#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ERICH3	127254	hgsc.bcm.edu	37	1	75114999	75114999	+	Splice_Site	SNP	C	C	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr1:75114999C>A	ENST00000326665.5	-	2	242	c.24G>T	c.(22-24)ggG>ggT	p.G8G		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		8										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CAGCAAGTAACCTAAAATACA	0.353																																					p.G8G		Atlas-SNP	.											.	C1orf173	380	.	0			c.G24T						PASS	.						71.0	72.0	72.0					1																	75114999		2203	4300	6503	SO:0001630	splice_region_variant	127254	exon2			AAGTAACCTAAAA																												ENST00000326665.5:c.24-1G>T	chr1.hg19:g.75114999C>A		115.0	0.0	.		76.0	25.0	.	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.	.	none		0.353	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		Silent
INTS3	65123	hgsc.bcm.edu	37	1	153736638	153736638	+	Silent	SNP	A	A	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr1:153736638A>G	ENST00000318967.2	+	18	2434	c.1866A>G	c.(1864-1866)ctA>ctG	p.L622L	INTS3_ENST00000456435.1_Silent_p.L416L|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000512605.1_Silent_p.L416L|INTS3_ENST00000435409.2_Silent_p.L622L	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	623					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTTCCTGCCTACAGGAGCTCT	0.572																																					p.L622L		Atlas-SNP	.											.	INTS3	83	.	0			c.A1866G						PASS	.						131.0	122.0	125.0					1																	153736638		2203	4300	6503	SO:0001819	synonymous_variant	65123	exon18			CTGCCTACAGGAG	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1866A>G	chr1.hg19:g.153736638A>G		172.0	0.0	.		107.0	46.0	.	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Silent	SNP	ENST00000318967.2	hg19	CCDS1052.1																																																																																			.	.	.	none		0.572	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
FAIM3	9214	hgsc.bcm.edu	37	1	207085119	207085119	+	Silent	SNP	G	G	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr1:207085119G>C	ENST00000367091.3	-	4	809	c.666C>G	c.(664-666)ccC>ccG	p.P222P	FAIM3_ENST00000420007.2_Silent_p.P222P|FAIM3_ENST00000442471.2_Silent_p.P110P|FAIM3_ENST00000528654.1_Intron	NM_005449.4	NP_005440.1	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3	222					cellular defense response (GO:0006968)|immune system process (GO:0002376)|negative regulation of apoptotic process (GO:0043066)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(84;0.201)					TGGGCGTCTGGGGCTTGAGCA	0.542											OREG0014185	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P222P		Atlas-SNP	.											.	FAIM3	36	.	0			c.C666G						PASS	.						92.0	91.0	91.0					1																	207085119		2203	4300	6503	SO:0001819	synonymous_variant	9214	exon4			CGTCTGGGGCTTG	AF057557	CCDS1473.1, CCDS44304.1	1q32.1	2013-01-11			ENSG00000162894	ENSG00000162894		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14315	protein-coding gene	gene with protein product		606015				9586636, 1563211	Standard	NM_005449		Approved	TOSO	uc001hey.3	O60667	OTTHUMG00000036457	ENST00000367091.3:c.666C>G	chr1.hg19:g.207085119G>C		137.0	0.0	.	2164	97.0	26.0	.	NM_005449	A8K7J2|B7Z6Z0|D9MWM3	Silent	SNP	ENST00000367091.3	hg19	CCDS1473.1																																																																																			.	.	.	none		0.542	FAIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088677.1	NM_005449	
PIGR	5284	hgsc.bcm.edu	37	1	207105817	207105817	+	Silent	SNP	C	C	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr1:207105817C>G	ENST00000356495.4	-	8	2175	c.1992G>C	c.(1990-1992)cgG>cgC	p.R664R	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	664					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TCTTCCTGTGCCGGGCTCTGG	0.647																																					p.R664R		Atlas-SNP	.											.	PIGR	98	.	0			c.G1992C						PASS	.						72.0	75.0	74.0					1																	207105817		2203	4300	6503	SO:0001819	synonymous_variant	5284	exon8			CCTGTGCCGGGCT		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1992G>C	chr1.hg19:g.207105817C>G		157.0	0.0	.		97.0	34.0	.	NM_002644	Q68D81|Q8IZY7	Silent	SNP	ENST00000356495.4	hg19	CCDS1474.1																																																																																			.	.	.	none		0.647	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
OR2T1	26696	hgsc.bcm.edu	37	1	248569960	248569960	+	Missense_Mutation	SNP	G	G	T	rs150412216	byFrequency	TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr1:248569960G>T	ENST00000366474.1	+	1	665	c.665G>T	c.(664-666)cGg>cTg	p.R222L		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCAATTCCCGGGAGATTAAC	0.517																																					p.R222L		Atlas-SNP	.											.	OR2T1	89	.	0			c.G665T						PASS	.						120.0	111.0	114.0					1																	248569960		2203	4300	6503	SO:0001583	missense	26696	exon1			ATTCCCGGGAGAT	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.665G>T	chr1.hg19:g.248569960G>T	ENSP00000355430:p.Arg222Leu	109.0	0.0	.		78.0	4.0	.	NM_030904	Q6IEZ9	Missense_Mutation	SNP	ENST00000366474.1	hg19	CCDS31115.1	.	.	.	.	.	.	.	.	.	.	g	16.46	3.129768	0.56721	.	.	ENSG00000175143	ENST00000366474	T	0.36157	1.27	4.84	0.732	0.18283	GPCR, rhodopsin-like superfamily (1);	0.254304	0.20520	U	0.090718	T	0.31734	0.0806	M	0.62209	1.925	0.09310	N	1	B	0.24576	0.106	B	0.34242	0.178	T	0.38067	-0.9678	10	0.59425	D	0.04	.	1.1502	0.01784	0.326:0.145:0.3802:0.1488	.	222	O43869	OR2T1_HUMAN	L	222	ENSP00000355430:R222L	ENSP00000355430:R222L	R	+	2	0	OR2T1	246636583	0.000000	0.05858	0.022000	0.16811	0.987000	0.75469	0.557000	0.23454	0.236000	0.21180	0.650000	0.86243	CGG	.	G|0.998;A|0.002	.	alt		0.517	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097346.2		
PLEKHB2	55041	hgsc.bcm.edu	37	2	131897791	131897791	+	Missense_Mutation	SNP	G	G	C	rs143964327		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr2:131897791G>C	ENST00000403716.1	+	7	1035	c.475G>C	c.(475-477)Gtt>Ctt	p.V159L	PLEKHB2_ENST00000439822.2_Missense_Mutation_p.K114N|PLEKHB2_ENST00000438882.2_Intron|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.V158L|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.V159L|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.V167L|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.V111L|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.V159L	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	159						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		AGGAACTCAAGTTGTCTACGC	0.512																																					p.V167L		Atlas-SNP	.											.	PLEKHB2	47	.	0			c.G499C						PASS	.	G	LEU/VAL,LEU/VAL	1,4405	4.2+/-10.8	0,1,2202	62.0	57.0	59.0		475,472	3.9	1.0	2	dbSNP_134	59	0,8600		0,0,4300	no	missense,missense	PLEKHB2	NM_001100623.1,NM_017958.2	32,32	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	159/223,158/222	131897791	1,13005	2203	4300	6503	SO:0001583	missense	55041	exon7			ACTCAAGTTGTCT		CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.475G>C	chr2.hg19:g.131897791G>C	ENSP00000385892:p.Val159Leu	61.0	0.0	.		49.0	20.0	.	NM_001267065	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	ENST00000403716.1	hg19	CCDS46413.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.16|16.16	3.043536|3.043536	0.55003|0.55003	2.27E-4|2.27E-4	0.0|0.0	ENSG00000115762|ENSG00000115762	ENST00000439822|ENST00000409158;ENST00000403716;ENST00000234115;ENST00000538982;ENST00000409612;ENST00000409279	.|.	.|.	.|.	4.81|4.81	3.91|3.91	0.45181|0.45181	.|.	.|.	.|.	.|.	.|.	T|T	0.61236|0.61236	0.2331|0.2331	M|M	0.76328|0.76328	2.33|2.33	0.43574|0.43574	D|D	0.995904|0.995904	B|B;B;B;B	0.30482|0.21905	0.281|0.036;0.061;0.036;0.062	B|B;B;B;B	0.32624|0.26094	0.149|0.03;0.066;0.03;0.03	T|T	0.56757|0.56757	-0.7926|-0.7926	8|8	0.17369|0.25106	T|T	0.5|0.35	.|.	12.1112|12.1112	0.53840|0.53840	0.0:0.0:0.8269:0.1731|0.0:0.0:0.8269:0.1731	.|.	114|158;158;159;167	B4DZ66|Q53FF1;Q96CS7-3;Q96CS7;B8ZZN1	.|.;.;PKHB2_HUMAN;.	N|L	114|167;159;158;111;159;159	.|.	ENSP00000389629:K114N|ENSP00000234115:V158L	K|V	+|+	3|1	2|0	PLEKHB2|PLEKHB2	131614261|131614261	0.999000|0.999000	0.42202|0.42202	0.982000|0.982000	0.44146|0.44146	0.843000|0.843000	0.47879|0.47879	1.275000|1.275000	0.33144|0.33144	0.993000|0.993000	0.38866|0.38866	0.650000|0.650000	0.86243|0.86243	AAG|GTT	.	G|1.000;C|0.000	0.000	weak		0.512	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331304.2	NM_017958	
TTN	7273	hgsc.bcm.edu	37	2	179567316	179567316	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr2:179567316C>A	ENST00000591111.1	-	105	29571	c.29347G>T	c.(29347-29349)Gaa>Taa	p.E9783*	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E10100*|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Nonsense_Mutation_p.E8856*			Q8WZ42	TITIN_HUMAN	titin	13861	Ig-like 79.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGGACACTTCACACTCAAAG	0.438																																					p.E10100X		Atlas-SNP	.											.	TTN	18412	.	0			c.G30298T						PASS	.						177.0	174.0	175.0					2																	179567316		2019	4185	6204	SO:0001587	stop_gained	7273	exon107			ACACTTCACACTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29347G>T	chr2.hg19:g.179567316C>A	ENSP00000465570:p.Glu9783*	140.0	0.0	.		89.0	43.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	60	45.686615	0.99987	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.8805	0.96895	0.0:1.0:0.0:0.0	.	.	.	.	X	8856	.	ENSP00000343764:E8856X	E	-	1	0	TTN	179275561	1.000000	0.71417	0.986000	0.45419	0.981000	0.71138	7.818000	0.86416	2.704000	0.92352	0.655000	0.94253	GAA	.	.	.	none		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
HSPE1	3336	hgsc.bcm.edu	37	2	198365946	198365946	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr2:198365946C>G	ENST00000233893.5	+	2	595	c.152C>G	c.(151-153)tCg>tGg	p.S51W	HSPE1_ENST00000465573.1_Intron|HSPE1_ENST00000409468.1_Missense_Mutation_p.S51W|HSPD1_ENST00000345042.2_5'Flank|HSPD1_ENST00000388968.3_5'Flank|HSPE1_ENST00000409729.1_Intron|HSPD1_ENST00000544407.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_Missense_Mutation_p.S51W	NM_002157.2	NP_002148.1	P61604	CH10_HUMAN	heat shock 10kDa protein 1	51					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|osteoblast differentiation (GO:0001649)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			lung(1)	1			Epithelial(96;0.225)			GCTGTTGGATCGGGTTCTAAA	0.408																																					p.S51W		Atlas-SNP	.											.	HSPE1	2	.	0			c.C152G						PASS	.						53.0	55.0	54.0					2																	198365946		2203	4300	6503	SO:0001583	missense	3336	exon2			TTGGATCGGGTTC	AF109872	CCDS2320.1	2q33.1	2013-10-17	2013-10-17		ENSG00000115541	ENSG00000115541		"""Heat Shock Proteins / Chaperonins"""	5269	protein-coding gene	gene with protein product	"""chaperonin 10"""	600141	"""heat shock 10kD protein 1 (chaperonin 10)"""			7914093, 7698325	Standard	NM_002157		Approved	CPN10, GROES		P61604	OTTHUMG00000132749	ENST00000233893.5:c.152C>G	chr2.hg19:g.198365946C>G	ENSP00000233893:p.Ser51Trp	38.0	0.0	.		23.0	10.0	.	NM_002157	O95421|Q04984|Q53X54|Q9UDH0	Missense_Mutation	SNP	ENST00000233893.5	hg19	CCDS2320.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710542	0.68730	.	.	ENSG00000115541	ENST00000233893;ENST00000409468	.	.	.	5.37	5.37	0.77165	GroES-like (1);	0.221653	0.39475	U	0.001344	T	0.80813	0.4695	M	0.89214	3.015	0.58432	D	0.999999	D	0.60575	0.988	D	0.65573	0.936	D	0.84237	0.0470	9	0.72032	D	0.01	-11.1967	14.0187	0.64541	0.1511:0.8489:0.0:0.0	.	51	P61604	CH10_HUMAN	W	51	.	ENSP00000233893:S51W	S	+	2	0	HSPE1	198074191	0.720000	0.27996	0.637000	0.29366	0.705000	0.40729	3.596000	0.54024	2.530000	0.85305	0.557000	0.71058	TCG	.	.	.	none		0.408	HSPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256112.1	NM_002157	
DNASE1L3	1776	hgsc.bcm.edu	37	3	58179114	58179114	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr3:58179114T>C	ENST00000394549.2	-	7	1073	c.757A>G	c.(757-759)Agt>Ggt	p.S253G	DNASE1L3_ENST00000486455.1_Missense_Mutation_p.S223G|DNASE1L3_ENST00000483681.1_Missense_Mutation_p.S253G|DNASE1L3_ENST00000318316.3_Missense_Mutation_p.S253G	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	253					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		TCAAAAACACTGTTTGACTTG	0.433																																					p.S253G	Esophageal Squamous(96;1069 1424 4841 43466 52325)	Atlas-SNP	.											.	DNASE1L3	36	.	0			c.A757G						PASS	.						111.0	99.0	103.0					3																	58179114		2203	4300	6503	SO:0001583	missense	1776	exon7			AAACACTGTTTGA	AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.757A>G	chr3.hg19:g.58179114T>C	ENSP00000378053:p.Ser253Gly	119.0	0.0	.		58.0	20.0	.	NM_004944	B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	ENST00000394549.2	hg19	CCDS2886.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.327576	0.24080	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000394549	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.7	-7.58	0.01313	Endonuclease/exonuclease/phosphatase (2);	1.174290	0.05847	N	0.620530	T	0.30324	0.0761	N	0.17723	0.515	0.09310	N	1	B;B;B	0.10296	0.001;0.003;0.001	B;B;B	0.09377	0.003;0.004;0.003	T	0.17684	-1.0361	10	0.21540	T	0.41	.	8.2569	0.31763	0.0:0.3088:0.2525:0.4387	.	223;253;253	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	G	223;253;253;253;253	ENSP00000419052:S223G;ENSP00000316193:S253G;ENSP00000417047:S253G;ENSP00000378053:S253G	ENSP00000316193:S253G	S	-	1	0	DNASE1L3	58154154	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.785000	0.04628	-1.315000	0.02297	-0.290000	0.09829	AGT	.	.	.	none		0.433	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353533.1	NM_004944	
HERC3	8916	hgsc.bcm.edu	37	4	89575198	89575198	+	Nonsense_Mutation	SNP	G	G	T	rs35418561		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr4:89575198G>T	ENST00000402738.1	+	7	930	c.691G>T	c.(691-693)Gaa>Taa	p.E231*	HERC3_ENST00000407637.1_Nonsense_Mutation_p.E231*|HERC3_ENST00000264345.3_Nonsense_Mutation_p.E231*	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	231					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TCTAGATCGAGAATCTCCATG	0.368																																					p.E231X		Atlas-SNP	.											.	HERC3	82	.	0			c.G691T						PASS	.						87.0	88.0	88.0					4																	89575198		2203	4300	6503	SO:0001587	stop_gained	8916	exon7			GATCGAGAATCTC	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.691G>T	chr4.hg19:g.89575198G>T	ENSP00000385684:p.Glu231*	94.0	0.0	.		36.0	26.0	.	NM_014606	A8K1S5|Q8IXX3	Nonsense_Mutation	SNP	ENST00000402738.1	hg19	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	G	36	5.963882	0.97151	.	.	ENSG00000138641	ENST00000402738;ENST00000407637;ENST00000264345	.	.	.	5.12	4.24	0.50183	.	0.168861	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	10.4986	0.44791	0.078:0.1468:0.7752:0.0	.	.	.	.	X	231	.	ENSP00000264345:E231X	E	+	1	0	HERC3	89794221	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	5.005000	0.63972	2.664000	0.90586	0.655000	0.94253	GAA	.	.	.	none		0.368	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
MYOZ3	91977	hgsc.bcm.edu	37	5	150050078	150050078	+	Missense_Mutation	SNP	G	G	A	rs370373786		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr5:150050078G>A	ENST00000297130.4	+	3	293	c.94G>A	c.(94-96)Gtg>Atg	p.V32M	MYOZ3_ENST00000517768.1_Missense_Mutation_p.V32M|CTC-345K18.2_ENST00000511626.2_RNA|MYOZ3_ENST00000520112.1_5'Flank	NM_001122853.2|NM_133371.4	NP_001116325.1|NP_588612.2			myozenin 3											large_intestine(2)|lung(1)|skin(2)	5		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAGCTGAGCGTGCCCCAGGA	0.612																																					p.V32M		Atlas-SNP	.											.	MYOZ3	21	.	0			c.G94A						PASS	.	G	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	50.0	39.0	43.0		94,94	2.9	1.0	5		43	0,8600		0,0,4300	no	missense,missense	MYOZ3	NM_001122853.1,NM_133371.3	21,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	32/252,32/252	150050078	1,13005	2203	4300	6503	SO:0001583	missense	91977	exon3			CTGAGCGTGCCCC	AF480443	CCDS4309.1	5q33.2	2008-07-18			ENSG00000164591	ENSG00000164591			18565	protein-coding gene	gene with protein product	"""calsarcin 3"", ""FATZ related protein 3"""	610735				11842093	Standard	NM_001122853		Approved	CS-3, CS3, FRP3	uc003lsr.3	Q8TDC0	OTTHUMG00000130077	ENST00000297130.4:c.94G>A	chr5.hg19:g.150050078G>A	ENSP00000297130:p.Val32Met	40.0	0.0	.		23.0	16.0	.	NM_001122853		Missense_Mutation	SNP	ENST00000297130.4	hg19	CCDS4309.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.820957	0.50633	2.27E-4	0.0	ENSG00000164591	ENST00000517768;ENST00000297130	T;T	0.70516	-0.49;-0.49	4.74	2.91	0.33838	.	0.542979	0.16126	N	0.228410	T	0.67268	0.2875	M	0.75777	2.31	0.80722	D	1	P	0.51653	0.947	B	0.41946	0.371	T	0.69771	-0.5055	10	0.72032	D	0.01	-16.886	7.231	0.26043	0.277:0.0:0.723:0.0	.	32	Q8TDC0	MYOZ3_HUMAN	M	32	ENSP00000428815:V32M;ENSP00000297130:V32M	ENSP00000297130:V32M	V	+	1	0	MYOZ3	150030271	0.186000	0.23225	0.968000	0.41197	0.985000	0.73830	0.833000	0.27504	1.116000	0.41820	0.555000	0.69702	GTG	.	.	.	weak		0.612	MYOZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252369.1	NM_001122853	
KCNK5	8645	hgsc.bcm.edu	37	6	39159334	39159334	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr6:39159334G>A	ENST00000359534.3	-	5	1170	c.832C>T	c.(832-834)Cag>Tag	p.Q278*		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	278					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						CCCTTCACCTGCAGGGCCTTC	0.547																																					p.Q278X		Atlas-SNP	.											.	KCNK5	57	.	0			c.C832T						PASS	.						100.0	105.0	104.0					6																	39159334		2203	4300	6503	SO:0001587	stop_gained	8645	exon5			TCACCTGCAGGGC	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.832C>T	chr6.hg19:g.39159334G>A	ENSP00000352527:p.Gln278*	252.0	0.0	.		150.0	47.0	.	NM_003740	B2RAQ6|B5TJL2|Q5VV76	Nonsense_Mutation	SNP	ENST00000359534.3	hg19	CCDS4841.1	.	.	.	.	.	.	.	.	.	.	G	35	5.470988	0.96274	.	.	ENSG00000164626	ENST00000359534	.	.	.	5.35	4.47	0.54385	.	1.406490	0.05067	N	0.481046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	15.979	0.80091	0.0:0.1351:0.8649:0.0	.	.	.	.	X	278	.	ENSP00000352527:Q278X	Q	-	1	0	KCNK5	39267312	0.997000	0.39634	0.848000	0.33437	0.146000	0.21551	4.384000	0.59607	1.233000	0.43693	0.561000	0.74099	CAG	.	.	.	none		0.547	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040449.1	NM_003740	
MB21D1	115004	hgsc.bcm.edu	37	6	74135070	74135070	+	Silent	SNP	A	A	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr6:74135070A>G	ENST00000370315.3	-	5	1543	c.1449T>C	c.(1447-1449)taT>taC	p.Y483Y	MB21D1_ENST00000370318.1_Intron	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	483					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						CAGGAATAAAATAATTCTCAA	0.373																																					p.Y483Y		Atlas-SNP	.											.	MB21D1	33	.	0			c.T1449C						PASS	.						54.0	54.0	54.0					6																	74135070		2203	4300	6503	SO:0001819	synonymous_variant	115004	exon5			AATAAAATAATTC	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1449T>C	chr6.hg19:g.74135070A>G		73.0	0.0	.		39.0	17.0	.	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Silent	SNP	ENST00000370315.3	hg19	CCDS4978.1																																																																																			.	.	.	none		0.373	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		94.0	0.0	.		71.0	5.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
CPED1	79974	hgsc.bcm.edu	37	7	120629777	120629777	+	Silent	SNP	C	C	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr7:120629777C>G	ENST00000310396.5	+	2	569	c.102C>G	c.(100-102)acC>acG	p.T34T	CPED1_ENST00000450913.2_Silent_p.T34T|CPED1_ENST00000340646.5_Silent_p.T34T|CPED1_ENST00000495036.1_3'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	34						endoplasmic reticulum (GO:0005783)											AGACTCTGACCCTCCGAGGGT	0.587																																					p.T34T		Atlas-SNP	.											.	.	.	.	0			c.C102G						PASS	.						112.0	107.0	109.0					7																	120629777		2203	4300	6503	SO:0001819	synonymous_variant	79974	exon1			TCTGACCCTCCGA		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.102C>G	chr7.hg19:g.120629777C>G		146.0	0.0	.		86.0	36.0	.	NM_001105533	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	hg19	CCDS34739.1																																																																																			.	.	.	none		0.587	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
PTPRZ1	5803	hgsc.bcm.edu	37	7	121679512	121679512	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr7:121679512A>T	ENST00000393386.2	+	20	5918	c.5507A>T	c.(5506-5508)aAa>aTa	p.K1836I	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.K969I	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1836	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TTGCAGAGAAAATGTGATCAG	0.423																																					p.K1836I		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.A5507T						PASS	.						84.0	83.0	84.0					7																	121679512		2203	4300	6503	SO:0001583	missense	5803	exon20			AGAGAAAATGTGA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5507A>T	chr7.hg19:g.121679512A>T	ENSP00000377047:p.Lys1836Ile	82.0	0.0	.		65.0	35.0	.	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	hg19	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.982726	0.93044	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.21361	2.01;2.01	5.88	5.88	0.94601	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	H	0.96460	3.825	0.80722	D	1	D;P;P	0.76494	0.999;0.503;0.674	D;P;P	0.85130	0.997;0.843;0.802	T	0.75169	-0.3412	10	0.87932	D	0	.	16.3015	0.82820	1.0:0.0:0.0:0.0	.	975;969;1836	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	I	1836;969	ENSP00000377047:K1836I;ENSP00000410000:K969I	ENSP00000377047:K1836I	K	+	2	0	PTPRZ1	121466748	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.195000	0.72088	2.239000	0.73571	0.533000	0.62120	AAA	.	.	.	none		0.423	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
SF3B2	10992	hgsc.bcm.edu	37	11	65829382	65829382	+	Silent	SNP	C	C	A	rs559206953		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr11:65829382C>A	ENST00000322535.6	+	16	1939	c.1890C>A	c.(1888-1890)ccC>ccA	p.P630P	SF3B2_ENST00000528302.1_Silent_p.P613P	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	630					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AGGTCCCTCCCCCATGGCTGA	0.562																																					p.P630P		Atlas-SNP	.											.	SF3B2	85	.	0			c.C1890A						PASS	.						115.0	109.0	111.0					11																	65829382		2201	4295	6496	SO:0001819	synonymous_variant	10992	exon16			CCCTCCCCCATGG	U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1890C>A	chr11.hg19:g.65829382C>A		64.0	0.0	.		38.0	20.0	.	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	hg19	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	C	6.177	0.400770	0.11696	.	.	ENSG00000087365	ENST00000530981	.	.	.	5.8	-0.975	0.10289	.	0.105145	0.64402	D	0.000003	T	0.53916	0.1826	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51212	-0.8734	6	0.87932	D	0	-15.3896	2.3521	0.04286	0.1231:0.3008:0.3612:0.2149	.	.	.	.	H	51	.	ENSP00000436757:P51H	P	+	2	0	SF3B2	65585958	0.832000	0.29368	0.923000	0.36655	0.530000	0.34684	-0.126000	0.10563	-0.166000	0.10890	0.650000	0.86243	CCC	.	.	.	none		0.562	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
ARAP1	116985	hgsc.bcm.edu	37	11	72406598	72406598	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr11:72406598T>C	ENST00000393609.3	-	25	3698	c.3496A>G	c.(3496-3498)Agt>Ggt	p.S1166G	ARAP1_ENST00000393605.3_Missense_Mutation_p.S926G|ARAP1_ENST00000359373.5_Missense_Mutation_p.S1166G|ARAP1_ENST00000495878.1_5'UTR|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000426523.1_Missense_Mutation_p.S921G|ARAP1_ENST00000334211.8_Missense_Mutation_p.S921G|ARAP1_ENST00000455638.2_Missense_Mutation_p.S1166G|ARAP1_ENST00000429686.1_Missense_Mutation_p.S860G	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1166					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGGGTCCCACTGGCAGTGCCA	0.647																																					p.S1166G	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-SNP	.											.	ARAP1	168	.	0			c.A3496G						PASS	.						46.0	44.0	45.0					11																	72406598		2200	4293	6493	SO:0001583	missense	116985	exon25			TCCCACTGGCAGT	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3496A>G	chr11.hg19:g.72406598T>C	ENSP00000377233:p.Ser1166Gly	69.0	0.0	.		30.0	12.0	.	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	ENST00000393609.3	hg19	CCDS41687.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846485	0.51164	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686	T;T;T;T;T;T;T	0.07327	3.21;3.21;3.22;3.27;3.2;3.27;3.23	4.43	4.43	0.53597	.	0.300288	0.30419	N	0.009674	T	0.07007	0.0178	N	0.08118	0	0.34771	D	0.733746	B;P;P;B;B	0.50943	0.026;0.92;0.94;0.033;0.056	B;B;P;B;B	0.47402	0.01;0.422;0.546;0.028;0.031	T	0.35251	-0.9796	10	0.62326	D	0.03	.	12.6484	0.56748	0.0:0.0:0.0:1.0	.	921;860;1166;1166;926	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	G	1166;1166;926;921;1166;921;860	ENSP00000352332:S1166G;ENSP00000390461:S1166G;ENSP00000377230:S926G;ENSP00000335506:S921G;ENSP00000377233:S1166G;ENSP00000392264:S921G;ENSP00000403127:S860G	ENSP00000335506:S921G	S	-	1	0	ARAP1	72084246	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.593000	0.67550	1.875000	0.54330	0.377000	0.23210	AGT	.	.	.	none		0.647	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
CAPZA3	93661	hgsc.bcm.edu	37	12	18892035	18892035	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr12:18892035T>A	ENST00000317658.3	+	1	991	c.833T>A	c.(832-834)cTg>cAg	p.L278Q	PLCZ1_ENST00000435379.1_5'Flank|PLCZ1_ENST00000539875.1_5'Flank|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000266505.7_5'Flank|PLCZ1_ENST00000447925.2_5'Flank	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3	278					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				GACTTGAATCTGGTGATGTAT	0.393																																					p.L278Q		Atlas-SNP	.											.	CAPZA3	51	.	0			c.T833A						PASS	.						51.0	53.0	52.0					12																	18892035		2200	4287	6487	SO:0001583	missense	93661	exon1			TGAATCTGGTGAT	AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001	ENST00000317658.3:c.833T>A	chr12.hg19:g.18892035T>A	ENSP00000326238:p.Leu278Gln	135.0	0.0	.		83.0	35.0	.	NM_033328	Q969J0	Missense_Mutation	SNP	ENST00000317658.3	hg19	CCDS8681.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.824365	0.50739	.	.	ENSG00000177938	ENST00000317658	.	.	.	4.54	3.39	0.38822	.	0.000000	0.28088	U	0.016650	T	0.34395	0.0896	N	0.08118	0	0.33519	D	0.592145	P	0.49783	0.928	P	0.56612	0.802	T	0.50311	-0.8843	9	0.87932	D	0	-8.2508	7.6761	0.28486	0.0:0.0985:0.0:0.9015	.	278	Q96KX2	CAZA3_HUMAN	Q	278	.	ENSP00000326238:L278Q	L	+	2	0	CAPZA3	18783302	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	4.188000	0.58351	0.778000	0.33520	0.379000	0.24179	CTG	.	.	.	none		0.393	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401902.1	NM_033328	
MTUS2	23281	hgsc.bcm.edu	37	13	29600351	29600351	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr13:29600351G>A	ENST00000431530.3	+	1	1604	c.1546G>A	c.(1546-1548)Gtt>Att	p.V516I		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	506						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CACCACATCTGTTGCTGAAAA	0.507																																					p.V516I		Atlas-SNP	.											.	MTUS2	279	.	0			c.G1546A						PASS	.						85.0	89.0	88.0					13																	29600351		1967	4155	6122	SO:0001583	missense	23281	exon1			ACATCTGTTGCTG	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.1546G>A	chr13.hg19:g.29600351G>A	ENSP00000392057:p.Val516Ile	79.0	0.0	.		56.0	25.0	.	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	hg19	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	g	11.63	1.695795	0.30052	.	.	ENSG00000132938	ENST00000431530	T	0.14266	2.52	5.39	1.52	0.23074	.	0.415389	0.20061	N	0.100094	T	0.10637	0.0260	L	0.51422	1.61	0.09310	N	1	B	0.23185	0.081	B	0.15484	0.013	T	0.25222	-1.0138	9	.	.	.	.	5.784	0.18322	0.2147:0.2602:0.5251:0.0	.	506	Q5JR59	MTUS2_HUMAN	I	516	ENSP00000392057:V516I	.	V	+	1	0	MTUS2	28498351	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.241000	0.18065	0.388000	0.25054	-0.175000	0.13238	GTT	.	.	.	none		0.507	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
NBEA	26960	hgsc.bcm.edu	37	13	35733740	35733740	+	Silent	SNP	A	A	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr13:35733740A>C	ENST00000400445.3	+	22	3966	c.3432A>C	c.(3430-3432)acA>acC	p.T1144T	NBEA_ENST00000310336.4_Silent_p.T1144T|NBEA_ENST00000379939.2_Silent_p.T1144T|NBEA_ENST00000540320.1_Silent_p.T1144T	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1144					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ATAGTAGTACATCATTTCTCT	0.333																																					p.T1144T		Atlas-SNP	.											.	NBEA	340	.	0			c.A3432C						PASS	.						48.0	44.0	45.0					13																	35733740		1841	4085	5926	SO:0001819	synonymous_variant	26960	exon22			TAGTACATCATTT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.3432A>C	chr13.hg19:g.35733740A>C		33.0	0.0	.		34.0	5.0	.	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	hg19	CCDS45026.1																																																																																			.	.	.	none		0.333	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
TXNDC16	57544	hgsc.bcm.edu	37	14	52907333	52907333	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr14:52907333G>C	ENST00000281741.4	-	19	2323	c.1952C>G	c.(1951-1953)aCa>aGa	p.T651R	TXNDC16_ENST00000554399.1_5'UTR	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	651					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					CTTTACCAGTGTCAATATTGC	0.308																																					p.T651R		Atlas-SNP	.											.	TXNDC16	59	.	0			c.C1952G						PASS	.						81.0	77.0	78.0					14																	52907333		2203	4297	6500	SO:0001583	missense	57544	exon19			ACCAGTGTCAATA	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1952C>G	chr14.hg19:g.52907333G>C	ENSP00000281741:p.Thr651Arg	44.0	0.0	.		39.0	4.0	.	NM_020784	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	ENST00000281741.4	hg19	CCDS32083.1	.	.	.	.	.	.	.	.	.	.	G	0.336	-0.953307	0.02285	.	.	ENSG00000087301	ENST00000281741	T	0.28666	1.6	5.29	-2.77	0.05877	.	0.845265	0.10716	N	0.642273	T	0.10121	0.0248	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.29181	-1.0020	10	0.17832	T	0.49	-16.9969	0.0038	0.00000	0.287:0.2064:0.2084:0.2982	.	646;651	B7ZME4;Q9P2K2	.;TXD16_HUMAN	R	651	ENSP00000281741:T651R	ENSP00000281741:T651R	T	-	2	0	TXNDC16	51977083	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-1.373000	0.02568	-0.539000	0.06273	-0.216000	0.12614	ACA	.	.	.	none		0.308	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411681.1	XM_051699	
MORF4L1	10933	hgsc.bcm.edu	37	15	79185887	79185887	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr15:79185887T>C	ENST00000331268.5	+	10	868	c.664T>C	c.(664-666)Tat>Cat	p.Y222H	MORF4L1_ENST00000379535.4_Missense_Mutation_p.Y208H|MORF4L1_ENST00000426013.2_Missense_Mutation_p.Y183H|MORF4L1_ENST00000558746.1_Missense_Mutation_p.Y156H|MORF4L1_ENST00000559345.1_Missense_Mutation_p.Y95H|MORF4L1_ENST00000561171.1_Intron|MORF4L1_ENST00000558502.1_Missense_Mutation_p.Y95H	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1	222	Interaction with RB1-1.|MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.|Sufficient for interaction with PHF12.|Sufficient for interaction with SIN3A.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						ATAGCTCTTTTATCTTCCTGC	0.299																																					p.Y222H		Atlas-SNP	.											.	MORF4L1	26	.	0			c.T664C						PASS	.						67.0	71.0	70.0					15																	79185887		2196	4288	6484	SO:0001583	missense	10933	exon10			CTCTTTTATCTTC	AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.664T>C	chr15.hg19:g.79185887T>C	ENSP00000331310:p.Tyr222His	102.0	0.0	.		96.0	33.0	.	NM_206839	B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	Missense_Mutation	SNP	ENST00000331268.5	hg19	CCDS10307.1	.	.	.	.	.	.	.	.	.	.	T	8.246	0.807960	0.16467	.	.	ENSG00000185787	ENST00000379535;ENST00000426013;ENST00000331268	T;T;T	0.09163	3.01;3.01;3.01	4.72	4.72	0.59763	.	0.113729	0.64402	D	0.000011	T	0.06005	0.0156	N	0.10874	0.06	0.39713	D	0.971363	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.27706	-1.0066	10	0.44086	T	0.13	-22.6224	8.8633	0.35272	0.1672:0.0:0.0:0.8328	.	183;222	Q9UBU8-2;Q9UBU8	.;MO4L1_HUMAN	H	208;183;222	ENSP00000368850:Y208H;ENSP00000408880:Y183H;ENSP00000331310:Y222H	ENSP00000331310:Y222H	Y	+	1	0	MORF4L1	76972942	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.625000	0.61262	1.902000	0.55061	0.459000	0.35465	TAT	.	.	.	none		0.299	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000290131.4	NM_006791	
FLYWCH2	114984	hgsc.bcm.edu	37	16	2946458	2946458	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr16:2946458T>G	ENST00000396958.3	+	3	388	c.8T>G	c.(7-9)cTg>cGg	p.L3R	FLYWCH2_ENST00000293981.6_Missense_Mutation_p.L3R|FLYWCH2_ENST00000572006.1_Missense_Mutation_p.L3R	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	3							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						GGGATGCCCCTGCCCGAGCCC	0.672																																					p.L3R		Atlas-SNP	.											.	FLYWCH2	12	.	0			c.T8G						PASS	.						28.0	35.0	32.0					16																	2946458		2197	4300	6497	SO:0001583	missense	114984	exon3			TGCCCCTGCCCGA	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.8T>G	chr16.hg19:g.2946458T>G	ENSP00000380159:p.Leu3Arg	45.0	0.0	.		33.0	11.0	.	NM_001142499		Missense_Mutation	SNP	ENST00000396958.3	hg19	CCDS10482.1	.	.	.	.	.	.	.	.	.	.	T	8.600	0.886580	0.17540	.	.	ENSG00000162076	ENST00000396958;ENST00000293981	.	.	.	3.6	2.48	0.30137	.	0.351696	0.16312	N	0.219949	T	0.25121	0.0610	L	0.32530	0.975	0.24368	N	0.994842	P	0.44044	0.825	B	0.39935	0.314	T	0.11470	-1.0586	9	0.87932	D	0	.	6.3825	0.21542	0.2172:0.0:0.0:0.7828	.	3	Q96CP2	FWCH2_HUMAN	R	3	.	ENSP00000293981:L3R	L	+	2	0	FLYWCH2	2886459	0.936000	0.31750	0.877000	0.34402	0.638000	0.38207	0.665000	0.25083	0.717000	0.32145	0.334000	0.21626	CTG	.	.	.	none		0.672	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439	
FLYWCH2	114984	hgsc.bcm.edu	37	16	2946461	2946461	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr16:2946461C>A	ENST00000396958.3	+	3	391	c.11C>A	c.(10-12)cCc>cAc	p.P4H	FLYWCH2_ENST00000293981.6_Missense_Mutation_p.P4H|FLYWCH2_ENST00000572006.1_Missense_Mutation_p.P4H	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	4							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						ATGCCCCTGCCCGAGCCCAGC	0.672																																					p.P4H		Atlas-SNP	.											.	FLYWCH2	12	.	0			c.C11A						PASS	.						28.0	36.0	33.0					16																	2946461		2197	4300	6497	SO:0001583	missense	114984	exon3			CCCTGCCCGAGCC	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.11C>A	chr16.hg19:g.2946461C>A	ENSP00000380159:p.Pro4His	49.0	0.0	.		40.0	14.0	.	NM_001142499		Missense_Mutation	SNP	ENST00000396958.3	hg19	CCDS10482.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050286	0.36181	.	.	ENSG00000162076	ENST00000396958;ENST00000293981	.	.	.	3.6	3.6	0.41247	.	0.236227	0.22090	N	0.064771	T	0.45316	0.1336	L	0.34521	1.04	0.21697	N	0.999582	D	0.65815	0.995	P	0.57468	0.821	T	0.26121	-1.0112	9	0.87932	D	0	.	11.0322	0.47781	0.0:1.0:0.0:0.0	.	4	Q96CP2	FWCH2_HUMAN	H	4	.	ENSP00000293981:P4H	P	+	2	0	FLYWCH2	2886462	0.035000	0.19736	0.510000	0.27712	0.655000	0.38815	1.813000	0.38962	2.322000	0.78497	0.407000	0.27541	CCC	.	.	.	none		0.672	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439	
RBBP6	5930	hgsc.bcm.edu	37	16	24582258	24582258	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr16:24582258A>C	ENST00000319715.4	+	18	4303	c.3871A>C	c.(3871-3873)Act>Cct	p.T1291P	RBBP6_ENST00000381039.3_Missense_Mutation_p.T451P|RBBP6_ENST00000348022.2_Missense_Mutation_p.T1257P	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1291					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		TACAAAGCGAACTGTGATTAA	0.343																																					p.T1291P		Atlas-SNP	.											.	RBBP6	158	.	0			c.A3871C						PASS	.						44.0	43.0	43.0					16																	24582258		2197	4300	6497	SO:0001583	missense	5930	exon18			AAGCGAACTGTGA		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.3871A>C	chr16.hg19:g.24582258A>C	ENSP00000317872:p.Thr1291Pro	103.0	0.0	.		63.0	26.0	.	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	hg19	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	A	16.89	3.248060	0.59103	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.34667	1.35;1.46;1.36	5.6	5.6	0.85130	.	0.161807	0.42420	D	0.000707	T	0.49406	0.1555	L	0.32530	0.975	0.47621	D	0.999476	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.997;0.994	T	0.40794	-0.9544	10	0.35671	T	0.21	-16.9171	16.0786	0.80985	1.0:0.0:0.0:0.0	.	451;1257;1291	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	P	451;1291;1257	ENSP00000370427:T451P;ENSP00000317872:T1291P;ENSP00000316291:T1257P	ENSP00000317872:T1291P	T	+	1	0	RBBP6	24489759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.465000	0.80898	2.254000	0.74563	0.460000	0.39030	ACT	.	.	.	none		0.343	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E|PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																					p.E322E		Atlas-SNP	.											PRKCSH,caecum,carcinoma,0,1	PRKCSH	55	.	1	Deletion - In frame(1)	central_nervous_system(1)	c.G966A						PASS	.						27.0	27.0	27.0					19																	11558370		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAAGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	chr19.hg19:g.11558370G>A		19.0	2.0	.		13.0	4.0	.	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	hg19	CCDS32911.1																																																																																			.	.	.	weak		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
ZNF700	90592	hgsc.bcm.edu	37	19	12060128	12060128	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr19:12060128C>T	ENST00000254321.5	+	4	1432	c.1289C>T	c.(1288-1290)gCc>gTc	p.A430V	ZNF700_ENST00000482090.1_Missense_Mutation_p.A412V|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TTCAGATCTGCCTCACAGCTT	0.473																																					p.A433V		Atlas-SNP	.											.	ZNF700	81	.	0			c.C1298T						PASS	.						91.0	82.0	85.0					19																	12060128		2203	4300	6503	SO:0001583	missense	90592	exon4			GATCTGCCTCACA	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1289C>T	chr19.hg19:g.12060128C>T	ENSP00000254321:p.Ala430Val	75.0	0.0	.		63.0	24.0	.	NM_001271848	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	hg19	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	c	4.742	0.138029	0.09083	.	.	ENSG00000196757	ENST00000254321	T	0.34072	1.38	0.606	0.606	0.17559	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17450	0.0419	N	0.16708	0.43	0.09310	N	1	B	0.27910	0.193	B	0.21708	0.036	T	0.23868	-1.0176	9	0.17832	T	0.49	.	5.5675	0.17179	0.3178:0.6822:0.0:0.0	.	430	Q9H0M5	ZN700_HUMAN	V	430	ENSP00000254321:A430V	ENSP00000254321:A430V	A	+	2	0	ZNF700	11921128	0.000000	0.05858	0.001000	0.08648	0.090000	0.18270	-0.886000	0.04157	0.577000	0.29470	0.195000	0.17529	GCC	.	.	.	none		0.473	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
PLEKHG2	64857	hgsc.bcm.edu	37	19	39914552	39914552	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr19:39914552C>G	ENST00000409794.3	+	19	3629	c.2779C>G	c.(2779-2781)Ctt>Gtt	p.L927V	PLEKHG2_ENST00000458508.2_Missense_Mutation_p.L868V|PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.L898V|PLEKHG2_ENST00000378550.1_Intron|CTB-60E11.4_ENST00000601124.1_lincRNA	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	927					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TAAGCAAGACCTTCCGGGCAT	0.577																																					p.L927V		Atlas-SNP	.											.	PLEKHG2	329	.	0			c.C2779G						PASS	.						75.0	73.0	74.0					19																	39914552		2203	4300	6503	SO:0001583	missense	64857	exon19			CAAGACCTTCCGG	AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.2779C>G	chr19.hg19:g.39914552C>G	ENSP00000386733:p.Leu927Val	108.0	0.0	.		80.0	32.0	.	NM_022835	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	ENST00000409794.3	hg19	CCDS33022.2	.	.	.	.	.	.	.	.	.	.	C	6.255	0.415175	0.11870	.	.	ENSG00000090924	ENST00000409794;ENST00000425673;ENST00000458508	T;T;T	0.69306	-0.26;-0.28;-0.39	4.94	2.56	0.30785	.	1.430940	0.04629	N	0.403390	T	0.50905	0.1643	N	0.08118	0	0.41040	D	0.985222	B;B;B	0.12630	0.003;0.002;0.006	B;B;B	0.06405	0.002;0.001;0.001	T	0.27606	-1.0069	10	0.72032	D	0.01	.	11.6779	0.51440	0.0:0.5758:0.4242:0.0	.	898;927;868	Q9H7P9-3;Q9H7P9;E7ESZ3	.;PKHG2_HUMAN;.	V	927;898;868	ENSP00000386733:L927V;ENSP00000392906:L898V;ENSP00000408857:L868V	ENSP00000386733:L927V	L	+	1	0	PLEKHG2	44606392	0.001000	0.12720	0.688000	0.30117	0.059000	0.15707	1.112000	0.31172	1.207000	0.43291	0.655000	0.94253	CTT	.	.	.	none		0.577	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326802.1	NM_022835	
ZNF45	7596	hgsc.bcm.edu	37	19	44418234	44418234	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr19:44418234C>T	ENST00000269973.5	-	10	2444	c.1354G>A	c.(1354-1356)Ggc>Agc	p.G452S	ZNF45_ENST00000589703.1_Missense_Mutation_p.G452S|RP11-15A1.2_ENST00000586247.1_RNA	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	452					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						TGGCTGAAGCCCTTGCCACAC	0.483																																					p.G452S		Atlas-SNP	.											.	ZNF45	51	.	0			c.G1354A						PASS	.						62.0	63.0	63.0					19																	44418234		2203	4300	6503	SO:0001583	missense	7596	exon10			TGAAGCCCTTGCC	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1354G>A	chr19.hg19:g.44418234C>T	ENSP00000269973:p.Gly452Ser	128.0	0.0	.		71.0	23.0	.	NM_003425	P17016|P78472|Q9P1U9	Missense_Mutation	SNP	ENST00000269973.5	hg19	CCDS12632.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692770	0.48202	.	.	ENSG00000124459	ENST00000269973	T	0.35421	1.31	3.62	3.62	0.41486	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37178	N	0.002211	T	0.17023	0.0409	N	0.01122	-1.005	0.26498	N	0.974814	B	0.34349	0.45	B	0.42995	0.404	T	0.15464	-1.0436	10	0.44086	T	0.13	-11.8092	10.0287	0.42087	0.2022:0.7977:0.0:0.0	.	452	Q02386	ZNF45_HUMAN	S	452	ENSP00000269973:G452S	ENSP00000269973:G452S	G	-	1	0	ZNF45	49110074	0.000000	0.05858	0.984000	0.44739	0.830000	0.47004	0.090000	0.15025	2.030000	0.59900	0.462000	0.41574	GGC	.	.	.	none		0.483	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
SLC8A2	6543	hgsc.bcm.edu	37	19	47969527	47969527	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr19:47969527C>T	ENST00000236877.6	-	2	529	c.134G>A	c.(133-135)gGg>gAg	p.G45E	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	45					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GCGGTAGGACCCCTGGCAGCC	0.731																																					p.G45E		Atlas-SNP	.											.	SLC8A2	77	.	0			c.G134A						PASS	.						10.0	9.0	9.0					19																	47969527		2191	4277	6468	SO:0001583	missense	6543	exon2			TAGGACCCCTGGC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.134G>A	chr19.hg19:g.47969527C>T	ENSP00000236877:p.Gly45Glu	10.0	0.0	.		9.0	7.0	.	NM_015063	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	hg19	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525726	0.44969	.	.	ENSG00000118160	ENST00000236877	T	0.30448	1.53	4.25	3.19	0.36642	.	0.402651	0.22338	N	0.061364	T	0.23611	0.0571	L	0.51914	1.62	0.21782	N	0.999548	B	0.06786	0.001	B	0.06405	0.002	T	0.25433	-1.0132	10	0.10111	T	0.7	.	9.7772	0.40626	0.0:0.7898:0.2102:0.0	.	45	Q9UPR5	NAC2_HUMAN	E	45	ENSP00000236877:G45E	ENSP00000236877:G45E	G	-	2	0	SLC8A2	52661339	0.158000	0.22850	0.999000	0.59377	0.952000	0.60782	1.497000	0.35649	0.979000	0.38497	0.462000	0.41574	GGG	.	.	.	none		0.731	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
NAPB	63908	hgsc.bcm.edu	37	20	23370612	23370612	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr20:23370612A>G	ENST00000377026.4	-	7	617	c.532T>C	c.(532-534)Tac>Cac	p.Y178H	NAPB_ENST00000432543.2_Missense_Mutation_p.Y139H|NAPB_ENST00000398425.3_Missense_Mutation_p.Y84H|NAPB_ENST00000472855.1_5'UTR	NM_001283018.1|NM_001283020.1|NM_022080.2	NP_001269947.1|NP_001269949.1|NP_071363.1	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, beta	178					intracellular protein transport (GO:0006886)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	extracellular vesicular exosome (GO:0070062)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					GCTTTCTGGTACTGCTCAAGC	0.398																																					p.Y178H		Atlas-SNP	.											.	NAPB	22	.	0			c.T532C						PASS	.						101.0	99.0	99.0					20																	23370612		2203	4300	6503	SO:0001583	missense	63908	exon7			TCTGGTACTGCTC	AK022817	CCDS13152.1, CCDS63241.1, CCDS63242.1, CCDS74710.1	20p12.3-p11.21	2008-08-01			ENSG00000125814	ENSG00000125814			15751	protein-coding gene	gene with protein product		611270				8455721	Standard	NM_022080		Approved	SNAP-BETA, SNAPB	uc002wta.3	Q9H115	OTTHUMG00000032062	ENST00000377026.4:c.532T>C	chr20.hg19:g.23370612A>G	ENSP00000366225:p.Tyr178His	141.0	0.0	.		116.0	52.0	.	NM_022080	B4DK44|Q4G0M0|Q4G187|Q5JXF9|Q8N3C4	Missense_Mutation	SNP	ENST00000377026.4	hg19	CCDS13152.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.897519	0.91962	.	.	ENSG00000125814	ENST00000377026;ENST00000398425;ENST00000432543;ENST00000431864	T;T;T	0.48201	0.82;0.82;0.82	5.35	5.35	0.76521	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.77698	0.4169	H	0.97758	4.07	0.80722	D	1	D;D;D;D	0.65815	0.995;0.983;0.982;0.995	P;P;P;P	0.62435	0.902;0.82;0.848;0.902	D	0.86047	0.1523	10	0.87932	D	0	-17.6345	14.5087	0.67769	1.0:0.0:0.0:0.0	.	139;84;182;178	B4DK44;Q4G0M0;B4DIV0;Q9H115	.;.;.;SNAB_HUMAN	H	178;84;139;135	ENSP00000366225:Y178H;ENSP00000381459:Y84H;ENSP00000413600:Y139H	ENSP00000366225:Y178H	Y	-	1	0	NAPB	23318612	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.251000	0.95483	2.027000	0.59764	0.383000	0.25322	TAC	.	.	.	none		0.398	NAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078317.2	NM_022080	
RIPK4	54101	hgsc.bcm.edu	37	21	43161570	43161570	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr21:43161570C>A	ENST00000352483.2	-	9	1991	c.1927G>T	c.(1927-1929)Gtg>Ttg	p.V643L	RIPK4_ENST00000332512.3_Missense_Mutation_p.V595L|RIPK4_ENST00000542057.1_Missense_Mutation_p.V532L|RIPK4_ENST00000544709.1_Missense_Mutation_p.V532L|AP001615.9_ENST00000423276.1_RNA			P57078	RIPK4_HUMAN	receptor-interacting serine-threonine kinase 4	643					morphogenesis of an epithelium (GO:0002009)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TTCACACTCACCCCCGGCTGC	0.682																																					p.V595L		Atlas-SNP	.											.	RIPK4	151	.	0			c.G1783T						PASS	.						55.0	55.0	55.0					21																	43161570		2203	4298	6501	SO:0001583	missense	54101	exon8			CACTCACCCCCGG	AJ278016	CCDS13675.1	21q22.3	2013-01-10	2004-07-06	2004-07-06	ENSG00000183421	ENSG00000183421		"""Ankyrin repeat domain containing"""	496	protein-coding gene	gene with protein product	"""protein kinase C-associated kinase"", ""PKC-delta-interacting protein kinase"""	605706	"""ankyrin repeat domain 3"""	ANKRD3		10830953	Standard	NM_020639		Approved	DIK, ANKK2, RIP4, PKK	uc002yzn.1	P57078	OTTHUMG00000086770	ENST00000352483.2:c.1927G>T	chr21.hg19:g.43161570C>A	ENSP00000330161:p.Val643Leu	146.0	0.0	.		91.0	29.0	.	NM_020639	Q96KH0	Missense_Mutation	SNP	ENST00000352483.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.44|18.44	3.625278|3.625278	0.66901|0.66901	.|.	.|.	ENSG00000183421|ENSG00000183421	ENST00000330470|ENST00000332512;ENST00000352483;ENST00000544709;ENST00000542057	.|T;T;T;T	.|0.65364	.|2.4;2.4;-0.15;-0.15	4.89|4.89	3.99|3.99	0.46301|0.46301	.|.	.|0.235579	.|0.28694	.|N	.|0.014447	T|T	0.51007|0.51007	0.1649|0.1649	L|L	0.28504|0.28504	0.86|0.86	0.35928|0.35928	D|D	0.832337|0.832337	.|B	.|0.33940	.|0.433	.|B	.|0.33454	.|0.164	T|T	0.62101|0.62101	-0.6925|-0.6925	6|10	0.39692|0.62326	T|D	0.17|0.03	-26.51|-26.51	14.2846|14.2846	0.66238|0.66238	0.0:0.8502:0.1498:0.0|0.0:0.8502:0.1498:0.0	.|.	.|595	.|P57078-2	.|.	V|L	331|595;643;532;532	.|ENSP00000332454:V595L;ENSP00000330161:V643L;ENSP00000441754:V532L;ENSP00000442901:V532L	ENSP00000330975:G331V|ENSP00000332454:V595L	G|V	-|-	2|1	0|0	RIPK4|RIPK4	42034639|42034639	0.982000|0.982000	0.34865|0.34865	0.944000|0.944000	0.38274|0.38274	0.671000|0.671000	0.39405|0.39405	4.763000|4.763000	0.62257|0.62257	1.021000|1.021000	0.39600|0.39600	0.591000|0.591000	0.81541|0.81541	GGT|GTG	.	.	.	none		0.682	RIPK4-201	KNOWN	basic	protein_coding	protein_coding		NM_020639	
CCT8L2	150160	hgsc.bcm.edu	37	22	17073382	17073382	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr22:17073382C>T	ENST00000359963.3	-	1	318	c.59G>A	c.(58-60)aGg>aAg	p.R20K		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	20					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CGGGCTCTCCCTTGGGTTCAG	0.657																																					p.R20K		Atlas-SNP	.											.	CCT8L2	150	.	0			c.G59A						PASS	.						39.0	45.0	43.0					22																	17073382		2203	4300	6503	SO:0001583	missense	150160	exon1			CTCTCCCTTGGGT	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.59G>A	chr22.hg19:g.17073382C>T	ENSP00000353048:p.Arg20Lys	105.0	0.0	.		32.0	26.0	.	NM_014406	A4QPH3|Q9UJS3	Missense_Mutation	SNP	ENST00000359963.3	hg19	CCDS13738.1	.	.	.	.	.	.	.	.	.	.	c	0.015	-1.563933	0.00903	.	.	ENSG00000198445	ENST00000359963	T	0.55052	0.54	1.81	-1.91	0.07641	.	1.067860	0.07473	N	0.902516	T	0.23410	0.0566	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24333	-1.0163	10	0.02654	T	1	-1.1577	5.1497	0.15004	0.0:0.3187:0.0:0.6813	.	20	Q96SF2	TCPQM_HUMAN	K	20	ENSP00000353048:R20K	ENSP00000353048:R20K	R	-	2	0	CCT8L2	15453382	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.440000	0.02412	-0.377000	0.07930	0.393000	0.25936	AGG	.	.	.	none		0.657	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280580.1		
MT-CYB	4519	hgsc.bcm.edu	37	M	15713	15713	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chrM:15713T>C	ENST00000361789.2	+	1	967	c.967T>C	c.(967-969)Tca>Cca	p.S323P	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	323					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CACTAAGCCAATCACTTTATT	0.453																																					p.S323P		Atlas-SNP	.											.	.	.	.	0			c.T967C						PASS	.																																			SO:0001583	missense	0	exon1			AGCCAATCACTTT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.967T>C	chrM.hg19:g.15713T>C	ENSP00000354554:p.Ser323Pro	0.0	0.0	.		66.0	50.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	A|0.999;G|0.001	.	alt		0.453	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
LAMTOR4	389541	hgsc.bcm.edu	37	7	99746597	99746598	+	Start_Codon_Ins	INS	-	-	G			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr7:99746597_99746598insG	ENST00000341942.5	+	0	68_69				LAMTOR4_ENST00000441173.1_Start_Codon_Ins	NM_001008395.2	NP_001008396.1	Q0VGL1	LTOR4_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 4						cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											AAGACTGCGATGGTGAGTGAGG	0.658																																					p.M1fs		Atlas-INDEL	.											.	.	.	.	0			c.2_3insG						PASS	.																																			SO:0001582	initiator_codon_variant	389541	exon1			.		CCDS34702.1	7q22	2012-09-24	2012-09-24	2012-09-24	ENSG00000188186	ENSG00000188186			33772	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 59"""	C7orf59		22980980	Standard	NM_001008395		Approved		uc003utq.2	Q0VGL1	OTTHUMG00000154854	ENST00000341942.5:c.3dupG	chr7.hg19:g.99746599_99746599dupG		132.0	0.0	0		86.0	23.0	0.267442	NM_001008395		Frame_Shift_Ins	INS	ENST00000341942.5	hg19	CCDS34702.1																																																																																			.	.	.	none		0.658	LAMTOR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337373.2	NM_001008395	
TRPC5	7224	hgsc.bcm.edu	37	X	111090414	111090416	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chrX:111090414_111090416delTCA	ENST00000262839.2	-	6	2544_2546	c.1626_1628delTGA	c.(1624-1629)tatgaa>taa	p.542_543YE>*		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	542					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AGCTCTGGTTTCATAATAGAAGT	0.433																																					p.543_543del		Atlas-INDEL	.											.	TRPC5	142	.	0			c.1627_1629del						PASS	.																																			SO:0001651	inframe_deletion	7224	exon6			.	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1626_1628delTGA	chrX.hg19:g.111090414_111090416delTCA	ENSP00000262839:p.Tyr542_Glu543delins*	198.0	0.0	0		150.0	72.0	0.48	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	In_Frame_Del	DEL	ENST00000262839.2	hg19	CCDS14561.1																																																																																			.	.	.	none		0.433	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
FLYWCH2	114984	hgsc.bcm.edu	37	16	2946454	2946456	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr16:2946454_2946456delCCC	ENST00000396958.3	+	3	384_386	c.4_6delCCC	c.(4-6)cccdel	p.P2del	FLYWCH2_ENST00000293981.6_In_Frame_Del_p.P2del|FLYWCH2_ENST00000572006.1_In_Frame_Del_p.P2del	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2	2							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						TCCCGGGATGCCCCTGCCCGAGC	0.67																																					p.1_2del		Atlas-INDEL	.											.	FLYWCH2	12	.	0			c.3_5del						PASS	.																																			SO:0001651	inframe_deletion	114984	exon3			.	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.4_6delCCC	chr16.hg19:g.2946454_2946456delCCC	ENSP00000380159:p.Pro2del	42.0	0.0	0		29.0	11.0	0.37931	NM_001142499		In_Frame_Del	DEL	ENST00000396958.3	hg19	CCDS10482.1																																																																																			.	.	.	none		0.670	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250944.1	NM_138439	
HLA-DPB1	3115	hgsc.bcm.edu	37	6	33048613	33048613	+	Frame_Shift_Del	DEL	A	A	-	rs41550319		TCGA-G7-7501-01A-11D-2201-08	TCGA-G7-7501-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	37a54336-f21c-4e13-b4bb-c370f1e563c9	6bab150d-1510-4c7a-bb5d-ff665290e36a	g.chr6:33048613delA	ENST00000418931.2	+	2	381	c.265delA	c.(265-267)aacfs	p.N89fs	HLA-DPB1_ENST00000471184.1_3'UTR|HLA-DPB1_ENST00000535465.1_Frame_Shift_Del_p.N89fs|HLA-DPA1_ENST00000419277.1_5'Flank	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	89	Beta-1.		N -> H (in allele DPB1*02:03; dbSNP:rs41550319).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						GGAGTACTGGAACAGCCAGAA	0.657																																					p.W88X		Atlas-INDEL	.											.	HLA-DPB1	28	.	0			c.264delG						PASS	.						54.0	55.0	54.0					6																	33048613		1511	2709	4220	SO:0001589	frameshift_variant	3115	exon2			.		CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.265delA	chr6.hg19:g.33048613delA	ENSP00000408146:p.Asn89fs	91.0	0.0	0		56.0	12.0	0.214286	NM_002121	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Frame_Shift_Del	DEL	ENST00000418931.2	hg19	CCDS4765.1																																																																																			.	.	.	none		0.657	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076106.2	NM_002121	
