2.557000|2.557000	0.86248|0.86248	0.462000|0.462000	0.41574|0.41574	CCG|CGC	.	.	.	none		0.582	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
XDH	7498	hgsc.bcm.edu	37	2	31595113	31595113	+	Silent	SNP	G	G	T	rs201668777	byFrequency	TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:31595113G>T	ENST00000379416.3	-	17	1885	c.1837C>A	c.(1837-1839)Cgg>Agg	p.R613R		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	613					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GCGTGGGCCCGGGTGCTGGTG	0.627																																					p.R613R	Colon(66;682 1445 30109 40147)	Atlas-SNP	.											.	XDH	191	.	0			c.C1837A						PASS	.						98.0	104.0	102.0					2																	31595113		2203	4300	6503	SO:0001819	synonymous_variant	7498	exon17			GGGCCCGGGTGCT	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1837C>A	chr2.hg19:g.31595113G>T		266.0	0.0	.		252.0	11.0	.	NM_000379	Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	hg19	CCDS1775.1																																																																																			.	G|1.000;A|0.000	.	alt		0.627	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
ABCA12	26154	hgsc.bcm.edu	37	2	215865500	215865500	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:215865500T>G	ENST00000272895.7	-	22	3327	c.3108A>C	c.(3106-3108)caA>caC	p.Q1036H	ABCA12_ENST00000389661.4_Missense_Mutation_p.Q718H	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1036					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCCTTCCAGTTTGCAATTCAA	0.428																																					p.Q1036H	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.A3108C						PASS	.						125.0	130.0	128.0					2																	215865500		2203	4300	6503	SO:0001583	missense	26154	exon22			TCCAGTTTGCAAT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3108A>C	chr2.hg19:g.215865500T>G	ENSP00000272895:p.Gln1036His	166.0	0.0	.		183.0	41.0	.	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533445	0.45073	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95656	-3.77;-3.77	5.73	2.68	0.31781	.	0.087482	0.49916	D	0.000121	D	0.92456	0.7605	L	0.43152	1.355	0.80722	D	1	B;B	0.32467	0.136;0.372	B;B	0.38156	0.152;0.266	D	0.89343	0.3655	10	0.66056	D	0.02	.	8.1984	0.31411	0.0:0.731:0.0:0.269	.	1036;718	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	H	1036;718	ENSP00000272895:Q1036H;ENSP00000374312:Q718H	ENSP00000272895:Q1036H	Q	-	3	2	ABCA12	215573745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.506000	0.45433	0.612000	0.30071	0.454000	0.30748	CAA	.	.	.	none		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
CATIP	375307	hgsc.bcm.edu	37	2	219222364	219222364	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:219222364C>T	ENST00000289388.3	+	3	255	c.226C>T	c.(226-228)Cag>Tag	p.Q76*	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		76					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGGAAATACCAGGAAAAACT	0.552																																					p.Q76X		Atlas-SNP	.											.	C2orf62	28	.	0			c.C226T						PASS	.						72.0	63.0	66.0					2																	219222364		2203	4300	6503	SO:0001587	stop_gained	375307	exon3			AAATACCAGGAAA																												ENST00000289388.3:c.226C>T	chr2.hg19:g.219222364C>T	ENSP00000289388:p.Gln76*	103.0	0.0	.		93.0	16.0	.	NM_198559		Nonsense_Mutation	SNP	ENST00000289388.3	hg19	CCDS2414.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987633	0.35036	.	.	ENSG00000158428	ENST00000289388	.	.	.	4.56	-4.72	0.03269	.	1.478090	0.03845	N	0.271323	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.2458	4.8866	0.13706	0.2205:0.5606:0.0905:0.1283	.	.	.	.	X	76	.	ENSP00000289388:Q76X	Q	+	1	0	C2orf62	218930608	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.212000	0.17497	-0.542000	0.06249	-0.457000	0.05445	CAG	.	.	.	none		0.552	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
SLC25A38	54977	hgsc.bcm.edu	37	3	39431018	39431018	+	Silent	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:39431018C>T	ENST00000273158.4	+	2	479	c.102C>T	c.(100-102)ggC>ggT	p.G34G		NM_017875.2	NP_060345.2			solute carrier family 25, member 38									p.G34G(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		TCCTGTGTGGCTCCATCAGTG	0.522																																					p.G34G		Atlas-SNP	.											SLC25A38,colon,carcinoma,0,1	SLC25A38	25	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T						PASS	.						209.0	174.0	186.0					3																	39431018		2203	4300	6503	SO:0001819	synonymous_variant	54977	exon2			GTGTGGCTCCATC	BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.102C>T	chr3.hg19:g.39431018C>T		126.0	0.0	.		116.0	27.0	.	NM_017875		Silent	SNP	ENST00000273158.4	hg19	CCDS2685.1																																																																																			.	.	.	none		0.522	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254057.3	NM_017875	
TNFSF10	8743	hgsc.bcm.edu	37	3	172232704	172232704	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr3:172232704T>C	ENST00000241261.2	-	2	339	c.217A>G	c.(217-219)Atg>Gtg	p.M73V	TNFSF10_ENST00000420541.2_Missense_Mutation_p.M73V	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	73					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GGGCTGTTCATACTCTCTTCG	0.502																																					p.M73V		Atlas-SNP	.											.	TNFSF10	30	.	0			c.A217G						PASS	.						144.0	137.0	140.0					3																	172232704		2203	4300	6503	SO:0001583	missense	8743	exon2			TGTTCATACTCTC	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.217A>G	chr3.hg19:g.172232704T>C	ENSP00000241261:p.Met73Val	130.0	0.0	.		176.0	41.0	.	NM_003810	A1Y9B3	Missense_Mutation	SNP	ENST00000241261.2	hg19	CCDS3219.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.547137	0.00140	.	.	ENSG00000121858	ENST00000241261;ENST00000420541	D;T	0.86366	-2.11;1.59	5.61	-1.89	0.07689	.	0.989409	0.08265	N	0.972345	T	0.71804	0.3383	L	0.34521	1.04	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.11329	0.006;0.001	T	0.57136	-0.7863	10	0.05351	T	0.99	-3.1928	0.8408	0.01149	0.3634:0.1464:0.1187:0.3715	.	73;73	A1Y9B3;P50591	.;TNF10_HUMAN	V	73	ENSP00000241261:M73V;ENSP00000389931:M73V	ENSP00000241261:M73V	M	-	1	0	TNFSF10	173715398	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.552000	0.23376	-0.567000	0.06046	-0.256000	0.11100	ATG	.	.	.	none		0.502	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346601.1		
ACOX3	8310	hgsc.bcm.edu	37	4	8372681	8372681	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:8372681G>A	ENST00000356406.5	-	17	2014	c.1937C>T	c.(1936-1938)cCt>cTt	p.P646L	ACOX3_ENST00000503233.1_Missense_Mutation_p.P646L|ACOX3_ENST00000413009.2_Silent_p.S623S|ACOX3_ENST00000515797.1_5'UTR	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	646					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						AAAGTCAGGAGGAGCGATCAC	0.562																																					p.P646L		Atlas-SNP	.											.	ACOX3	70	.	0			c.C1937T						PASS	.						120.0	104.0	109.0					4																	8372681		2203	4300	6503	SO:0001583	missense	8310	exon17			TCAGGAGGAGCGA	Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.1937C>T	chr4.hg19:g.8372681G>A	ENSP00000348775:p.Pro646Leu	68.0	0.0	.		59.0	12.0	.	NM_003501	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	hg19	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577015	0.86645	.	.	ENSG00000087008	ENST00000356406;ENST00000503233	T;T	0.38401	1.14;1.14	4.88	4.88	0.63580	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.069225	0.64402	N	0.000015	T	0.50718	0.1632	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.38628	-0.9652	9	0.11182	T	0.66	-18.1485	15.4924	0.75619	0.0:0.0:1.0:0.0	.	646	O15254	ACOX3_HUMAN	L	646	ENSP00000348775:P646L;ENSP00000421625:P646L	ENSP00000348775:P646L	P	-	2	0	ACOX3	8423581	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	6.945000	0.75947	2.226000	0.72624	0.549000	0.68633	CCT	.	.	.	none		0.562	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
CENPC	1060	hgsc.bcm.edu	37	4	68385012	68385012	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:68385012C>G	ENST00000273853.6	-	6	790	c.540G>C	c.(538-540)aaG>aaC	p.K180N		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	180					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										AAGTCTCTCTCTTTTGGGCAC	0.323																																					p.K180N		Atlas-SNP	.											.	CENPC1	66	.	0			c.G540C						PASS	.						88.0	83.0	84.0					4																	68385012		1809	4078	5887	SO:0001583	missense	1060	exon6			CTCTCTCTTTTGG	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.540G>C	chr4.hg19:g.68385012C>G	ENSP00000273853:p.Lys180Asn	106.0	0.0	.		138.0	36.0	.	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	hg19	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463886	0.26335	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.75	0.447	0.16608	.	0.626565	0.15039	N	0.283991	T	0.39226	0.1070	L	0.59436	1.845	0.28032	N	0.9341	D;D	0.65815	0.995;0.995	P;P	0.53954	0.738;0.738	T	0.30592	-0.9973	9	0.72032	D	0.01	-2.2885	2.5395	0.04722	0.3496:0.401:0.1533:0.0961	.	180;180	Q8IW27;Q03188	.;CENPC_HUMAN	N	180	.	ENSP00000273853:K180N	K	-	3	2	CENPC1	68067607	0.030000	0.19436	0.952000	0.39060	0.104000	0.19210	-0.627000	0.05521	0.173000	0.19788	-0.293000	0.09583	AAG	.	.	.	none		0.323	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
GC	2638	hgsc.bcm.edu	37	4	72629625	72629625	+	Nonsense_Mutation	SNP	C	C	A	rs371509305		TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:72629625C>A	ENST00000273951.8	-	5	845	c.502G>T	c.(502-504)Gga>Tga	p.G168*	GC_ENST00000503472.1_5'UTR|GC_ENST00000513476.1_Nonsense_Mutation_p.G168*|GC_ENST00000504199.1_Nonsense_Mutation_p.G187*	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	168	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.			G -> E (in Ref. 1; AAA52173). {ECO:0000305}.	small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	GGAGCTTGTCCGTAATTAGTG	0.358																																					p.G187X		Atlas-SNP	.											.	GC	132	.	0			c.G559T						PASS	.						87.0	90.0	89.0					4																	72629625		2203	4300	6503	SO:0001587	stop_gained	2638	exon6			CTTGTCCGTAATT	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.502G>T	chr4.hg19:g.72629625C>A	ENSP00000273951:p.Gly168*	131.0	0.0	.		134.0	6.0	.	NM_001204307	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Nonsense_Mutation	SNP	ENST00000273951.8	hg19	CCDS3550.1	.	.	.	.	.	.	.	.	.	.	C	37	6.603213	0.97697	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	.	.	.	5.49	5.49	0.81192	.	0.123122	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	13.6514	0.62312	0.0:0.9245:0.0:0.0755	.	.	.	.	X	168;187;168	.	ENSP00000273951:G168X	G	-	1	0	GC	72848489	0.989000	0.36119	1.000000	0.80357	0.768000	0.43524	1.917000	0.39996	2.727000	0.93392	0.650000	0.86243	GGA	.	.	.	alt		0.358	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
RNF150	57484	hgsc.bcm.edu	37	4	141832440	141832440	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr4:141832440G>C	ENST00000515673.2	-	6	1089	c.1056C>G	c.(1054-1056)aaC>aaG	p.N352K	RNF150_ENST00000420921.2_Missense_Mutation_p.N211K|RNF150_ENST00000379512.2_Missense_Mutation_p.N211K|RNF150_ENST00000507500.1_Missense_Mutation_p.N352K|RNF150_ENST00000306799.3_Missense_Mutation_p.N310K			Q9ULK6	RN150_HUMAN	ring finger protein 150	352						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					CTGTGATCTGGTTGGTGGGTG	0.557																																					p.N352K		Atlas-SNP	.											.	RNF150	94	.	0			c.C1056G						PASS	.						100.0	93.0	95.0					4																	141832440		2203	4300	6503	SO:0001583	missense	57484	exon6			GATCTGGTTGGTG	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.1056C>G	chr4.hg19:g.141832440G>C	ENSP00000425840:p.Asn352Lys	105.0	0.0	.		111.0	14.0	.	NM_020724	Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	ENST00000515673.2	hg19	CCDS34065.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474491	0.63737	.	.	ENSG00000170153	ENST00000379512;ENST00000420921;ENST00000306799;ENST00000515673;ENST00000507500;ENST00000506101	T;T;T;T;T;T	0.15139	2.45;2.45;2.49;3.47;3.48;2.51	5.74	0.749	0.18381	.	0.472179	0.23614	N	0.046304	T	0.16257	0.0391	L	0.29908	0.895	0.51767	D	0.999932	P;B;B	0.40970	0.734;0.294;0.415	P;B;B	0.47528	0.549;0.299;0.334	T	0.03103	-1.1072	10	0.46703	T	0.11	.	9.3149	0.37928	0.5802:0.0:0.4198:0.0	.	310;352;352	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	K	211;211;310;352;352;183	ENSP00000368827:N211K;ENSP00000394581:N211K;ENSP00000304321:N310K;ENSP00000425840:N352K;ENSP00000425568:N352K;ENSP00000425947:N183K	ENSP00000304321:N310K	N	-	3	2	RNF150	142051890	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	0.973000	0.29422	0.180000	0.19960	0.655000	0.94253	AAC	.	.	.	none		0.557	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090	
ZBED9	114821	hgsc.bcm.edu	37	6	28554157	28554157	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:28554157C>A	ENST00000452236.2	-	1	955	c.338G>T	c.(337-339)cGg>cTg	p.R113L	RP5-1186N24.3_ENST00000499525.1_RNA|SCAND3_ENST00000530247.1_Intron	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						ATTATGCTCCCGCACCCAAGA	0.527																																					p.R113L		Atlas-SNP	.											SCAND3,NS,carcinoma,0,1	SCAND3	156	.	0			c.G338T						PASS	.						123.0	130.0	128.0					6																	28554157		2203	4300	6503	SO:0001583	missense	114821	exon1			TGCTCCCGCACCC																												ENST00000452236.2:c.338G>T	chr6.hg19:g.28554157C>A	ENSP00000395259:p.Arg113Leu	267.0	0.0	.		236.0	11.0	.	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	hg19	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009764	0.54361	.	.	ENSG00000232040	ENST00000452236	T	0.04551	3.6	3.46	1.66	0.24008	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.08670	0.0215	M	0.82056	2.57	0.25606	N	0.986544	D	0.71674	0.998	D	0.73708	0.981	T	0.11012	-1.0605	9	0.87932	D	0	.	5.6758	0.17747	0.0:0.6443:0.0:0.3557	.	113	Q6R2W3	SCND3_HUMAN	L	113	ENSP00000395259:R113L	ENSP00000395259:R113L	R	-	2	0	SCAND3	28662136	0.000000	0.05858	0.683000	0.30040	0.759000	0.43091	-0.482000	0.06544	0.291000	0.22468	0.655000	0.94253	CGG	.	.	.	none		0.527	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
LMBRD1	55788	hgsc.bcm.edu	37	6	70462182	70462182	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:70462182T>C	ENST00000370577.3	-	4	603	c.374A>G	c.(373-375)gAa>gGa	p.E125G	LMBRD1_ENST00000370570.1_Missense_Mutation_p.E52G	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	125					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						ATCATCCTTTTCTTCATAATA	0.294																																					p.E125G		Atlas-SNP	.											.	LMBRD1	61	.	0			c.A374G						PASS	.						54.0	56.0	56.0					6																	70462182		2197	4278	6475	SO:0001583	missense	55788	exon4			TCCTTTTCTTCAT	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.374A>G	chr6.hg19:g.70462182T>C	ENSP00000359609:p.Glu125Gly	71.0	0.0	.		77.0	16.0	.	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	ENST00000370577.3	hg19	CCDS4969.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102734	0.56183	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.26067	1.76;1.76	5.33	4.15	0.48705	LMBR1-like membrane protein (1);	0.051951	0.85682	D	0.000000	T	0.19805	0.0476	M	0.85462	2.755	0.58432	D	0.999998	B	0.18968	0.032	B	0.22880	0.042	T	0.09487	-1.0672	10	0.39692	T	0.17	-12.1431	10.4775	0.44674	0.0:0.0797:0.0:0.9203	.	125	Q9NUN5	LMBD1_HUMAN	G	125;52	ENSP00000359609:E125G;ENSP00000359602:E52G	ENSP00000359602:E52G	E	-	2	0	LMBRD1	70518903	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.495000	0.66912	2.022000	0.59522	0.455000	0.32223	GAA	.	.	.	none		0.294	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
SYNE1	23345	hgsc.bcm.edu	37	6	152673335	152673335	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr6:152673335T>C	ENST00000367255.5	-	70	12008	c.11407A>G	c.(11407-11409)Act>Gct	p.T3803A	SYNE1_ENST00000448038.1_Missense_Mutation_p.T3788A|SYNE1_ENST00000341594.5_Missense_Mutation_p.T3774A|SYNE1_ENST00000265368.4_Missense_Mutation_p.T3803A|SYNE1_ENST00000423061.1_Missense_Mutation_p.T3788A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3803					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCCGGACAGTGCTGGTCAGT	0.448										HNSCC(10;0.0054)																											p.T3803A		Atlas-SNP	.											.	SYNE1	3227	.	0			c.A11407G						PASS	.						251.0	230.0	237.0					6																	152673335		2203	4300	6503	SO:0001583	missense	23345	exon70			GGACAGTGCTGGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11407A>G	chr6.hg19:g.152673335T>C	ENSP00000356224:p.Thr3803Ala	217.0	0.0	.		261.0	44.0	.	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	9.518	1.107572	0.20714	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34072	1.45;1.45;1.45;1.45;1.38	6.04	2.28	0.28536	.	0.339507	0.25194	N	0.032438	T	0.07638	0.0192	L	0.43152	1.355	0.09310	N	0.999998	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.06405	0.001;0.001;0.001;0.002	T	0.39603	-0.9606	10	0.08837	T	0.75	.	4.3779	0.11279	0.2094:0.2204:0.0:0.5702	.	3803;3803;3803;3788	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	A	3803;3788;3803;3788;3774	ENSP00000356224:T3803A;ENSP00000396024:T3788A;ENSP00000265368:T3803A;ENSP00000390975:T3788A;ENSP00000341887:T3774A	ENSP00000265368:T3803A	T	-	1	0	SYNE1	152715028	0.076000	0.21285	0.602000	0.28890	0.876000	0.50452	0.615000	0.24329	0.155000	0.19261	0.460000	0.39030	ACT	.	.	.	none		0.448	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
PKD1L1	168507	hgsc.bcm.edu	37	7	47898372	47898372	+	Missense_Mutation	SNP	C	C	A	rs146609164	byFrequency	TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:47898372C>A	ENST00000289672.2	-	27	4311	c.4261G>T	c.(4261-4263)Ggt>Tgt	p.G1421C		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1421	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GATATGAGACCGATGAGCTCA	0.483																																					p.G1421C		Atlas-SNP	.											.	PKD1L1	328	.	0			c.G4261T						PASS	.						135.0	131.0	133.0					7																	47898372		2203	4300	6503	SO:0001583	missense	168507	exon27			TGAGACCGATGAG	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4261G>T	chr7.hg19:g.47898372C>A	ENSP00000289672:p.Gly1421Cys	98.0	0.0	.		121.0	7.0	.	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	C	8.989	0.977345	0.18812	.	.	ENSG00000158683	ENST00000289672	T	0.19250	2.16	5.03	0.111	0.14619	Egg jelly receptor, REJ-like (1);	2.019780	0.02131	N	0.056369	T	0.13628	0.0330	N	0.22421	0.69	0.09310	N	1	P	0.35600	0.511	B	0.31869	0.137	T	0.13872	-1.0493	10	0.39692	T	0.17	0.4077	4.0897	0.09963	0.3374:0.3834:0.2792:0.0	.	1421	Q8TDX9	PK1L1_HUMAN	C	1421	ENSP00000289672:G1421C	ENSP00000289672:G1421C	G	-	1	0	PKD1L1	47864897	0.013000	0.17824	0.000000	0.03702	0.005000	0.04900	0.268000	0.18571	-0.126000	0.11682	-0.171000	0.13296	GGT	.	C|1.000;T|0.000	.	alt		0.483	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
TMEM248	55069	hgsc.bcm.edu	37	7	66410208	66410208	+	Silent	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:66410208T>C	ENST00000341567.4	+	3	660	c.405T>C	c.(403-405)caT>caC	p.H135H		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	135						integral component of membrane (GO:0016021)											ACGTCACCCATCTGTACTCAA	0.527																																					p.H135H		Atlas-SNP	.											.	.	.	.	0			c.T405C						PASS	.						107.0	105.0	106.0					7																	66410208		2203	4300	6503	SO:0001819	synonymous_variant	55069	exon3			CACCCATCTGTAC		CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.405T>C	chr7.hg19:g.66410208T>C		244.0	0.0	.		247.0	43.0	.	NM_017994	Q53H07|Q96FR2	Silent	SNP	ENST00000341567.4	hg19	CCDS5536.1																																																																																			.	.	.	none		0.527	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251745.2	NM_017994	
ING3	54556	hgsc.bcm.edu	37	7	120595620	120595620	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:120595620A>G	ENST00000315870.5	+	4	357	c.209A>G	c.(208-210)tAt>tGt	p.Y70C	ING3_ENST00000339121.5_Missense_Mutation_p.Y70C|ING3_ENST00000445699.1_Missense_Mutation_p.Y70C|ING3_ENST00000431467.1_Missense_Mutation_p.Y55C	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	70					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					CAGGACTACTATAAAGCTTTG	0.303																																					p.Y70C		Atlas-SNP	.											.	ING3	36	.	0			c.A209G						PASS	.						78.0	79.0	78.0					7																	120595620		2203	4300	6503	SO:0001583	missense	54556	exon4			ACTACTATAAAGC	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.209A>G	chr7.hg19:g.120595620A>G	ENSP00000320566:p.Tyr70Cys	30.0	0.0	.		36.0	5.0	.	NM_019071	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	ENST00000315870.5	hg19	CCDS5778.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990024	0.74589	.	.	ENSG00000071243	ENST00000315870;ENST00000339121;ENST00000445699;ENST00000431467	D;D	0.95518	-3.7;-3.73	5.54	5.54	0.83059	Inhibitor of growth protein, N-terminal (1);	0.059163	0.64402	D	0.000001	D	0.96765	0.8944	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.975;0.988;0.999;0.999	D;P;P;D;D	0.67900	0.911;0.739;0.811;0.912;0.954	D	0.95906	0.8919	10	0.38643	T	0.18	-21.6296	10.2439	0.43330	0.852:0.0:0.0:0.148	.	70;70;70;70;70	B7ZKQ7;Q5GRH6;Q9NXR8;Q9NXR8-2;C9JUT0	.;.;ING3_HUMAN;.;.	C	70;70;70;55	ENSP00000320566:Y70C;ENSP00000388506:Y55C	ENSP00000320566:Y70C	Y	+	2	0	ING3	120382856	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.966000	0.76073	2.230000	0.72887	0.528000	0.53228	TAT	.	.	.	none		0.303	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
HIPK2	28996	hgsc.bcm.edu	37	7	139416356	139416356	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr7:139416356C>A	ENST00000406875.3	-	2	572	c.478G>T	c.(478-480)Ggg>Tgg	p.G160W	HIPK2_ENST00000428878.2_Missense_Mutation_p.G160W|HIPK2_ENST00000342645.6_Missense_Mutation_p.G160W	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	160	Transcriptional corepression. {ECO:0000250}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					ACAGTGGCCCCGCTTGCATTA	0.557																																					p.G160W		Atlas-SNP	.											.	HIPK2	192	.	0			c.G478T						PASS	.						139.0	121.0	126.0					7																	139416356		1568	3582	5150	SO:0001583	missense	28996	exon2			TGGCCCCGCTTGC	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.478G>T	chr7.hg19:g.139416356C>A	ENSP00000385571:p.Gly160Trp	192.0	0.0	.		194.0	8.0	.	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	C	15.42	2.827150	0.50739	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.55413	0.52;0.55;0.55	5.41	4.53	0.55603	.	.	.	.	.	T	0.73164	0.3552	.	.	.	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.987	T	0.77707	-0.2487	8	0.87932	D	0	.	14.152	0.65392	0.0:0.9279:0.0:0.0721	.	160;160	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	W	160	ENSP00000385571:G160W;ENSP00000413724:G160W;ENSP00000343108:G160W	ENSP00000343108:G160W	G	-	1	0	HIPK2	139062842	1.000000	0.71417	0.935000	0.37517	0.365000	0.29674	7.677000	0.84024	1.277000	0.44412	-0.140000	0.14226	GGG	.	.	.	none		0.557	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
MCPH1	79648	hgsc.bcm.edu	37	8	6302006	6302006	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:6302006A>T	ENST00000344683.5	+	8	839	c.763A>T	c.(763-765)Att>Ttt	p.I255F	MCPH1_ENST00000522905.1_Missense_Mutation_p.I207F|MCPH1_ENST00000519480.1_Missense_Mutation_p.I255F	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	255					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GGAAGGATCCATTAATGACAT	0.358																																					p.I255F	Colon(95;1448 1467 8277 34473 35819)	Atlas-SNP	.											.	MCPH1	65	.	0			c.A763T						PASS	.						129.0	122.0	124.0					8																	6302006		1883	4107	5990	SO:0001583	missense	79648	exon8			GGATCCATTAATG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.763A>T	chr8.hg19:g.6302006A>T	ENSP00000342924:p.Ile255Phe	89.0	0.0	.		89.0	23.0	.	NM_001172574	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	hg19	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.579572	0.86645	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.13778	2.56;2.56;2.56	5.26	-7.74	0.01241	.	1.774350	0.02525	N	0.092983	T	0.17492	0.0420	L	0.53249	1.67	0.09310	N	1	P;P;P	0.46784	0.884;0.867;0.884	P;P;P	0.52267	0.522;0.694;0.522	T	0.40289	-0.9571	10	0.32370	T	0.25	0.0924	3.4052	0.07338	0.3624:0.1106:0.4182:0.1088	.	207;255;255	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	F	255;255;207	ENSP00000342924:I255F;ENSP00000430962:I255F;ENSP00000430768:I207F	ENSP00000342924:I255F	I	+	1	0	MCPH1	6289414	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-0.113000	0.10774	-1.605000	0.01593	0.533000	0.62120	ATT	.	.	.	none		0.358	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
IKBKB	3551	hgsc.bcm.edu	37	8	42173753	42173753	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:42173753T>A	ENST00000520810.1	+	10	1012	c.826T>A	c.(826-828)Tgg>Agg	p.W276R	IKBKB_ENST00000379708.3_Missense_Mutation_p.W53R|IKBKB_ENST00000416505.2_Missense_Mutation_p.W217R|IKBKB_ENST00000520835.1_Missense_Mutation_p.W274R|IKBKB_ENST00000522147.1_Intron	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	ACTGGAGAAGTGGCTGCAACT	0.562																																					p.W276R		Atlas-SNP	.											.	IKBKB	88	.	0			c.T826A						PASS	.						66.0	58.0	61.0					8																	42173753		2203	4300	6503	SO:0001583	missense	3551	exon10			GAGAAGTGGCTGC	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.826T>A	chr8.hg19:g.42173753T>A	ENSP00000430684:p.Trp276Arg	68.0	0.0	.		48.0	10.0	.	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	hg19	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.617138	0.87359	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.64803	-0.12;-0.12;-0.12;1.78	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057892	0.85682	D	0.000000	T	0.78780	0.4337	M	0.75264	2.295	0.80722	D	1	P;D;P;D;D;D	0.89917	0.879;0.998;0.836;0.999;0.995;1.0	P;D;B;D;D;D	0.97110	0.745;0.987;0.425;0.987;0.988;1.0	T	0.81621	-0.0850	10	0.72032	D	0.01	.	15.1947	0.73078	0.0:0.0:0.0:1.0	.	217;274;53;227;276;276	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	R	276;217;274;53	ENSP00000430684:W276R;ENSP00000404920:W217R;ENSP00000430868:W274R;ENSP00000369030:W53R	ENSP00000369030:W53R	W	+	1	0	IKBKB	42292910	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.228000	0.72288	1.994000	0.58287	0.460000	0.39030	TGG	.	.	.	none		0.562	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
CYP7A1	1581	hgsc.bcm.edu	37	8	59409487	59409487	+	Missense_Mutation	SNP	C	C	A	rs201046553		TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:59409487C>A	ENST00000301645.3	-	3	721	c.584G>T	c.(583-585)cGg>cTg	p.R195L		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	195					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R195L(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				CTGTGTGTCCCGCCTTGTAAG	0.458									Neonatal Giant Cell Hepatitis																												p.R195L		Atlas-SNP	.											.	CYP7A1	76	.	1	Substitution - Missense(1)	lung(1)	c.G584T						PASS	.						136.0	129.0	131.0					8																	59409487		2203	4300	6503	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	GTGTCCCGCCTTG	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.584G>T	chr8.hg19:g.59409487C>A	ENSP00000301645:p.Arg195Leu	163.0	0.0	.		176.0	9.0	.	NM_000780	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	hg19	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	c	7.189	0.591159	0.13812	.	.	ENSG00000167910	ENST00000301645	T	0.63913	-0.07	5.74	-2.23	0.06930	.	0.519770	0.23353	N	0.049112	T	0.31513	0.0799	N	0.08118	0	0.25011	N	0.991403	B	0.11235	0.004	B	0.14578	0.011	T	0.29941	-0.9995	10	0.08381	T	0.77	-0.7265	9.3325	0.38030	0.0:0.1223:0.4845:0.3932	.	195	P22680	CP7A1_HUMAN	L	195	ENSP00000301645:R195L	ENSP00000301645:R195L	R	-	2	0	CYP7A1	59572041	1.000000	0.71417	0.000000	0.03702	0.001000	0.01503	1.764000	0.38471	-0.158000	0.11040	-0.414000	0.06135	CGG	.	C|1.000;T|0.000	.	alt		0.458	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
FBXL6	26233	hgsc.bcm.edu	37	8	145579793	145579793	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr8:145579793T>C	ENST00000331890.5	-	8	1371	c.1307A>G	c.(1306-1308)cAg>cGg	p.Q436R	FBXL6_ENST00000526524.1_Intron|SLC52A2_ENST00000530047.1_5'Flank|FBXL6_ENST00000455319.2_Missense_Mutation_p.Q430R|SLC52A2_ENST00000540505.1_5'Flank|TMEM249_ENST00000531225.1_5'Flank|SLC52A2_ENST00000527078.1_5'Flank|TMEM249_ENST00000398633.3_5'Flank|SLC52A2_ENST00000402965.1_5'Flank|SLC52A2_ENST00000329994.2_5'Flank|SLC52A2_ENST00000532887.1_5'Flank	NM_012162.2	NP_036294.2	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6	436					protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)		ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|lung(3)|ovary(1)	5	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCACCACTTCTGGGTCAAAAA	0.592																																					p.Q436R		Atlas-SNP	.											.	FBXL6	26	.	0			c.A1307G						PASS	.						70.0	77.0	74.0					8																	145579793		2203	4299	6502	SO:0001583	missense	26233	exon8			CACTTCTGGGTCA	AF174592	CCDS6422.1, CCDS47942.1	8q24.3	2011-06-09			ENSG00000182325	ENSG00000182325		"""F-boxes / Leucine-rich repeats"""	13603	protein-coding gene	gene with protein product		609076				10531035, 10531037	Standard	NM_012162		Approved	FBL6	uc003zcb.3	Q8N531	OTTHUMG00000165169	ENST00000331890.5:c.1307A>G	chr8.hg19:g.145579793T>C	ENSP00000330098:p.Gln436Arg	181.0	0.0	.		156.0	30.0	.	NM_012162	Q53G43|Q9H5W9|Q9UKC7	Missense_Mutation	SNP	ENST00000331890.5	hg19	CCDS6422.1	.	.	.	.	.	.	.	.	.	.	T	10.23	1.292836	0.23564	.	.	ENSG00000182325	ENST00000455319;ENST00000331890	T;T	0.24538	1.85;1.85	5.13	1.23	0.21249	.	0.612082	0.16879	N	0.195799	T	0.14141	0.0342	L	0.31207	0.915	0.22803	N	0.998711	B;B	0.14438	0.006;0.01	B;B	0.11329	0.003;0.006	T	0.32955	-0.9887	10	0.12766	T	0.61	-2.0714	6.0415	0.19736	0.0:0.403:0.0:0.597	.	436;430	Q8N531;Q8N531-2	FBXL6_HUMAN;.	R	430;436	ENSP00000403873:Q430R;ENSP00000330098:Q436R	ENSP00000330098:Q436R	Q	-	2	0	FBXL6	145550601	0.622000	0.27085	0.991000	0.47740	0.810000	0.45777	0.327000	0.19663	0.240000	0.21263	0.460000	0.39030	CAG	.	.	.	none		0.592	FBXL6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382413.1	NM_024555	
KIN	22944	hgsc.bcm.edu	37	10	7825098	7825098	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr10:7825098C>G	ENST00000379562.4	-	2	202	c.155G>C	c.(154-156)aGa>aCa	p.R52T	KIN_ENST00000543003.1_Intron|KIN_ENST00000535925.1_Missense_Mutation_p.R52T	NM_012311.3	NP_036443.1			Kin17 DNA and RNA binding protein											endometrium(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(2)	19						CAATAGTTGTCTCTGATGAGA	0.328																																					p.R52T		Atlas-SNP	.											.	KIN	39	.	0			c.G155C						PASS	.						61.0	60.0	60.0					10																	7825098		2203	4298	6501	SO:0001583	missense	22944	exon2			AGTTGTCTCTGAT	AJ005273	CCDS7080.1	10p15-p14	2014-07-15	2014-07-15		ENSG00000151657	ENSG00000151657			6327	protein-coding gene	gene with protein product		601720	"""antigenic determinant of recA protein (mouse) homolog"", ""KIN, antigenic determinant of recA protein homolog (mouse)"""			1923796, 24140279	Standard	NM_012311		Approved	KIN17, Rts2	uc001ijt.3	O60870	OTTHUMG00000017634	ENST00000379562.4:c.155G>C	chr10.hg19:g.7825098C>G	ENSP00000368881:p.Arg52Thr	49.0	0.0	.		61.0	8.0	.	NM_012311		Missense_Mutation	SNP	ENST00000379562.4	hg19	CCDS7080.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266664	0.80358	.	.	ENSG00000151657	ENST00000535925;ENST00000379562	.	.	.	6.06	4.18	0.49190	DNA/RNA-binding protein Kin17, conserved domain (1);	0.132739	0.64402	D	0.000002	T	0.81331	0.4800	H	0.95114	3.625	0.80722	D	1	B;B	0.22146	0.065;0.065	B;B	0.35470	0.203;0.203	T	0.80384	-0.1405	9	0.87932	D	0	-35.5448	10.9911	0.47549	0.13:0.8027:0.0:0.0672	.	52;52	B4DX32;O60870	.;KIN17_HUMAN	T	52	.	ENSP00000368881:R52T	R	-	2	0	KIN	7865104	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.693000	0.84214	0.846000	0.35142	0.650000	0.86243	AGA	.	.	.	none		0.328	KIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046683.2	NM_012311	
PLCE1	51196	hgsc.bcm.edu	37	10	95849076	95849076	+	Intron	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr10:95849076A>G	ENST00000371380.3	+	2	1441				PLCE1_ENST00000260766.3_Intron|RP11-429H9.4_ENST00000438899.1_RNA|PLCE1_ENST00000371385.3_Silent_p.V75V|PLCE1_ENST00000371375.1_Silent_p.V75V			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1						activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TCTCTGAGGTACCCAATTTTA	0.502																																					p.V75V		Atlas-SNP	.											.	PLCE1	543	.	0			c.A225G						PASS	.						142.0	126.0	131.0					10																	95849076		1568	3582	5150	SO:0001627	intron_variant	51196	exon1			TGAGGTACCCAAT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.1207-42855A>G	chr10.hg19:g.95849076A>G		198.0	0.0	.		169.0	66.0	.	NM_001165979	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	hg19	CCDS41552.1																																																																																			.	.	.	none		0.502	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
BEST1	7439	hgsc.bcm.edu	37	11	61730354	61730354	+	Silent	SNP	C	C	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr11:61730354C>T	ENST00000378043.4	+	10	2371	c.1728C>T	c.(1726-1728)gcC>gcT	p.A576A	FTH1_ENST00000529191.1_Intron|BEST1_ENST00000378042.3_Silent_p.A489A|BEST1_ENST00000449131.2_Silent_p.A516A|BEST1_ENST00000534553.1_3'UTR|FTH1_ENST00000529631.1_Intron|BEST1_ENST00000301774.9_Silent_p.A204A	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	576					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CTTATTGGGCCTTGGAAAACA	0.507																																					p.A576A		Atlas-SNP	.											.	BEST1	85	.	0			c.C1728T						PASS	.						120.0	130.0	126.0					11																	61730354		2202	4299	6501	SO:0001819	synonymous_variant	7439	exon10			TTGGGCCTTGGAA	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1728C>T	chr11.hg19:g.61730354C>T		103.0	0.0	.		91.0	13.0	.	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Silent	SNP	ENST00000378043.4	hg19	CCDS31580.1																																																																																			.	.	.	none		0.507	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
PARP11	57097	hgsc.bcm.edu	37	12	3921402	3921402	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:3921402C>A	ENST00000228820.4	-	8	1048	c.904G>T	c.(904-906)Ggg>Tgg	p.G302W	PARP11_ENST00000476985.1_Intron|PARP11_ENST00000447133.3_Missense_Mutation_p.G221W|PARP11_ENST00000397096.2_Intron|PARP11_ENST00000427057.2_Missense_Mutation_p.G221W	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	295	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			ACATAGCTCCCGTCTTTGGAA	0.398																																					p.G302W		Atlas-SNP	.											PARP11,NS,malignant_melanoma,0,1	PARP11	39	.	0			c.G904T						PASS	.						119.0	103.0	109.0					12																	3921402		2203	4300	6503	SO:0001583	missense	57097	exon8			AGCTCCCGTCTTT	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.904G>T	chr12.hg19:g.3921402C>A	ENSP00000228820:p.Gly302Trp	118.0	2.0	.		151.0	9.0	.	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	hg19	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571674	0.65765	.	.	ENSG00000111224	ENST00000427057;ENST00000228820;ENST00000447133	T;T;T	0.14391	2.51;2.51;2.51	5.28	5.28	0.74379	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.106561	0.64402	D	0.000004	T	0.40932	0.1137	M	0.81497	2.545	0.44985	D	0.998009	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.989;0.994	T	0.28267	-1.0049	10	0.87932	D	0	.	16.4627	0.84069	0.0:1.0:0.0:0.0	.	221;302;295	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	W	221;302;221	ENSP00000397058:G221W;ENSP00000228820:G302W;ENSP00000405385:G221W	ENSP00000228820:G302W	G	-	1	0	PARP11	3791663	0.987000	0.35691	1.000000	0.80357	0.999000	0.98932	2.777000	0.47717	2.747000	0.94245	0.650000	0.86243	GGG	.	.	.	none		0.398	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
ABCC9	10060	hgsc.bcm.edu	37	12	21962862	21962862	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:21962862G>A	ENST00000261201.4	-	35	4238	c.4239C>T	c.(4237-4239)tgC>tgT	p.C1413C	ABCC9_ENST00000345162.2_Silent_p.C1377C|ABCC9_ENST00000261200.4_Silent_p.C1413C	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1413	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGTCATCTGTGCATTTGCACT	0.323																																					p.C1413C		Atlas-SNP	.											.	ABCC9	411	.	0			c.C4239T						PASS	.						83.0	85.0	84.0					12																	21962862		2203	4300	6503	SO:0001819	synonymous_variant	10060	exon35			ATCTGTGCATTTG	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4239C>T	chr12.hg19:g.21962862G>A		94.0	0.0	.		127.0	24.0	.	NM_005691	O60707	Silent	SNP	ENST00000261201.4	hg19	CCDS8694.1																																																																																			.	.	.	none		0.323	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
C2CD5	9847	hgsc.bcm.edu	37	12	22666235	22666235	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:22666235T>C	ENST00000333957.4	-	9	1286	c.1031A>G	c.(1030-1032)gAa>gGa	p.E344G	C2CD5_ENST00000446597.1_Missense_Mutation_p.E344G|C2CD5_ENST00000396028.2_Missense_Mutation_p.E335G|C2CD5_ENST00000542676.1_Missense_Mutation_p.E344G|C2CD5_ENST00000545552.1_Missense_Mutation_p.E335G|C2CD5_ENST00000536386.1_Missense_Mutation_p.E335G|C2CD5_ENST00000544930.1_Missense_Mutation_p.E137G	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	344					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										TACCCTCTGTTCCAACGCTGA	0.378																																					p.E344G		Atlas-SNP	.											.	.	.	.	0			c.A1031G						PASS	.						149.0	131.0	137.0					12																	22666235		2203	4300	6503	SO:0001583	missense	9847	exon9			CTCTGTTCCAACG	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.1031A>G	chr12.hg19:g.22666235T>C	ENSP00000334229:p.Glu344Gly	163.0	0.0	.		187.0	31.0	.	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	T	19.42	3.824771	0.71143	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930;ENST00000544281	T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.0	3.85	0.44370	.	0.062767	0.64402	N	0.000006	T	0.65144	0.2663	L	0.57536	1.79	0.49915	D	0.999836	D;D;D;D;D;D	0.89917	0.999;0.992;1.0;0.992;1.0;0.979	D;P;D;P;D;P	0.85130	0.973;0.784;0.996;0.864;0.997;0.628	T	0.64045	-0.6499	10	0.51188	T	0.08	-22.0629	9.2812	0.37729	0.0:0.0816:0.0:0.9184	.	335;344;137;335;335;344	F5H2A1;B4DRN7;F5H3N1;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;.;K0528_HUMAN	G	344;344;335;335;344;335;137;96	ENSP00000334229:E344G;ENSP00000388756:E344G;ENSP00000439392:E335G;ENSP00000379345:E335G;ENSP00000441951:E344G;ENSP00000443204:E335G;ENSP00000445288:E137G;ENSP00000443479:E96G	ENSP00000334229:E344G	E	-	2	0	KIAA0528	22557502	1.000000	0.71417	0.988000	0.46212	0.978000	0.69477	7.272000	0.78516	0.920000	0.36970	0.528000	0.53228	GAA	.	.	.	none		0.378	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
CAPRIN2	65981	hgsc.bcm.edu	37	12	30886574	30886574	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:30886574A>G	ENST00000395805.2	-	5	1428	c.881T>C	c.(880-882)gTa>gCa	p.V294A	CAPRIN2_ENST00000538387.1_Intron|CAPRIN2_ENST00000308433.5_Intron|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.V294A|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.V294A|CAPRIN2_ENST00000298892.5_Missense_Mutation_p.V294A	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGTCGTTCCTACCACTGCTTT	0.398																																					p.V294A		Atlas-SNP	.											.	CAPRIN2	109	.	0			c.T881C						PASS	.						164.0	143.0	150.0					12																	30886574		2203	4300	6503	SO:0001583	missense	65981	exon5			GTTCCTACCACTG	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.881T>C	chr12.hg19:g.30886574A>G	ENSP00000379150:p.Val294Ala	200.0	0.0	.		219.0	13.0	.	NM_023925		Missense_Mutation	SNP	ENST00000395805.2	hg19	CCDS55816.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.850529	0.32699	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T	0.21031	2.47;2.03;2.03;2.03;2.03;2.03	4.96	4.96	0.65561	.	0.276479	0.34460	N	0.003948	T	0.09730	0.0239	N	0.11201	0.11	0.80722	D	1	B;B;B;B;B	0.28783	0.142;0.222;0.029;0.049;0.013	B;B;B;B;B	0.28011	0.043;0.085;0.006;0.013;0.008	T	0.24977	-1.0145	10	0.15066	T	0.55	-12.678	7.5105	0.27571	0.8402:0.0:0.1598:0.0	.	294;294;294;294;294	Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;CAPR2_HUMAN;.;.	A	40;294;294;294;294;20;213	ENSP00000415407:V40A;ENSP00000298892:V294A;ENSP00000379150:V294A;ENSP00000251071:V294A;ENSP00000391479:V294A;ENSP00000438010:V213A	ENSP00000251071:V294A	V	-	2	0	CAPRIN2	30777841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.311000	0.51919	2.069000	0.61940	0.533000	0.62120	GTA	.	.	.	none		0.398	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403322.2	NM_023925	
ARID2	196528	hgsc.bcm.edu	37	12	46246367	46246367	+	Silent	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:46246367C>A	ENST00000334344.6	+	15	4633	c.4461C>A	c.(4459-4461)ccC>ccA	p.P1487P	ARID2_ENST00000444670.1_Silent_p.P1097P|ARID2_ENST00000422737.1_Silent_p.P1338P|ARID2_ENST00000457135.1_Silent_p.P95P|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1487					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAGCAGTTCCCGACTCAGGAT	0.463			"""N, S, F"""		hepatocellular carcinoma																																p.P1487P		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.C4461A						PASS	.						113.0	107.0	109.0					12																	46246367		2203	4300	6503	SO:0001819	synonymous_variant	196528	exon15			AGTTCCCGACTCA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4461C>A	chr12.hg19:g.46246367C>A		171.0	0.0	.		172.0	8.0	.	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.	.	none		0.463	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
KRT85	3891	hgsc.bcm.edu	37	12	52761009	52761009	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:52761009A>G	ENST00000257901.3	-	1	256	c.181T>C	c.(181-183)Tcc>Ccc	p.S61P	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	61	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGCCCGCAGGAGCCCAGGTTG	0.716																																					p.S61P		Atlas-SNP	.											.	KRT85	78	.	0			c.T181C						PASS	.						18.0	23.0	21.0					12																	52761009		2197	4295	6492	SO:0001583	missense	3891	exon1			CGCAGGAGCCCAG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.181T>C	chr12.hg19:g.52761009A>G	ENSP00000257901:p.Ser61Pro	79.0	0.0	.		58.0	11.0	.	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	hg19	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	A	5.873	0.345197	0.11126	.	.	ENSG00000135443	ENST00000257901	T	0.77877	-1.13	4.66	-2.96	0.05547	.	0.601870	0.15091	N	0.281064	T	0.51261	0.1664	N	0.12182	0.205	0.23563	N	0.997407	B	0.06786	0.001	B	0.10450	0.005	T	0.29488	-1.0010	10	0.40728	T	0.16	.	2.3992	0.04397	0.2911:0.4181:0.1687:0.1221	.	61	P78386	KRT85_HUMAN	P	61	ENSP00000257901:S61P	ENSP00000257901:S61P	S	-	1	0	KRT85	51047276	0.000000	0.05858	0.660000	0.29694	0.354000	0.29330	-0.238000	0.08977	-0.599000	0.05798	-0.366000	0.07423	TCC	.	.	.	none		0.716	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
SYCP3	50511	hgsc.bcm.edu	37	12	102127436	102127436	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr12:102127436C>G	ENST00000392927.3	-	6	501	c.370G>C	c.(370-372)Gaa>Caa	p.E124Q	SYCP3_ENST00000266743.2_Missense_Mutation_p.E124Q|SYCP3_ENST00000392924.1_Missense_Mutation_p.E124Q	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	124	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TGAGAATATTCTTGGTTAAGC	0.308																																					p.E124Q		Atlas-SNP	.											.	SYCP3	19	.	0			c.G370C						PASS	.						110.0	102.0	105.0					12																	102127436		2203	4300	6503	SO:0001583	missense	50511	exon6			AATATTCTTGGTT	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.370G>C	chr12.hg19:g.102127436C>G	ENSP00000376658:p.Glu124Gln	73.0	0.0	.		89.0	12.0	.	NM_001177949		Missense_Mutation	SNP	ENST00000392927.3	hg19	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197243	0.38806	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.95	5.01	0.66863	.	0.115967	0.64402	D	0.000019	T	0.72078	0.3416	M	0.67953	2.075	0.44247	D	0.997095	D	0.54397	0.966	P	0.56343	0.796	T	0.69698	-0.5075	9	0.34782	T	0.22	1.5322	15.6276	0.76874	0.1381:0.8619:0.0:0.0	.	124	Q8IZU3	SYCP3_HUMAN	Q	124	.	ENSP00000266743:E124Q	E	-	1	0	SYCP3	100651567	1.000000	0.71417	0.797000	0.32132	0.043000	0.13939	4.291000	0.59025	2.817000	0.96982	0.563000	0.77884	GAA	.	.	.	none		0.308	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
USPL1	10208	hgsc.bcm.edu	37	13	31233386	31233386	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr13:31233386A>C	ENST00000255304.4	+	9	3514	c.3172A>C	c.(3172-3174)Aag>Cag	p.K1058Q		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	1058					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GAGTCCGATGAAGACTGATAT	0.373																																					p.K1058Q	Ovarian(60;318 1180 1554 28110 31601)	Atlas-SNP	.											.	USPL1	82	.	0			c.A3172C						PASS	.						93.0	94.0	93.0					13																	31233386		2202	4300	6502	SO:0001583	missense	10208	exon9			CCGATGAAGACTG	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.3172A>C	chr13.hg19:g.31233386A>C	ENSP00000255304:p.Lys1058Gln	92.0	0.0	.		110.0	20.0	.	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	hg19	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675070	0.67928	.	.	ENSG00000132952	ENST00000255304	T	0.26518	1.73	5.62	5.62	0.85841	.	0.083251	0.51477	D	0.000089	T	0.46870	0.1415	M	0.64997	1.995	0.25803	N	0.984481	D	0.67145	0.996	D	0.66497	0.944	T	0.43589	-0.9382	10	0.72032	D	0.01	-19.9681	14.3888	0.66963	1.0:0.0:0.0:0.0	.	1058	Q5W0Q7	USPL1_HUMAN	Q	1058	ENSP00000255304:K1058Q	ENSP00000255304:K1058Q	K	+	1	0	USPL1	30131386	0.983000	0.35010	0.930000	0.37139	0.675000	0.39556	4.229000	0.58625	2.143000	0.66587	0.455000	0.32223	AAG	.	.	.	none		0.373	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
ITM2B	9445	hgsc.bcm.edu	37	13	48833064	48833064	+	Silent	SNP	A	A	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr13:48833064A>G	ENST00000378565.5	+	5	899	c.696A>G	c.(694-696)caA>caG	p.Q232Q	ITM2B_ENST00000378549.5_Silent_p.Q126Q	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	232					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		ACAAACTGCAACGCAGAGAAA	0.338																																					p.Q232Q		Atlas-SNP	.											.	ITM2B	24	.	0			c.A696G						PASS	.						85.0	78.0	81.0					13																	48833064		2203	4300	6503	SO:0001819	synonymous_variant	9445	exon5			ACTGCAACGCAGA	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.696A>G	chr13.hg19:g.48833064A>G		54.0	0.0	.		83.0	13.0	.	NM_021999	Q5W0A3|Q96B24|Q9NYH1	Silent	SNP	ENST00000378565.5	hg19	CCDS9409.1																																																																																			.	.	.	none		0.338	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999	
BTBD7	55727	hgsc.bcm.edu	37	14	93708871	93708871	+	Silent	SNP	G	G	T	rs145129249	byFrequency	TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr14:93708871G>T	ENST00000334746.5	-	11	3454	c.3147C>A	c.(3145-3147)acC>acA	p.T1049T	BTBD7_ENST00000393170.2_Silent_p.T623T|BTBD7_ENST00000554565.1_Silent_p.T698T	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	1049					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GGGCTGGACCGGTACTAGCAT	0.507																																					p.T1049T		Atlas-SNP	.											.	BTBD7	112	.	0			c.C3147A						PASS	.						109.0	117.0	114.0					14																	93708871		2203	4300	6503	SO:0001819	synonymous_variant	55727	exon11			TGGACCGGTACTA	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.3147C>A	chr14.hg19:g.93708871G>T		251.0	0.0	.		176.0	8.0	.	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Silent	SNP	ENST00000334746.5	hg19	CCDS32146.1																																																																																			.	G|1.000;A|0.000	.	alt		0.507	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
EDC4	23644	hgsc.bcm.edu	37	16	67910484	67910484	+	Silent	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr16:67910484G>A	ENST00000358933.5	+	3	572	c.333G>A	c.(331-333)aaG>aaA	p.K111K	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	111					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		TTTCAAGCAAGGCCCGGGGAA	0.537																																					p.K111K		Atlas-SNP	.											.	EDC4	101	.	0			c.G333A						PASS	.						76.0	65.0	69.0					16																	67910484		2198	4300	6498	SO:0001819	synonymous_variant	23644	exon3			AAGCAAGGCCCGG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.333G>A	chr16.hg19:g.67910484G>A		71.0	0.0	.		78.0	15.0	.	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	ENST00000358933.5	hg19	CCDS10849.1																																																																																			.	.	.	none		0.537	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
GAN	8139	hgsc.bcm.edu	37	16	81388211	81388211	+	Silent	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr16:81388211C>A	ENST00000568107.2	+	3	646	c.484C>A	c.(484-486)Cga>Aga	p.R162R		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	162	BACK.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GACTCATTTCCGAGACGTCAG	0.428																																					p.R162R	GBM(106;1239 1507 7582 9741 33976)	Atlas-SNP	.											.	GAN	59	.	0			c.C484A						PASS	.						161.0	146.0	151.0					16																	81388211		2202	4300	6502	SO:0001819	synonymous_variant	8139	exon3			CATTTCCGAGACG	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.484C>A	chr16.hg19:g.81388211C>A		165.0	0.0	.		192.0	8.0	.	NM_022041		Silent	SNP	ENST00000568107.2	hg19	CCDS10935.1																																																																																			.	.	.	none		0.428	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
GLP2R	9340	hgsc.bcm.edu	37	17	9764494	9764494	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:9764494C>A	ENST00000262441.5	+	8	1477	c.964C>A	c.(964-966)Cgt>Agt	p.R322S	GLP2R_ENST00000574745.1_Missense_Mutation_p.R142S	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	322					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	GGGTTTCGCCCGTGCACACCT	0.493																																					p.R322S		Atlas-SNP	.											.	GLP2R	90	.	0			c.C964A						PASS	.						198.0	180.0	186.0					17																	9764494		2203	4300	6503	SO:0001583	missense	9340	exon8			TTCGCCCGTGCAC	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.964C>A	chr17.hg19:g.9764494C>A	ENSP00000262441:p.Arg322Ser	227.0	0.0	.		245.0	10.0	.	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	hg19	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	C	8.206	0.799227	0.16397	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.46451	0.87	5.24	5.24	0.73138	GPCR, family 2-like (1);	0.000000	0.40222	N	0.001141	T	0.65512	0.2698	M	0.86178	2.8	0.09310	N	1	D	0.69078	0.997	D	0.74348	0.983	T	0.61917	-0.6964	10	0.87932	D	0	.	11.1891	0.48675	0.2849:0.7151:0.0:0.0	.	322	O95838	GLP2R_HUMAN	S	322;297;322	ENSP00000262441:R322S	ENSP00000262441:R322S	R	+	1	0	GLP2R	9705219	0.948000	0.32251	0.788000	0.31933	0.475000	0.33008	2.876000	0.48498	2.706000	0.92434	0.655000	0.94253	CGT	.	.	.	none		0.493	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
BRCA1	672	hgsc.bcm.edu	37	17	41244817	41244817	+	Missense_Mutation	SNP	C	C	T	rs80357712|rs397509003|rs80357605|rs80357917		TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:41244817C>T	ENST00000357654.3	-	10	2849	c.2731G>A	c.(2731-2733)Gga>Aga	p.G911R	BRCA1_ENST00000493795.1_Missense_Mutation_p.G864R|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.G911R|BRCA1_ENST00000346315.3_Missense_Mutation_p.G911R|BRCA1_ENST00000309486.4_Missense_Mutation_p.G615R|BRCA1_ENST00000354071.3_Missense_Mutation_p.G911R	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	911					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCATTCTTTCCTTGATTTTCT	0.398			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.G911R		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.G2731A						PASS	.						132.0	130.0	131.0					17																	41244817		2203	4300	6503	SO:0001583	missense	672	exon10	Familial Cancer Database		TCTTTCCTTGATT	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.2731G>A	chr17.hg19:g.41244817C>T	ENSP00000350283:p.Gly911Arg	145.0	0.0	.		146.0	24.0	.	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977264	0.34848	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795	T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39	4.85	2.8	0.32819	.	0.776431	0.11349	N	0.573162	D	0.84188	0.5417	M	0.65320	2	0.09310	N	1	B;B;B;B;D;B	0.59357	0.024;0.065;0.132;0.12;0.985;0.036	B;B;B;B;P;B	0.57371	0.046;0.046;0.261;0.22;0.819;0.043	T	0.71461	-0.4586	10	0.56958	D	0.05	.	8.2084	0.31469	0.0:0.7274:0.0:0.2726	.	911;870;911;911;911;911	E7EMP0;E7ERL4;Q5YLB2;E9PFC7;P38398;P38398-2	.;.;.;.;BRCA1_HUMAN;.	R	911;911;911;911;615;911;864	ENSP00000350283:G911R;ENSP00000326002:G911R;ENSP00000246907:G911R;ENSP00000310938:G615R;ENSP00000418960:G911R;ENSP00000418775:G864R	ENSP00000310938:G615R	G	-	1	0	BRCA1	38498343	0.001000	0.12720	0.001000	0.08648	0.134000	0.20937	0.961000	0.29267	0.582000	0.29556	0.484000	0.47621	GGA	.	.	.	none		0.398	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
ABCC3	8714	hgsc.bcm.edu	37	17	48735832	48735832	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:48735832C>A	ENST00000285238.8	+	6	729	c.649C>A	c.(649-651)Cgc>Agc	p.R217S	ABCC3_ENST00000427699.1_Missense_Mutation_p.R217S	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	217					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.L215_F219delLSRLF(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CTTTCTCTCCCGCCTGTTTTT	0.582																																					p.R217S		Atlas-SNP	.											ABCC3_ENST00000427699,rectum,carcinoma,0,2	ABCC3	138	.	1	Deletion - In frame(1)	prostate(1)	c.C649A						PASS	.						128.0	118.0	121.0					17																	48735832		2203	4300	6503	SO:0001583	missense	8714	exon6			CTCTCCCGCCTGT	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.649C>A	chr17.hg19:g.48735832C>A	ENSP00000285238:p.Arg217Ser	223.0	2.0	.		282.0	13.0	.	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037328	0.75617	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.93019	-3.15;-3.15	5.92	4.96	0.65561	.	0.158362	0.42964	D	0.000632	D	0.94288	0.8165	M	0.77103	2.36	0.49483	D	0.999793	P;P	0.46987	0.866;0.888	B;P	0.53549	0.353;0.729	D	0.92427	0.5950	10	0.29301	T	0.29	-14.056	8.5005	0.33154	0.2579:0.6706:0.0:0.0715	.	217;217	O15438;O15438-5	MRP3_HUMAN;.	S	217	ENSP00000395160:R217S;ENSP00000285238:R217S	ENSP00000285238:R217S	R	+	1	0	ABCC3	46090831	0.028000	0.19301	1.000000	0.80357	0.985000	0.73830	1.110000	0.31147	1.515000	0.48885	0.561000	0.74099	CGC	.	.	.	none		0.582	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
MSI2	124540	hgsc.bcm.edu	37	17	55754379	55754379	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:55754379G>A	ENST00000284073.2	+	13	1186	c.977G>A	c.(976-978)gGa>gAa	p.G326E	MSI2_ENST00000442934.2_Missense_Mutation_p.G265E|MSI2_ENST00000416426.2_Missense_Mutation_p.G322E	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	326						cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		TTTACAAATGGATACCATTGA	0.458			T	HOXA9	CML																																p.G326E		Atlas-SNP	.		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	.	MSI2	52	.	0			c.G977A						PASS	.						234.0	195.0	208.0					17																	55754379		2203	4300	6503	SO:0001583	missense	124540	exon13			CAAATGGATACCA	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.977G>A	chr17.hg19:g.55754379G>A	ENSP00000284073:p.Gly326Glu	173.0	0.0	.		252.0	80.0	.	NM_138962	Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	hg19	CCDS11596.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739690	0.89573	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000442934	D;T;T	0.89050	-2.46;0.62;1.01	4.87	4.87	0.63330	.	0.052819	0.85682	D	0.000000	D	0.93605	0.7958	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.94391	0.7614	10	0.87932	D	0	.	18.0345	0.89296	0.0:0.0:1.0:0.0	.	322;326	B4DHE8;Q96DH6	.;MSI2H_HUMAN	E	322;326;265	ENSP00000414671:G322E;ENSP00000284073:G326E;ENSP00000392607:G265E	ENSP00000284073:G326E	G	+	2	0	MSI2	53109378	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.430000	0.97488	2.260000	0.74910	0.462000	0.41574	GGA	.	.	.	none		0.458	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1		
EXOC7	23265	hgsc.bcm.edu	37	17	74081426	74081426	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:74081426T>A	ENST00000335146.7	-	16	1887	c.1834A>T	c.(1834-1836)Att>Ttt	p.I612F	EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000411744.2_Missense_Mutation_p.I553F|EXOC7_ENST00000467929.2_Missense_Mutation_p.I533F|EXOC7_ENST00000332065.5_Missense_Mutation_p.I530F|EXOC7_ENST00000405575.4_Missense_Mutation_p.I584F|EXOC7_ENST00000607838.1_Missense_Mutation_p.I584F|EXOC7_ENST00000589210.1_Missense_Mutation_p.I561F			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	612					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			TGCTGCTCAATGTGCTCCCGG	0.632																																					p.I612F		Atlas-SNP	.											.	EXOC7	47	.	0			c.A1834T						PASS	.						57.0	47.0	50.0					17																	74081426		2202	4300	6502	SO:0001583	missense	23265	exon16			GCTCAATGTGCTC	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1834A>T	chr17.hg19:g.74081426T>A	ENSP00000334100:p.Ile612Phe	30.0	0.0	.		40.0	14.0	.	NM_001145297	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	hg19	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	t	27.2	4.809754	0.90707	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.43	4.43	0.53597	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76097	0.3940	M	0.78637	2.42	0.80722	D	1	B;B;P;P;D;B;P	0.58268	0.143;0.014;0.851;0.874;0.982;0.029;0.925	B;B;P;P;D;B;P	0.66497	0.109;0.109;0.635;0.731;0.944;0.043;0.803	T	0.75204	-0.3400	9	0.27082	T	0.32	-17.3693	13.7322	0.62794	0.0:0.0:0.0:1.0	.	553;584;533;498;612;530;561	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	F	530;450;584;612;561;498;553	.	ENSP00000333806:I530F	I	-	1	0	EXOC7	71593021	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	8.037000	0.88933	1.656000	0.50722	0.392000	0.25879	ATT	.	.	.	none		0.632	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
APCDD1	147495	hgsc.bcm.edu	37	18	10487626	10487626	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr18:10487626C>G	ENST00000355285.5	+	5	1490	c.1136C>G	c.(1135-1137)gCc>gGc	p.A379G	APCDD1_ENST00000578882.1_Missense_Mutation_p.S175R	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		GCGGCCACAGCCTCACTGCTC	0.597																																					p.A379G		Atlas-SNP	.											.	APCDD1	57	.	0			c.C1136G						PASS	.						75.0	69.0	71.0					18																	10487626		2203	4300	6503	SO:0001583	missense	147495	exon5			CCACAGCCTCACT	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1136C>G	chr18.hg19:g.10487626C>G	ENSP00000347433:p.Ala379Gly	135.0	0.0	.		95.0	15.0	.	NM_153000		Missense_Mutation	SNP	ENST00000355285.5	hg19	CCDS11849.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172736	0.38413	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.18502	2.21	5.06	5.06	0.68205	.	0.162880	0.56097	D	0.000037	T	0.29288	0.0729	M	0.63843	1.955	0.29806	N	0.832069	P	0.46952	0.887	P	0.47044	0.535	T	0.12656	-1.0539	10	0.87932	D	0	-34.4277	18.7893	0.91966	0.0:1.0:0.0:0.0	.	379	Q8J025	APCD1_HUMAN	G	379;430	ENSP00000347433:A379G	ENSP00000347433:A379G	A	+	2	0	APCDD1	10477626	1.000000	0.71417	0.981000	0.43875	0.968000	0.65278	5.655000	0.67981	2.496000	0.84212	0.561000	0.74099	GCC	.	.	.	none		0.597	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
ST8SIA5	29906	hgsc.bcm.edu	37	18	44284579	44284579	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr18:44284579G>T	ENST00000315087.7	-	2	840	c.180C>A	c.(178-180)tgC>tgA	p.C60*	ST8SIA5_ENST00000538168.1_Nonsense_Mutation_p.C96*|ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000536490.1_Intron	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	60					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)			kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						TCAGCTCCAGGCATCTTGTGG	0.512																																					p.C60X		Atlas-SNP	.											.	ST8SIA5	57	.	0			c.C180A						PASS	.						183.0	165.0	171.0					18																	44284579		2203	4300	6503	SO:0001587	stop_gained	29906	exon2			CTCCAGGCATCTT	U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.180C>A	chr18.hg19:g.44284579G>T	ENSP00000321343:p.Cys60*	286.0	0.0	.		317.0	13.0	.	NM_013305	B7Z1K9|Q6IAW7	Nonsense_Mutation	SNP	ENST00000315087.7	hg19	CCDS11930.1	.	.	.	.	.	.	.	.	.	.	G	37	6.507977	0.97624	.	.	ENSG00000101638	ENST00000315087;ENST00000538168	.	.	.	4.48	1.66	0.24008	.	0.052875	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5961	0.33716	0.2644:0.0:0.7356:0.0	.	.	.	.	X	60;96	.	ENSP00000321343:C60X	C	-	3	2	ST8SIA5	42538577	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.934000	0.48956	0.457000	0.26962	0.561000	0.74099	TGC	.	.	.	none		0.512	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
VAV1	7409	hgsc.bcm.edu	37	19	6833546	6833546	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:6833546T>G	ENST00000602142.1	+	17	1700	c.1618T>G	c.(1618-1620)Ttc>Gtc	p.F540V	VAV1_ENST00000596764.1_Missense_Mutation_p.F508V|VAV1_ENST00000539284.1_Missense_Mutation_p.F443V|VAV1_ENST00000304076.2_Missense_Mutation_p.F540V|VAV1_ENST00000599806.1_Missense_Mutation_p.F485V	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	540					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CAGAGGTACCTTCTATCAGGG	0.542																																					p.F540V		Atlas-SNP	.											.	VAV1	140	.	0			c.T1618G						PASS	.						94.0	96.0	95.0					19																	6833546		2203	4300	6503	SO:0001583	missense	7409	exon17			GGTACCTTCTATC		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1618T>G	chr19.hg19:g.6833546T>G	ENSP00000472929:p.Phe540Val	167.0	0.0	.		203.0	25.0	.	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	hg19	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306485	0.60305	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D;D	0.92647	-3.08;-3.08	4.73	4.73	0.59995	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.055969	0.64402	D	0.000001	D	0.92954	0.7758	L	0.32530	0.975	0.58432	D	0.999999	D;D;D;D	0.89917	0.995;0.998;1.0;0.999	D;D;D;D	0.87578	0.94;0.982;0.998;0.996	D	0.93330	0.6700	10	0.62326	D	0.03	.	12.1658	0.54129	0.0:0.0:0.0:1.0	.	443;540;485;540	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	V	540;443	ENSP00000302269:F540V;ENSP00000443242:F443V	ENSP00000302269:F540V	F	+	1	0	VAV1	6784546	1.000000	0.71417	0.998000	0.56505	0.416000	0.31233	5.489000	0.66875	1.784000	0.52394	0.402000	0.26972	TTC	.	.	.	none		0.542	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
ZNF132	7691	hgsc.bcm.edu	37	19	58945194	58945194	+	Silent	SNP	T	T	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr19:58945194T>A	ENST00000254166.3	-	3	2017	c.1617A>T	c.(1615-1617)ggA>ggT	p.G539G	CTD-2619J13.17_ENST00000594816.1_lincRNA	NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		AAGGCTTTTCTCCAGTGTGAA	0.478																																					p.G539G		Atlas-SNP	.											.	ZNF132	56	.	0			c.A1617T						PASS	.						81.0	83.0	82.0					19																	58945194		2203	4300	6503	SO:0001819	synonymous_variant	7691	exon3			CTTTTCTCCAGTG	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1617A>T	chr19.hg19:g.58945194T>A		107.0	0.0	.		112.0	22.0	.	NM_003433	Q32MI9	Silent	SNP	ENST00000254166.3	hg19	CCDS12980.1																																																																																			.	.	.	none		0.478	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
SEC23B	10483	hgsc.bcm.edu	37	20	18496315	18496315	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr20:18496315A>T	ENST00000336714.3	+	4	733	c.301A>T	c.(301-303)Ata>Tta	p.I101L	SEC23B_ENST00000494645.1_3'UTR|SEC23B_ENST00000262544.2_Missense_Mutation_p.I101L|SEC23B_ENST00000377475.3_Missense_Mutation_p.I101L|SEC23B_ENST00000377465.1_Missense_Mutation_p.I101L	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	101					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TTATGGAGGCATATCTGAGGT	0.348																																					p.I101L		Atlas-SNP	.											.	SEC23B	70	.	0			c.A301T						PASS	.						155.0	118.0	130.0					20																	18496315		2203	4300	6503	SO:0001583	missense	10483	exon4			GGAGGCATATCTG	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.301A>T	chr20.hg19:g.18496315A>T	ENSP00000338844:p.Ile101Leu	103.0	0.0	.		102.0	14.0	.	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.215314	0.79352	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.04	5.04	0.67666	Zinc finger, Sec23/Sec24-type (1);	0.000000	0.85682	D	0.000000	D	0.86347	0.5911	M	0.81112	2.525	0.80722	D	1	P;P	0.41041	0.736;0.643	P;B	0.45577	0.486;0.271	D	0.87381	0.2357	10	0.49607	T	0.09	-22.3484	14.4009	0.67044	1.0:0.0:0.0:0.0	.	101;101	B4DJW8;Q15437	.;SC23B_HUMAN	L	101	ENSP00000403971:I101L;ENSP00000338844:I101L;ENSP00000262544:I101L;ENSP00000366695:I101L;ENSP00000366685:I101L	ENSP00000262544:I101L	I	+	1	0	SEC23B	18444315	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.929000	0.92859	2.241000	0.73720	0.528000	0.53228	ATA	.	.	.	none		0.348	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
TRAF5	7188	hgsc.bcm.edu	37	1	211545951	211545952	+	Frame_Shift_Ins	INS	-	-	C			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr1:211545951_211545952insC	ENST00000261464.5	+	11	1635_1636	c.1581_1582insC	c.(1582-1584)tctfs	p.S528fs	TRAF5_ENST00000336184.2_Frame_Shift_Ins_p.S528fs|TRAF5_ENST00000367004.3_Frame_Shift_Ins_p.S528fs|TRAF5_ENST00000427925.2_Frame_Shift_Ins_p.S422fs	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	528	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TTGTGGCTCATTCTGTTTTGGA	0.465																																					p.H527fs		Atlas-INDEL	.											.	TRAF5	64	.	0			c.1581_1582insC						PASS	.																																			SO:0001589	frameshift_variant	7188	exon11			.	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	Exception_encountered	chr1.hg19:g.211545951_211545952insC	ENSP00000261464:p.Ser528fs	118.0	0.0	0		118.0	20.0	0.169492	NM_145759	B4DIS9|B4E0A2|Q6FHY1	Frame_Shift_Ins	INS	ENST00000261464.5	hg19	CCDS1497.1																																																																																			.	.	.	none		0.465	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
SP100	6672	hgsc.bcm.edu	37	2	231338157	231338157	+	Splice_Site	DEL	T	T	-			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr2:231338157delT	ENST00000264052.5	+	16	1901		c.e16+2		SP100_ENST00000409112.1_Splice_Site|SP100_ENST00000340126.4_Splice_Site	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ACATGATGGGTAAGGCTACCC	0.468																																					.		Atlas-INDEL	.											.	SP100	167	.	0			c.1546+1T>-						PASS	.						164.0	152.0	156.0					2																	231338157		2203	4300	6503	SO:0001630	splice_region_variant	6672	exon16			.	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1546+2T>-	chr2.hg19:g.231338157delT		126.0	0.0	0		135.0	23.0	0.17037	NM_003113	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Splice_Site	DEL	ENST00000264052.5	hg19	CCDS2477.1																																																																																			.	.	.	none		0.468	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	Intron
TEKT1	83659	hgsc.bcm.edu	37	17	6718552	6718553	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6796-01A-11D-1961-08	TCGA-G7-6796-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d747a9f3-e148-4273-883e-8b64db6779a2	82db6745-95f5-4b86-acd4-8aeb5ec873db	g.chr17:6718552_6718553insA	ENST00000338694.2	-	5	687_688	c.558_559insT	c.(556-561)gatatcfs	p.I187fs	TEKT1_ENST00000535086.1_Frame_Shift_Ins_p.I41fs	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	187						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				GAGAAGCAGATATCATCTATGG	0.48																																					p.I187fs		Atlas-INDEL	.											.	TEKT1	49	.	0			c.559_560insT						PASS	.																																			SO:0001589	frameshift_variant	83659	exon5			.		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.559dupT	chr17.hg19:g.6718553_6718553dupA	ENSP00000341346:p.Ile187fs	209.0	0.0	0		263.0	37.0	0.140684	NM_053285	D3DTM7	Frame_Shift_Ins	INS	ENST00000338694.2	hg19	CCDS11083.1																																																																																			.	.	.	none		0.480	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
