#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZSCAN20	7579	hgsc.bcm.edu	37	1	33960785	33960785	+	Silent	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr1:33960785C>T	ENST00000361328.3	+	8	2994	c.2841C>T	c.(2839-2841)atC>atT	p.I947I		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	947					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCAAGCTCATCACACACCAGA	0.527																																					p.I947I		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C2841T						PASS	.						82.0	96.0	91.0					1																	33960785		2167	4282	6449	SO:0001819	synonymous_variant	7579	exon8			GCTCATCACACAC	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2841C>T	chr1.hg19:g.33960785C>T		108.0	0.0	.		39.0	36.0	.	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	hg19	CCDS41300.1																																																																																			.	.	.	none		0.527	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
URB2	9816	hgsc.bcm.edu	37	1	229770863	229770863	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr1:229770863A>G	ENST00000258243.2	+	4	639	c.503A>G	c.(502-504)cAg>cGg	p.Q168R		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	168						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GTGGTAGCCCAGTTGTTTGAG	0.582																																					p.Q168R		Atlas-SNP	.											.	URB2	152	.	0			c.A503G						PASS	.						68.0	55.0	59.0					1																	229770863		2203	4300	6503	SO:0001583	missense	9816	exon4			TAGCCCAGTTGTT	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.503A>G	chr1.hg19:g.229770863A>G	ENSP00000258243:p.Gln168Arg	105.0	0.0	.		26.0	21.0	.	NM_014777	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	hg19	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	A	9.721	1.159761	0.21454	.	.	ENSG00000135763	ENST00000258243	T	0.09817	2.94	5.68	0.193	0.15139	.	0.485156	0.24580	N	0.037302	T	0.09512	0.0234	L	0.56769	1.78	0.22226	N	0.999273	P	0.35077	0.483	B	0.30251	0.113	T	0.20571	-1.0271	9	.	.	.	-5.5473	9.3827	0.38325	0.4958:0.3913:0.0:0.1129	.	168	Q14146	URB2_HUMAN	R	168	ENSP00000258243:Q168R	.	Q	+	2	0	URB2	227837486	0.984000	0.35163	0.009000	0.14445	0.428000	0.31595	1.413000	0.34725	0.129000	0.18514	0.528000	0.53228	CAG	.	.	.	none		0.582	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
OR2T3	343173	hgsc.bcm.edu	37	1	248637423	248637423	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr1:248637423G>T	ENST00000359594.2	+	1	797	c.772G>T	c.(772-774)Ggt>Tgt	p.G258C		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTGCTCTTCGGTGCTTCCTT	0.547																																					p.G258C		Atlas-SNP	.											.	OR2T3	79	.	0			c.G772T						PASS	.						285.0	260.0	268.0					1																	248637423		2203	4300	6503	SO:0001583	missense	343173	exon1			CTCTTCGGTGCTT		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.772G>T	chr1.hg19:g.248637423G>T	ENSP00000352604:p.Gly258Cys	647.0	0.0	.		392.0	20.0	.	NM_001005495	B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	hg19	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	g	11.47	1.647301	0.29246	.	.	ENSG00000196539	ENST00000359594	T	0.38722	1.12	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.67163	0.2864	M	0.88450	2.955	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55982	-0.8054	9	0.87932	D	0	.	10.4397	0.44457	0.0:0.0:1.0:0.0	.	258	Q8NH03	OR2T3_HUMAN	C	258	ENSP00000352604:G258C	ENSP00000352604:G258C	G	+	1	0	OR2T3	246704046	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-0.435000	0.06931	1.014000	0.39417	0.186000	0.17326	GGT	.	.	.	none		0.547	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495	
ROCK2	9475	hgsc.bcm.edu	37	2	11361482	11361482	+	Splice_Site	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:11361482C>A	ENST00000315872.6	-	9	1549	c.1101G>T	c.(1099-1101)acG>acT	p.T367T	ROCK2_ENST00000401753.1_Splice_Site_p.T124T	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	367	AGC-kinase C-terminal.|Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CAGGAGCTGCCGCTATTAAAA	0.308																																					p.T367T		Atlas-SNP	.											ROCK2_ENST00000315872,NS,carcinoma,0,2	ROCK2	224	.	0			c.G1101T						PASS	.						62.0	66.0	65.0					2																	11361482		1828	4082	5910	SO:0001630	splice_region_variant	9475	exon9			AGCTGCCGCTATT	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1100-1G>T	chr2.hg19:g.11361482C>A		137.0	0.0	.		145.0	7.0	.	NM_004850	Q53QZ0|Q53SJ7|Q9UQN5	Silent	SNP	ENST00000315872.6	hg19	CCDS42654.1																																																																																			.	.	.	none		0.308	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		Silent
APOB	338	hgsc.bcm.edu	37	2	21229324	21229324	+	Silent	SNP	G	G	T	rs558589282		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:21229324G>T	ENST00000233242.1	-	26	10543	c.10416C>A	c.(10414-10416)acC>acA	p.T3472T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3472	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T3472T(2)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCTTTAGCGGTAGAGTACA	0.398																																					p.T3472T		Atlas-SNP	.											APOB,NS,carcinoma,0,1	APOB	761	.	2	Substitution - coding silent(2)	lung(2)	c.C10416A						PASS	.						102.0	103.0	102.0					2																	21229324		2203	4300	6503	SO:0001819	synonymous_variant	338	exon26			TTTAGCGGTAGAG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10416C>A	chr2.hg19:g.21229324G>T		166.0	0.0	.		135.0	12.0	.	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.	.	none		0.398	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
GFPT1	2673	hgsc.bcm.edu	37	2	69553334	69553334	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:69553334A>T	ENST00000357308.4	-	20	2265	c.2087T>A	c.(2086-2088)gTg>gAg	p.V696E	GFPT1_ENST00000361060.5_Missense_Mutation_p.V678E	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	696					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						CTCTACAGTCACAGATTTGGC	0.343																																					p.V696E		Atlas-SNP	.											.	GFPT1	38	.	0			c.T2087A						PASS	.						89.0	90.0	90.0					2																	69553334		2203	4300	6503	SO:0001583	missense	2673	exon20			ACAGTCACAGATT		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.2087T>A	chr2.hg19:g.69553334A>T	ENSP00000349860:p.Val696Glu	46.0	0.0	.		60.0	22.0	.	NM_001244710	Q53QE6|Q9BXF8	Missense_Mutation	SNP	ENST00000357308.4	hg19	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559990	0.86335	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.77358	-1.09;-1.09	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93684	0.7982	H	0.99732	4.735	0.80722	D	1	D	0.65815	0.995	D	0.85130	0.997	D	0.96269	0.9197	10	0.87932	D	0	-14.7507	14.9534	0.71091	1.0:0.0:0.0:0.0	.	678	Q06210-2	.	E	696;678	ENSP00000349860:V696E;ENSP00000354347:V678E	ENSP00000349860:V696E	V	-	2	0	GFPT1	69406838	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.082000	0.94059	2.302000	0.77476	0.533000	0.62120	GTG	.	.	.	none		0.343	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
NCKAP5	344148	hgsc.bcm.edu	37	2	133541732	133541732	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:133541732C>G	ENST00000409261.1	-	14	3025	c.2652G>C	c.(2650-2652)tgG>tgC	p.W884C	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.W884C|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	884										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCACTGGACCCAGTCCCTCC	0.577																																					p.W884C		Atlas-SNP	.											.	NCKAP5	322	.	0			c.G2652C						PASS	.						54.0	56.0	56.0					2																	133541732		1979	4160	6139	SO:0001583	missense	344148	exon14			CTGGACCCAGTCC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2652G>C	chr2.hg19:g.133541732C>G	ENSP00000387128:p.Trp884Cys	174.0	0.0	.		85.0	52.0	.	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	c	11.53	1.664921	0.29604	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.10860	2.83;2.83	5.1	4.18	0.49190	.	0.226096	0.22876	U	0.054566	T	0.20820	0.0501	L	0.32530	0.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.70935	0.971	T	0.00448	-1.1733	10	0.48119	T	0.1	.	13.5162	0.61541	0.1547:0.8453:0.0:0.0	.	884	O14513	NCKP5_HUMAN	C	884	ENSP00000387128:W884C;ENSP00000380603:W884C	ENSP00000380603:W884C	W	-	3	0	NCKAP5	133258202	0.911000	0.30947	0.557000	0.28306	0.216000	0.24613	3.191000	0.50981	2.661000	0.90470	0.651000	0.88453	TGG	.	.	.	none		0.577	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
ITM2C	81618	hgsc.bcm.edu	37	2	231741583	231741583	+	Silent	SNP	G	G	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:231741583G>C	ENST00000326427.6	+	4	588	c.462G>C	c.(460-462)gcG>gcC	p.A154A	ITM2C_ENST00000326407.6_Intron|ITM2C_ENST00000492029.1_3'UTR|ITM2C_ENST00000335005.6_Silent_p.A107A|ITM2C_ENST00000409704.2_Silent_p.A92A	NM_030926.4	NP_112188.1	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C	154	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			cervix(2)|lung(1)|ovary(1)|skin(1)	5		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTCTGACTGCGTACCATGATA	0.587																																					p.A154A		Atlas-SNP	.											.	ITM2C	17	.	0			c.G462C						PASS	.						147.0	126.0	133.0					2																	231741583		2203	4300	6503	SO:0001819	synonymous_variant	81618	exon4			GACTGCGTACCAT	AF038953	CCDS2479.1, CCDS33395.1, CCDS33396.1, CCDS74665.1	2q37	2012-10-10			ENSG00000135916	ENSG00000135916		"""BRICHOS domain containing"""	6175	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2C"""	609554				9653160	Standard	NM_030926		Approved	BRI3, E25, hRPC.1050_D_4, ITM3, BRICD2C	uc002vqz.3	Q9NQX7	OTTHUMG00000133219	ENST00000326427.6:c.462G>C	chr2.hg19:g.231741583G>C		169.0	0.0	.		107.0	50.0	.	NM_030926	B3KPG4|Q4G0A8|Q53H84|Q6IAE7|Q86VK5|Q8N288|Q8TAW0|Q9BUP8	Silent	SNP	ENST00000326427.6	hg19	CCDS2479.1																																																																																			.	.	.	none		0.587	ITM2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256954.2	NM_030926	
CCR2	729230	hgsc.bcm.edu	37	3	46399085	46399085	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:46399085T>A	ENST00000400888.2	+	1	106	c.67T>A	c.(67-69)Ttt>Att	p.F23I	CCR2_ENST00000292301.4_Missense_Mutation_p.F23I|CCR2_ENST00000465202.1_Intron|CCR2_ENST00000445132.2_Missense_Mutation_p.F23I			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	23					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		AGTCACCACCTTTTTTGATTA	0.478																																					p.F23I		Atlas-SNP	.											.	CCR2	103	.	0			c.T67A						PASS	.						195.0	172.0	179.0					3																	46399085		1568	3582	5150	SO:0001583	missense	729230	exon2			ACCACCTTTTTTG		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.67T>A	chr3.hg19:g.46399085T>A	ENSP00000383681:p.Phe23Ile	280.0	1.0	.		280.0	136.0	.	NM_001123041	A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	hg19	CCDS43078.1	.	.	.	.	.	.	.	.	.	.	T	9.930	1.214490	0.22289	.	.	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000421659;ENST00000400888	T;T;T;T	0.68479	-0.33;-0.31;1.34;-0.31	4.62	-6.25	0.02039	.	6.783580	0.00397	N	0.000040	T	0.40743	0.1129	N	0.12746	0.255	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15235	-1.0444	10	0.22109	T	0.4	.	2.8484	0.05550	0.3386:0.2093:0.3514:0.1007	.	23;23	P41597;Q4VBL2	CCR2_HUMAN;.	I	23	ENSP00000399285:F23I;ENSP00000292301:F23I;ENSP00000396736:F23I;ENSP00000383681:F23I	ENSP00000292301:F23I	F	+	1	0	CCR2	46374089	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.134000	0.15932	-0.799000	0.04439	-1.318000	0.01297	TTT	.	.	.	none		0.478	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
SLC26A6	65010	hgsc.bcm.edu	37	3	48668741	48668741	+	Splice_Site	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:48668741T>C	ENST00000395550.2	-	8	951		c.e8-2		SLC26A6_ENST00000482282.1_5'Flank|SLC26A6_ENST00000383733.3_Splice_Site|SLC26A6_ENST00000337000.8_Splice_Site|SLC26A6_ENST00000455886.2_Splice_Site|SLC26A6_ENST00000358747.6_Splice_Site|SLC26A6_ENST00000420764.2_Splice_Site			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6						angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		CCCGATGAGCTGTGGGAGAGG	0.577																																					.	NSCLC(13;369 479 28271 30152 44026)	Atlas-SNP	.											.	SLC26A6	45	.	0			c.841-2A>G						PASS	.						40.0	42.0	41.0					3																	48668741		2105	4230	6335	SO:0001630	splice_region_variant	65010	exon8			ATGAGCTGTGGGA	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.904-2A>G	chr3.hg19:g.48668741T>C		24.0	0.0	.		13.0	8.0	.	NM_001040454	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Splice_Site	SNP	ENST00000395550.2	hg19	CCDS43087.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878586	0.72294	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886;ENST00000421649	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9886	0.80183	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC26A6	48643745	1.000000	0.71417	0.988000	0.46212	0.877000	0.50540	7.298000	0.78815	2.173000	0.68751	0.533000	0.62120	.	.	.	.	none		0.577	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911	Intron
ZMYND10	51364	hgsc.bcm.edu	37	3	50379017	50379017	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:50379017C>T	ENST00000231749.3	-	11	2507	c.1235G>A	c.(1234-1236)tGg>tAg	p.W412*	ZMYND10-AS1_ENST00000440013.1_RNA|RASSF1_ENST00000488024.1_5'Flank|RASSF1_ENST00000357043.2_5'Flank|ZMYND10_ENST00000360165.3_Nonsense_Mutation_p.W407*|RASSF1_ENST00000359365.4_5'Flank|ZMYND10_ENST00000490675.1_5'UTR	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10	412	Interaction with LRRC6.				inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GCAGCAATACCACTCATTCTG	0.572										TSP Lung(30;0.18)																											p.W412X		Atlas-SNP	.											.	ZMYND10	37	.	0			c.G1235A						PASS	.						138.0	129.0	132.0					3																	50379017		2203	4300	6503	SO:0001587	stop_gained	51364	exon11			CAATACCACTCAT	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874	ENST00000231749.3:c.1235G>A	chr3.hg19:g.50379017C>T	ENSP00000231749:p.Trp412*	126.0	0.0	.		78.0	30.0	.	NM_015896	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Nonsense_Mutation	SNP	ENST00000231749.3	hg19	CCDS2825.1	.	.	.	.	.	.	.	.	.	.	C	37	6.249939	0.97412	.	.	ENSG00000004838	ENST00000231749;ENST00000360165	.	.	.	5.4	5.4	0.78164	.	0.053779	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.9405	19.525	0.95201	0.0:1.0:0.0:0.0	.	.	.	.	X	412;407	.	ENSP00000231749:W412X	W	-	2	0	ZMYND10	50354021	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	7.761000	0.85260	2.699000	0.92147	0.655000	0.94253	TGG	.	.	.	none		0.572	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
FAM208A	23272	hgsc.bcm.edu	37	3	56658883	56658883	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:56658883G>C	ENST00000493960.2	-	22	4301	c.4291C>G	c.(4291-4293)Cag>Gag	p.Q1431E	FAM208A_ENST00000431842.2_Missense_Mutation_p.Q994E|FAM208A_ENST00000485156.1_Intron|FAM208A_ENST00000355628.5_Missense_Mutation_p.Q1370E	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1431							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TGTCGTTGCTGTATGTTCTGA	0.383																																					p.Q1431E		Atlas-SNP	.											.	FAM208A	113	.	0			c.C4291G						PASS	.						127.0	125.0	126.0					3																	56658883		2203	4300	6503	SO:0001583	missense	23272	exon22			GTTGCTGTATGTT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.4291C>G	chr3.hg19:g.56658883G>C	ENSP00000417509:p.Gln1431Glu	121.0	0.0	.		147.0	58.0	.	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	hg19	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279138	0.80692	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.53206	0.63;0.63;0.63	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000008	T	0.52613	0.1745	L	0.38838	1.175	0.47245	D	0.999367	P;B;D;B	0.61697	0.629;0.045;0.99;0.435	B;B;P;B	0.55011	0.382;0.094;0.766;0.104	T	0.54070	-0.8348	10	0.72032	D	0.01	-0.4466	14.6453	0.68756	0.0:0.0:0.8544:0.1456	.	1431;1370;994;1431	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	E	994;1431;1370	ENSP00000399410:Q994E;ENSP00000417509:Q1431E;ENSP00000347845:Q1370E	ENSP00000347845:Q1370E	Q	-	1	0	C3orf63	56633923	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.500000	0.81588	2.685000	0.91497	0.655000	0.94253	CAG	.	.	.	none		0.383	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
ACOX2	8309	hgsc.bcm.edu	37	3	58517532	58517532	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:58517532C>A	ENST00000302819.5	-	6	882	c.591G>T	c.(589-591)cgG>cgT	p.R197R	ACOX2_ENST00000459701.2_Silent_p.R197R	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	197					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		GGGTGGCTGACCGTCCCACTG	0.612																																					p.R197R		Atlas-SNP	.											.	ACOX2	53	.	0			c.G591T						PASS	.						57.0	50.0	52.0					3																	58517532		2203	4300	6503	SO:0001819	synonymous_variant	8309	exon6			GGCTGACCGTCCC	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.591G>T	chr3.hg19:g.58517532C>A		79.0	0.0	.		34.0	18.0	.	NM_003500	A6NF16|B2R8U5	Silent	SNP	ENST00000302819.5	hg19	CCDS33775.1																																																																																			.	.	.	none		0.612	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
EPHA3	2042	hgsc.bcm.edu	37	3	89521663	89521663	+	Missense_Mutation	SNP	C	C	A	rs549868478	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:89521663C>A	ENST00000336596.2	+	16	2965	c.2740C>A	c.(2740-2742)Cgc>Agc	p.R914S	EPHA3_ENST00000494014.1_Missense_Mutation_p.R914S	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	914	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.		R -> H (in dbSNP:rs17801309). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CACTACCTTCCGCACAACAGG	0.468										TSP Lung(6;0.00050)																											p.R914S		Atlas-SNP	.											.	EPHA3	501	.	0			c.C2740A						PASS	.						181.0	170.0	174.0					3																	89521663		2203	4300	6503	SO:0001583	missense	2042	exon16			ACCTTCCGCACAA	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2740C>A	chr3.hg19:g.89521663C>A	ENSP00000337451:p.Arg914Ser	250.0	0.0	.		249.0	16.0	.	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	c	12.06	1.824931	0.32237	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;T	0.83755	-1.76;-0.64	5.73	3.93	0.45458	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.328872	0.37012	N	0.002289	T	0.72542	0.3473	N	0.19112	0.55	0.26449	N	0.975649	B	0.28760	0.221	B	0.33521	0.165	T	0.59220	-0.7495	9	.	.	.	.	13.0963	0.59195	0.1289:0.7475:0.1236:0.0	.	914	P29320	EPHA3_HUMAN	S	914	ENSP00000337451:R914S;ENSP00000419190:R914S	.	R	+	1	0	EPHA3	89604353	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.492000	0.45311	0.772000	0.33382	-0.121000	0.15023	CGC	.	.	.	none		0.468	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
ZBTB11	27107	hgsc.bcm.edu	37	3	101370105	101370105	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:101370105C>T	ENST00000312938.4	-	11	3647	c.3067G>A	c.(3067-3069)Gta>Ata	p.V1023I		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	1023					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TGTGCTAATACATAATTAACC	0.398																																					p.V1023I		Atlas-SNP	.											.	ZBTB11	77	.	0			c.G3067A						PASS	.						135.0	131.0	132.0					3																	101370105		2203	4300	6503	SO:0001583	missense	27107	exon11			CTAATACATAATT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.3067G>A	chr3.hg19:g.101370105C>T	ENSP00000326200:p.Val1023Ile	181.0	0.0	.		168.0	70.0	.	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982094	0.93044	.	.	ENSG00000066422	ENST00000312938	T	0.12672	2.66	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.28300	0.0699	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.00899	-1.1522	10	0.30078	T	0.28	-12.9426	19.5182	0.95174	0.0:1.0:0.0:0.0	.	1023	O95625	ZBT11_HUMAN	I	1023	ENSP00000326200:V1023I	ENSP00000326200:V1023I	V	-	1	0	ZBTB11	102852795	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	7.445000	0.80570	2.692000	0.91855	0.555000	0.69702	GTA	.	.	.	none		0.398	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376409	113376409	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:113376409T>C	ENST00000478658.1	-	5	4137	c.4120A>G	c.(4120-4122)Atg>Gtg	p.M1374V	KIAA2018_ENST00000316407.4_Missense_Mutation_p.M1374V|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1374						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGACTGACCATCATTTGAGTT	0.468																																					p.M1374V		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A4120G						PASS	.						105.0	102.0	103.0					3																	113376409		1991	4160	6151	SO:0001583	missense	205717	exon7			TGACCATCATTTG	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4120A>G	chr3.hg19:g.113376409T>C	ENSP00000420721:p.Met1374Val	112.0	0.0	.		96.0	38.0	.	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.417459	0.25552	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.18338	2.22;2.22	5.68	4.46	0.54185	.	0.087940	0.85682	D	0.000000	T	0.13415	0.0325	L	0.32530	0.975	0.47862	D	0.999537	B	0.30406	0.278	B	0.30179	0.112	T	0.07404	-1.0774	10	0.37606	T	0.19	-12.1634	11.116	0.48259	0.0:0.0:0.3371:0.6629	.	1374	Q68DE3	K2018_HUMAN	V	1374	ENSP00000320794:M1374V;ENSP00000420721:M1374V	ENSP00000320794:M1374V	M	-	1	0	KIAA2018	114859099	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	2.543000	0.45752	2.169000	0.68431	0.402000	0.26972	ATG	.	.	.	none		0.468	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
FSTL1	11167	hgsc.bcm.edu	37	3	120122159	120122159	+	Silent	SNP	A	A	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:120122159A>G	ENST00000295633.3	-	8	980	c.624T>C	c.(622-624)aaT>aaC	p.N208N	FSTL1_ENST00000424703.2_Silent_p.N173N	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	208	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		TCCAATCAGCATTTTCATCAG	0.438																																					p.N208N		Atlas-SNP	.											.	FSTL1	43	.	0			c.T624C						PASS	.						106.0	106.0	106.0					3																	120122159		2203	4300	6503	SO:0001819	synonymous_variant	11167	exon8			ATCAGCATTTTCA	U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.624T>C	chr3.hg19:g.120122159A>G		132.0	0.0	.		156.0	65.0	.	NM_007085	A8K523|B4DTT5|D3DN90|Q549Z0	Silent	SNP	ENST00000295633.3	hg19	CCDS2998.1																																																																																			.	.	.	none		0.438	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085	
ETV5	2119	hgsc.bcm.edu	37	3	185766603	185766603	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr3:185766603G>A	ENST00000306376.5	-	13	1604	c.1358C>T	c.(1357-1359)gCc>gTc	p.A453V	ETV5_ENST00000434744.1_Missense_Mutation_p.A453V|ETV5_ENST00000480706.1_5'UTR|ETV5_ENST00000537818.1_Missense_Mutation_p.A495V	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	453					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GGAGAAGAGGGCATCTGGGTC	0.582			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.A453V		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5	106	.	0			c.C1358T						PASS	.						70.0	61.0	64.0					3																	185766603		2203	4300	6503	SO:0001583	missense	2119	exon13			AAGAGGGCATCTG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1358C>T	chr3.hg19:g.185766603G>A	ENSP00000306894:p.Ala453Val	73.0	0.0	.		43.0	25.0	.	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	hg19	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043894	0.93685	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.54866	0.55;0.55;0.55	5.85	5.85	0.93711	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	L	0.49513	1.565	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.70149	-0.4951	10	0.87932	D	0	.	18.9349	0.92582	0.0:0.0:1.0:0.0	.	453;495	P41161;B7Z7D7	ETV5_HUMAN;.	V	453;453;495	ENSP00000306894:A453V;ENSP00000413755:A453V;ENSP00000441737:A495V	ENSP00000306894:A453V	A	-	2	0	ETV5	187249297	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.773000	0.95371	0.655000	0.94253	GCC	.	.	.	none		0.582	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
SLC4A4	8671	hgsc.bcm.edu	37	4	72332250	72332250	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr4:72332250C>A	ENST00000264485.5	+	13	1704	c.1587C>A	c.(1585-1587)acC>acA	p.T529T	SLC4A4_ENST00000512686.1_Silent_p.T485T|SLC4A4_ENST00000351898.6_Silent_p.T529T|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000425175.1_Silent_p.T529T|SLC4A4_ENST00000340595.3_Silent_p.T485T	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	529			T -> S (in pRTA-OA; decreased cotransporter activity). {ECO:0000269|PubMed:15930088, ECO:0000303|PubMed:17661077}.		bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TGAGCAGCACCGGACCTGTCC	0.398																																					p.T529T		Atlas-SNP	.											.	SLC4A4	269	.	0			c.C1587A						PASS	.						150.0	142.0	145.0					4																	72332250		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon13			CAGCACCGGACCT	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1587C>A	chr4.hg19:g.72332250C>A		183.0	0.0	.		178.0	11.0	.	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	hg19	CCDS43236.1																																																																																			.	.	.	none		0.398	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
ANK2	287	hgsc.bcm.edu	37	4	114177035	114177035	+	Missense_Mutation	SNP	C	C	A	rs143043717	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr4:114177035C>A	ENST00000357077.4	+	11	1188	c.1135C>A	c.(1135-1137)Cgt>Agt	p.R379S	ANK2_ENST00000506722.1_Missense_Mutation_p.R358S|ANK2_ENST00000394537.3_Missense_Mutation_p.R379S|ANK2_ENST00000264366.6_Missense_Mutation_p.R379S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	379					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R379S(2)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGGCCACTACCGTGTAACCAA	0.507																																					p.R379S		Atlas-SNP	.											ANK2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ANK2	576	.	2	Substitution - Missense(2)	lung(1)|central_nervous_system(1)	c.C1135A						PASS	.						158.0	141.0	147.0					4																	114177035		2203	4300	6503	SO:0001583	missense	287	exon11			CACTACCGTGTAA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1135C>A	chr4.hg19:g.114177035C>A	ENSP00000349588:p.Arg379Ser	291.0	0.0	.		198.0	13.0	.	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719331	0.89205	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.63744	-0.06;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.91	5.91	0.95273	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000026	T	0.64778	0.2629	N	0.05306	-0.075	0.80722	D	1	D;D;P;P;D	0.67145	0.984;0.973;0.929;0.885;0.996	P;P;B;P;D	0.79784	0.877;0.56;0.429;0.56;0.993	T	0.72711	-0.4211	10	0.59425	D	0.04	.	20.2896	0.98541	0.0:1.0:0.0:0.0	.	379;379;379;358;358	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	S	358;358;358;394;379;379;379;358	ENSP00000423799:R358S;ENSP00000421011:R358S;ENSP00000421067:R358S;ENSP00000424722:R394S;ENSP00000378044:R379S;ENSP00000349588:R379S;ENSP00000264366:R379S	ENSP00000264366:R379S	R	+	1	0	ANK2	114396484	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.021000	0.64072	2.794000	0.96219	0.655000	0.94253	CGT	.	C|1.000;T|0.000	.	alt		0.507	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FAT4	79633	hgsc.bcm.edu	37	4	126369689	126369689	+	Silent	SNP	G	G	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr4:126369689G>T	ENST00000394329.3	+	9	7531	c.7518G>T	c.(7516-7518)tcG>tcT	p.S2506S	FAT4_ENST00000335110.5_Silent_p.S804S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2506	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATTCTCTTTCGGGTAGAAATT	0.423																																					p.S2506S		Atlas-SNP	.											FAT4_ENST00000394329,NS,carcinoma,0,2	FAT4	1752	.	0			c.G7518T						PASS	.						68.0	71.0	70.0					4																	126369689		2203	4299	6502	SO:0001819	synonymous_variant	79633	exon9			TCTTTCGGGTAGA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7518G>T	chr4.hg19:g.126369689G>T		123.0	0.0	.		165.0	8.0	.	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	ENST00000394329.3	hg19	CCDS3732.3																																																																																			.	.	.	none		0.423	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT1	2195	hgsc.bcm.edu	37	4	187539870	187539870	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr4:187539870C>A	ENST00000441802.2	-	10	8079	c.7870G>T	c.(7870-7872)Gat>Tat	p.D2624Y		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2624	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GAGCCCTCATCGGCATCACTT	0.443										HNSCC(5;0.00058)																											p.D2624Y	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G7870T						PASS	.						63.0	59.0	60.0					4																	187539870		1948	4127	6075	SO:0001583	missense	2195	exon10			CCTCATCGGCATC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7870G>T	chr4.hg19:g.187539870C>A	ENSP00000406229:p.Asp2624Tyr	79.0	0.0	.		84.0	37.0	.	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612696	0.46631	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.74737	-0.87	5.2	5.2	0.72013	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.92675	0.7672	H	0.99090	4.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95297	0.8400	10	0.87932	D	0	.	19.2916	0.94102	0.0:1.0:0.0:0.0	.	2624	Q14517	FAT1_HUMAN	Y	2624;2626	ENSP00000406229:D2624Y	ENSP00000260147:D2626Y	D	-	1	0	FAT1	187776864	1.000000	0.71417	0.347000	0.25668	0.077000	0.17291	7.651000	0.83577	2.861000	0.98227	0.655000	0.94253	GAT	.	.	.	none		0.443	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FAT1	2195	hgsc.bcm.edu	37	4	187630250	187630250	+	Silent	SNP	C	C	A	rs374978739		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr4:187630250C>A	ENST00000441802.2	-	2	941	c.732G>T	c.(730-732)acG>acT	p.T244T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	244	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CGATGTGCACCGTTAGCTTGG	0.512										HNSCC(5;0.00058)																											p.T244T	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G732T						PASS	.						144.0	143.0	143.0					4																	187630250		2179	4286	6465	SO:0001819	synonymous_variant	2195	exon2			GTGCACCGTTAGC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.732G>T	chr4.hg19:g.187630250C>A		277.0	0.0	.		226.0	11.0	.	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.	.	alt		0.512	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PCDHB4	56131	hgsc.bcm.edu	37	5	140502471	140502471	+	Silent	SNP	G	G	T	rs375984500	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr5:140502471G>T	ENST00000194152.1	+	1	891	c.891G>T	c.(889-891)acG>acT	p.T297T	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	297	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGAAGTCACGGGAGAAATAC	0.358																																					p.T297T		Atlas-SNP	.											.	PCDHB4	177	.	0			c.G891T						PASS	.						86.0	103.0	97.0					5																	140502471		2197	4298	6495	SO:0001819	synonymous_variant	56131	exon1			AGTCACGGGAGAA	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.891G>T	chr5.hg19:g.140502471G>T		239.0	0.0	.		275.0	14.0	.	NM_018938	Q4V761	Silent	SNP	ENST00000194152.1	hg19	CCDS4246.1																																																																																			.	.	.	alt		0.358	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
ECT2L	345930	hgsc.bcm.edu	37	6	139167797	139167797	+	Silent	SNP	C	C	A	rs376022291		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr6:139167797C>A	ENST00000423192.1	+	7	1047	c.886C>A	c.(886-888)Cgg>Agg	p.R296R	ECT2L_ENST00000367682.2_Silent_p.R296R|ECT2L_ENST00000541398.1_Silent_p.R227R			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	296							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						AATATCATCCCGGATTCCTGC	0.383			"""N, Splice, Mis"""		ETP ALL																																p.R296R		Atlas-SNP	.		Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	.	ECT2L	75	.	0			c.C886A						PASS	.						227.0	218.0	221.0					6																	139167797		1940	4146	6086	SO:0001819	synonymous_variant	345930	exon7			TCATCCCGGATTC		CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.886C>A	chr6.hg19:g.139167797C>A		395.0	0.0	.		497.0	20.0	.	NM_001195037	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	ENST00000423192.1	hg19	CCDS43508.1																																																																																			.	.	.	alt		0.383	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042441.3	NM_001077706	
AKAP12	9590	hgsc.bcm.edu	37	6	151626981	151626981	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr6:151626981C>G	ENST00000253332.1	+	2	451	c.262C>G	c.(262-264)Ctg>Gtg	p.L88V	AKAP12_ENST00000402676.2_Missense_Mutation_p.L88V			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	88					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAAAGGAGCCCTGAACGGTCA	0.552																																					p.L88V	Melanoma(141;1616 1805 10049 24534 51979)	Atlas-SNP	.											.	AKAP12	170	.	0			c.C262G						PASS	.						53.0	46.0	49.0					6																	151626981		2203	4300	6503	SO:0001583	missense	9590	exon3			GGAGCCCTGAACG	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.262C>G	chr6.hg19:g.151626981C>G	ENSP00000253332:p.Leu88Val	48.0	0.0	.		34.0	13.0	.	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	ENST00000253332.1	hg19	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	C	0.285	-0.983780	0.02180	.	.	ENSG00000131016	ENST00000402676;ENST00000253332	T;T	0.08546	3.08;3.08	0.158	0.158	0.14942	.	.	.	.	.	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.48031	-0.9070	8	0.30854	T	0.27	.	.	.	.	.	88	Q02952	AKA12_HUMAN	V	88	ENSP00000384537:L88V;ENSP00000253332:L88V	ENSP00000253332:L88V	L	+	1	2	AKAP12	151668674	.	.	0.029000	0.17559	0.052000	0.14988	.	.	0.202000	0.20498	0.205000	0.17691	CTG	.	.	.	none		0.552	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
PGAM2	5224	hgsc.bcm.edu	37	7	44105125	44105125	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr7:44105125C>A	ENST00000297283.3	-	1	61	c.4G>T	c.(4-6)Gcc>Tcc	p.A2S	AC017116.11_ENST00000445938.1_RNA	NM_000290.3	NP_000281.2	P15259	PGAM2_HUMAN	phosphoglycerate mutase 2 (muscle)	2					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to mercury ion (GO:0046689)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|striated muscle contraction (GO:0006941)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase activity (GO:0046538)|bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|cofactor binding (GO:0048037)|phosphoglycerate mutase activity (GO:0004619)			large_intestine(2)|lung(4)|ovary(1)|stomach(1)	8						CGGTGAGTGGCCATGGTGGCA	0.607																																					p.A2S		Atlas-SNP	.											.	PGAM2	20	.	0			c.G4T						PASS	.						62.0	54.0	57.0					7																	44105125		2203	4300	6503	SO:0001583	missense	5224	exon1			GAGTGGCCATGGT		CCDS34624.1	7p13-p12	2008-11-17			ENSG00000164708	ENSG00000164708	5.4.2.1, 3.1.3.13, 5.4.2.4		8889	protein-coding gene	gene with protein product		612931					Standard	NM_000290		Approved	PGAM-M	uc003tjs.3	P15259	OTTHUMG00000155355	ENST00000297283.3:c.4G>T	chr7.hg19:g.44105125C>A	ENSP00000297283:p.Ala2Ser	136.0	0.0	.		107.0	38.0	.	NM_000290		Missense_Mutation	SNP	ENST00000297283.3	hg19	CCDS34624.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060303	0.36373	.	.	ENSG00000164708	ENST00000297283	T	0.80909	-1.43	5.93	-3.63	0.04529	.	0.487586	0.24258	N	0.040105	T	0.55162	0.1903	N	0.05554	-0.025	0.29035	N	0.885422	B	0.06786	0.001	B	0.10450	0.005	T	0.40979	-0.9534	10	0.45353	T	0.12	-11.1352	6.6092	0.22741	0.115:0.5762:0.2239:0.0848	.	2	P15259	PGAM2_HUMAN	S	2	ENSP00000297283:A2S	ENSP00000297283:A2S	A	-	1	0	PGAM2	44071650	0.648000	0.27313	0.979000	0.43373	0.986000	0.74619	-0.141000	0.10327	-0.536000	0.06298	0.650000	0.86243	GCC	.	.	.	none		0.607	PGAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339614.1		
TMED4	222068	hgsc.bcm.edu	37	7	44621125	44621125	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr7:44621125A>G	ENST00000457408.2	-	3	362	c.310T>C	c.(310-312)Tcc>Ccc	p.S104P	TMED4_ENST00000289577.5_Missense_Mutation_p.S104P|TMED4_ENST00000481238.1_Missense_Mutation_p.S104P|TMED4_ENST00000444131.2_5'UTR	NM_182547.2	NP_872353.2	Q7Z7H5	TMED4_HUMAN	transmembrane emp24 protein transport domain containing 4	104	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6						GGCGTGTGGGAGGTGAACGTG	0.557																																					p.S104P		Atlas-SNP	.											.	TMED4	13	.	0			c.T310C						PASS	.						89.0	89.0	89.0					7																	44621125		2203	4300	6503	SO:0001583	missense	222068	exon3			TGTGGGAGGTGAA	BC035467	CCDS5493.1	7p13	2004-12-21			ENSG00000158604	ENSG00000158604			22301	protein-coding gene	gene with protein product		612038				12761501	Standard	NM_182547		Approved	HNLF	uc003tli.3	Q7Z7H5	OTTHUMG00000129210	ENST00000457408.2:c.310T>C	chr7.hg19:g.44621125A>G	ENSP00000404042:p.Ser104Pro	85.0	0.0	.		76.0	41.0	.	NM_182547	A4D2K8|B4DFJ4|Q56VW3|Q7Z432|Q8N2P6	Missense_Mutation	SNP	ENST00000457408.2	hg19	CCDS5493.1	.	.	.	.	.	.	.	.	.	.	A	34	5.340815	0.95783	.	.	ENSG00000158604	ENST00000457408;ENST00000289577;ENST00000419520;ENST00000481238	T;T;T	0.18502	2.21;2.21;2.21	5.22	5.22	0.72569	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.93720	3.45	0.80722	D	1	D;D	0.76494	0.999;0.984	D;D	0.74348	0.983;0.962	T	0.63795	-0.6556	10	0.87932	D	0	-13.0927	13.1033	0.59233	1.0:0.0:0.0:0.0	.	104;104	Q7Z7H5-3;Q7Z7H5	.;TMED4_HUMAN	P	104;104;88;104	ENSP00000404042:S104P;ENSP00000289577:S104P;ENSP00000417443:S104P	ENSP00000289577:S104P	S	-	1	0	TMED4	44587650	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.944000	0.92980	2.191000	0.70037	0.533000	0.62120	TCC	.	.	.	none		0.557	TMED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251290.1	NM_182547	
ADAM28	10863	hgsc.bcm.edu	37	8	24209520	24209520	+	Silent	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr8:24209520T>C	ENST00000265769.4	+	21	2309	c.2199T>C	c.(2197-2199)caT>caC	p.H733H	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.C482R	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	733					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TGAAGCCCCATGTGTATGATC	0.378																																					p.H733H	NSCLC(193;488 2149 22258 34798 40734)	Atlas-SNP	.											.	ADAM28	100	.	0			c.T2199C						PASS	.						117.0	114.0	115.0					8																	24209520		2203	4300	6503	SO:0001819	synonymous_variant	10863	exon21			GCCCCATGTGTAT	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.2199T>C	chr8.hg19:g.24209520T>C		116.0	0.0	.		135.0	56.0	.	NM_014265	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	ENST00000265769.4	hg19	CCDS34865.1	.	.	.	.	.	.	.	.	.	.	T	7.970	0.748895	0.15710	.	.	ENSG00000042980	ENST00000397649;ENST00000521629	T	0.01745	4.66	4.14	-4.67	0.03319	.	.	.	.	.	T	0.01800	0.0057	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42189	-0.9466	6	0.87932	D	0	.	2.3577	0.04300	0.1532:0.4266:0.1567:0.2635	.	.	.	.	R	482;366	ENSP00000380770:C482R	ENSP00000380770:C482R	C	+	1	0	ADAM28	24265465	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.317000	0.01122	-0.875000	0.04022	-0.347000	0.07816	TGT	.	.	.	none		0.378	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
TTI2	80185	hgsc.bcm.edu	37	8	33369626	33369626	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr8:33369626C>A	ENST00000431156.2	-	2	1124	c.506G>T	c.(505-507)cGg>cTg	p.R169L	SNORD13_ENST00000459299.1_RNA|TTI2_ENST00000519356.1_5'Flank|TTI2_ENST00000360742.5_Missense_Mutation_p.R169L|TTI2_ENST00000520636.1_Missense_Mutation_p.R169L	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	169																	AGCAACTTCCCGAGATCTCGG	0.522																																					p.R169L		Atlas-SNP	.											.	.	.	.	0			c.G506T						PASS	.						149.0	145.0	147.0					8																	33369626		2203	4300	6503	SO:0001583	missense	80185	exon2			ACTTCCCGAGATC	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.506G>T	chr8.hg19:g.33369626C>A	ENSP00000411169:p.Arg169Leu	260.0	0.0	.		173.0	12.0	.	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	C	3.157	-0.172868	0.06421	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636;ENST00000520397	T;T;T	0.76839	-0.71;-0.71;-1.05	4.66	-6.22	0.02058	.	0.588907	0.13846	N	0.358711	T	0.65668	0.2713	L	0.31926	0.97	0.09310	N	1	B;B;B	0.16396	0.014;0.017;0.014	B;B;B	0.18561	0.019;0.022;0.013	T	0.42103	-0.9471	10	0.54805	T	0.06	-4.8077	16.956	0.86259	0.0:0.749:0.0:0.251	.	169;169;169	E5RH83;Q6NXR4;E5RIH5	.;TTI2_HUMAN;.	L	169	ENSP00000353971:R169L;ENSP00000411169:R169L;ENSP00000428401:R169L	ENSP00000353971:R169L	R	-	2	0	C8orf41	33489168	0.000000	0.05858	0.000000	0.03702	0.411000	0.31082	-1.676000	0.01946	-1.280000	0.02402	-0.136000	0.14681	CGG	.	.	.	none		0.522	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
XKR4	114786	hgsc.bcm.edu	37	8	56435874	56435874	+	Silent	SNP	C	C	G	rs4263738		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr8:56435874C>G	ENST00000327381.6	+	3	1141	c.1041C>G	c.(1039-1041)gcC>gcG	p.A347A	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	347						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGTCCCTGGCCTGGGCCTTGG	0.562																																					p.A347A		Atlas-SNP	.											.	XKR4	104	.	0			c.C1041G						PASS	.						62.0	57.0	59.0					8																	56435874		2203	4300	6503	SO:0001819	synonymous_variant	114786	exon3			CCTGGCCTGGGCC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1041C>G	chr8.hg19:g.56435874C>G		78.0	0.0	.		39.0	19.0	.	NM_052898	Q96PZ8	Silent	SNP	ENST00000327381.6	hg19	CCDS34893.1																																																																																			.	.	.	alt		0.562	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
HNF4G	3174	hgsc.bcm.edu	37	8	76465335	76465335	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr8:76465335T>C	ENST00000354370.1	+	6	677	c.407T>C	c.(406-408)aTt>aCt	p.I136T	HNF4G_ENST00000396423.2_Missense_Mutation_p.I173T			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	136					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			ATTGCAAGTATTGGTGATGTC	0.358																																					p.I173T		Atlas-SNP	.											.	HNF4G	111	.	0			c.T518C						PASS	.						120.0	109.0	113.0					8																	76465335		2203	4300	6503	SO:0001583	missense	3174	exon5			CAAGTATTGGTGA		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.407T>C	chr8.hg19:g.76465335T>C	ENSP00000346339:p.Ile136Thr	83.0	0.0	.		120.0	58.0	.	NM_004133	Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.96	3.517111	0.64634	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	D;D	0.94723	-3.5;-3.5	5.4	5.4	0.78164	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.102401	0.64402	D	0.000003	D	0.93769	0.8008	M	0.71036	2.16	0.58432	D	0.999998	B;B	0.10296	0.001;0.003	B;B	0.21151	0.02;0.033	D	0.91547	0.5254	10	0.66056	D	0.02	.	15.5943	0.76566	0.0:0.0:0.0:1.0	.	173;136	F1D8Q4;Q14541	.;HNF4G_HUMAN	T	136;173	ENSP00000346339:I136T;ENSP00000379701:I173T	ENSP00000346339:I136T	I	+	2	0	HNF4G	76627890	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	7.450000	0.80656	2.263000	0.75096	0.533000	0.62120	ATT	.	.	.	none		0.358	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133	
PTK2	5747	hgsc.bcm.edu	37	8	141745382	141745382	+	Silent	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr8:141745382C>T	ENST00000522684.1	-	22	2227	c.1998G>A	c.(1996-1998)cgG>cgA	p.R666R	PTK2_ENST00000535192.1_Silent_p.R666R|PTK2_ENST00000519465.1_Silent_p.R294R|PTK2_ENST00000538769.1_Silent_p.R334R|PTK2_ENST00000340930.3_Silent_p.R666R|PTK2_ENST00000521059.1_Silent_p.R666R|MIR151A_ENST00000521276.1_RNA|PTK2_ENST00000395218.2_Silent_p.R666R|PTK2_ENST00000517887.1_Silent_p.R710R|PTK2_ENST00000519419.1_Silent_p.R710R	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	666	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TAAACCTGGGCCGCCTGCTGG	0.532																																					p.R688R		Atlas-SNP	.											.	PTK2	311	.	0			c.G2064A						PASS	.						61.0	52.0	55.0					8																	141745382		2203	4300	6503	SO:0001819	synonymous_variant	5747	exon22			CCTGGGCCGCCTG	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1998G>A	chr8.hg19:g.141745382C>T		41.0	0.0	.		29.0	15.0	.	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	ENST00000522684.1	hg19	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	C	9.232	1.036008	0.19590	.	.	ENSG00000169398	ENST00000519654	.	.	.	5.51	3.39	0.38822	.	.	.	.	.	T	0.62171	0.2406	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60591	-0.7233	4	.	.	.	.	11.6247	0.51138	0.0:0.7826:0.0:0.2174	.	.	.	.	T	677	.	.	A	-	1	0	PTK2	141814564	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.429000	0.34903	1.340000	0.45581	-0.136000	0.14681	GCC	.	.	.	none		0.532	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
TBC1D13	54662	hgsc.bcm.edu	37	9	131565636	131565636	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr9:131565636C>G	ENST00000372648.5	+	8	801	c.651C>G	c.(649-651)atC>atG	p.I217M	TBC1D13_ENST00000466056.1_3'UTR|TBC1D13_ENST00000539497.1_Missense_Mutation_p.I36M|TBC1D13_ENST00000223865.8_Intron	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	217	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						TCCTGTTCATCTACGCCAAGC	0.552																																					p.I217M		Atlas-SNP	.											.	TBC1D13	27	.	0			c.C651G						PASS	.						151.0	121.0	131.0					9																	131565636		2203	4300	6503	SO:0001583	missense	54662	exon8			GTTCATCTACGCC	AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.651C>G	chr9.hg19:g.131565636C>G	ENSP00000361731:p.Ile217Met	109.0	0.0	.		65.0	34.0	.	NM_018201	A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Missense_Mutation	SNP	ENST00000372648.5	hg19	CCDS6911.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879150	0.72294	.	.	ENSG00000107021	ENST00000372648;ENST00000539497	T;T	0.12569	2.67;2.67	5.48	4.56	0.56223	Rab-GAP/TBC domain (4);	0.111120	0.64402	N	0.000011	T	0.29976	0.0750	M	0.78223	2.4	0.80722	D	1	D	0.55605	0.972	P	0.58721	0.844	T	0.02588	-1.1137	10	0.41790	T	0.15	-25.7081	8.7782	0.34776	0.0:0.769:0.1524:0.0786	.	217	Q9NVG8	TBC13_HUMAN	M	217;36	ENSP00000361731:I217M;ENSP00000437751:I36M	ENSP00000361731:I217M	I	+	3	3	TBC1D13	130605457	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	4.786000	0.62425	1.253000	0.44018	0.655000	0.94253	ATC	.	.	.	none		0.552	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054496.1	NM_018201	
MCM10	55388	hgsc.bcm.edu	37	10	13222572	13222572	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr10:13222572A>C	ENST00000484800.2	+	7	1001	c.898A>C	c.(898-900)Ata>Cta	p.I300L	MCM10_ENST00000378694.1_Missense_Mutation_p.I299L|MCM10_ENST00000378714.3_Missense_Mutation_p.I299L			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	300	OB-fold domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						ATTTGGGGTTATATTGAAGAA	0.423																																					p.I300L		Atlas-SNP	.											.	MCM10	76	.	0			c.A898C						PASS	.						232.0	230.0	231.0					10																	13222572		2203	4300	6503	SO:0001583	missense	55388	exon7			GGGGTTATATTGA	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.898A>C	chr10.hg19:g.13222572A>C	ENSP00000418268:p.Ile300Leu	182.0	0.0	.		192.0	88.0	.	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	hg19	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.422993	0.25639	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.16073	2.38;2.37;2.37	5.82	5.82	0.92795	.	0.103877	0.64402	D	0.000003	T	0.16257	0.0391	N	0.26042	0.785	0.53688	D	0.999971	B;B;B	0.22683	0.037;0.073;0.008	B;B;B	0.30029	0.061;0.11;0.041	T	0.05683	-1.0870	10	0.36615	T	0.2	-11.6005	16.1814	0.81903	1.0:0.0:0.0:0.0	.	299;299;300	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	L	299;300;300;299	ENSP00000367986:I299L;ENSP00000418268:I300L;ENSP00000367966:I299L	ENSP00000354945:I300L	I	+	1	0	MCM10	13262578	1.000000	0.71417	0.940000	0.37924	0.594000	0.36715	4.284000	0.58983	2.234000	0.73211	0.533000	0.62120	ATA	.	.	.	none		0.423	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
CCDC7	79741	hgsc.bcm.edu	37	10	33134884	33134884	+	Silent	SNP	C	C	A	rs201575874	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr10:33134884C>A	ENST00000375030.2	+	17	1825	c.1207C>A	c.(1207-1209)Cga>Aga	p.R403R	C10orf68_ENST00000375028.3_Silent_p.R448R|C10orf68_ENST00000375025.4_Silent_p.R508R			Q9H943	CJ068_HUMAN		444								p.R444R(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						GAAGAGTCACCGAGGTAAGAG	0.333																																					p.R444R		Atlas-SNP	.											.	C10orf68	75	.	1	Substitution - coding silent(1)	lung(1)	c.C1330A						PASS	.						70.0	82.0	78.0					10																	33134884		2202	4295	6497	SO:0001819	synonymous_variant	79741	exon16			AGTCACCGAGGTA																												ENST00000375030.2:c.1207C>A	chr10.hg19:g.33134884C>A		219.0	0.0	.		297.0	14.0	.	NM_024688	B0QZ71|Q08AN7|Q8N7T7	Silent	SNP	ENST00000375030.2	hg19																																																																																				.	C|1.000;T|0.000	.	alt		0.333	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000313999.2		
BMS1	9790	hgsc.bcm.edu	37	10	43315762	43315762	+	Missense_Mutation	SNP	C	C	A	rs397839854		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr10:43315762C>A	ENST00000374518.5	+	16	2722	c.2659C>A	c.(2659-2661)Cgc>Agc	p.R887S		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	887					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						GATGTACGTCCGCATTGAGAT	0.458																																					p.R887S		Atlas-SNP	.											BMS1,colon,carcinoma,-1,1	BMS1	132	.	0			c.C2659A						PASS	.						135.0	131.0	132.0					10																	43315762		2203	4300	6503	SO:0001583	missense	9790	exon16			TACGTCCGCATTG	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2659C>A	chr10.hg19:g.43315762C>A	ENSP00000363642:p.Arg887Ser	158.0	0.0	.		130.0	7.0	.	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075513	0.76415	.	.	ENSG00000165733	ENST00000374518	T	0.19669	2.13	5.05	5.05	0.67936	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58047	0.2095	M	0.92459	3.31	0.58432	D	0.999998	D	0.76494	0.999	D	0.87578	0.998	T	0.69363	-0.5165	10	0.59425	D	0.04	.	18.4608	0.90737	0.0:1.0:0.0:0.0	.	887	Q14692	BMS1_HUMAN	S	887	ENSP00000363642:R887S	ENSP00000363642:R887S	R	+	1	0	BMS1	42635768	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.662000	0.61525	2.352000	0.79861	0.454000	0.30748	CGC	.	.	.	none		0.458	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
PCBD1	5092	hgsc.bcm.edu	37	10	72643783	72643783	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr10:72643783T>C	ENST00000299299.3	-	4	489	c.239A>G	c.(238-240)cAt>cGt	p.H80R	PCBD1_ENST00000493228.1_5'UTR	NM_000281.2	NP_000272.1	P61457	PHS_HUMAN	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha	80	Substrate binding. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein homotetramerization (GO:0051289)|regulation of protein homodimerization activity (GO:0043496)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	4-alpha-hydroxytetrahydrobiopterin dehydratase activity (GO:0008124)|identical protein binding (GO:0042802)|phenylalanine 4-monooxygenase activity (GO:0004505)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|large_intestine(1)	4						GGCACACTCATGGGTGCTCAG	0.512																																					p.H80R		Atlas-SNP	.											.	PCBD1	8	.	0			c.A239G						PASS	.						94.0	76.0	82.0					10																	72643783		2203	4300	6503	SO:0001583	missense	5092	exon4			CACTCATGGGTGC	BC006324	CCDS31217.1	10q22	2014-04-01	2007-11-06	2005-02-11	ENSG00000166228	ENSG00000166228	4.2.1.96		8646	protein-coding gene	gene with protein product	"""Pterin-4a-carbinolamine dehydratase (dimerization cofactor of hepatic nuclear factor 1-alpha)"", ""pterin-4-alpha carbinolamine dehydratase"", ""dimerizing cofactor for HNF1"""	126090	"""6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)"", ""pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)"""	DCOH, PCBD		8486378	Standard	XM_005269877		Approved	PCD	uc001jrn.1	P61457	OTTHUMG00000018417	ENST00000299299.3:c.239A>G	chr10.hg19:g.72643783T>C	ENSP00000299299:p.His80Arg	62.0	0.0	.		61.0	20.0	.	NM_000281	P70519|P80095|Q9D930	Missense_Mutation	SNP	ENST00000299299.3	hg19	CCDS31217.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375645	0.61735	.	.	ENSG00000166228	ENST00000299299	D	0.92752	-3.1	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.97801	0.9278	H	0.98333	4.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99478	1.0947	10	0.87932	D	0	.	15.9584	0.79906	0.0:0.0:0.0:1.0	.	80	P61457	PHS_HUMAN	R	80	ENSP00000299299:H80R	ENSP00000299299:H80R	H	-	2	0	PCBD1	72313789	1.000000	0.71417	0.978000	0.43139	0.159000	0.22180	7.474000	0.81024	2.165000	0.68154	0.528000	0.53228	CAT	.	.	.	none		0.512	PCBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048527.1	NM_000281	
TSG101	7251	hgsc.bcm.edu	37	11	18505434	18505434	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr11:18505434G>T	ENST00000251968.3	-	8	1241	c.826C>A	c.(826-828)Cgt>Agt	p.R276S	TSG101_ENST00000536719.1_Missense_Mutation_p.R276S|TSG101_ENST00000357193.3_Missense_Mutation_p.R171S	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	276					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.R276S(2)|p.R276C(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						TGATCTAAACGGGTAACCATC	0.423																																					p.R276S	GBM(99;1348 1396 8611 26475 50572)	Atlas-SNP	.											TSG101,NS,carcinoma,0,1	TSG101	43	.	3	Substitution - Missense(3)	lung(2)|prostate(1)	c.C826A						PASS	.						188.0	186.0	187.0					11																	18505434		2199	4293	6492	SO:0001583	missense	7251	exon8			CTAAACGGGTAAC	U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.826C>A	chr11.hg19:g.18505434G>T	ENSP00000251968:p.Arg276Ser	321.0	1.0	.		291.0	12.0	.	NM_006292	Q9BUM5	Missense_Mutation	SNP	ENST00000251968.3	hg19	CCDS7842.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730672	0.48939	.	.	ENSG00000074319	ENST00000536719;ENST00000251968;ENST00000357193	T;T;T	0.22539	1.95;1.95;1.95	5.46	5.46	0.80206	.	0.054589	0.64402	D	0.000001	T	0.28599	0.0708	M	0.79926	2.475	0.51233	D	0.999916	B	0.21071	0.051	B	0.14023	0.01	T	0.14504	-1.0470	10	0.14656	T	0.56	-5.396	17.4765	0.87660	0.0:0.0:1.0:0.0	.	276	Q99816	TS101_HUMAN	S	276;276;171	ENSP00000438471:R276S;ENSP00000251968:R276S;ENSP00000349721:R171S	ENSP00000251968:R276S	R	-	1	0	TSG101	18462010	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.714000	0.68422	2.561000	0.86390	0.462000	0.41574	CGT	.	.	.	none		0.423	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292	
OR4C13	283092	hgsc.bcm.edu	37	11	49974076	49974076	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr11:49974076C>A	ENST00000555099.1	+	1	134	c.102C>A	c.(100-102)atC>atA	p.I34I		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TCATCTACATCAACGCCATGA	0.413																																					p.I34I		Atlas-SNP	.											.	OR4C13	96	.	0			c.C102A						PASS	.						206.0	190.0	195.0					11																	49974076		2201	4296	6497	SO:0001819	synonymous_variant	283092	exon1			CTACATCAACGCC	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.102C>A	chr11.hg19:g.49974076C>A		299.0	0.0	.		307.0	35.0	.	NM_001001955	A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	hg19	CCDS31495.1																																																																																			.	.	.	none		0.413	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
FAT3	120114	hgsc.bcm.edu	37	11	92086947	92086947	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr11:92086947C>A	ENST00000298047.6	+	1	1686	c.1669C>A	c.(1669-1671)Cgc>Agc	p.R557S	FAT3_ENST00000541502.1_Missense_Mutation_p.R557S|FAT3_ENST00000525166.1_Missense_Mutation_p.R407S|FAT3_ENST00000409404.2_Missense_Mutation_p.R557S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTCACCATACCGCCATGAAAG	0.418										TCGA Ovarian(4;0.039)																											p.R557S		Atlas-SNP	.											FAT3_ENST00000409404,right_upper_lobe,carcinoma,0,2	FAT3	1822	.	0			c.C1669A						PASS	.						80.0	81.0	80.0					11																	92086947		1845	4102	5947	SO:0001583	missense	120114	exon1			CCATACCGCCATG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1669C>A	chr11.hg19:g.92086947C>A	ENSP00000298047:p.Arg557Ser	153.0	0.0	.		149.0	7.0	.	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	C	14.21	2.466335	0.43839	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.82	5.82	0.92795	.	.	.	.	.	T	0.58119	0.2100	L	0.27053	0.805	0.48975	D	0.999731	D	0.89917	1.0	D	0.91635	0.999	T	0.53767	-0.8392	9	0.34782	T	0.22	.	19.0792	0.93175	0.0:1.0:0.0:0.0	.	557	Q8TDW7-3	.	S	557;557;557;407	ENSP00000298047:R557S;ENSP00000387040:R557S;ENSP00000443786:R557S;ENSP00000432586:R407S	ENSP00000298047:R557S	R	+	1	0	FAT3	91726595	1.000000	0.71417	0.997000	0.53966	0.585000	0.36419	6.184000	0.72008	2.755000	0.94549	0.591000	0.81541	CGC	.	.	.	none		0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
HEBP1	50865	hgsc.bcm.edu	37	12	13140120	13140120	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:13140120T>C	ENST00000014930.4	-	3	522	c.364A>G	c.(364-366)Att>Gtt	p.I122V	HEBP1_ENST00000536942.1_Missense_Mutation_p.I122V|RP11-392P7.6_ENST00000499948.2_RNA	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	122					circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		CGTTCCTCAATCTTAACGCTT	0.483																																					p.I122V		Atlas-SNP	.											.	HEBP1	16	.	0			c.A364G						PASS	.						179.0	158.0	165.0					12																	13140120		2203	4300	6503	SO:0001583	missense	50865	exon3			CCTCAATCTTAAC	AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771	ENST00000014930.4:c.364A>G	chr12.hg19:g.13140120T>C	ENSP00000014930:p.Ile122Val	211.0	0.0	.		187.0	75.0	.	NM_015987	A8K1G2|Q9Y5Z5	Missense_Mutation	SNP	ENST00000014930.4	hg19	CCDS31749.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.631678	0.29068	.	.	ENSG00000013583	ENST00000014930;ENST00000535636;ENST00000536942	T;T;T	0.25579	1.79;1.79;1.79	5.66	4.45	0.53987	Regulatory factor, effector, bacterial (1);	0.047188	0.85682	D	0.000000	T	0.33527	0.0866	M	0.77313	2.365	0.47737	D	0.9995	B	0.22746	0.074	B	0.32762	0.152	T	0.12192	-1.0557	10	0.27082	T	0.32	-5.125	12.5735	0.56352	0.1242:0.0:0.0:0.8758	.	122	Q9NRV9	HEBP1_HUMAN	V	122;51;122	ENSP00000014930:I122V;ENSP00000442020:I51V;ENSP00000441678:I122V	ENSP00000014930:I122V	I	-	1	0	HEBP1	13031387	1.000000	0.71417	0.882000	0.34594	0.210000	0.24377	3.727000	0.54984	2.283000	0.76528	0.533000	0.62120	ATT	.	.	.	none		0.483	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401001.1		
PPFIBP1	8496	hgsc.bcm.edu	37	12	27809595	27809595	+	Missense_Mutation	SNP	A	A	C	rs369414467		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:27809595A>C	ENST00000318304.8	+	10	1119	c.836A>C	c.(835-837)gAa>gCa	p.E279A	PPFIBP1_ENST00000537927.1_Missense_Mutation_p.E126A|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.E248A|PPFIBP1_ENST00000542629.1_Missense_Mutation_p.E248A	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	279					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					AAGGAATCTGAAGTAAAAAGG	0.313																																					p.E279A		Atlas-SNP	.											.	PPFIBP1	153	.	0			c.A836C						PASS	.						73.0	76.0	75.0					12																	27809595		2203	4299	6502	SO:0001583	missense	8496	exon10			AATCTGAAGTAAA	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.836A>C	chr12.hg19:g.27809595A>C	ENSP00000314724:p.Glu279Ala	113.0	0.0	.		176.0	79.0	.	NM_177444	O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	hg19	CCDS55812.1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.699998	0.48307	.	.	ENSG00000110841	ENST00000543820;ENST00000545381;ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425	T;T;T;T;T;T	0.59083	0.29;0.62;0.71;1.19;1.2;1.61	5.05	5.05	0.67936	.	0.000000	0.35151	U	0.003420	T	0.56645	0.1999	L	0.38953	1.18	0.41614	D	0.988929	P;B;P;B	0.44776	0.828;0.044;0.843;0.073	P;B;B;B	0.49477	0.612;0.027;0.384;0.06	T	0.57940	-0.7724	10	0.42905	T	0.14	-26.9289	13.3332	0.60500	1.0:0.0:0.0:0.0	.	126;279;248;248	Q86W92-3;Q86W92;Q86W92-2;Q86W92-4	.;LIPB1_HUMAN;.;.	A	250;248;107;126;279;248;248	ENSP00000445822:E248A;ENSP00000444304:E107A;ENSP00000445425:E126A;ENSP00000314724:E279A;ENSP00000443442:E248A;ENSP00000228425:E248A	ENSP00000228425:E248A	E	+	2	0	PPFIBP1	27700862	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	6.463000	0.73530	2.022000	0.59522	0.533000	0.62120	GAA	.	.	.	alt		0.313	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
GPD1	2819	hgsc.bcm.edu	37	12	50503242	50503242	+	Nonsense_Mutation	SNP	C	C	G	rs116736822	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:50503242C>G	ENST00000301149.3	+	8	1222	c.990C>G	c.(988-990)taC>taG	p.Y330*	COX14_ENST00000317943.2_5'Flank|GPD1_ENST00000548814.1_Nonsense_Mutation_p.Y307*|COX14_ENST00000550487.1_5'Flank|COX14_ENST00000550654.1_5'Flank|COX14_ENST00000548985.1_5'Flank|RP4-605O3.4_ENST00000552815.1_RNA	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	330					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						AGGTGTGCTACGAGGGCCAGC	0.577																																					p.Y330X	NSCLC(141;1402 1905 9497 13391 44868)	Atlas-SNP	.											.	GPD1	23	.	0			c.C990G						PASS	.						139.0	108.0	118.0					12																	50503242		2203	4300	6503	SO:0001587	stop_gained	2819	exon8			GTGCTACGAGGGC		CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.990C>G	chr12.hg19:g.50503242C>G	ENSP00000301149:p.Tyr330*	135.0	0.0	.		87.0	26.0	.	NM_005276	F8W1L5|Q8N1B0	Nonsense_Mutation	SNP	ENST00000301149.3	hg19	CCDS8799.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796601	0.90453	.	.	ENSG00000167588	ENST00000301149;ENST00000548814	.	.	.	4.99	-5.7	0.02421	.	0.125588	0.53938	D	0.000044	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4578	14.9665	0.71198	0.0:0.6296:0.0:0.3704	.	.	.	.	X	330;307	.	ENSP00000301149:Y330X	Y	+	3	2	GPD1	48789509	0.008000	0.16893	0.884000	0.34674	0.899000	0.52679	-0.879000	0.04188	-1.358000	0.02177	-0.379000	0.06801	TAC	.	C|0.998;T|0.002	.	alt		0.577	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406018.1		
LRIG3	121227	hgsc.bcm.edu	37	12	59271290	59271290	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:59271290C>A	ENST00000320743.3	-	15	2714	c.2428G>T	c.(2428-2430)Gtc>Ttc	p.V810F	LRIG3_ENST00000379141.4_Missense_Mutation_p.V750F	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	810					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			ATGATCACGACACCCACAGTG	0.562			T	ROS1	NSCLC																																p.V810F		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.G2428T						PASS	.						212.0	121.0	152.0					12																	59271290		2203	4300	6503	SO:0001583	missense	121227	exon15			TCACGACACCCAC	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.2428G>T	chr12.hg19:g.59271290C>A	ENSP00000326759:p.Val810Phe	98.0	0.0	.		61.0	39.0	.	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.675366	0.47781	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.61040	0.18;0.14	5.59	3.74	0.42951	.	0.494270	0.15041	N	0.283853	T	0.47414	0.1444	L	0.47716	1.5	0.39938	D	0.974378	P;P	0.39665	0.682;0.624	B;B	0.37508	0.252;0.154	T	0.36212	-0.9757	9	.	.	.	.	8.2502	0.31712	0.0:0.6658:0.0:0.3342	.	750;810	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	F	750;810	ENSP00000368436:V750F;ENSP00000326759:V810F	.	V	-	1	0	LRIG3	57557557	1.000000	0.71417	0.987000	0.45799	0.819000	0.46315	2.549000	0.45803	0.796000	0.33947	0.655000	0.94253	GTC	.	.	.	none		0.562	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
PLXNC1	10154	hgsc.bcm.edu	37	12	94613897	94613897	+	Silent	SNP	C	C	A	rs146510015		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:94613897C>A	ENST00000258526.4	+	6	1909	c.1660C>A	c.(1660-1662)Cgg>Agg	p.R554R		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	554					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.R554R(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TCAGCCCAACCGGACCTGCAC	0.458																																					p.R554R		Atlas-SNP	.											PLXNC1,NS,carcinoma,0,1	PLXNC1	135	.	2	Substitution - coding silent(2)	lung(2)	c.C1660A						PASS	.						147.0	156.0	153.0					12																	94613897		2203	4300	6503	SO:0001819	synonymous_variant	10154	exon6			CCCAACCGGACCT	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1660C>A	chr12.hg19:g.94613897C>A		338.0	0.0	.		197.0	15.0	.	NM_005761	Q59H25	Silent	SNP	ENST00000258526.4	hg19	CCDS9049.1																																																																																			.	C|1.000;T|0.000	.	alt		0.458	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
ANKRD13A	88455	hgsc.bcm.edu	37	12	110457067	110457067	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:110457067T>C	ENST00000261739.4	+	6	834	c.668T>C	c.(667-669)gTt>gCt	p.V223A	ANKRD13A_ENST00000550404.1_3'UTR	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	223						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						AGCAGGGAAGTTGAGCGGCGG	0.438																																					p.V223A		Atlas-SNP	.											.	ANKRD13A	39	.	0			c.T668C						PASS	.						76.0	76.0	76.0					12																	110457067		2203	4300	6503	SO:0001583	missense	88455	exon6			GGGAAGTTGAGCG	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.668T>C	chr12.hg19:g.110457067T>C	ENSP00000261739:p.Val223Ala	114.0	0.0	.		92.0	39.0	.	NM_033121	O60736	Missense_Mutation	SNP	ENST00000261739.4	hg19	CCDS9140.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543716	0.65198	.	.	ENSG00000076513	ENST00000261738;ENST00000261739	T	0.65364	-0.15	5.83	5.83	0.93111	.	0.052948	0.85682	D	0.000000	T	0.73567	0.3603	M	0.72894	2.215	0.80722	D	1	D;D;D	0.56746	0.977;0.977;0.977	P;P;P	0.55011	0.766;0.766;0.766	T	0.77107	-0.2710	10	0.72032	D	0.01	-13.8298	15.3732	0.74584	0.0:0.0:0.0:1.0	.	223;223;223	B4DYP5;Q3ZTS7;Q8IZ07	.;.;AN13A_HUMAN	A	8;223	ENSP00000261739:V223A	ENSP00000261738:V8A	V	+	2	0	ANKRD13A	108941450	1.000000	0.71417	0.945000	0.38365	0.982000	0.71751	6.241000	0.72369	2.229000	0.72834	0.482000	0.46254	GTT	.	.	.	none		0.438	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
SBNO1	55206	hgsc.bcm.edu	37	12	123780521	123780521	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:123780521C>A	ENST00000602398.1	-	32	4243	c.4116G>T	c.(4114-4116)gcG>gcT	p.A1372A	SBNO1_ENST00000420886.2_Silent_p.A1372A|SBNO1_ENST00000602750.1_Silent_p.A1371A|SBNO1_ENST00000267176.4_Silent_p.A1371A			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1372					regulation of transcription, DNA-templated (GO:0006355)			p.A1371A(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TCTGTTGGACCGCAAGCTGTT	0.428																																					p.A1372A		Atlas-SNP	.											.	SBNO1	138	.	1	Substitution - coding silent(1)	lung(1)	c.G4116T						PASS	.						350.0	312.0	325.0					12																	123780521		2203	4300	6503	SO:0001819	synonymous_variant	55206	exon31			TTGGACCGCAAGC	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.4116G>T	chr12.hg19:g.123780521C>A		367.0	0.0	.		297.0	15.0	.	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	ENST00000602398.1	hg19	CCDS53844.1																																																																																			.	.	.	none		0.428	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
TMEM260	54916	hgsc.bcm.edu	37	14	57075923	57075923	+	Silent	SNP	C	C	A	rs140983222		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr14:57075923C>A	ENST00000261556.6	+	6	858	c.736C>A	c.(736-738)Cgg>Agg	p.R246R	TMEM260_ENST00000538838.1_Silent_p.R246R|TMEM260_ENST00000536419.1_5'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	246						integral component of membrane (GO:0016021)											TAATCACGCCCGGTGGACCTG	0.483																																					p.R246R		Atlas-SNP	.											.	.	.	.	0			c.C736A						PASS	.						207.0	199.0	202.0					14																	57075923		2203	4300	6503	SO:0001819	synonymous_variant	0	exon6			CACGCCCGGTGGA	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.736C>A	chr14.hg19:g.57075923C>A		497.0	0.0	.		311.0	14.0	.	NM_017799	A8KAN4|B3KPF5|Q86XE1	Silent	SNP	ENST00000261556.6	hg19	CCDS9727.2																																																																																			.	C|1.000;T|0.000	.	alt		0.483	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
SIX4	51804	hgsc.bcm.edu	37	14	61190290	61190290	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr14:61190290A>C	ENST00000216513.4	-	1	562	c.503T>G	c.(502-504)aTc>aGc	p.I168S		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	168					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GCTCTCGAGGATGCTGTAGAG	0.692																																					p.I168S		Atlas-SNP	.											.	SIX4	69	.	0			c.T503G						PASS	.						13.0	14.0	14.0					14																	61190290		2190	4286	6476	SO:0001583	missense	51804	exon1			TCGAGGATGCTGT	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.503T>G	chr14.hg19:g.61190290A>C	ENSP00000216513:p.Ile168Ser	26.0	0.0	.		20.0	9.0	.	NM_017420	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	hg19	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793861	0.70452	.	.	ENSG00000100625	ENST00000216513;ENST00000556952	D	0.94046	-3.34	3.63	3.63	0.41609	.	0.265948	0.36591	N	0.002504	D	0.93086	0.7799	M	0.70842	2.15	0.58432	D	0.999997	P;D	0.53312	0.84;0.959	P;P	0.47346	0.537;0.544	D	0.93446	0.6798	10	0.87932	D	0	.	12.4167	0.55498	1.0:0.0:0.0:0.0	.	160;168	G3V2N2;Q9UIU6	.;SIX4_HUMAN	S	168;160	ENSP00000216513:I168S	ENSP00000216513:I168S	I	-	2	0	SIX4	60260043	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.828000	0.92047	1.508000	0.48769	0.528000	0.53228	ATC	.	.	.	none		0.692	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
IREB2	3658	hgsc.bcm.edu	37	15	78765688	78765688	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr15:78765688G>A	ENST00000258886.8	+	8	1137	c.988G>A	c.(988-990)Gtt>Att	p.V330I	IREB2_ENST00000560440.1_Missense_Mutation_p.V330I	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	330					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		AAACCCTTTTGTTACATCCAT	0.373																																					p.V330I	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.G988A						PASS	.						223.0	207.0	212.0					15																	78765688		2196	4293	6489	SO:0001583	missense	3658	exon8			CCTTTTGTTACAT	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.988G>A	chr15.hg19:g.78765688G>A	ENSP00000258886:p.Val330Ile	115.0	0.0	.		106.0	48.0	.	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	hg19	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689480	0.48097	.	.	ENSG00000136381	ENST00000258886	T	0.23754	1.89	5.93	5.93	0.95920	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (1);	0.252836	0.46442	D	0.000283	T	0.24928	0.0605	L	0.43646	1.37	0.27813	N	0.942089	B;B	0.20164	0.003;0.042	B;B	0.23150	0.032;0.044	T	0.26744	-1.0094	10	0.07813	T	0.8	.	20.3334	0.98727	0.0:0.0:1.0:0.0	.	330;330	P48200;Q8WVK6	IREB2_HUMAN;.	I	330	ENSP00000258886:V330I	ENSP00000258886:V330I	V	+	1	0	IREB2	76552743	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.095000	0.64529	2.818000	0.97014	0.591000	0.81541	GTT	.	.	.	none		0.373	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
STX4	6810	hgsc.bcm.edu	37	16	31046334	31046334	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr16:31046334C>A	ENST00000313843.3	+	5	666	c.351C>A	c.(349-351)tcC>tcA	p.S117S	STX4_ENST00000493902.1_3'UTR|STX4_ENST00000394998.1_Silent_p.S115S	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4	117					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)				NS(2)|breast(1)|large_intestine(3)|lung(3)	9						ACTATAACTCCGTCAACACAA	0.423																																					p.S117S		Atlas-SNP	.											.	STX4	28	.	0			c.C351A						PASS	.						78.0	85.0	83.0					16																	31046334		2197	4300	6497	SO:0001819	synonymous_variant	6810	exon5			TAACTCCGTCAAC	AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404	ENST00000313843.3:c.351C>A	chr16.hg19:g.31046334C>A		169.0	0.0	.		220.0	9.0	.	NM_004604	A8MXY0|Q15525|Q6FHE8	Silent	SNP	ENST00000313843.3	hg19	CCDS10700.1																																																																																			.	.	.	none		0.423	STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255538.3	NM_004604	
CES3	23491	hgsc.bcm.edu	37	16	67000741	67000741	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr16:67000741C>A	ENST00000303334.4	+	8	1106	c.1035C>A	c.(1033-1035)aaC>aaA	p.N345K	CES3_ENST00000394037.1_Missense_Mutation_p.N345K|CES3_ENST00000543856.1_5'Flank	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	345						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		GTGTCAACAACCATGAGTTCA	0.582																																					p.N345K		Atlas-SNP	.											.	CES3	56	.	0			c.C1035A						PASS	.						134.0	131.0	132.0					16																	67000741		2200	4300	6500	SO:0001583	missense	23491	exon8			CAACAACCATGAG	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1035C>A	chr16.hg19:g.67000741C>A	ENSP00000304782:p.Asn345Lys	248.0	0.0	.		223.0	85.0	.	NM_024922	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	hg19	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991536	0.35131	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.65549	-0.16;-0.16	3.97	-2.89	0.05665	Carboxylesterase, type B (1);	0.000000	0.43579	D	0.000560	T	0.40862	0.1134	N	0.20610	0.595	0.80722	D	1	P	0.37207	0.587	B	0.41174	0.349	T	0.33650	-0.9860	10	0.08179	T	0.78	.	11.2659	0.49110	0.0:0.6915:0.0:0.3085	.	345	Q6UWW8	EST3_HUMAN	K	345	ENSP00000304782:N345K;ENSP00000377602:N345K	ENSP00000304782:N345K	N	+	3	2	CES3	65558242	0.304000	0.24472	0.647000	0.29507	0.123000	0.20343	-0.234000	0.09028	-0.385000	0.07833	-0.809000	0.03173	AAC	.	.	.	none		0.582	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
FAM65A	79567	hgsc.bcm.edu	37	16	67576026	67576026	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr16:67576026G>A	ENST00000379312.3	+	13	1470	c.1349G>A	c.(1348-1350)cGg>cAg	p.R450Q	FAM65A_ENST00000422602.2_Missense_Mutation_p.R466Q|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.R446Q|FAM65A_ENST00000540839.3_Missense_Mutation_p.R466Q|CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.R460Q	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	450						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CCCTACAGTCGGACTCTGAGC	0.632																																					p.R466Q		Atlas-SNP	.											.	FAM65A	104	.	0			c.G1397A						PASS	.						75.0	71.0	72.0					16																	67576026		2198	4300	6498	SO:0001583	missense	79567	exon13			ACAGTCGGACTCT	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1349G>A	chr16.hg19:g.67576026G>A	ENSP00000368614:p.Arg450Gln	139.0	0.0	.		155.0	35.0	.	NM_001193523	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	hg19	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517558	0.85495	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.32753	1.44;1.44;1.44	4.62	4.62	0.57501	.	0.467258	0.23181	N	0.051009	T	0.50137	0.1598	L	0.57536	1.79	0.54753	D	0.999984	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.39187	-0.9626	10	0.14252	T	0.57	-16.318	17.523	0.87792	0.0:0.0:1.0:0.0	.	460;466;450;466	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.;.;FA65A_HUMAN;.	Q	450;446;466;460	ENSP00000368614:R450Q;ENSP00000042381:R446Q;ENSP00000400099:R466Q	ENSP00000042381:R446Q	R	+	2	0	FAM65A	66133527	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.569000	0.82380	2.149000	0.67028	0.442000	0.29010	CGG	.	.	.	none		0.632	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
CHMP1A	5119	hgsc.bcm.edu	37	16	89717999	89717999	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr16:89717999G>C	ENST00000397901.3	-	3	339	c.83C>G	c.(82-84)gCg>gGg	p.A28G	CHMP1A_ENST00000547614.1_5'UTR|CHMP1A_ENST00000550102.1_Missense_Mutation_p.A28G|CHMP1A_ENST00000253475.5_Silent_p.G21G|CHMP1A_ENST00000535997.2_5'UTR	NM_002768.3	NP_002759.2	Q9HD42	CHM1A_HUMAN	charged multivesicular body protein 1A	28					cytokinesis (GO:0000910)|gene silencing (GO:0016458)|mitotic chromosome condensation (GO:0007076)|negative regulation of transcription by glucose (GO:0045014)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|proteolysis (GO:0006508)|transcription, DNA-templated (GO:0006351)|vesicle-mediated transport (GO:0016192)	condensed nuclear chromosome (GO:0000794)|early endosome (GO:0005769)|endomembrane system (GO:0012505)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|nuclear matrix (GO:0016363)	metallopeptidase activity (GO:0008237)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|ovary(1)	3		all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.048)		GGCCTGCTCCGCCTTGGAGTC	0.572																																					p.A28G		Atlas-SNP	.											.	CHMP1A	15	.	0			c.C83G						PASS	.						76.0	85.0	82.0					16																	89717999		2034	4180	6214	SO:0001583	missense	5119	exon3			TGCTCCGCCTTGG	U58048	CCDS45552.1	16q24.3	2011-09-21	2011-09-21	2007-03-20	ENSG00000131165	ENSG00000131165		"""Charged multivesicular body proteins"""	8740	protein-coding gene	gene with protein product		164010	"""procollagen (type III) N-endopeptidase"", ""chromatin modifying protein 1A"""	PRSM1, PCOLN3		11559748, 11559747	Standard	NM_002768		Approved	KIAA0047, CHMP1, Vps46A	uc002fnu.4	Q9HD42	OTTHUMG00000169521	ENST00000397901.3:c.83C>G	chr16.hg19:g.89717999G>C	ENSP00000380998:p.Ala28Gly	89.0	0.0	.		75.0	43.0	.	NM_002768	A2RU09|Q14468|Q15779|Q96G31	Missense_Mutation	SNP	ENST00000397901.3	hg19	CCDS45552.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467907	0.43839	.	.	ENSG00000131165	ENST00000397901;ENST00000550102	T;T	0.72505	-0.66;-0.66	4.81	2.69	0.31865	.	.	.	.	.	T	0.55768	0.1941	.	.	.	0.80722	D	1	B	0.15141	0.012	B	0.23419	0.046	T	0.46233	-0.9206	7	.	.	.	-3.1301	9.7579	0.40515	0.0779:0.141:0.7812:0.0	.	28	Q9HD42	CHM1A_HUMAN	G	28	ENSP00000380998:A28G;ENSP00000449243:A28G	.	A	-	2	0	CHMP1A	88245500	1.000000	0.71417	0.633000	0.29310	0.764000	0.43329	5.816000	0.69222	1.132000	0.42129	0.655000	0.94253	GCG	.	.	.	none		0.572	CHMP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404581.1	NM_002768	
FANCA	2175	hgsc.bcm.edu	37	16	89874755	89874755	+	Silent	SNP	C	C	A	rs143314367		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr16:89874755C>A	ENST00000389301.3	-	6	573	c.543G>T	c.(541-543)gcG>gcT	p.A181A	FANCA_ENST00000389302.3_Silent_p.A181A|FANCA_ENST00000534992.1_Silent_p.A181A|FANCA_ENST00000563673.1_Silent_p.A181A|FANCA_ENST00000568369.1_Silent_p.A181A|FANCA_ENST00000543736.1_Silent_p.A149A	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	181			A -> V (in FA; dbSNP:rs17232246).		DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.A181A(1)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GATGCCACACCGCTTCAAGCA	0.403			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.A181A		Atlas-SNP	.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	99	.	1	Substitution - coding silent(1)	lung(1)	c.G543T						PASS	.						144.0	135.0	138.0					16																	89874755		2198	4300	6498	SO:0001819	synonymous_variant	2175	exon6	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CCACACCGCTTCA	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.543G>T	chr16.hg19:g.89874755C>A		206.0	0.0	.		368.0	15.0	.	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	hg19	CCDS32515.1																																																																																			.	C|0.999;T|0.001	.	alt		0.403	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
SPAG5	10615	hgsc.bcm.edu	37	17	26911492	26911492	+	Missense_Mutation	SNP	C	C	A	rs140086700		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr17:26911492C>A	ENST00000321765.5	-	12	2500	c.2168G>T	c.(2167-2169)cGg>cTg	p.R723L		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	723	Gln-rich.|Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CAACTGAGCCCGGAGATCTAG	0.493																																					p.R723L		Atlas-SNP	.											.	SPAG5	92	.	0			c.G2168T						PASS	.						147.0	139.0	142.0					17																	26911492		2203	4300	6503	SO:0001583	missense	10615	exon12			TGAGCCCGGAGAT	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2168G>T	chr17.hg19:g.26911492C>A	ENSP00000323300:p.Arg723Leu	231.0	0.0	.		220.0	10.0	.	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	hg19	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103948	0.37145	.	.	ENSG00000076382	ENST00000321765;ENST00000536674	.	.	.	6.02	-4.11	0.03928	.	1.207820	0.05827	N	0.616907	T	0.19685	0.0473	N	0.14661	0.345	0.18873	N	0.999981	B	0.31193	0.312	B	0.26094	0.066	T	0.27123	-1.0083	9	0.62326	D	0.03	0.4992	8.2083	0.31469	0.0:0.5014:0.1246:0.374	.	723	Q96R06	SPAG5_HUMAN	L	723;220	.	ENSP00000323300:R723L	R	-	2	0	SPAG5	23935619	0.000000	0.05858	0.772000	0.31596	0.996000	0.88848	-2.533000	0.00942	-0.956000	0.03631	0.650000	0.86243	CGG	.	C|1.000;T|0.000	.	alt		0.493	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
ZNF207	7756	hgsc.bcm.edu	37	17	30696350	30696350	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr17:30696350A>T	ENST00000321233.6	+	10	1307	c.1153A>T	c.(1153-1155)Aat>Tat	p.N385Y	ZNF207_ENST00000394673.2_Missense_Mutation_p.N370Y|ZNF207_ENST00000342555.6_Missense_Mutation_p.N404Y|ZNF207_ENST00000577908.1_Missense_Mutation_p.N401Y|ZNF207_ENST00000341711.6_Missense_Mutation_p.N302Y|ZNF207_ENST00000394670.4_Missense_Mutation_p.N401Y	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	385	GLEBS.				attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			GTATCAACGTAATCTTCCTCG	0.502																																					p.N401Y		Atlas-SNP	.											.	ZNF207	32	.	0			c.A1201T						PASS	.						102.0	101.0	101.0					17																	30696350		2203	4300	6503	SO:0001583	missense	7756	exon11			CAACGTAATCTTC	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.1153A>T	chr17.hg19:g.30696350A>T	ENSP00000322777:p.Asn385Tyr	117.0	0.0	.		96.0	48.0	.	NM_001098507	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	ENST00000321233.6	hg19	CCDS11271.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.710294	0.48517	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T	0.47177	0.87;0.85	5.55	5.55	0.83447	.	0.143629	0.64402	D	0.000010	T	0.60209	0.2251	L	0.40543	1.245	0.48762	D	0.999708	D;D;D;P;D	0.76494	0.972;0.972;0.972;0.924;0.999	P;P;P;P;D	0.83275	0.6;0.6;0.6;0.461;0.996	T	0.58137	-0.7689	10	0.37606	T	0.19	.	15.7019	0.77549	1.0:0.0:0.0:0.0	.	354;404;401;370;385	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	Y	401;354;404;370;302;385	ENSP00000378165:N401Y;ENSP00000344913:N302Y	ENSP00000322777:N370Y	N	+	1	0	ZNF207	27720463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.566000	0.67372	2.108000	0.64289	0.477000	0.44152	AAT	.	.	.	none		0.502	ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
PPM1D	8493	hgsc.bcm.edu	37	17	58740837	58740837	+	Missense_Mutation	SNP	G	G	A	rs200809297		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr17:58740837G>A	ENST00000305921.3	+	6	1974	c.1742G>A	c.(1741-1743)cGa>cAa	p.R581Q	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	581					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			CTCACCATGCGACGCAGACTT	0.443											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.R581Q		Atlas-SNP	.											.	PPM1D	50	.	0			c.G1742A						PASS	.						85.0	82.0	83.0					17																	58740837		2203	4300	6503	SO:0001583	missense	8493	exon6			CCATGCGACGCAG	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1742G>A	chr17.hg19:g.58740837G>A	ENSP00000306682:p.Arg581Gln	109.0	0.0	.	1033	104.0	52.0	.	NM_003620	Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	hg19	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564808	0.86439	.	.	ENSG00000170836	ENST00000305921	T	0.61158	0.13	5.98	5.01	0.66863	.	0.278410	0.34268	N	0.004118	T	0.66157	0.2761	L	0.34521	1.04	0.40466	D	0.980292	D	0.89917	1.0	D	0.63957	0.92	T	0.71721	-0.4507	10	0.87932	D	0	-2.6262	17.3117	0.87212	0.0:0.1253:0.8747:0.0	.	581	O15297	PPM1D_HUMAN	Q	581	ENSP00000306682:R581Q	ENSP00000306682:R581Q	R	+	2	0	PPM1D	56095619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.144000	0.77357	1.522000	0.49001	0.591000	0.81541	CGA	.	G|0.999;A|0.001	0.001	weak		0.443	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
ANKRD12	23253	hgsc.bcm.edu	37	18	9275635	9275635	+	Silent	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr18:9275635C>A	ENST00000262126.4	+	11	6117	c.5877C>A	c.(5875-5877)gcC>gcA	p.A1959A	ANKRD12_ENST00000400020.3_Silent_p.A1936A|ANKRD12_ENST00000383440.2_Silent_p.A1936A|snoU13_ENST00000459594.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1959						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TGCTGGATGCCGAAGTATACA	0.363																																					p.A1959A		Atlas-SNP	.											ANKRD12,NS,carcinoma,0,1	ANKRD12	167	.	0			c.C5877A						PASS	.						163.0	148.0	153.0					18																	9275635		2203	4300	6503	SO:0001819	synonymous_variant	23253	exon11			GGATGCCGAAGTA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5877C>A	chr18.hg19:g.9275635C>A		146.0	2.0	.		247.0	12.0	.	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	hg19	CCDS11843.1																																																																																			.	.	.	none		0.363	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
SMAD7	4092	hgsc.bcm.edu	37	18	46447887	46447887	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr18:46447887C>T	ENST00000262158.2	-	4	1422	c.1136G>A	c.(1135-1137)cGg>cAg	p.R379Q	SMAD7_ENST00000591805.1_Missense_Mutation_p.R164Q|SMAD7_ENST00000589634.1_Missense_Mutation_p.R378Q|SMAD7_ENST00000585986.1_5'UTR	NM_001190821.1|NM_005904.3	NP_001177750.1|NP_005895.1	O15105	SMAD7_HUMAN	SMAD family member 7	379	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				adherens junction assembly (GO:0034333)|artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|cellular protein complex localization (GO:0034629)|cellular response to transforming growth factor beta stimulus (GO:0071560)|gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|regulation of activin receptor signaling pathway (GO:0032925)|regulation of cardiac muscle contraction (GO:0055117)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|response to laminar fluid shear stress (GO:0034616)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activin binding (GO:0048185)|beta-catenin binding (GO:0008013)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity (GO:0030617)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	10	Colorectal(1;0.0518)					GTCATTGGGCCGCTGCAGGCT	0.582																																					p.R379Q		Atlas-SNP	.											.	SMAD7	22	.	0			c.G1136A						PASS	.						90.0	77.0	81.0					18																	46447887		2203	4300	6503	SO:0001583	missense	4092	exon4			TTGGGCCGCTGCA	AF010193	CCDS11936.1, CCDS54186.1, CCDS59317.1	18q21.1	2006-11-06	2006-11-06	2004-05-26	ENSG00000101665	ENSG00000101665		"""SMADs"""	6773	protein-coding gene	gene with protein product		602932	"""MAD, mothers against decapentaplegic homolog 7 (Drosophila)"", ""SMAD, mothers against DPP homolog 7 (Drosophila)"""	MADH8, MADH7		9256479, 9730599	Standard	NM_005904		Approved		uc002ldg.3	O15105	OTTHUMG00000132655	ENST00000262158.2:c.1136G>A	chr18.hg19:g.46447887C>T	ENSP00000262158:p.Arg379Gln	91.0	0.0	.		66.0	25.0	.	NM_005904	B7Z773|K7EQ10|O14740|Q6DK23	Missense_Mutation	SNP	ENST00000262158.2	hg19	CCDS11936.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380052	0.82682	.	.	ENSG00000101665	ENST00000545051;ENST00000262158	D	0.98792	-5.14	5.66	5.66	0.87406	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.97648	0.9229	N	0.05330	-0.07	0.80722	D	1	P;D	0.71674	0.68;0.998	B;D	0.79108	0.19;0.992	D	0.97332	0.9951	10	0.23891	T	0.37	.	19.7417	0.96234	0.0:1.0:0.0:0.0	.	379;191	O15105;B3KYA8	SMAD7_HUMAN;.	Q	164;379	ENSP00000262158:R379Q	ENSP00000262158:R379Q	R	-	2	0	SMAD7	44701885	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.972000	0.63756	2.658000	0.90341	0.591000	0.81541	CGG	.	.	.	none		0.582	SMAD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255906.1	NM_005904	
SALL3	27164	hgsc.bcm.edu	37	18	76755171	76755171	+	Missense_Mutation	SNP	G	G	C	rs371088522		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr18:76755171G>C	ENST00000537592.2	+	2	3180	c.3180G>C	c.(3178-3180)atG>atC	p.M1060I	SALL3_ENST00000536229.3_Missense_Mutation_p.M855I|SALL3_ENST00000575389.2_Missense_Mutation_p.M988I	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1060					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CACCCACCATGATCAAAATGG	0.612																																					p.M1060I		Atlas-SNP	.											.	SALL3	162	.	0			c.G3180C						PASS	.						64.0	64.0	64.0					18																	76755171		2203	4300	6503	SO:0001583	missense	27164	exon2			CACCATGATCAAA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3180G>C	chr18.hg19:g.76755171G>C	ENSP00000441823:p.Met1060Ile	119.0	0.0	.		100.0	4.0	.	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	hg19	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	G	9.680	1.148949	0.21288	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08370	3.1	5.1	3.24	0.37175	.	0.285135	0.29362	N	0.012368	T	0.07007	0.0178	N	0.20986	0.625	0.43617	D	0.995995	B;B	0.20887	0.002;0.049	B;B	0.14023	0.002;0.01	T	0.23084	-1.0198	10	0.35671	T	0.21	-20.2151	15.0906	0.72192	0.0:0.2696:0.7304:0.0	.	720;1060	F5GXY4;Q9BXA9	.;SALL3_HUMAN	I	1060;988;720	ENSP00000441823:M1060I	ENSP00000299466:M1060I	M	+	3	0	SALL3	74856159	1.000000	0.71417	0.871000	0.34182	0.073000	0.16967	3.010000	0.49559	0.505000	0.28104	0.561000	0.74099	ATG	.	.	.	alt		0.612	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
KCNN1	3780	hgsc.bcm.edu	37	19	18100536	18100536	+	Silent	SNP	C	C	A	rs377567043		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr19:18100536C>A	ENST00000222249.9	+	8	1501	c.1182C>A	c.(1180-1182)gcC>gcA	p.A394A		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	394	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TAAAAAACGCCGCTGCTAACG	0.502																																					p.A394A		Atlas-SNP	.											.	KCNN1	74	.	0			c.C1182A						PASS	.						143.0	141.0	142.0					19																	18100536		1895	4132	6027	SO:0001819	synonymous_variant	3780	exon8			AAACGCCGCTGCT	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1182C>A	chr19.hg19:g.18100536C>A		289.0	0.0	.		247.0	10.0	.	NM_002248	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	hg19																																																																																				.	.	.	alt		0.502	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
GATAD2A	54815	hgsc.bcm.edu	37	19	19613195	19613195	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr19:19613195C>T	ENST00000360315.3	+	11	1943	c.1631C>T	c.(1630-1632)aCg>aTg	p.T544M	GATAD2A_ENST00000358713.3_Missense_Mutation_p.T544M|GATAD2A_ENST00000429563.2_Missense_Mutation_p.T347M|GATAD2A_ENST00000537887.1_Missense_Mutation_p.T173M|GATAD2A_ENST00000252577.5_Missense_Mutation_p.T519M|GATAD2A_ENST00000404158.1_Missense_Mutation_p.T545M	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	544					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GTCCTGCACACGTTCAGTCCG	0.647																																					p.T544M		Atlas-SNP	.											.	GATAD2A	81	.	0			c.C1631T						PASS	.						76.0	79.0	78.0					19																	19613195		2203	4300	6503	SO:0001583	missense	54815	exon11			TGCACACGTTCAG	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1631C>T	chr19.hg19:g.19613195C>T	ENSP00000353463:p.Thr544Met	182.0	0.0	.		93.0	36.0	.	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	hg19	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160141	0.57368	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000537887;ENST00000404158;ENST00000358713;ENST00000429563	T;T;T;T	0.45668	1.43;1.48;1.43;0.89	5.23	5.23	0.72850	.	0.357947	0.31872	N	0.006930	T	0.56202	0.1969	L	0.47716	1.5	0.38138	D	0.938352	D;D;D	0.89917	0.994;0.998;1.0	P;P;P	0.61592	0.628;0.794;0.891	T	0.62248	-0.6894	10	0.72032	D	0.01	-26.0515	17.4151	0.87497	0.0:1.0:0.0:0.0	.	347;564;544	B4DKZ7;B5MC40;Q86YP4	.;.;P66A_HUMAN	M	544;519;173;564;544;347	ENSP00000353463:T544M;ENSP00000252577:T519M;ENSP00000351552:T544M;ENSP00000388416:T347M	ENSP00000252577:T519M	T	+	2	0	GATAD2A	19474195	1.000000	0.71417	0.929000	0.37066	0.486000	0.33341	4.956000	0.63645	2.452000	0.82932	0.585000	0.79938	ACG	.	.	.	none		0.647	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
ZNF573	126231	hgsc.bcm.edu	37	19	38230139	38230140	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr19:38230139_38230140CC>AA	ENST00000590414.2	-	4	1272_1273	c.1251_1252GG>TT	c.(1249-1254)aaGGaa>aaTTaa	p.417_418KE>N*	ZNF573_ENST00000392138.1_Nonsense_Mutation_p.330_331KE>N*|ZNF573_ENST00000339503.4_Nonsense_Mutation_p.359_360KE>N*|ZNF573_ENST00000536220.1_Nonsense_Mutation_p.329_330KE>N*|ZNF573_ENST00000357309.3_Nonsense_Mutation_p.329_330KE>N*			Q86YE8	ZN573_HUMAN	zinc finger protein 573	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TTTCCGCATTCCTTGCATTCAT	0.376																																					p.E418X|p.K417N		Atlas-SNP	.											.	ZNF573	63	.	0			c.G1252T|c.G1251T						PASS	.																																			SO:0001587	stop_gained	126231	exon5			CGCATTCCTTGCA|GCATTCCTTGCAT	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1251_1252delinsAA	chr19.hg19:g.38230139_38230140delinsAA	ENSP00000465020:p.K417_E418delinsN*	275.0|274.0	0.0	.		300.0|296.0	132.0	.	NM_001172690	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000590414.2	hg19	CCDS59381.1																																																																																			.	.	.	none		0.376	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
PRR12	57479	hgsc.bcm.edu	37	19	50097991	50097991	+	Silent	SNP	G	G	C	rs527711314		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr19:50097991G>C	ENST00000418929.2	+	4	411	c.399G>C	c.(397-399)tcG>tcC	p.S133S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TCTTCATCTCGGGTGCCCTGC	0.662																																					p.S133S		Atlas-SNP	.											.	PRR12	157	.	0			c.G399C						PASS	.						27.0	32.0	31.0					19																	50097991		2036	4191	6227	SO:0001819	synonymous_variant	57479	exon4			CATCTCGGGTGCC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.399G>C	chr19.hg19:g.50097991G>C		72.0	0.0	.		30.0	15.0	.	NM_020719	E9PB06|Q8N4J6	Silent	SNP	ENST00000418929.2	hg19	CCDS46143.1																																																																																			.	.	.	none		0.662	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
NSFL1C	55968	hgsc.bcm.edu	37	20	1433207	1433207	+	Missense_Mutation	SNP	C	C	A	rs371393612		TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr20:1433207C>A	ENST00000216879.4	-	7	1583	c.716G>T	c.(715-717)cGg>cTg	p.R239L	NSFL1C_ENST00000350991.4_Missense_Mutation_p.R241L|NSFL1C_ENST00000476071.1_Missense_Mutation_p.R241L|NSFL1C_ENST00000353088.2_Missense_Mutation_p.R208L|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000381658.4_Missense_Mutation_p.R128L	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	239	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.					chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R239Q(1)		breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						GTCCTCGTCCCGATGGTCCTC	0.572																																					p.R239L		Atlas-SNP	.											NSFL1C,caecum,carcinoma,0,1	NSFL1C	38	.	1	Substitution - Missense(1)	large_intestine(1)	c.G716T						PASS	.						179.0	159.0	166.0					20																	1433207		2203	4300	6503	SO:0001583	missense	55968	exon7			TCGTCCCGATGGT	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.716G>T	chr20.hg19:g.1433207C>A	ENSP00000216879:p.Arg239Leu	285.0	2.0	.		345.0	19.0	.	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	hg19	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	C	35	5.461733	0.96240	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T;T	0.50277	0.75;0.78;0.78;0.78;0.79	5.13	5.13	0.70059	SEP domain (4);	0.000000	0.85682	D	0.000000	T	0.67581	0.2908	M	0.66506	2.035	0.80722	D	1	D;D;D	0.67145	0.996;0.989;0.991	D;D;D	0.80764	0.992;0.99;0.994	T	0.69363	-0.5165	10	0.72032	D	0.01	-15.8878	17.2951	0.87168	0.0:1.0:0.0:0.0	.	208;128;239	Q9UNZ2-4;Q9UNZ2-6;Q9UNZ2	.;.;NSF1C_HUMAN	L	208;241;239;128;241	ENSP00000338643:R208L;ENSP00000418529:R241L;ENSP00000216879:R239L;ENSP00000371074:R128L;ENSP00000202584:R241L	ENSP00000216879:R239L	R	-	2	0	NSFL1C	1381207	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.754000	0.62191	2.824000	0.97209	0.655000	0.94253	CGG	.	.	.	alt		0.572	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
PCED1A	64773	hgsc.bcm.edu	37	20	2819363	2819363	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr20:2819363C>A	ENST00000360652.2	-	5	975	c.473G>T	c.(472-474)cGg>cTg	p.R158L	VPS16_ENST00000380469.3_5'Flank|VPS16_ENST00000380445.3_5'Flank|PCED1A_ENST00000356872.3_Missense_Mutation_p.R107L	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	158																	CAGGTTCTCCCGGTAGCTCTC	0.582																																					p.R158L		Atlas-SNP	.											FAM113A,colon,carcinoma,0,1	.	.	.	0			c.G473T						PASS	.						172.0	154.0	160.0					20																	2819363		2203	4300	6503	SO:0001583	missense	64773	exon5			TTCTCCCGGTAGC	AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.473G>T	chr20.hg19:g.2819363C>A	ENSP00000353868:p.Arg158Leu	322.0	0.0	.		236.0	10.0	.	NM_022760	Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	ENST00000360652.2	hg19	CCDS13035.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.844032	0.32606	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	3.89	2.93	0.34026	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.151472	0.40908	D	0.000997	T	0.10723	0.0262	N	0.13235	0.315	0.39966	D	0.974729	B;B	0.24426	0.031;0.103	B;B	0.24701	0.034;0.055	T	0.12192	-1.0557	10	0.33141	T	0.24	-7.013	6.7152	0.23300	0.0:0.872:0.0:0.128	.	107;158	Q9H1Q7-2;Q9H1Q7	.;F113A_HUMAN	L	107;158;107;158	ENSP00000349334:R107L;ENSP00000353868:R158L;ENSP00000388935:R107L;ENSP00000401711:R158L	ENSP00000349334:R107L	R	-	2	0	FAM113A	2767363	0.494000	0.26043	0.922000	0.36590	0.442000	0.32017	0.684000	0.25364	2.205000	0.71048	0.462000	0.41574	CGG	.	.	.	none		0.582	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760	
NF2	4771	hgsc.bcm.edu	37	22	30051666	30051666	+	Splice_Site	SNP	G	G	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr22:30051666G>A	ENST00000338641.4	+	6	1040		c.e6+1		NF2_ENST00000413209.2_Intron|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000361676.4_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000347330.5_Intron|NF2_ENST00000334961.7_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(5)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GCCGAGCCAGGTGAGGCCCAT	0.408			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	NF2_ENST00000403999,NS,carcinoma,0,5	NF2	1312	.	5	Unknown(5)	meninges(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)	c.599+1G>A	GRCh37	CS951487	NF2	S		PASS	.						83.0	87.0	85.0					22																	30051666		2203	4300	6503	SO:0001630	splice_region_variant	4771	exon6	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	AGCCAGGTGAGGC	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.599+1G>A	chr22.hg19:g.30051666G>A		91.0	0.0	.		42.0	37.0	.	NM_016418	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	hg19	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954606	0.92726	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.036	0.92978	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28381666	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.653000	0.98506	2.484000	0.83849	0.555000	0.69702	.	.	.	.	none		0.408	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
NXF3	56000	hgsc.bcm.edu	37	X	102337711	102337711	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chrX:102337711C>T	ENST00000395065.3	-	8	858	c.757G>A	c.(757-759)Gtc>Atc	p.V253I	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Missense_Mutation_p.V164I	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	253					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TCTTCATGGACGTCCAGGGAG	0.478																																					p.V253I		Atlas-SNP	.											.	NXF3	81	.	0			c.G757A						PASS	.						174.0	145.0	154.0					X																	102337711		2203	4300	6503	SO:0001583	missense	56000	exon8			CATGGACGTCCAG	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.757G>A	chrX.hg19:g.102337711C>T	ENSP00000378504:p.Val253Ile	155.0	1.0	.		91.0	87.0	.	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	hg19	CCDS14503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.019|0.019	-1.461864|-1.461864	0.01062|0.01062	.|.	.|.	ENSG00000147206|ENSG00000147206	ENST00000427570|ENST00000395065;ENST00000425463	.|T;T	.|0.33865	.|1.39;1.39	3.64|3.64	1.2|1.2	0.21068|0.21068	.|.	.|0.308479	.|0.33364	.|N	.|0.004994	T|T	0.07638|0.07638	0.0192|0.0192	N|N	0.00686|0.00686	-1.255|-1.255	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.17852	.|0.024;0.011;0.004	.|B;B;B	.|0.10450	.|0.005;0.003;0.001	T|T	0.37314|0.37314	-0.9711|-0.9711	5|10	.|0.02654	.|T	.|1	-12.7344|-12.7344	4.8575|4.8575	0.13566|0.13566	0.0:0.2749:0.0:0.7251|0.0:0.2749:0.0:0.7251	.|.	.|253;149;253	.|B4DYI1;E9PEY7;Q9H4D5	.|.;.;NXF3_HUMAN	H|I	129|253;164	.|ENSP00000378504:V253I;ENSP00000404347:V164I	.|ENSP00000378504:V253I	R|V	-|-	2|1	0|0	NXF3|NXF3	102224367|102224367	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.923000|0.923000	0.28757|0.28757	0.139000|0.139000	0.18822|0.18822	-0.881000|-0.881000	0.02953|0.02953	CGT|GTC	.	.	.	none		0.478	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
DOCK11	139818	hgsc.bcm.edu	37	X	117731503	117731503	+	Silent	SNP	A	A	T			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chrX:117731503A>T	ENST00000276202.7	+	21	2436	c.2373A>T	c.(2371-2373)gcA>gcT	p.A791A	DOCK11_ENST00000276204.6_Silent_p.A791A	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	791	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGAATGATGCAGAATCAAGAA	0.398																																					p.A791A		Atlas-SNP	.											.	DOCK11	185	.	0			c.A2373T						PASS	.						92.0	82.0	85.0					X																	117731503		2203	4300	6503	SO:0001819	synonymous_variant	139818	exon21			TGATGCAGAATCA	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.2373A>T	chrX.hg19:g.117731503A>T		90.0	0.0	.		91.0	87.0	.	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Silent	SNP	ENST00000276202.7	hg19	CCDS35373.1																																																																																			.	.	.	none		0.398	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
KIAA1210	57481	hgsc.bcm.edu	37	X	118223094	118223094	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chrX:118223094A>G	ENST00000402510.2	-	11	2098	c.2099T>C	c.(2098-2100)aTc>aCc	p.I700T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	700										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TTCTAACTGGATATGAGAAGG	0.443																																					p.I700T		Atlas-SNP	.											.	KIAA1210	171	.	0			c.T2099C						PASS	.						46.0	44.0	45.0					X																	118223094		1917	4125	6042	SO:0001583	missense	57481	exon11			AACTGGATATGAG	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2099T>C	chrX.hg19:g.118223094A>G	ENSP00000384670:p.Ile700Thr	57.0	0.0	.		58.0	50.0	.	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	A	12.44	1.939623	0.34189	.	.	ENSG00000250423	ENST00000402510	T	0.15952	2.38	4.42	-4.42	0.03579	.	.	.	.	.	T	0.07007	0.0178	N	0.24115	0.695	0.09310	N	1	B	0.28850	0.225	B	0.29176	0.099	T	0.40021	-0.9585	9	0.12103	T	0.63	.	0.4269	0.00465	0.264:0.1592:0.2924:0.2844	.	700	Q9ULL0	K1210_HUMAN	T	700	ENSP00000384670:I700T	ENSP00000384670:I700T	I	-	2	0	RP13-347D8.6	118107122	0.000000	0.05858	0.000000	0.03702	0.365000	0.29674	-1.161000	0.03144	-1.043000	0.03258	0.350000	0.21858	ATC	.	.	.	none		0.443	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151152656	151152656	+	Frame_Shift_Del	DEL	T	T	-	rs803411	byFrequency	TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr6:151152656delT	ENST00000358517.2	+	15	2620	c.2409delT	c.(2407-2409)actfs	p.T803fs	PLEKHG1_ENST00000367328.1_Frame_Shift_Del_p.T803fs			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	803							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ATCAGGCCACTCCCGATCATG	0.512																																					p.T803fs		Atlas-INDEL	.											.	PLEKHG1	97	.	0			c.2408delC						PASS	.						116.0	113.0	114.0					6																	151152656		2203	4300	6503	SO:0001589	frameshift_variant	57480	exon16			.	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2409delT	chr6.hg19:g.151152656delT	ENSP00000351318:p.Thr803fs	158.0	0.0	0		127.0	60.0	0.472441	NM_001029884	Q5T1F2	Frame_Shift_Del	DEL	ENST00000358517.2	hg19	CCDS34552.1																																																																																			.	.	.	none		0.512	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
BHMT	635	hgsc.bcm.edu	37	5	78426827	78426828	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr5:78426827_78426828insA	ENST00000274353.5	+	8	1216_1217	c.1109_1110insA	c.(1108-1113)ccagatfs	p.D371fs	BHMT_ENST00000524080.1_Frame_Shift_Ins_p.D218fs|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	371					amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	ATGTCAAAGCCAGATGGCTGGG	0.495																																					p.P370fs		Atlas-INDEL	.											.	BHMT	53	.	0			c.1109_1110insA						PASS	.																																			SO:0001589	frameshift_variant	635	exon8			.	BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.1110dupA	chr5.hg19:g.78426828_78426828dupA	ENSP00000274353:p.Asp371fs	276.0	0.0	0		276.0	105.0	0.380435	NM_001713	Q9UNI9	Frame_Shift_Ins	INS	ENST00000274353.5	hg19	CCDS4046.1																																																																																			.	.	.	none		0.495	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226961.1	NM_001713	
PSME4	23198	hgsc.bcm.edu	37	2	54147352	54147352	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr2:54147352delC	ENST00000404125.1	-	19	2453	c.2398delG	c.(2398-2400)gatfs	p.D800fs	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	800					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AGTTTTCCATCCCCACAATGC	0.383																																					p.D800fs		Atlas-INDEL	.											.	PSME4	247	.	0			c.2399delA						PASS	.						149.0	171.0	164.0					2																	54147352		2203	4300	6503	SO:0001589	frameshift_variant	23198	exon19			.	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2398delG	chr2.hg19:g.54147352delC	ENSP00000384211:p.Asp800fs	456.0	0.0	0		468.0	189.0	0.403846	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Frame_Shift_Del	DEL	ENST00000404125.1	hg19	CCDS33197.2																																																																																			.	.	.	none		0.383	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
KRT76	51350	hgsc.bcm.edu	37	12	53170736	53170736	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr12:53170736delT	ENST00000332411.2	-	1	393	c.340delA	c.(340-342)agtfs	p.S114fs		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	114	Head.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						ccaaaaccactacctactcct	0.607																																					p.S114fs		Atlas-INDEL	.											.	KRT76	72	.	0			c.341delG						PASS	.						268.0	276.0	273.0					12																	53170736		2203	4299	6502	SO:0001589	frameshift_variant	51350	exon1			.	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.340delA	chr12.hg19:g.53170736delT	ENSP00000330101:p.Ser114fs	72.0	0.0	0		54.0	24.0	0.444444	NM_015848	B4DRR3|Q7Z795	Frame_Shift_Del	DEL	ENST00000332411.2	hg19	CCDS8838.1																																																																																			.	.	.	none		0.607	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
RGS7BP	401190	hgsc.bcm.edu	37	5	63905047	63905047	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-6797-01A-11D-1961-08	TCGA-G7-6797-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b1bd2e14-32b6-4c57-bad1-59c0591876c2	5df531ff-b58f-4f9b-8103-b154da29a87c	g.chr5:63905047delT	ENST00000334025.2	+	6	1068	c.742delT	c.(742-744)ttcfs	p.F249fs		NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	249					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		GAAGAGAAGGTTCTTTGGGCT	0.478																																					p.R247fs		Atlas-INDEL	.											.	RGS7BP	32	.	0			c.741delG						PASS	.						168.0	148.0	155.0					5																	63905047		2203	4300	6503	SO:0001589	frameshift_variant	401190	exon6			.	BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.742delT	chr5.hg19:g.63905047delT	ENSP00000334851:p.Phe249fs	121.0	0.0	0		101.0	38.0	0.376238	NM_001029875	B7Z3X1	Frame_Shift_Del	DEL	ENST00000334025.2	hg19	CCDS34170.1																																																																																			.	.	.	none		0.478	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368464.1	NM_001029875	
