#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TRIM63	84676	hgsc.bcm.edu	37	1	26392820	26392820	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr1:26392820C>T	ENST00000374272.3	-	2	409	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	TRIM63_ENST00000483052.1_5'UTR	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	91	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTGCAGGCCGTACACTCCG	0.632																																					p.G91S		Atlas-SNP	.											.	TRIM63	33	.	0			c.G271A						PASS	.						115.0	85.0	95.0					1																	26392820		2203	4300	6503	SO:0001583	missense	84676	exon2			GCAGGCCGTACAC	AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.271G>A	chr1.hg19:g.26392820C>T	ENSP00000363390:p.Gly91Ser	82.0	0.0	.		48.0	23.0	.	NM_032588	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	ENST00000374272.3	hg19	CCDS273.1	.	.	.	.	.	.	.	.	.	.	C	36	5.648865	0.96714	.	.	ENSG00000158022	ENST00000374272	T	0.28454	1.61	5.64	5.64	0.86602	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	M	0.73430	2.235	0.80722	D	1	D	0.71674	0.998	D	0.64595	0.927	T	0.56823	-0.7915	10	0.54805	T	0.06	.	19.3141	0.94204	0.0:1.0:0.0:0.0	.	91	Q969Q1	TRI63_HUMAN	S	91	ENSP00000363390:G91S	ENSP00000363390:G91S	G	-	1	0	TRIM63	26265407	1.000000	0.71417	0.966000	0.40874	0.852000	0.48524	7.811000	0.86092	2.655000	0.90218	0.655000	0.94253	GGC	.	.	.	none		0.632	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019750.1	NM_032588	
ATXN7L2	127002	hgsc.bcm.edu	37	1	110031587	110031587	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr1:110031587G>A	ENST00000369870.3	+	7	917	c.902G>A	c.(901-903)gGg>gAg	p.G301E		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	301										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		AAGAGCCCAGGGCGCAAGGAG	0.647																																					p.G301E		Atlas-SNP	.											.	ATXN7L2	60	.	0			c.G902A						PASS	.						43.0	43.0	43.0					1																	110031587		2203	4300	6503	SO:0001583	missense	127002	exon7			GCCCAGGGCGCAA	BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.902G>A	chr1.hg19:g.110031587G>A	ENSP00000358886:p.Gly301Glu	77.0	0.0	.		74.0	42.0	.	NM_153340		Missense_Mutation	SNP	ENST00000369870.3	hg19	CCDS30794.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594207	0.28445	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.27890	1.64	5.97	3.96	0.45880	.	0.326224	0.26875	N	0.022059	T	0.07908	0.0198	L	0.36672	1.1	0.80722	D	1	P	0.38250	0.624	B	0.37267	0.245	T	0.06023	-1.0850	10	0.02654	T	1	-9.0894	9.0628	0.36444	0.0:0.3133:0.535:0.1516	.	301	Q5T6C5	AT7L2_HUMAN	E	301	ENSP00000358886:G301E	ENSP00000358886:G301E	G	+	2	0	ATXN7L2	109833110	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.864000	0.27926	1.496000	0.48567	0.655000	0.94253	GGG	.	.	.	none		0.647	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030331.1	NM_153340	
PRRC2C	23215	hgsc.bcm.edu	37	1	171501480	171501480	+	Splice_Site	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr1:171501480A>G	ENST00000338920.4	+	12	1485		c.e12-1		PRRC2C_ENST00000426496.2_Splice_Site|PRRC2C_ENST00000367742.3_Splice_Site|PRRC2C_ENST00000476522.1_Splice_Site|PRRC2C_ENST00000392078.3_Splice_Site	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C						hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TTAATGTTTCAGCATCCACCT	0.438																																					.		Atlas-SNP	.											.	.	.	.	0			c.1249-2A>G						PASS	.						40.0	38.0	39.0					1																	171501480		2203	4300	6503	SO:0001630	splice_region_variant	23215	exon12			TGTTTCAGCATCC	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1249-1A>G	chr1.hg19:g.171501480A>G		110.0	0.0	.		75.0	36.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Splice_Site	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.026744	0.75390	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRRC2C	169768104	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.321000	0.72881	2.308000	0.77769	0.533000	0.62120	.	.	.	.	none		0.438	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	Intron
CFHR2	3080	hgsc.bcm.edu	37	1	196927093	196927093	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr1:196927093A>G	ENST00000367415.5	+	4	603	c.503A>G	c.(502-504)tAt>tGt	p.Y168C	CFHR2_ENST00000496448.1_3'UTR|CFHR2_ENST00000367421.3_Missense_Mutation_p.Y168C|CFHR2_ENST00000476712.2_Missense_Mutation_p.Y152C	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	168	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TTGTCAGTATATGCTCCAGGT	0.408																																					p.Y168C		Atlas-SNP	.											.	CFHR2	73	.	0			c.A503G						PASS	.						170.0	154.0	160.0					1																	196927093		2203	4300	6503	SO:0001583	missense	3080	exon4			CAGTATATGCTCC	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.503A>G	chr1.hg19:g.196927093A>G	ENSP00000356385:p.Tyr168Cys	264.0	0.0	.		183.0	85.0	.	NM_005666	Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367415.5	hg19	CCDS30959.1	.	.	.	.	.	.	.	.	.	.	.	12.53	1.965546	0.34659	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	T;T	0.69926	-0.44;-0.44	4.25	3.09	0.35607	Complement control module (2);Sushi/SCR/CCP (3);	0.922642	0.08792	N	0.893138	D	0.88683	0.6503	H	0.99299	4.505	0.09310	N	1	D	0.89917	1.0	D	0.71656	0.974	T	0.73046	-0.4106	10	0.87932	D	0	.	8.9845	0.35986	0.8122:0.1878:0.0:0.0	.	168	P36980	FHR2_HUMAN	C	168	ENSP00000356391:Y168C;ENSP00000356385:Y168C	ENSP00000356385:Y168C	Y	+	2	0	CFHR2	195193716	0.931000	0.31567	0.003000	0.11579	0.004000	0.04260	5.025000	0.64097	0.465000	0.27167	-0.604000	0.04097	TAT	.	.	.	none		0.408	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088815.2	NM_005666	
ZBTB18	10472	hgsc.bcm.edu	37	1	244218407	244218407	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr1:244218407A>G	ENST00000358704.4	+	2	1480	c.1331A>G	c.(1330-1332)gAg>gGg	p.E444G		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	435					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CACTCGGGGGAGAAGCCCTAC	0.632																																					p.E444G		Atlas-SNP	.											.	.	.	.	0			c.A1331G						PASS	.						69.0	71.0	70.0					1																	244218407		2203	4300	6503	SO:0001583	missense	10472	exon2			CGGGGGAGAAGCC	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1331A>G	chr1.hg19:g.244218407A>G	ENSP00000351539:p.Glu444Gly	147.0	0.0	.		114.0	5.0	.	NM_205768	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	hg19	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	A	17.43	3.386591	0.61956	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.27557	1.66	5.68	5.68	0.88126	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.55893	0.1949	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.79108	0.992;0.986	T	0.59789	-0.7388	10	0.87932	D	0	.	15.9354	0.79698	1.0:0.0:0.0:0.0	.	435;444	Q99592;Q99592-2	ZN238_HUMAN;.	G	444	ENSP00000351539:E444G	ENSP00000351539:E444G	E	+	2	0	ZNF238	242285030	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.182000	0.69389	0.533000	0.62120	GAG	.	.	.	none		0.632	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
RMND5A	64795	hgsc.bcm.edu	37	2	86968117	86968117	+	Silent	SNP	T	T	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:86968117T>C	ENST00000283632.4	+	2	705	c.210T>C	c.(208-210)gaT>gaC	p.D70D		NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	70										kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						GAATAAAGGATACTGTTCAAA	0.388																																					p.D70D		Atlas-SNP	.											RMND5A,NS,carcinoma,0,1	RMND5A	33	.	0			c.T210C						PASS	.						98.0	92.0	94.0					2																	86968117		2201	4297	6498	SO:0001819	synonymous_variant	64795	exon2			AAAGGATACTGTT	BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.210T>C	chr2.hg19:g.86968117T>C		1255.0	0.0	.		971.0	225.0	.	NM_022780	D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Silent	SNP	ENST00000283632.4	hg19	CCDS1991.1																																																																																			.	.	.	none		0.388	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252591.2	NM_022780	
BAZ2B	29994	hgsc.bcm.edu	37	2	160295123	160295123	+	Silent	SNP	T	T	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:160295123T>A	ENST00000392783.2	-	8	1479	c.984A>T	c.(982-984)ccA>ccT	p.P328P	BAZ2B_ENST00000392782.1_Silent_p.P326P|BAZ2B_ENST00000355831.2_Silent_p.P328P|BAZ2B_ENST00000343439.5_Silent_p.P326P	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CAAGAGGTAATGGCTGGTGTA	0.423																																					p.P328P		Atlas-SNP	.											.	BAZ2B	196	.	0			c.A984T						PASS	.						184.0	184.0	184.0					2																	160295123		1845	4101	5946	SO:0001819	synonymous_variant	29994	exon8			AGGTAATGGCTGG	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.984A>T	chr2.hg19:g.160295123T>A		62.0	0.0	.		56.0	31.0	.	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Silent	SNP	ENST00000392783.2	hg19	CCDS2209.2																																																																																			.	.	.	none		0.423	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
TTC21B	79809	hgsc.bcm.edu	37	2	166785751	166785751	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:166785751A>C	ENST00000243344.7	-	11	1417	c.1280T>G	c.(1279-1281)tTt>tGt	p.F427C		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	427					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)				breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TAATTGTGAAAAGTGAGTGTC	0.328																																					p.F427C		Atlas-SNP	.											.	TTC21B	130	.	0			c.T1280G						PASS	.						68.0	71.0	70.0					2																	166785751		2202	4299	6501	SO:0001583	missense	79809	exon11			TGTGAAAAGTGAG	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1280T>G	chr2.hg19:g.166785751A>C	ENSP00000243344:p.Phe427Cys	355.0	0.0	.		316.0	137.0	.	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	hg19	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	a	17.10	3.304208	0.60305	.	.	ENSG00000123607	ENST00000243344	T	0.62498	0.02	5.38	5.38	0.77491	.	0.095949	0.64402	D	0.000001	T	0.79969	0.4538	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.68192	0.956;0.798	T	0.82796	-0.0280	10	0.59425	D	0.04	-10.2853	15.6905	0.77446	1.0:0.0:0.0:0.0	.	427;427	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	C	427	ENSP00000243344:F427C	ENSP00000243344:F427C	F	-	2	0	TTC21B	166493997	1.000000	0.71417	1.000000	0.80357	0.265000	0.26407	8.881000	0.92415	2.170000	0.68504	0.529000	0.55759	TTT	.	.	.	none		0.328	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
TTN	7273	hgsc.bcm.edu	37	2	179476842	179476842	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:179476842G>A	ENST00000591111.1	-	217	45597	c.45373C>T	c.(45373-45375)Cga>Tga	p.R15125*	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.R16766*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.R7893*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.R7826*|TTN_ENST00000460472.2_Nonsense_Mutation_p.R7701*|TTN_ENST00000342992.6_Nonsense_Mutation_p.R14198*			Q8WZ42	TITIN_HUMAN	titin	15125	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAACATGTCGTTTTGTCACA	0.403																																					p.R16766X		Atlas-SNP	.											.	TTN	18412	.	0			c.C50296T						PASS	.						106.0	94.0	98.0					2																	179476842		1874	4098	5972	SO:0001587	stop_gained	7273	exon267			CATGTCGTTTTGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45373C>T	chr2.hg19:g.179476842G>A	ENSP00000465570:p.Arg15125*	109.0	0.0	.		99.0	44.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	59	37.731312	0.99984	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	6.17	0.537	0.17144	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.6047	0.45388	0.0:0.1944:0.2015:0.604	.	.	.	.	X	14198;7701;7893;7826;7701	.	ENSP00000340554:R7893X	R	-	1	2	TTN	179185087	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	1.702000	0.37836	0.136000	0.18733	0.655000	0.94253	CGA	.	.	.	none		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PID1	55022	hgsc.bcm.edu	37	2	230127427	230127427	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:230127427A>G	ENST00000392054.3	-	2	434	c.95T>C	c.(94-96)tTa>tCa	p.L32S	PID1_ENST00000392055.3_Intron|PID1_ENST00000409462.1_Intron	NM_017933.4	NP_060403.3	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	0					cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		tccaaaatgtaaaggttggca	0.448																																					p.L32S		Atlas-SNP	.											.	PID1	43	.	0			c.T95C						PASS	.						154.0	158.0	156.0					2																	230127427		1327	2309	3636	SO:0001583	missense	55022	exon2			AAATGTAAAGGTT	AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000392054.3:c.95T>C	chr2.hg19:g.230127427A>G	ENSP00000375907:p.Leu32Ser	86.0	0.0	.		49.0	18.0	.	NM_017933	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Missense_Mutation	SNP	ENST00000392054.3	hg19	CCDS2471.1	.	.	.	.	.	.	.	.	.	.	A	12.48	1.951464	0.34471	.	.	ENSG00000153823	ENST00000392054	.	.	.	2.79	1.6	0.23607	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.09310	N	1	B	0.29301	0.241	B	0.29440	0.102	T	0.21518	-1.0243	6	.	.	.	.	5.1959	0.15236	0.7417:0.0:0.0:0.2583	.	32	Q7Z2X4-2	.	S	32	.	.	L	-	2	0	PID1	229835671	0.008000	0.16893	0.001000	0.08648	0.001000	0.01503	0.637000	0.24659	0.484000	0.27630	0.379000	0.24179	TTA	.	.	.	none		0.448	PID1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331809.1	NM_017933	
SLC26A6	65010	hgsc.bcm.edu	37	3	48664425	48664425	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:48664425G>T	ENST00000395550.2	-	18	2004	c.1957C>A	c.(1957-1959)Cca>Aca	p.P653T	SLC26A6_ENST00000420764.2_Missense_Mutation_p.P652T|SLC26A6_ENST00000455886.2_Missense_Mutation_p.P617T|SLC26A6_ENST00000383733.3_Missense_Mutation_p.P634T|SLC26A6_ENST00000337000.8_Missense_Mutation_p.P545T|SLC26A6_ENST00000358747.6_Missense_Mutation_p.P632T			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	653	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		GACCCATCTGGGGCCTTGGAG	0.597																																					p.P653T	NSCLC(13;369 479 28271 30152 44026)	Atlas-SNP	.											.	SLC26A6	45	.	0			c.C1957A						PASS	.						110.0	117.0	114.0					3																	48664425		2002	4171	6173	SO:0001583	missense	65010	exon18			CATCTGGGGCCTT	AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.1957C>A	chr3.hg19:g.48664425G>T	ENSP00000378920:p.Pro653Thr	87.0	0.0	.		94.0	59.0	.	NM_022911	B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	ENST00000395550.2	hg19	CCDS43087.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247190	0.59103	.	.	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886	D;D;D;D;D;D	0.93366	-3.03;-3.04;-3.12;-3.05;-3.03;-3.21	4.95	2.18	0.27775	Sulphate transporter/antisigma-factor antagonist STAS (3);	.	.	.	.	D	0.84813	0.5555	N	0.08118	0	0.18873	N	0.999989	P;B;P;B;P;B;B	0.43024	0.687;0.166;0.798;0.01;0.629;0.143;0.096	B;B;P;B;B;B;B	0.46299	0.439;0.138;0.511;0.015;0.446;0.142;0.089	T	0.75396	-0.3332	9	0.07030	T	0.85	.	8.6099	0.33795	0.3:0.0:0.7:0.0	.	617;647;545;634;652;653;4039	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	T	652;653;634;545;647;632;617	ENSP00000404684:P652T;ENSP00000378920:P653T;ENSP00000373239:P634T;ENSP00000337648:P545T;ENSP00000351597:P632T;ENSP00000401066:P617T	ENSP00000337648:P545T	P	-	1	0	SLC26A6	48639429	0.629000	0.27146	0.606000	0.28943	0.890000	0.51754	0.329000	0.19698	0.234000	0.21139	0.491000	0.48974	CCA	.	.	.	none		0.597	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345040.1	NM_022911	
SEMA3F	6405	hgsc.bcm.edu	37	3	50214250	50214250	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:50214250A>T	ENST00000002829.3	+	7	1083	c.599A>T	c.(598-600)aAg>aTg	p.K200M	SEMA3F_ENST00000413852.1_Missense_Mutation_p.K101M|SEMA3F_ENST00000434342.1_Missense_Mutation_p.K169M	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	200	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GGGAAGGGCAAGTGTCCGTAC	0.617																																					p.K200M		Atlas-SNP	.											.	SEMA3F	62	.	0			c.A599T						PASS	.						170.0	142.0	152.0					3																	50214250		2203	4300	6503	SO:0001583	missense	6405	exon7			AGGGCAAGTGTCC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.599A>T	chr3.hg19:g.50214250A>T	ENSP00000002829:p.Lys200Met	63.0	0.0	.		57.0	15.0	.	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	ENST00000002829.3	hg19	CCDS2811.1	.	.	.	.	.	.	.	.	.	.	A	31	5.066774	0.93898	.	.	ENSG00000001617	ENST00000414301;ENST00000450338;ENST00000413852;ENST00000002829;ENST00000434342;ENST00000420831	T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.141423	0.64402	D	0.000006	T	0.39911	0.1096	M	0.78801	2.425	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.31833	-0.9929	10	0.87932	D	0	.	15.4628	0.75373	1.0:0.0:0.0:0.0	.	169;200	C9JQ85;Q13275	.;SEM3F_HUMAN	M	169;169;101;200;169;133	ENSP00000392588:K169M;ENSP00000398399:K169M;ENSP00000388931:K101M;ENSP00000002829:K200M;ENSP00000409859:K169M;ENSP00000416356:K133M	ENSP00000002829:K200M	K	+	2	0	SEMA3F	50189254	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.120000	0.77153	2.190000	0.69967	0.459000	0.35465	AAG	.	.	.	none		0.617	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
CACNA2D3	55799	hgsc.bcm.edu	37	3	55018690	55018690	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:55018690A>G	ENST00000474759.1	+	30	2660	c.2612A>G	c.(2611-2613)tAc>tGc	p.Y871C	CACNA2D3_ENST00000415676.2_Missense_Mutation_p.Y871C|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.Y871C|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.Y777C	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	871						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TCTGAAGACTACACACAGGTG	0.343																																					p.Y871C		Atlas-SNP	.											.	CACNA2D3	159	.	0			c.A2612G						PASS	.						61.0	58.0	59.0					3																	55018690		1823	4082	5905	SO:0001583	missense	55799	exon30			AAGACTACACACA	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2612A>G	chr3.hg19:g.55018690A>G	ENSP00000419101:p.Tyr871Cys	83.0	0.0	.		93.0	70.0	.	NM_018398	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	hg19	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316289	0.60524	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.95	5.95	0.96441	.	0.355700	0.30639	N	0.009197	T	0.67392	0.2888	L	0.27053	0.805	0.38988	D	0.95908	P	0.43477	0.808	P	0.48873	0.593	T	0.69442	-0.5144	10	0.38643	T	0.18	.	14.9948	0.71421	1.0:0.0:0.0:0.0	.	871	Q8IZS8	CA2D3_HUMAN	C	871;871;871;777;777	ENSP00000389506:Y871C;ENSP00000419101:Y871C;ENSP00000288197:Y871C;ENSP00000417279:Y777C	ENSP00000288197:Y871C	Y	+	2	0	CACNA2D3	54993730	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	3.801000	0.55545	2.279000	0.76181	0.533000	0.62120	TAC	.	.	.	none		0.343	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
GTPBP8	29083	hgsc.bcm.edu	37	3	112709865	112709865	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:112709865C>T	ENST00000383678.2	+	1	101	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W	RP11-484K9.4_ENST00000609673.1_RNA|GTPBP8_ENST00000473129.1_5'Flank|GTPBP8_ENST00000383677.3_Missense_Mutation_p.R7W|GTPBP8_ENST00000467752.1_5'Flank	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	7					barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						GCCCGGGCTGCGGCTGGGAGC	0.632																																					p.R7W		Atlas-SNP	.											.	GTPBP8	22	.	0			c.C19T						PASS	.						15.0	22.0	20.0					3																	112709865		2168	4234	6402	SO:0001583	missense	29083	exon1			GGGCTGCGGCTGG	BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.19C>T	chr3.hg19:g.112709865C>T	ENSP00000373176:p.Arg7Trp	77.0	0.0	.		55.0	25.0	.	NM_138485	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	ENST00000383678.2	hg19	CCDS33820.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521196	0.64747	.	.	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485	T;T	0.46819	0.86;0.91	5.85	-0.347	0.12617	.	0.697407	0.13168	N	0.408513	T	0.27313	0.0670	N	0.21583	0.68	0.09310	N	0.999991	B;B	0.11235	0.004;0.003	B;B	0.08055	0.003;0.002	T	0.13656	-1.0501	10	0.41790	T	0.15	0.1747	3.9332	0.09294	0.2516:0.39:0.0:0.3583	.	7;7	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	W	7	ENSP00000373176:R7W;ENSP00000373175:R7W	ENSP00000295864:R7W	R	+	1	2	GTPBP8	114192555	0.000000	0.05858	0.001000	0.08648	0.131000	0.20780	-1.774000	0.01784	-0.108000	0.12066	0.491000	0.48974	CGG	.	.	.	none		0.632	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354260.2	NM_014170	
ALDH1L1	10840	hgsc.bcm.edu	37	3	125844500	125844500	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:125844500A>G	ENST00000393434.2	-	15	2108	c.1759T>C	c.(1759-1761)Tgc>Cgc	p.C587R	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.C587R|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.C597R|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.C486R|ALDH1L1_ENST00000393431.2_3'UTR	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	587	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GCAGCCAGGCAGGCAGCTGTC	0.572																																					p.C597R		Atlas-SNP	.											.	ALDH1L1	138	.	0			c.T1789C						PASS	.						96.0	85.0	88.0					3																	125844500		2203	4300	6503	SO:0001583	missense	10840	exon15			CCAGGCAGGCAGC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1759T>C	chr3.hg19:g.125844500A>G	ENSP00000377083:p.Cys587Arg	154.0	1.0	.		144.0	102.0	.	NM_001270364	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	hg19	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834548	0.71373	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	4.5	4.5	0.54988	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.25158	0.0611	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.994;0.995	T	0.00797	-1.1562	10	0.87932	D	0	.	11.7788	0.52001	1.0:0.0:0.0:0.0	.	486;587	E9PBX3;O75891	.;AL1L1_HUMAN	R	597;587;486;587	ENSP00000273450:C597R;ENSP00000420293:C587R;ENSP00000395881:C486R;ENSP00000377083:C587R	ENSP00000273450:C597R	C	-	1	0	ALDH1L1	127327190	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	8.421000	0.90259	1.881000	0.54492	0.482000	0.46254	TGC	.	.	.	none		0.572	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
SENP2	59343	hgsc.bcm.edu	37	3	185341841	185341841	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:185341841G>T	ENST00000296257.5	+	15	1822	c.1582G>T	c.(1582-1584)Gag>Tag	p.E528*	SENP2_ENST00000545472.1_Nonsense_Mutation_p.E518*|SENP2_ENST00000427465.2_Nonsense_Mutation_p.E352*	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	528	Protease.				cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			GAATCTTTTAGAGTGGACCCA	0.348																																					p.E528X		Atlas-SNP	.											.	SENP2	88	.	0			c.G1582T						PASS	.						140.0	134.0	136.0					3																	185341841		2203	4300	6503	SO:0001587	stop_gained	59343	exon15			CTTTTAGAGTGGA	AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.1582G>T	chr3.hg19:g.185341841G>T	ENSP00000296257:p.Glu528*	53.0	0.0	.		55.0	18.0	.	NM_021627	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Nonsense_Mutation	SNP	ENST00000296257.5	hg19	CCDS33902.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221146	0.79464	.	.	ENSG00000163904	ENST00000545472;ENST00000296257;ENST00000437107;ENST00000427465;ENST00000444509	.	.	.	5.84	5.84	0.93424	.	0.059916	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-29.0982	12.6115	0.56554	0.0:0.0:0.8347:0.1653	.	.	.	.	X	518;528;399;352;191	.	ENSP00000296257:E528X	E	+	1	0	SENP2	186824535	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	5.393000	0.66279	2.767000	0.95098	0.555000	0.69702	GAG	.	.	.	none		0.348	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345159.1	NM_021627	
JAKMIP1	152789	hgsc.bcm.edu	37	4	6107649	6107649	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:6107649C>T	ENST00000282924.5	-	3	660	c.175G>A	c.(175-177)Gag>Aag	p.E59K	JAKMIP1_ENST00000409831.1_Missense_Mutation_p.E59K|JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.E59K|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409371.3_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	59	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGCTCCTGCTCGCGCTCCAGC	0.667																																					p.E59K		Atlas-SNP	.											JAKMIP1_ENST00000409021,colon,carcinoma,0,2	JAKMIP1	250	.	0			c.G175A						PASS	.						27.0	27.0	27.0					4																	6107649		2164	4259	6423	SO:0001583	missense	152789	exon3			CCTGCTCGCGCTC	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.175G>A	chr4.hg19:g.6107649C>T	ENSP00000282924:p.Glu59Lys	92.0	0.0	.		33.0	14.0	.	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	hg19	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	C	31	5.078307	0.94000	.	.	ENSG00000152969	ENST00000409021;ENST00000418227;ENST00000425341;ENST00000282924;ENST00000409831	T;T;T	0.35789	1.29;1.29;1.29	3.93	3.93	0.45458	.	0.000000	0.64402	D	0.000007	T	0.60392	0.2265	M	0.79258	2.445	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.74023	0.92;0.982;0.92	T	0.67818	-0.5572	10	0.87932	D	0	.	15.4753	0.75474	0.0:1.0:0.0:0.0	.	59;59;59	F2Z2K5;Q96N16-2;Q96N16	.;.;JKIP1_HUMAN	K	59	ENSP00000386711:E59K;ENSP00000282924:E59K;ENSP00000386925:E59K	ENSP00000282924:E59K	E	-	1	0	JAKMIP1	6158550	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.172000	0.77604	2.166000	0.68216	0.484000	0.47621	GAG	.	.	.	none		0.667	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
WDR19	57728	hgsc.bcm.edu	37	4	39191388	39191388	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:39191388G>C	ENST00000399820.3	+	4	431	c.277G>C	c.(277-279)Gac>Cac	p.D93H	WDR19_ENST00000506503.1_Missense_Mutation_p.D93H|WDR19_ENST00000288634.7_5'UTR	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	93					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CAGCCAGTTAGACAATGGCAT	0.353																																					p.D93H		Atlas-SNP	.											.	WDR19	96	.	0			c.G277C						PASS	.						108.0	102.0	104.0					4																	39191388		1835	4094	5929	SO:0001583	missense	57728	exon4			CAGTTAGACAATG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.277G>C	chr4.hg19:g.39191388G>C	ENSP00000382717:p.Asp93His	114.0	0.0	.		93.0	50.0	.	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	hg19	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522217	0.85600	.	.	ENSG00000157796	ENST00000399820;ENST00000509560;ENST00000506503;ENST00000399836	T;T;T	0.28069	3.43;1.63;3.43	5.94	5.94	0.96194	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.124661	0.64402	D	0.000001	T	0.59445	0.2194	M	0.83118	2.625	0.80722	D	1	D;D	0.61697	0.99;0.989	P;P	0.62382	0.897;0.901	T	0.59343	-0.7472	10	0.49607	T	0.09	-25.4728	20.3593	0.98849	0.0:0.0:1.0:0.0	.	93;93	Q8NEZ3;D6R9P6	WDR19_HUMAN;.	H	93;34;93;92	ENSP00000382717:D93H;ENSP00000426918:D34H;ENSP00000423491:D93H	ENSP00000382717:D93H	D	+	1	0	WDR19	38867783	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.397000	0.97276	2.822000	0.97130	0.557000	0.71058	GAC	.	.	.	none		0.353	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
KIAA1211	57482	hgsc.bcm.edu	37	4	57182299	57182299	+	Silent	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:57182299C>T	ENST00000504228.1	+	6	2736	c.2631C>T	c.(2629-2631)gaC>gaT	p.D877D	KIAA1211_ENST00000264229.6_Silent_p.D877D|KIAA1211_ENST00000541073.1_Silent_p.D870D			Q6ZU35	K1211_HUMAN	KIAA1211	877										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GCACCGGAGACAGCGCGGATG	0.577																																					p.D877D		Atlas-SNP	.											.	KIAA1211	178	.	0			c.C2631T						PASS	.						39.0	48.0	45.0					4																	57182299		2186	4290	6476	SO:0001819	synonymous_variant	57482	exon8			CGGAGACAGCGCG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2631C>T	chr4.hg19:g.57182299C>T		79.0	0.0	.		62.0	31.0	.	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	hg19	CCDS43230.1																																																																																			.	.	.	none		0.577	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
CNOT6L	246175	hgsc.bcm.edu	37	4	78665898	78665898	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:78665898A>G	ENST00000504123.1	-	7	821	c.691T>C	c.(691-693)Tgt>Cgt	p.C231R	CNOT6L_ENST00000506166.1_Intron|CNOT6L_ENST00000264903.4_Missense_Mutation_p.C231R			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	231	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						TCTGCGTCACAGTTAACAATT	0.383																																					p.C231R		Atlas-SNP	.											.	CNOT6L	57	.	0			c.T691C						PASS	.						67.0	61.0	63.0					4																	78665898		1872	4120	5992	SO:0001583	missense	246175	exon7			CGTCACAGTTAAC	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.691T>C	chr4.hg19:g.78665898A>G	ENSP00000424896:p.Cys231Arg	93.0	0.0	.		48.0	20.0	.	NM_144571	Q9UF92	Missense_Mutation	SNP	ENST00000504123.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.99|17.99	3.523382|3.523382	0.64747|0.64747	.|.	.|.	ENSG00000138767|ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485|ENST00000515506	T;T;T|.	0.79940|.	-1.32;-1.32;-1.32|.	5.17|5.17	5.17|5.17	0.71159|0.71159	Endonuclease/exonuclease/phosphatase (2);|.	0.089945|.	0.85682|.	D|.	0.000000|.	T|T	0.39009|0.39009	0.1062|0.1062	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	P;B|.	0.40875|.	0.731;0.05|.	B;B|.	0.42692|.	0.395;0.125|.	T|T	0.32134|0.32134	-0.9918|-0.9918	10|5	0.33940|.	T|.	0.23|.	-18.9235|-18.9235	15.2936|15.2936	0.73885|0.73885	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	204;231|.	Q96LI5-2;Q96LI5|.	.;CNO6L_HUMAN|.	R|P	231;231;238|259	ENSP00000424896:C231R;ENSP00000264903:C231R;ENSP00000425571:C238R|.	ENSP00000264903:C231R|.	C|L	-|-	1|2	0|0	CNOT6L|CNOT6L	78884922|78884922	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.445000|7.445000	0.80570|0.80570	2.089000|2.089000	0.63090|0.63090	0.533000|0.533000	0.62120|0.62120	TGT|CTG	.	.	.	none		0.383	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1		
C4orf29	80167	hgsc.bcm.edu	37	4	128930118	128930118	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:128930118C>G	ENST00000444616.1	+	5	569	c.322C>G	c.(322-324)Cct>Gct	p.P108A	C4orf29_ENST00000388795.5_Missense_Mutation_p.P26A|C4orf29_ENST00000398965.1_Missense_Mutation_p.P108A			Q0P651	CD029_HUMAN	chromosome 4 open reading frame 29	108						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						CAAATATAGACCTGTATGCAT	0.294																																					p.P108A		Atlas-SNP	.											.	C4orf29	58	.	0			c.C322G						PASS	.						80.0	74.0	76.0					4																	128930118		1836	4092	5928	SO:0001583	missense	80167	exon5			TATAGACCTGTAT	AK024759	CCDS47131.1	4q28.2	2008-02-05			ENSG00000164074	ENSG00000164074			26111	protein-coding gene	gene with protein product						12477932	Standard	XM_006714318		Approved	FLJ21106	uc021xrt.1	Q0P651	OTTHUMG00000133304	ENST00000444616.1:c.322C>G	chr4.hg19:g.128930118C>G	ENSP00000397229:p.Pro108Ala	238.0	0.0	.		164.0	77.0	.	NM_001039717	A1A4W8|A1A4W9|Q9H7A7	Missense_Mutation	SNP	ENST00000444616.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.98	3.521110	0.64747	.	.	ENSG00000164074	ENST00000454347;ENST00000398965;ENST00000444616;ENST00000388795;ENST00000545758	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.77877	0.4196	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75502	-0.3295	9	0.33940	T	0.23	-28.3825	18.8831	0.92364	0.0:1.0:0.0:0.0	.	108	Q0P651	CD029_HUMAN	A	108;108;108;26;26	.	ENSP00000373447:P26A	P	+	1	0	C4orf29	129149568	1.000000	0.71417	0.621000	0.29145	0.249000	0.25844	7.215000	0.77966	2.521000	0.84997	0.650000	0.86243	CCT	.	.	.	none		0.294	C4orf29-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000257098.1	NM_001039717	
ZNF366	167465	hgsc.bcm.edu	37	5	71739912	71739912	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr5:71739912C>T	ENST00000318442.5	-	5	2396	c.1906G>A	c.(1906-1908)Gcc>Acc	p.A636T	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	636	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CTCTGGGGGGCCAGGCCAGGG	0.652																																					p.A636T		Atlas-SNP	.											.	ZNF366	108	.	0			c.G1906A						PASS	.						104.0	119.0	114.0					5																	71739912		2203	4300	6503	SO:0001583	missense	167465	exon5			GGGGGGCCAGGCC	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.1906G>A	chr5.hg19:g.71739912C>T	ENSP00000313158:p.Ala636Thr	75.0	0.0	.		63.0	28.0	.	NM_152625	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	hg19	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.997047	0.35226	.	.	ENSG00000178175	ENST00000318442	T	0.08546	3.08	5.77	1.25	0.21368	.	1.473160	0.03691	N	0.247014	T	0.05502	0.0145	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.39035	-0.9633	10	0.25751	T	0.34	-1.5524	1.3046	0.02085	0.2362:0.3835:0.2159:0.1644	.	636	Q8N895	ZN366_HUMAN	T	636	ENSP00000313158:A636T	ENSP00000313158:A636T	A	-	1	0	ZNF366	71775668	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.858000	0.27845	0.421000	0.25980	-0.176000	0.13171	GCC	.	.	.	none		0.652	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
HMGCR	3156	hgsc.bcm.edu	37	5	74643113	74643113	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr5:74643113A>G	ENST00000287936.4	+	6	691	c.535A>G	c.(535-537)Att>Gtt	p.I179V	HMGCR_ENST00000343975.5_Missense_Mutation_p.I179V|HMGCR_ENST00000511206.1_Missense_Mutation_p.I179V	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	179	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	ATGTCTTGTGATTGGAGTTGG	0.358																																					p.I179V		Atlas-SNP	.											.	HMGCR	53	.	0			c.A535G						PASS	.						310.0	283.0	292.0					5																	74643113		2203	4300	6503	SO:0001583	missense	3156	exon6			CTTGTGATTGGAG		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.535A>G	chr5.hg19:g.74643113A>G	ENSP00000287936:p.Ile179Val	131.0	0.0	.		91.0	37.0	.	NM_001130996	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	hg19	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.775303	0.70107	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	D;D;D	0.95690	-3.78;-3.78;-3.78	5.33	5.33	0.75918	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.96605	0.8892	L	0.55017	1.72	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.87578	0.998;0.996;0.997;0.998	D	0.95694	0.8743	10	0.29301	T	0.29	-25.0512	14.959	0.71141	1.0:0.0:0.0:0.0	.	179;179;179;179	B2R649;A8KA27;P04035-2;P04035	.;.;.;HMDH_HUMAN	V	179;110;179;179	ENSP00000426745:I179V;ENSP00000287936:I179V;ENSP00000340816:I179V	ENSP00000287936:I179V	I	+	1	0	HMGCR	74678869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.244000	0.95423	1.990000	0.58119	0.528000	0.53228	ATT	.	.	.	none		0.358	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
YTHDC2	64848	hgsc.bcm.edu	37	5	112860848	112860848	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr5:112860848G>C	ENST00000161863.4	+	3	662	c.449G>C	c.(448-450)aGa>aCa	p.R150T	YTHDC2_ENST00000515883.1_Missense_Mutation_p.R150T	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	150					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		AAAACAGAAAGAGGAAATGTG	0.348																																					p.R150T		Atlas-SNP	.											.	YTHDC2	118	.	0			c.G449C						PASS	.						114.0	118.0	116.0					5																	112860848		2202	4300	6502	SO:0001583	missense	64848	exon3			CAGAAAGAGGAAA	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.449G>C	chr5.hg19:g.112860848G>C	ENSP00000161863:p.Arg150Thr	210.0	0.0	.		152.0	79.0	.	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	hg19	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844331	0.51164	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000514720;ENST00000511372	T;T	0.07327	4.18;3.2	5.93	5.93	0.95920	.	0.157221	0.53938	D	0.000050	T	0.11836	0.0288	L	0.59436	1.845	0.38827	D	0.955758	B	0.26708	0.157	B	0.24394	0.053	T	0.02661	-1.1127	10	0.42905	T	0.14	.	15.4187	0.74995	0.068:0.0:0.932:0.0	.	150	Q9H6S0	YTDC2_HUMAN	T	150;150;90;60	ENSP00000161863:R150T;ENSP00000423101:R150T	ENSP00000161863:R150T	R	+	2	0	YTHDC2	112888747	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.170000	0.71920	2.805000	0.96524	0.655000	0.94253	AGA	.	.	.	none		0.348	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
JAKMIP2	9832	hgsc.bcm.edu	37	5	146991868	146991868	+	Splice_Site	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr5:146991868C>T	ENST00000265272.5	-	20	2880		c.e20+1		JAKMIP2_ENST00000333010.6_Splice_Site|JAKMIP2_ENST00000507386.1_Splice_Site	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2							Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGACACCTACCTTTTCTTCT	0.308																																					.		Atlas-SNP	.											.	JAKMIP2	154	.	0			c.2349+1G>A						PASS	.						131.0	122.0	125.0					5																	146991868		2203	4300	6503	SO:0001630	splice_region_variant	9832	exon20			CACCTACCTTTTC	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.2412+1G>A	chr5.hg19:g.146991868C>T		32.0	0.0	.		34.0	15.0	.	NM_001270934	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Splice_Site	SNP	ENST00000265272.5	hg19	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609318	0.87258	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4408	0.94820	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JAKMIP2	146972061	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.249000	0.78278	2.677000	0.91161	0.655000	0.94253	.	.	.	.	none		0.308	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	Intron
ZBTB12	221527	hgsc.bcm.edu	37	6	31868749	31868749	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:31868749T>G	ENST00000375527.2	-	2	509	c.334A>C	c.(334-336)Atg>Ctg	p.M112L	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						ACGTGCTCCATCTGCAGGTAG	0.567																																					p.M112L		Atlas-SNP	.											.	ZBTB12	25	.	0			c.A334C						PASS	.						80.0	75.0	76.0					6																	31868749		2203	4300	6503	SO:0001583	missense	221527	exon2			GCTCCATCTGCAG	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.334A>C	chr6.hg19:g.31868749T>G	ENSP00000364677:p.Met112Leu	100.0	0.0	.		63.0	37.0	.	NM_181842	B0UY00|Q5JQ98	Missense_Mutation	SNP	ENST00000375527.2	hg19	CCDS4727.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.784945	0.90282	.	.	ENSG00000204366	ENST00000375527	T	0.65178	-0.14	4.4	4.4	0.53042	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	U	0.000000	T	0.61813	0.2377	L	0.45422	1.42	0.49213	D	0.999769	P	0.40032	0.699	P	0.58130	0.833	T	0.67975	-0.5531	10	0.87932	D	0	.	12.6202	0.56600	0.0:0.0:0.0:1.0	.	112	Q9Y330	ZBT12_HUMAN	L	112	ENSP00000364677:M112L	ENSP00000364677:M112L	M	-	1	0	ZBTB12	31976728	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.186000	0.72026	1.615000	0.50252	0.433000	0.28618	ATG	.	.	.	none		0.567	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
ZNF318	24149	hgsc.bcm.edu	37	6	43305593	43305593	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:43305593G>A	ENST00000361428.2	-	10	6220	c.6143C>T	c.(6142-6144)tCt>tTt	p.S2048F	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	2048					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			AGGTGATACAGAATTTTCTTC	0.468																																					p.S2048F		Atlas-SNP	.											.	ZNF318	175	.	0			c.C6143T						PASS	.						91.0	82.0	85.0					6																	43305593		2203	4300	6503	SO:0001583	missense	24149	exon10			GATACAGAATTTT	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.6143C>T	chr6.hg19:g.43305593G>A	ENSP00000354964:p.Ser2048Phe	175.0	0.0	.		87.0	40.0	.	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	hg19	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	G	8.914	0.959432	0.18507	.	.	ENSG00000171467	ENST00000361428	T	0.12774	2.65	5.2	3.27	0.37495	.	0.501221	0.19661	N	0.108975	T	0.10252	0.0251	L	0.32530	0.975	0.44485	D	0.99742	D	0.57571	0.98	P	0.56700	0.804	T	0.04203	-1.0969	10	0.54805	T	0.06	-4.6027	8.6883	0.34251	0.1987:0.0:0.8013:0.0	.	2048	Q5VUA4	ZN318_HUMAN	F	2048	ENSP00000354964:S2048F	ENSP00000354964:S2048F	S	-	2	0	ZNF318	43413571	1.000000	0.71417	0.884000	0.34674	0.096000	0.18686	1.868000	0.39509	1.432000	0.47375	0.655000	0.94253	TCT	.	.	.	none		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
CAPN11	11131	hgsc.bcm.edu	37	6	44140108	44140108	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:44140108C>A	ENST00000398776.1	+	5	517	c.479C>A	c.(478-480)cCc>cAc	p.P160H	CAPN11_ENST00000542245.1_Missense_Mutation_p.P160H	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	160	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CGCGTGGTGCCCAGAGGACAG	0.577											OREG0017466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P160H		Atlas-SNP	.											.	CAPN11	66	.	0			c.C479A						PASS	.						22.0	23.0	23.0					6																	44140108		1939	4119	6058	SO:0001583	missense	11131	exon5			TGGTGCCCAGAGG	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.479C>A	chr6.hg19:g.44140108C>A	ENSP00000381758:p.Pro160His	74.0	0.0	.	921	69.0	40.0	.	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	hg19	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708456	0.68615	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	D;D	0.92752	-3.1;-3.1	4.05	4.05	0.47172	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.49305	D	0.000159	D	0.97885	0.9305	H	0.99156	4.45	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.98911	1.0780	9	.	.	.	.	16.4876	0.84189	0.0:1.0:0.0:0.0	.	160	Q9UMQ6	CAN11_HUMAN	H	160	ENSP00000381758:P160H;ENSP00000441078:P160H	.	P	+	2	0	CAPN11	44248086	1.000000	0.71417	0.993000	0.49108	0.338000	0.28826	7.580000	0.82523	2.549000	0.85964	0.655000	0.94253	CCC	.	.	.	none		0.577	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
RNGTT	8732	hgsc.bcm.edu	37	6	89614664	89614664	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:89614664C>A	ENST00000369485.4	-	6	640	c.454G>T	c.(454-456)Gca>Tca	p.A152S	RNGTT_ENST00000369475.3_Missense_Mutation_p.A152S|RNGTT_ENST00000265607.6_Missense_Mutation_p.A152S|RNGTT_ENST00000538899.1_Missense_Mutation_p.A92S	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	152	TPase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		GTAGCAACTGCTGCTTCGATA	0.418																																					p.A152S		Atlas-SNP	.											.	RNGTT	52	.	0			c.G454T						PASS	.						94.0	95.0	94.0					6																	89614664		2203	4300	6503	SO:0001583	missense	8732	exon6			CAACTGCTGCTTC	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.454G>T	chr6.hg19:g.89614664C>A	ENSP00000358497:p.Ala152Ser	113.0	0.0	.		76.0	37.0	.	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	ENST00000369485.4	hg19	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	C	32	5.142079	0.94560	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	5.74	5.74	0.90152	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.045290	0.85682	D	0.000000	D	0.96932	0.8998	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.63046	0.989;0.992;0.99;0.992	D;D;D;D	0.67900	0.94;0.954;0.923;0.954	D	0.97014	0.9738	10	0.66056	D	0.02	.	19.9357	0.97140	0.0:1.0:0.0:0.0	.	92;152;152;152	B4DSJ8;Q5TCW7;O60942-2;O60942	.;.;.;MCE1_HUMAN	S	152;152;92;123;152	ENSP00000358497:A152S;ENSP00000265607:A152S;ENSP00000442609:A92S;ENSP00000358487:A152S	ENSP00000265607:A152S	A	-	1	0	RNGTT	89671383	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.634000	0.83273	2.715000	0.92844	0.655000	0.94253	GCA	.	.	.	none		0.418	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
TRAF3IP2	10758	hgsc.bcm.edu	37	6	111880633	111880633	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:111880633G>T	ENST00000340026.6	-	10	2294	c.1700C>A	c.(1699-1701)cCc>cAc	p.P567H	TRAF3IP2_ENST00000368731.2_5'UTR|TRAF3IP2-AS1_ENST00000456352.2_RNA|TRAF3IP2_ENST00000359831.4_Missense_Mutation_p.P557H|TRAF3IP2-AS1_ENST00000442928.2_RNA|TRAF3IP2-AS1_ENST00000438298.2_RNA|TRAF3IP2_ENST00000392556.4_Missense_Mutation_p.P146H|TRAF3IP2-AS1_ENST00000449449.2_RNA|TRAF3IP2_ENST00000368735.1_Missense_Mutation_p.P102H|TRAF3IP2-AS1_ENST00000440395.1_RNA|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000368761.5_Missense_Mutation_p.P558H			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	567					B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CTGAAGGGTGGGCAGAGGCCC	0.562																																					p.P558H		Atlas-SNP	.											.	TRAF3IP2	35	.	0			c.C1673A						PASS	.						90.0	91.0	90.0					6																	111880633		2203	4300	6503	SO:0001583	missense	10758	exon9			AGGGTGGGCAGAG	AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.1700C>A	chr6.hg19:g.111880633G>T	ENSP00000345984:p.Pro567His	97.0	0.0	.		67.0	34.0	.	NM_147686	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Missense_Mutation	SNP	ENST00000340026.6	hg19		.	.	.	.	.	.	.	.	.	.	G	22.0	4.233749	0.79688	.	.	ENSG00000056972	ENST00000392555;ENST00000368761;ENST00000392556;ENST00000340026;ENST00000359831;ENST00000368735	T;T;T	0.42900	0.98;0.98;0.96	6.17	6.17	0.99709	.	0.165337	0.56097	D	0.000040	T	0.54598	0.1868	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.53315	-0.8456	10	0.87932	D	0	-0.0313	20.8794	0.99867	0.0:0.0:1.0:0.0	.	557	Q7Z6Q1	.	H	567;558;146;567;557;102	ENSP00000357750:P558H;ENSP00000345984:P567H;ENSP00000352889:P557H	ENSP00000345984:P567H	P	-	2	0	TRAF3IP2	111987326	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	4.822000	0.62686	2.941000	0.99782	0.655000	0.94253	CCC	.	.	.	none		0.562	TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2		
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						PASS	.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		58.0	0.0	.		47.0	4.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.	.	none		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	hgsc.bcm.edu	37	6	170871180	170871180	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:170871180C>A	ENST00000392092.2	+	3	635	c.356C>A	c.(355-357)cCa>cAa	p.P119Q	TBP_ENST00000540980.1_Missense_Mutation_p.P99Q|TBP_ENST00000230354.6_Missense_Mutation_p.P119Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	119					cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		GGCCAGGCACCACAGCTCTTC	0.622																																					p.P119Q		Atlas-SNP	.											.	TBP	58	.	0			c.C356A						PASS	.						136.0	126.0	129.0					6																	170871180		2203	4300	6503	SO:0001583	missense	6908	exon3			AGGCACCACAGCT	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.356C>A	chr6.hg19:g.170871180C>A	ENSP00000375942:p.Pro119Gln	131.0	0.0	.		103.0	51.0	.	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Missense_Mutation	SNP	ENST00000392092.2	hg19	CCDS5315.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998609	0.74818	.	.	ENSG00000112592	ENST00000421512;ENST00000392092;ENST00000540980;ENST00000230354;ENST00000392091;ENST00000423353	T;T;T;T;T	0.65364	1.03;-0.15;-0.15;-0.15;1.03	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.49898	0.1584	L	0.29908	0.895	0.80722	D	1	D	0.54397	0.966	P	0.46479	0.518	T	0.57376	-0.7822	10	0.66056	D	0.02	-7.2007	19.3627	0.94446	0.0:1.0:0.0:0.0	.	119	P20226	TBP_HUMAN	Q	119;119;99;119;96;119	ENSP00000400008:P119Q;ENSP00000375942:P119Q;ENSP00000442132:P99Q;ENSP00000230354:P119Q;ENSP00000416482:P119Q	ENSP00000230354:P119Q	P	+	2	0	TBP	170713105	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	7.041000	0.76558	2.571000	0.86741	0.655000	0.94253	CCA	.	.	.	none		0.622	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
IQCE	23288	hgsc.bcm.edu	37	7	2625912	2625912	+	Silent	SNP	C	C	A	rs547114342		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:2625912C>A	ENST00000402050.2	+	12	1079	c.895C>A	c.(895-897)Cgg>Agg	p.R299R	IQCE_ENST00000404984.1_Silent_p.R248R|IQCE_ENST00000438376.2_Silent_p.R283R|IQCE_ENST00000325979.7_Silent_p.R234R	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	299						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GAGCTTGTCCCGGAGTGTCCA	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		20372	0.0		0.001	False		,,,				2504	0.0				p.R299R		Atlas-SNP	.											.,1	IQCE	66	.	0			c.C895A						PASS	.						53.0	62.0	59.0					7																	2625912		2006	4165	6171	SO:0001819	synonymous_variant	23288	exon12			TTGTCCCGGAGTG	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.895C>A	chr7.hg19:g.2625912C>A		69.0	0.0	.		74.0	10.0	.	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	ENST00000402050.2	hg19	CCDS43542.1																																																																																			.	.	.	none		0.592	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
INMT	11185	hgsc.bcm.edu	37	7	30795228	30795228	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:30795228T>G	ENST00000013222.5	+	3	569	c.553T>G	c.(553-555)Tca>Gca	p.S185A	INMT_ENST00000484180.1_3'UTR|INMT-FAM188B_ENST00000458257.1_Intron|INMT_ENST00000409539.1_Missense_Mutation_p.S184A	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	185					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)			kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						CAACCTTGCCTCACTGCTCAA	0.627																																					p.S185A		Atlas-SNP	.											.	INMT	38	.	0			c.T553G						PASS	.						117.0	99.0	105.0					7																	30795228		2203	4300	6503	SO:0001583	missense	11185	exon3			CTTGCCTCACTGC		CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.553T>G	chr7.hg19:g.30795228T>G	ENSP00000013222:p.Ser185Ala	55.0	0.0	.		74.0	17.0	.	NM_006774	B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	ENST00000013222.5	hg19	CCDS5430.1	.	.	.	.	.	.	.	.	.	.	T	12.65	2.001013	0.35320	.	.	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.09817	2.94;2.94	3.67	-3.34	0.04943	.	2.476700	0.02010	N	0.046915	T	0.15176	0.0366	M	0.79614	2.46	0.09310	N	1	B;B	0.18741	0.03;0.03	B;B	0.21546	0.035;0.035	T	0.39231	-0.9624	10	0.35671	T	0.21	-21.5047	6.0673	0.19870	0.2462:0.0:0.5263:0.2275	.	184;185	B8ZZ69;O95050	.;INMT_HUMAN	A	185;184	ENSP00000013222:S185A;ENSP00000386961:S184A	ENSP00000013222:S185A	S	+	1	0	INMT	30761753	0.000000	0.05858	0.000000	0.03702	0.174000	0.22865	-1.235000	0.02928	-0.261000	0.09405	0.459000	0.35465	TCA	.	.	.	none		0.627	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214993.3	NM_006774	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95668656	95668656	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:95668656G>T	ENST00000324972.6	+	14	1676	c.1483G>T	c.(1483-1485)Gca>Tca	p.A495S	DYNC1I1_ENST00000457059.1_Missense_Mutation_p.A478S|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.A458S|DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.A478S|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.A475S|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.A458S	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	495					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CTGCCACATGGCAGTGGGCCC	0.463																																					p.A495S		Atlas-SNP	.											.	DYNC1I1	111	.	0			c.G1483T						PASS	.						142.0	130.0	134.0					7																	95668656		2203	4300	6503	SO:0001583	missense	1780	exon14			CACATGGCAGTGG	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1483G>T	chr7.hg19:g.95668656G>T	ENSP00000320130:p.Ala495Ser	127.0	0.0	.		140.0	89.0	.	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867794	0.72065	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47948	0.1473	N	0.10874	0.06	0.80722	D	1	P;P;P;P;B	0.40638	0.725;0.542;0.542;0.597;0.336	P;B;B;B;B	0.51777	0.679;0.327;0.327;0.401;0.155	T	0.38757	-0.9646	10	0.20046	T	0.44	-0.3946	18.7491	0.91806	0.0:0.0:1.0:0.0	.	478;475;478;495;458	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	S	478;495;458;475;458;478	ENSP00000392337:A478S;ENSP00000320130:A495S;ENSP00000438377:A458S;ENSP00000398118:A475S;ENSP00000352348:A458S;ENSP00000412444:A478S	ENSP00000320130:A495S	A	+	1	0	DYNC1I1	95506592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.657000	0.98554	2.753000	0.94483	0.557000	0.71058	GCA	.	.	.	none		0.463	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
ACTL6B	51412	hgsc.bcm.edu	37	7	100253150	100253150	+	Silent	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:100253150C>T	ENST00000160382.5	-	3	268	c.162G>A	c.(160-162)ctG>ctA	p.L54L		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	54	Essential for mediating its function in dendritic development; may contribute to neuronal-specific targeting. {ECO:0000250}.				chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TGTCCCCCTCCAGCTCCAGCC	0.637																																					p.L54L		Atlas-SNP	.											.	ACTL6B	47	.	0			c.G162A						PASS	.						110.0	83.0	92.0					7																	100253150		2203	4300	6503	SO:0001819	synonymous_variant	51412	exon3			CCCCTCCAGCTCC	AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.162G>A	chr7.hg19:g.100253150C>T		51.0	0.0	.		65.0	22.0	.	NM_016188	A4D2D0|O75421	Silent	SNP	ENST00000160382.5	hg19	CCDS5702.1																																																																																			.	.	.	none		0.637	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356745.1	NM_016188	
MYOM2	9172	hgsc.bcm.edu	37	8	2026963	2026963	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr8:2026963G>T	ENST00000262113.4	+	12	1552	c.1411G>T	c.(1411-1413)Gtc>Ttc	p.V471F	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	471	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACCCTCCAGGGTCTCTGATGC	0.542																																					p.V471F		Atlas-SNP	.											.	MYOM2	251	.	0			c.G1411T						PASS	.						138.0	147.0	144.0					8																	2026963		2203	4300	6503	SO:0001583	missense	9172	exon12			TCCAGGGTCTCTG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1411G>T	chr8.hg19:g.2026963G>T	ENSP00000262113:p.Val471Phe	103.0	0.0	.		67.0	34.0	.	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	9.827	1.187293	0.21870	.	.	ENSG00000036448	ENST00000262113	T	0.60548	0.18	4.71	2.88	0.33553	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.264519	0.31721	N	0.007172	T	0.55242	0.1908	M	0.74881	2.28	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.52711	-0.8539	10	0.46703	T	0.11	.	10.2016	0.43087	0.1646:0.0:0.8354:0.0	.	471	P54296	MYOM2_HUMAN	F	471	ENSP00000262113:V471F	ENSP00000262113:V471F	V	+	1	0	MYOM2	2014370	0.195000	0.23338	0.741000	0.31004	0.515000	0.34225	1.501000	0.35693	0.494000	0.27859	0.561000	0.74099	GTC	.	.	.	none		0.542	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
UBR5	51366	hgsc.bcm.edu	37	8	103273473	103273473	+	Silent	SNP	A	A	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr8:103273473A>T	ENST00000520539.1	-	56	8463	c.7857T>A	c.(7855-7857)ccT>ccA	p.P2619P	UBR5_ENST00000220959.4_Silent_p.P2618P|UBR5_ENST00000518205.1_Silent_p.P347P|UBR5_ENST00000521922.1_Silent_p.P2612P	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2619	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTACACCATTAGGAATGAGTT	0.348																																					p.P2619P	Ovarian(131;96 1741 5634 7352 27489)	Atlas-SNP	.											.	UBR5	285	.	0			c.T7857A						PASS	.						152.0	130.0	138.0					8																	103273473		2203	4300	6503	SO:0001819	synonymous_variant	51366	exon56			ACCATTAGGAATG	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7857T>A	chr8.hg19:g.103273473A>T		103.0	0.0	.		91.0	36.0	.	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	hg19	CCDS34933.1																																																																																			.	.	.	none		0.348	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
LRRC14	9684	hgsc.bcm.edu	37	8	145745846	145745846	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr8:145745846T>G	ENST00000292524.1	+	3	700	c.554T>G	c.(553-555)cTc>cGc	p.L185R	RECQL4_ENST00000532237.1_5'Flank|RECQL4_ENST00000428558.2_5'Flank|LRRC14_ENST00000529022.1_Missense_Mutation_p.L185R	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	185										endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CGGGAGGCACTCCGAAGCAGC	0.711																																					p.L185R		Atlas-SNP	.											.	LRRC14	25	.	0			c.T554G						PASS	.						44.0	51.0	49.0					8																	145745846		2203	4297	6500	SO:0001583	missense	9684	exon4			AGGCACTCCGAAG	BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179	ENST00000292524.1:c.554T>G	chr8.hg19:g.145745846T>G	ENSP00000292524:p.Leu185Arg	46.0	0.0	.		31.0	14.0	.	NM_001272036	A8K0A8|D3DWM8	Missense_Mutation	SNP	ENST00000292524.1	hg19	CCDS6432.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467258	0.43839	.	.	ENSG00000160959	ENST00000527730;ENST00000529022;ENST00000292524	T;T;T	0.23950	1.88;4.7;4.7	4.51	4.51	0.55191	.	0.414516	0.23716	N	0.045274	T	0.45094	0.1325	L	0.58101	1.795	0.50171	D	0.999857	D	0.89917	1.0	D	0.81914	0.995	T	0.39014	-0.9634	10	0.59425	D	0.04	.	11.7962	0.52102	0.0:0.0:0.0:1.0	.	185	Q15048	LRC14_HUMAN	R	185	ENSP00000436452:L185R;ENSP00000434768:L185R;ENSP00000292524:L185R	ENSP00000292524:L185R	L	+	2	0	LRRC14	145716654	0.497000	0.26067	0.055000	0.19348	0.133000	0.20885	3.701000	0.54793	1.893000	0.54813	0.379000	0.24179	CTC	.	.	.	none		0.711	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382494.1	NM_014665	
FREM1	158326	hgsc.bcm.edu	37	9	14776064	14776064	+	Missense_Mutation	SNP	G	G	A	rs369703203		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr9:14776064G>A	ENST00000380880.3	-	25	5363	c.4580C>T	c.(4579-4581)cCt>cTt	p.P1527L	FREM1_ENST00000486223.1_5'Flank|FREM1_ENST00000380894.1_Missense_Mutation_p.P63L|FREM1_ENST00000380881.4_Missense_Mutation_p.P1528L|FREM1_ENST00000422223.2_Missense_Mutation_p.P1527L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1527					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AAGGAGGTCAGGGGAAAGCAG	0.602																																					p.P1527L		Atlas-SNP	.											.	FREM1	261	.	0			c.C4580T						PASS	.						123.0	135.0	131.0					9																	14776064		2020	4176	6196	SO:0001583	missense	158326	exon26			AGGTCAGGGGAAA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4580C>T	chr9.hg19:g.14776064G>A	ENSP00000370262:p.Pro1527Leu	145.0	0.0	.		111.0	50.0	.	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	hg19	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788320	0.70337	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.78003	0.66;0.66;-1.14;0.66	6.16	6.16	0.99307	.	0.207579	0.51477	D	0.000082	T	0.79964	0.4537	M	0.77103	2.36	0.80722	D	1	B;B	0.28378	0.075;0.209	B;B	0.24155	0.027;0.051	T	0.75207	-0.3399	10	0.37606	T	0.19	-4.5244	20.8598	0.99761	0.0:0.0:1.0:0.0	.	1527;63	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	L	1528;1527;63;1527	ENSP00000370263:P1528L;ENSP00000412940:P1527L;ENSP00000370278:P63L;ENSP00000370262:P1527L	ENSP00000370262:P1527L	P	-	2	0	FREM1	14766064	1.000000	0.71417	0.949000	0.38748	0.644000	0.38419	7.598000	0.82745	2.937000	0.99478	0.650000	0.86243	CCT	.	.	.	alt		0.602	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
GPR144	347088	hgsc.bcm.edu	37	9	127215926	127215926	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr9:127215926C>G	ENST00000334810.1	+	4	950	c.950C>G	c.(949-951)cCc>cGc	p.P317R				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	317					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						TCGCTGCTGCCCACTGTGTGG	0.746																																					p.P317R		Atlas-SNP	.											.	GPR144	33	.	0			c.C950G						PASS	.						3.0	4.0	4.0					9																	127215926		640	1476	2116	SO:0001583	missense	347088	exon4			TGCTGCCCACTGT	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.950C>G	chr9.hg19:g.127215926C>G	ENSP00000335156:p.Pro317Arg	22.0	0.0	.		21.0	10.0	.	NM_001161808	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	hg19	CCDS48016.1	.	.	.	.	.	.	.	.	.	.	C	7.765	0.706307	0.15239	.	.	ENSG00000180264	ENST00000334810;ENST00000439837	T	0.47528	0.84	3.92	1.85	0.25348	.	.	.	.	.	T	0.31451	0.0797	L	0.51422	1.61	0.09310	N	1	P	0.44195	0.828	B	0.36186	0.219	T	0.12863	-1.0531	9	0.21540	T	0.41	.	2.5302	0.04701	0.2176:0.4447:0.0:0.3377	.	317	Q7Z7M1	GP144_HUMAN	R	317;46	ENSP00000335156:P317R	ENSP00000335156:P317R	P	+	2	0	GPR144	126255747	0.006000	0.16342	0.051000	0.19133	0.056000	0.15407	0.279000	0.18771	0.751000	0.32900	0.313000	0.20887	CCC	.	.	.	none		0.746	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
MAMDC4	158056	hgsc.bcm.edu	37	9	139750216	139750216	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr9:139750216G>A	ENST00000317446.2	+	13	1554	c.1504G>A	c.(1504-1506)Ggc>Agc	p.G502S	MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Missense_Mutation_p.G502S	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CGAGGCTGGGGGCTGGGAGGA	0.701																																					p.G502S		Atlas-SNP	.											.	MAMDC4	117	.	0			c.G1504A						PASS	.						10.0	11.0	11.0					9																	139750216		2139	4234	6373	SO:0001583	missense	158056	exon13			GCTGGGGGCTGGG	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1504G>A	chr9.hg19:g.139750216G>A	ENSP00000319388:p.Gly502Ser	101.0	0.0	.		63.0	44.0	.	NM_206920		Missense_Mutation	SNP	ENST00000317446.2	hg19	CCDS7010.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.14|17.14	3.313754|3.313754	0.60414|0.60414	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000413647|ENST00000317446;ENST00000445819	.|T;T	.|0.02525	.|4.26;4.26	3.79|3.79	3.79|3.79	0.43588|0.43588	.|.	0.115488|0.115488	0.38548|0.38548	N|N	0.001648|0.001648	T|T	0.10594|0.10594	0.0259|0.0259	M|M	0.64997|0.64997	1.995|1.995	0.35799|0.35799	D|D	0.823021|0.823021	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	T|T	0.33497|0.33497	-0.9866|-0.9866	7|10	0.46703|0.22109	T|T	0.11|0.4	-31.4467|-31.4467	12.8395|12.8395	0.57793|0.57793	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|502	.|Q6UXC1-2	.|.	E|S	483|502	.|ENSP00000319388:G502S;ENSP00000411339:G502S	ENSP00000400009:G483E|ENSP00000319388:G502S	G|G	+|+	2|1	0|0	MAMDC4|MAMDC4	138870037|138870037	0.997000|0.997000	0.39634|0.39634	0.949000|0.949000	0.38748|0.38748	0.548000|0.548000	0.35241|0.35241	1.906000|1.906000	0.39887|0.39887	2.112000|2.112000	0.64535|0.64535	0.561000|0.561000	0.74099|0.74099	GGG|GGC	.	.	.	none		0.701	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254642.3	NM_206920	
DIP2C	22982	hgsc.bcm.edu	37	10	459976	459976	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr10:459976C>T	ENST00000280886.6	-	8	1021	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	DIP2C_ENST00000381496.3_Missense_Mutation_p.V205M	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	312						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TTCGTGACCACGCCCAGCTGC	0.622																																					p.V312M		Atlas-SNP	.											.	DIP2C	195	.	0			c.G934A						PASS	.						50.0	53.0	52.0					10																	459976		2203	4299	6502	SO:0001583	missense	22982	exon8			TGACCACGCCCAG	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.934G>A	chr10.hg19:g.459976C>T	ENSP00000280886:p.Val312Met	63.0	0.0	.		33.0	14.0	.	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	hg19	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	C	16.83	3.230399	0.58777	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.47177	0.85;0.85	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	M	0.78456	2.415	0.54753	D	0.999987	P;P	0.46621	0.881;0.801	B;B	0.34536	0.185;0.097	T	0.61068	-0.7137	10	0.51188	T	0.08	-29.0514	18.7949	0.91990	0.0:1.0:0.0:0.0	.	205;312	E7EPU2;Q9Y2E4	.;DIP2C_HUMAN	M	312;205	ENSP00000280886:V312M;ENSP00000370907:V205M	ENSP00000280886:V312M	V	-	1	0	DIP2C	449976	1.000000	0.71417	0.525000	0.27900	0.278000	0.26855	7.776000	0.85560	2.427000	0.82271	0.655000	0.94253	GTG	.	.	.	none		0.622	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
GDF2	2658	hgsc.bcm.edu	37	10	48416620	48416620	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr10:48416620A>G	ENST00000249598.1	-	1	233	c.74T>C	c.(73-75)cTg>cCg	p.L25P		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	25					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CCAGCTCTGCAGTGGCTTCCC	0.652																																					p.L25P		Atlas-SNP	.											.	GDF2	77	.	0			c.T74C						PASS	.						15.0	16.0	16.0					10																	48416620		2203	4300	6503	SO:0001583	missense	2658	exon1			CTCTGCAGTGGCT	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.74T>C	chr10.hg19:g.48416620A>G	ENSP00000249598:p.Leu25Pro	78.0	0.0	.		59.0	31.0	.	NM_016204	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	ENST00000249598.1	hg19	CCDS7219.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990617	0.74589	.	.	ENSG00000128802	ENST00000249598	T	0.81078	-1.45	5.69	5.69	0.88448	.	0.152498	0.44483	D	0.000444	D	0.84211	0.5422	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84892	0.0837	10	0.51188	T	0.08	.	13.958	0.64162	1.0:0.0:0.0:0.0	.	25	Q9UK05	GDF2_HUMAN	P	25	ENSP00000249598:L25P	ENSP00000249598:L25P	L	-	2	0	GDF2	48036626	1.000000	0.71417	0.770000	0.31555	0.601000	0.36947	6.229000	0.72294	2.292000	0.77174	0.533000	0.62120	CTG	.	.	.	none		0.652	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204	
HERC4	26091	hgsc.bcm.edu	37	10	69804160	69804160	+	Splice_Site	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr10:69804160C>T	ENST00000395198.3	-	4	634		c.e4+1		HERC4_ENST00000373700.4_Splice_Site|HERC4_ENST00000395187.2_Intron|HERC4_ENST00000412272.2_Splice_Site	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4						cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACCTTTGTTACCTGGGTACTC	0.423																																					.		Atlas-SNP	.											.	HERC4	78	.	0			c.386+1G>A						PASS	.						118.0	95.0	103.0					10																	69804160		2203	4300	6503	SO:0001630	splice_region_variant	26091	exon5			TTGTTACCTGGGT	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.386+1G>A	chr10.hg19:g.69804160C>T		114.0	0.0	.		76.0	41.0	.	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Splice_Site	SNP	ENST00000395198.3	hg19	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.007526	0.93287	.	.	ENSG00000148634	ENST00000412272;ENST00000395198;ENST00000373700;ENST00000513996	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4692	0.94956	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HERC4	69474166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.596000	0.87737	0.591000	0.81541	.	.	.	.	none		0.423	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	Intron
UNC5B	219699	hgsc.bcm.edu	37	10	73051493	73051493	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr10:73051493G>T	ENST00000335350.6	+	10	2015	c.1599G>T	c.(1597-1599)caG>caT	p.Q533H	UNC5B_ENST00000373192.4_Missense_Mutation_p.Q522H	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	533					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GTTCCCAGCAGCTCTTGGGCC	0.692																																					p.Q533H		Atlas-SNP	.											.	UNC5B	123	.	0			c.G1599T						PASS	.						32.0	33.0	33.0					10																	73051493		2203	4299	6502	SO:0001583	missense	219699	exon10			CCAGCAGCTCTTG	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1599G>T	chr10.hg19:g.73051493G>T	ENSP00000334329:p.Gln533His	61.0	0.0	.		47.0	20.0	.	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	hg19	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	g	10.59	1.392469	0.25118	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.48522	0.87;0.81	4.24	2.12	0.27331	.	0.784528	0.11226	N	0.586193	T	0.23133	0.0559	N	0.03115	-0.41	0.21897	N	0.999482	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18555	-1.0333	10	0.23302	T	0.38	-12.9608	9.6384	0.39824	0.0:0.397:0.478:0.125	.	522;533	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	H	533;522	ENSP00000334329:Q533H;ENSP00000362288:Q522H	ENSP00000334329:Q533H	Q	+	3	2	UNC5B	72721499	0.976000	0.34144	1.000000	0.80357	0.891000	0.51852	0.354000	0.20146	0.866000	0.35629	0.556000	0.70494	CAG	.	.	.	none		0.692	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
BCCIP	56647	hgsc.bcm.edu	37	10	127512176	127512176	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr10:127512176C>T	ENST00000278100.6	+	1	62	c.50C>T	c.(49-51)cCg>cTg	p.P17L	BCCIP_ENST00000368759.5_Missense_Mutation_p.P17L|UROS_ENST00000368797.4_5'Flank|BCCIP_ENST00000299130.3_Missense_Mutation_p.P17L|UROS_ENST00000368774.1_5'Flank|BCCIP_ENST00000429863.2_Missense_Mutation_p.P17L|UROS_ENST00000368778.3_5'Flank	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	17					cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GTTCCGCAGCCGCCGGATCCC	0.587																																					p.P17L		Atlas-SNP	.											.	BCCIP	48	.	0			c.C50T						PASS	.						105.0	107.0	106.0					10																	127512176		2203	4300	6503	SO:0001583	missense	56647	exon1			CGCAGCCGCCGGA	AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.50C>T	chr10.hg19:g.127512176C>T	ENSP00000278100:p.Pro17Leu	128.0	0.0	.		73.0	39.0	.	NM_016567	B3KP45|Q8ND15|Q96GC4|Q9P288	Missense_Mutation	SNP	ENST00000278100.6	hg19	CCDS7651.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935205	0.52866	.	.	ENSG00000107949	ENST00000278100;ENST00000299130;ENST00000368759;ENST00000429863;ENST00000392718	T;T;T;T	0.60797	0.46;0.28;0.16;0.47	4.85	1.96	0.26148	.	0.504572	0.16759	N	0.200707	T	0.32734	0.0839	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.20459	0.013;0.013;0.045;0.022;0.004	B;B;B;B;B	0.13407	0.003;0.003;0.009;0.007;0.003	T	0.17868	-1.0355	10	0.48119	T	0.1	-2.3078	6.7389	0.23424	0.0:0.6895:0.0:0.3105	.	17;17;17;17;17	B4E318;B4DUS0;Q9P287-2;Q9P287-4;Q9P287	.;.;.;.;BCCIP_HUMAN	L	17	ENSP00000278100:P17L;ENSP00000299130:P17L;ENSP00000357748:P17L;ENSP00000394758:P17L	ENSP00000278100:P17L	P	+	2	0	BCCIP	127502166	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.163000	0.16520	0.120000	0.18254	-0.215000	0.12644	CCG	.	.	.	none		0.587	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1		
MTMR2	8898	hgsc.bcm.edu	37	11	95657091	95657091	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr11:95657091G>A	ENST00000346299.5	-	1	368	c.28C>T	c.(28-30)Ctt>Ttt	p.L10F	MTMR2_ENST00000484818.1_5'Flank|MTMR2_ENST00000409459.1_5'UTR|MTMR2_ENST00000352297.7_5'UTR|MTMR2_ENST00000393223.3_5'UTR	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	10	Ser-rich.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGGGAGCCAAGACTCTCGCAG	0.701																																					p.L10F		Atlas-SNP	.											.	MTMR2	79	.	0			c.C28T						PASS	.						5.0	6.0	5.0					11																	95657091		2130	4130	6260	SO:0001583	missense	8898	exon1			AGCCAAGACTCTC	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.28C>T	chr11.hg19:g.95657091G>A	ENSP00000345752:p.Leu10Phe	275.0	0.0	.		182.0	76.0	.	NM_016156	A6NN98|Q9UPS9	Missense_Mutation	SNP	ENST00000346299.5	hg19	CCDS8305.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813946	0.50527	.	.	ENSG00000087053	ENST00000346299	D	0.95622	-3.76	4.49	2.5	0.30297	.	0.593190	0.14662	N	0.305920	D	0.91040	0.7181	L	0.29908	0.895	0.80722	D	1	D	0.56521	0.976	P	0.44597	0.454	D	0.88605	0.3152	10	0.66056	D	0.02	.	7.3712	0.26802	0.096:0.1696:0.7344:0.0	.	10	Q13614	MTMR2_HUMAN	F	10	ENSP00000345752:L10F	ENSP00000345752:L10F	L	-	1	0	MTMR2	95296739	1.000000	0.71417	0.968000	0.41197	0.179000	0.23085	2.766000	0.47629	1.044000	0.40200	0.561000	0.74099	CTT	.	.	.	none		0.701	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
TMPRSS4	56649	hgsc.bcm.edu	37	11	117973872	117973872	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr11:117973872C>A	ENST00000437212.3	+	4	428	c.214C>A	c.(214-216)Ccg>Acg	p.P72T	TMPRSS4_ENST00000523251.1_Missense_Mutation_p.P32T|TMPRSS4_ENST00000522307.1_5'UTR|TMPRSS4_ENST00000534111.1_Missense_Mutation_p.P70T|TMPRSS4_ENST00000522824.1_Missense_Mutation_p.P72T			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	72	LDL-receptor class A.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CCACTTCATCCCGAGGAAGCA	0.592																																					p.P72T		Atlas-SNP	.											.	TMPRSS4	46	.	0			c.C214A						PASS	.						140.0	138.0	138.0					11																	117973872		2200	4296	6496	SO:0001583	missense	56649	exon4			TTCATCCCGAGGA	AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.214C>A	chr11.hg19:g.117973872C>A	ENSP00000416037:p.Pro72Thr	81.0	0.0	.		43.0	21.0	.	NM_019894	A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Missense_Mutation	SNP	ENST00000437212.3	hg19	CCDS31684.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.901|7.901	0.734478|0.734478	0.15574|0.15574	.|.	.|.	ENSG00000137648|ENSG00000137648	ENST00000517544|ENST00000534111;ENST00000523251;ENST00000437212;ENST00000522824	.|D;D;D;D	.|0.91996	.|-2.95;-2.95;-2.95;-2.95	5.16|5.16	1.14|1.14	0.20703|0.20703	.|.	0.896737|0.896737	0.09414|0.09414	N|N	0.805430|0.805430	D|D	0.92951|0.92951	0.7757|0.7757	M|M	0.70108|0.70108	2.13|2.13	0.31916|0.31916	N|N	0.614078|0.614078	.|P;P;P;D	.|0.55172	.|0.87;0.949;0.859;0.97	.|B;P;B;P	.|0.51657	.|0.36;0.476;0.358;0.676	D|D	0.88864|0.88864	0.3328|0.3328	6|10	.|0.66056	.|D	.|0.02	.|.	9.626|9.626	0.39750|0.39750	0.0:0.6981:0.0:0.3019|0.0:0.6981:0.0:0.3019	.|.	.|47;32;72;70	.|B7Z900;E7ERX8;Q9NRS4;Q9NRS4-3	.|.;.;TMPS4_HUMAN;.	H|T	38|70;32;72;72	.|ENSP00000435184:P70T;ENSP00000429209:P32T;ENSP00000416037:P72T;ENSP00000430547:P72T	.|ENSP00000416037:P72T	P|P	+|+	2|1	0|0	TMPRSS4|TMPRSS4	117479082|117479082	0.360000|0.360000	0.24964|0.24964	0.448000|0.448000	0.26945|0.26945	0.048000|0.048000	0.14542|0.14542	0.926000|0.926000	0.28804|0.28804	0.203000|0.203000	0.20529|0.20529	-0.379000|-0.379000	0.06801|0.06801	CCC|CCG	.	.	.	none		0.592	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377328.2	NM_019894	
DDX6	1656	hgsc.bcm.edu	37	11	118635954	118635954	+	Silent	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr11:118635954G>T	ENST00000526070.2	-	6	969	c.609C>A	c.(607-609)acC>acA	p.T203T	DDX6_ENST00000264018.4_Silent_p.T203T|DDX6_ENST00000534980.1_Silent_p.T203T	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	203	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CTCGTAAATTGGTTCCTCCTG	0.413			T	IGH@	B-NHL																																p.T203T		Atlas-SNP	.		Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	.	DDX6	64	.	0			c.C609A						PASS	.						351.0	341.0	344.0					11																	118635954		1896	4113	6009	SO:0001819	synonymous_variant	1656	exon6			TAAATTGGTTCCT	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.609C>A	chr11.hg19:g.118635954G>T		61.0	0.0	.		54.0	19.0	.	NM_004397	Q5D048	Silent	SNP	ENST00000526070.2	hg19	CCDS44751.1																																																																																			.	.	.	none		0.413	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397	
SLC6A12	6539	hgsc.bcm.edu	37	12	308000	308000	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:308000T>G	ENST00000428720.1	-	8	1552	c.809A>C	c.(808-810)tAc>tCc	p.Y270S	SLC6A12_ENST00000536824.1_Missense_Mutation_p.Y270S|SLC6A12_ENST00000424061.2_Missense_Mutation_p.Y270S|SLC6A12_ENST00000359674.4_Missense_Mutation_p.Y270S|SLC6A12_ENST00000538272.1_5'UTR|SLC6A12_ENST00000397296.2_Missense_Mutation_p.Y270S	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	270					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			TGGCTTCAAGTAGTAGATGAT	0.537																																					p.Y270S		Atlas-SNP	.											.	SLC6A12	60	.	0			c.A809C						PASS	.						148.0	123.0	132.0					12																	308000		2203	4300	6503	SO:0001583	missense	6539	exon8			TTCAAGTAGTAGA	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.809A>C	chr12.hg19:g.308000T>G	ENSP00000388184:p.Tyr270Ser	225.0	0.0	.		221.0	125.0	.	NM_001122848	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	ENST00000428720.1	hg19	CCDS8501.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135276	0.77662	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.93154	0.7820	H	0.99464	4.58	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95722	0.8767	10	0.87932	D	0	.	14.0075	0.64473	0.0:0.0:0.0:1.0	.	270	P48065	S6A12_HUMAN	S	270	ENSP00000352702:Y270S;ENSP00000380464:Y270S;ENSP00000388184:Y270S;ENSP00000399136:Y270S;ENSP00000444268:Y270S	ENSP00000352702:Y270S	Y	-	2	0	SLC6A12	178261	1.000000	0.71417	0.994000	0.49952	0.740000	0.42216	7.796000	0.85898	1.762000	0.52044	0.533000	0.62120	TAC	.	.	.	none		0.537	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206671.2	NM_003044	
LRRK2	120892	hgsc.bcm.edu	37	12	40760813	40760813	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:40760813C>A	ENST00000298910.7	+	50	7454	c.7396C>A	c.(7396-7398)Ctt>Att	p.L2466I		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2466			L -> H (in PARK8). {ECO:0000269|PubMed:18213618}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TAAAGGAAGCCTTAAAAATGT	0.313																																					p.L2466I		Atlas-SNP	.											.	LRRK2	763	.	0			c.C7396A						PASS	.						63.0	66.0	65.0					12																	40760813		2203	4299	6502	SO:0001583	missense	120892	exon50			GGAAGCCTTAAAA	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7396C>A	chr12.hg19:g.40760813C>A	ENSP00000298910:p.Leu2466Ile	336.0	0.0	.		454.0	152.0	.	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	8.406	0.843103	0.16963	.	.	ENSG00000188906	ENST00000298910	T	0.35605	1.3	5.42	5.42	0.78866	WD40 repeat-like-containing domain (1);	0.208934	0.43110	D	0.000601	T	0.28962	0.0719	L	0.45581	1.43	0.35294	D	0.782415	B;B	0.23185	0.081;0.081	B;B	0.17722	0.019;0.019	T	0.29027	-1.0025	10	0.19147	T	0.46	.	10.2613	0.43427	0.0:0.9098:0.0:0.0902	.	2466;2466	Q17RV3;Q5S007	.;LRRK2_HUMAN	I	2466	ENSP00000298910:L2466I	ENSP00000298910:L2466I	L	+	1	0	LRRK2	39047080	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	2.021000	0.41020	2.534000	0.85438	0.313000	0.20887	CTT	.	.	.	none		0.313	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
LARP4	113251	hgsc.bcm.edu	37	12	50834282	50834282	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:50834282C>T	ENST00000398473.2	+	7	812	c.700C>T	c.(700-702)Cac>Tac	p.H234Y	LARP4_ENST00000429001.3_Missense_Mutation_p.H240Y|LARP4_ENST00000518561.1_Missense_Mutation_p.H164Y|LARP4_ENST00000522085.1_Missense_Mutation_p.H234Y|LARP4_ENST00000518444.1_Missense_Mutation_p.H233Y|LARP4_ENST00000347328.5_Missense_Mutation_p.H234Y|LARP4_ENST00000293618.8_Missense_Mutation_p.H234Y	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	234	RRM.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						TGAGTTTGCACACAATAGCAA	0.348																																					p.H234Y		Atlas-SNP	.											.	LARP4	58	.	0			c.C700T						PASS	.						99.0	88.0	91.0					12																	50834282		1863	4108	5971	SO:0001583	missense	113251	exon7			TTTGCACACAATA	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.700C>T	chr12.hg19:g.50834282C>T	ENSP00000381490:p.His234Tyr	453.0	0.0	.		653.0	404.0	.	NM_001170808	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	hg19	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935866	0.34189	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000441650;ENST00000522085;ENST00000398464;ENST00000518444;ENST00000518561;ENST00000520064;ENST00000347328	T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37	5.23	5.23	0.72850	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.45458	0.1343	N	0.25031	0.7	0.80722	D	1	D;B;D;P;D;D	0.89917	1.0;0.357;0.998;0.583;0.999;0.997	D;B;D;B;D;D	0.80764	0.99;0.155;0.994;0.233;0.968;0.947	T	0.18903	-1.0322	10	0.13853	T	0.58	.	19.1422	0.93450	0.0:1.0:0.0:0.0	.	135;233;234;234;234;240	Q71RC2-2;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;LARP4_HUMAN;.	Y	234;240;234;164;234;234;233;164;135;234	ENSP00000293618:H234Y;ENSP00000415464:H240Y;ENSP00000381490:H234Y;ENSP00000429781:H234Y;ENSP00000429077:H233Y;ENSP00000430851:H164Y;ENSP00000340901:H234Y	ENSP00000293618:H234Y	H	+	1	0	LARP4	49120549	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.632000	0.83247	2.609000	0.88269	0.484000	0.47621	CAC	.	.	.	none		0.348	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
C12orf66	144577	hgsc.bcm.edu	37	12	64615868	64615868	+	Silent	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:64615868G>A	ENST00000398055.3	-	1	203	c.150C>T	c.(148-150)agC>agT	p.S50S	C12orf66_ENST00000311915.8_Silent_p.S50S|RPS11P6_ENST00000535684.1_RNA|C12orf66_ENST00000540673.1_5'UTR|C12orf66_ENST00000544871.1_Intron	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	50										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						GCGACAGCCAGCTGCCCCCCG	0.617																																					p.S50S		Atlas-SNP	.											.	C12orf66	28	.	0			c.C150T						PASS	.						31.0	36.0	34.0					12																	64615868		1993	4166	6159	SO:0001819	synonymous_variant	144577	exon1			CAGCCAGCTGCCC		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.150C>T	chr12.hg19:g.64615868G>A		216.0	1.0	.		202.0	134.0	.	NM_152440	C9JX54|Q8IYA0	Silent	SNP	ENST00000398055.3	hg19	CCDS41803.1																																																																																			.	.	.	none		0.617	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400921.1	NM_152440	
TRHDE	29953	hgsc.bcm.edu	37	12	73012751	73012751	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:73012751C>T	ENST00000261180.4	+	13	2363	c.2267C>T	c.(2266-2268)gCt>gTt	p.A756V		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	756					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CCTTGGCATGCTGCCAGCCGA	0.353																																					p.A756V		Atlas-SNP	.											.	TRHDE	194	.	0			c.C2267T						PASS	.						53.0	57.0	56.0					12																	73012751		2201	4300	6501	SO:0001583	missense	29953	exon13			GGCATGCTGCCAG	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2267C>T	chr12.hg19:g.73012751C>T	ENSP00000261180:p.Ala756Val	381.0	0.0	.		409.0	135.0	.	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	hg19	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	35	5.481616	0.96307	.	.	ENSG00000072657	ENST00000261180	T	0.05649	3.41	5.77	5.77	0.91146	.	0.056300	0.64402	D	0.000001	T	0.09247	0.0228	L	0.35593	1.075	0.80722	D	1	B	0.30563	0.285	B	0.35073	0.195	T	0.28332	-1.0047	10	0.38643	T	0.18	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	756	Q9UKU6	TRHDE_HUMAN	V	756	ENSP00000261180:A756V	ENSP00000261180:A756V	A	+	2	0	TRHDE	71299018	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.160000	0.77495	2.885000	0.99019	0.655000	0.94253	GCT	.	.	.	none		0.353	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
APPL2	55198	hgsc.bcm.edu	37	12	105582149	105582149	+	Silent	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:105582149C>A	ENST00000258530.3	-	17	1761	c.1536G>T	c.(1534-1536)gtG>gtT	p.V512V	APPL2_ENST00000551662.1_Silent_p.V518V|APPL2_ENST00000539978.2_Silent_p.V469V	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CTTCATAAATCACTTCAGTAG	0.423																																					p.V518V		Atlas-SNP	.											.	APPL2	69	.	0			c.G1554T						PASS	.						142.0	131.0	135.0					12																	105582149		2203	4300	6503	SO:0001819	synonymous_variant	55198	exon17			ATAAATCACTTCA	AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1536G>T	chr12.hg19:g.105582149C>A		105.0	0.0	.		115.0	68.0	.	NM_001251904	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	ENST00000258530.3	hg19	CCDS9101.1																																																																																			.	.	.	none		0.423	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406238.3	NM_018171	
HECTD4	283450	hgsc.bcm.edu	37	12	112620983	112620983	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:112620983C>T	ENST00000430131.2	-	61	10746	c.9601G>A	c.(9601-9603)Gat>Aat	p.D3201N	HECTD4_ENST00000550722.1_Missense_Mutation_p.D3477N|HECTD4_ENST00000377560.5_Missense_Mutation_p.D3451N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3201					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ATCAATTCATCTTCACCATCC	0.368																																					p.D3489N		Atlas-SNP	.											.	.	.	.	0			c.G10465A						PASS	.						181.0	176.0	178.0					12																	112620983		1837	4098	5935	SO:0001583	missense	283450	exon62			ATTCATCTTCACC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9601G>A	chr12.hg19:g.112620983C>T	ENSP00000404379:p.Asp3201Asn	130.0	0.0	.		137.0	55.0	.	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	27.9	4.870119	0.91587	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.51574	0.7;0.7;0.7	5.7	5.7	0.88788	.	.	.	.	.	T	0.33702	0.0872	N	0.14661	0.345	0.58432	D	0.999996	P	0.40970	0.734	B	0.34824	0.19	T	0.36359	-0.9751	9	0.87932	D	0	.	18.8233	0.92106	0.0:1.0:0.0:0.0	.	3201	Q9Y4D8	K0614_HUMAN	N	3451;3201;3477	ENSP00000366783:D3451N;ENSP00000404379:D3201N;ENSP00000449784:D3477N	ENSP00000366783:D3451N	D	-	1	0	C12orf51	111105366	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.994000	0.76251	2.687000	0.91594	0.655000	0.94253	GAT	.	.	.	none		0.368	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TPCN1	53373	hgsc.bcm.edu	37	12	113704112	113704112	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:113704112T>A	ENST00000335509.6	+	4	679	c.365T>A	c.(364-366)cTc>cAc	p.L122H	TPCN1_ENST00000392569.4_Missense_Mutation_p.L54H|TPCN1_ENST00000541517.1_Missense_Mutation_p.L194H|TPCN1_ENST00000550785.1_Missense_Mutation_p.L194H	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	122					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CTGCTGCTGCTCTCCCTGTGC	0.657																																					p.L194H		Atlas-SNP	.											.	TPCN1	109	.	0			c.T581A						PASS	.						201.0	208.0	206.0					12																	113704112		2203	4300	6503	SO:0001583	missense	53373	exon5			TGCTGCTCTCCCT	AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.365T>A	chr12.hg19:g.113704112T>A	ENSP00000335300:p.Leu122His	43.0	0.0	.		45.0	11.0	.	NM_001143819	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	ENST00000335509.6	hg19	CCDS31908.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.823622	0.90873	.	.	ENSG00000186815	ENST00000552642;ENST00000552985;ENST00000335509;ENST00000552897;ENST00000550785;ENST00000541517;ENST00000392569;ENST00000552542;ENST00000548465	T;D;D;D;D	0.98602	-0.58;-4.88;-5.02;-5.02;-4.96	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000002	D	0.98801	0.9596	M	0.78456	2.415	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	D	0.99860	1.1082	10	0.87932	D	0	-27.5316	15.2318	0.73395	0.0:0.0:0.0:1.0	.	122;194;122	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	H	98;208;122;54;194;194;54;54;54	ENSP00000447569:L208H;ENSP00000335300:L122H;ENSP00000448083:L194H;ENSP00000438125:L194H;ENSP00000376350:L54H	ENSP00000335300:L122H	L	+	2	0	TPCN1	112188495	1.000000	0.71417	0.986000	0.45419	0.978000	0.69477	7.661000	0.83786	2.001000	0.58596	0.459000	0.35465	CTC	.	.	.	none		0.657	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405156.3	NM_017901	
PIBF1	10464	hgsc.bcm.edu	37	13	73357620	73357620	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr13:73357620A>T	ENST00000326291.6	+	2	351	c.13A>T	c.(13-15)Att>Ttt	p.I5F	DIS3_ENST00000475871.1_5'Flank|DIS3_ENST00000545453.1_5'Flank|DIS3_ENST00000377767.4_5'Flank|DIS3_ENST00000377780.4_5'Flank	NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	5						centrosome (GO:0005813)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		GTCTCGAAAAATTTCAAAGGA	0.269																																					p.I5F		Atlas-SNP	.											.	PIBF1	65	.	0			c.A13T						PASS	.						44.0	49.0	47.0					13																	73357620		2203	4299	6502	SO:0001583	missense	10464	exon2			CGAAAAATTTCAA	AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.13A>T	chr13.hg19:g.73357620A>T	ENSP00000317144:p.Ile5Phe	216.0	0.0	.		150.0	65.0	.	NM_006346	O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Missense_Mutation	SNP	ENST00000326291.6	hg19	CCDS31991.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341787	0.41498	.	.	ENSG00000083535	ENST00000326291;ENST00000538949	T	0.24350	1.86	5.19	-2.11	0.07187	.	1.080480	0.06937	N	0.812077	T	0.17746	0.0426	L	0.44542	1.39	0.21697	N	0.999583	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37454	-0.9705	10	0.48119	T	0.1	-1.1276	1.6908	0.02852	0.3442:0.242:0.2958:0.118	.	5;5	Q8WXW3;Q4G0R1	PIBF1_HUMAN;.	F	5	ENSP00000317144:I5F	ENSP00000317144:I5F	I	+	1	0	PIBF1	72255621	0.389000	0.25205	0.588000	0.28705	0.994000	0.84299	0.370000	0.20433	0.015000	0.14971	0.397000	0.26171	ATT	.	.	.	none		0.269	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	
SALL2	6297	hgsc.bcm.edu	37	14	21991632	21991632	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr14:21991632C>T	ENST00000327430.3	-	2	2524	c.2230G>A	c.(2230-2232)Ggg>Agg	p.G744R	SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.G607R|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	744					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CTCCCTGCCCCGGAGACTGTA	0.602																																					p.G744R		Atlas-SNP	.											.	SALL2	95	.	0			c.G2230A						PASS	.						55.0	48.0	51.0					14																	21991632		2203	4300	6503	SO:0001583	missense	6297	exon2			CTGCCCCGGAGAC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2230G>A	chr14.hg19:g.21991632C>T	ENSP00000333537:p.Gly744Arg	61.0	0.0	.		38.0	15.0	.	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	hg19	CCDS32045.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194957	0.38806	.	.	ENSG00000165821	ENST00000327430;ENST00000450879	T;T	0.04049	3.77;3.72	4.76	4.76	0.60689	.	0.204155	0.24504	N	0.037952	T	0.03651	0.0104	N	0.24115	0.695	0.20307	N	0.999917	B;B;B;B	0.28470	0.213;0.213;0.127;0.127	B;B;B;B	0.17433	0.012;0.018;0.012;0.012	T	0.35325	-0.9793	10	0.59425	D	0.04	-7.6456	8.8209	0.35025	0.0:0.8999:0.0:0.1001	.	607;607;505;744	B4DK65;E7EW59;B4DFD9;Q9Y467	.;.;.;SALL2_HUMAN	R	744;607	ENSP00000333537:G744R;ENSP00000396773:G607R	ENSP00000333537:G744R	G	-	1	0	SALL2	21061472	0.000000	0.05858	0.100000	0.21137	0.130000	0.20726	1.004000	0.29822	2.468000	0.83385	0.563000	0.77884	GGG	.	.	.	none		0.602	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
PSMB11	122706	hgsc.bcm.edu	37	14	23511771	23511771	+	Missense_Mutation	SNP	C	C	T	rs376450654		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr14:23511771C>T	ENST00000408907.2	+	1	396	c.337C>T	c.(337-339)Cgg>Tgg	p.R113W		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	113					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GCGGGAGCTGCGGCTTCGGGA	0.597																																					p.R113W		Atlas-SNP	.											.	PSMB11	40	.	0			c.C337T						PASS	.	C	TRP/ARG	0,4212		0,0,2106	64.0	70.0	68.0		337	3.4	1.0	14		68	1,8443		0,1,4221	no	missense	PSMB11	NM_001099780.1	101	0,1,6327	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	113/301	23511771	1,12655	2106	4222	6328	SO:0001583	missense	122706	exon1			GAGCTGCGGCTTC		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.337C>T	chr14.hg19:g.23511771C>T	ENSP00000386212:p.Arg113Trp	56.0	0.0	.		39.0	14.0	.	NM_001099780		Missense_Mutation	SNP	ENST00000408907.2	hg19	CCDS41923.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487586	0.64074	0.0	1.18E-4	ENSG00000222028	ENST00000408907	T	0.36340	1.26	5.24	3.36	0.38483	.	0.000000	0.85682	D	0.000000	T	0.67059	0.2853	M	0.92367	3.3	0.42052	D	0.99112	D	0.89917	1.0	D	0.87578	0.998	T	0.74791	-0.3545	10	0.87932	D	0	0.0206	13.1646	0.59562	0.2911:0.7089:0.0:0.0	.	113	A5LHX3	PSB11_HUMAN	W	113	ENSP00000386212:R113W	ENSP00000386212:R113W	R	+	1	2	PSMB11	22581611	0.100000	0.21855	0.999000	0.59377	0.850000	0.48378	0.220000	0.17660	0.553000	0.29044	0.563000	0.77884	CGG	.	.	.	weak		0.597	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408294.1	NM_001099780	
ZBTB42	100128927	hgsc.bcm.edu	37	14	105267928	105267928	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr14:105267928C>G	ENST00000342537.7	+	1	679	c.394C>G	c.(394-396)Cct>Gct	p.P132A	ZBTB42_ENST00000555360.1_Missense_Mutation_p.P132A	NM_001137601.1	NP_001131073.1	B2RXF5	ZBT42_HUMAN	zinc finger and BTB domain containing 42	132	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GAACCCTGCCCCTGGGGCAGA	0.657																																					p.P132A		Atlas-SNP	.											.	ZBTB42	10	.	0			c.C394G						PASS	.						23.0	27.0	26.0					14																	105267928		692	1589	2281	SO:0001583	missense	100128927	exon2			CCTGCCCCTGGGG	AX721091	CCDS45174.1	14q32.33	2013-01-09				ENSG00000179627		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	32550	protein-coding gene	gene with protein product		613915					Standard	NM_001137601		Approved	ZNF925	uc001ypp.3	B2RXF5		ENST00000342537.7:c.394C>G	chr14.hg19:g.105267928C>G	ENSP00000409107:p.Pro132Ala	169.0	0.0	.		116.0	56.0	.	NM_001137601	B7ZW21	Missense_Mutation	SNP	ENST00000342537.7	hg19	CCDS45174.1	.	.	.	.	.	.	.	.	.	.	C	0.614	-0.823799	0.02755	.	.	ENSG00000179627	ENST00000555360;ENST00000342537	T;T	0.12361	2.69;2.69	3.09	3.09	0.35607	.	.	.	.	.	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B	0.25667	0.131	B	0.19666	0.026	T	0.35847	-0.9772	9	0.08837	T	0.75	.	8.861	0.35258	0.0:0.6663:0.3337:0.0	.	132	B2RXF5	ZBT42_HUMAN	A	132	ENSP00000450673:P132A;ENSP00000409107:P132A	ENSP00000409107:P132A	P	+	1	0	ZBTB42	104338973	0.001000	0.12720	0.055000	0.19348	0.223000	0.24884	0.872000	0.28037	1.559000	0.49555	0.462000	0.41574	CCT	.	.	.	none		0.657	ZBTB42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410372.1		
MAP1A	4130	hgsc.bcm.edu	37	15	43818609	43818609	+	Silent	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr15:43818609G>T	ENST00000300231.5	+	4	5388	c.4938G>T	c.(4936-4938)gtG>gtT	p.V1646V	MAP1A_ENST00000399453.1_Silent_p.V1646V|MAP1A_ENST00000382031.1_Silent_p.V1884V			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1646					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GGCAGGATGTGGTCCAGGAGT	0.582																																					p.V1646V		Atlas-SNP	.											.	MAP1A	189	.	0			c.G4938T						PASS	.						45.0	59.0	54.0					15																	43818609		1974	4146	6120	SO:0001819	synonymous_variant	4130	exon4			GGATGTGGTCCAG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4938G>T	chr15.hg19:g.43818609G>T		124.0	0.0	.		73.0	4.0	.	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	ENST00000300231.5	hg19	CCDS42031.1																																																																																			.	.	.	none		0.582	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
CACNA1H	8912	hgsc.bcm.edu	37	16	1259111	1259111	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:1259111T>C	ENST00000348261.5	+	17	3691	c.3443T>C	c.(3442-3444)cTg>cCg	p.L1148P	CACNA1H_ENST00000358590.4_Missense_Mutation_p.L1148P|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Missense_Mutation_p.L1148P	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1148					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TGGAGCAGCCTGGGCCGTGCC	0.726																																					p.L1148P		Atlas-SNP	.											.	CACNA1H	317	.	0			c.T3443C						PASS	.						4.0	5.0	5.0					16																	1259111		1754	3783	5537	SO:0001583	missense	8912	exon17			GCAGCCTGGGCCG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3443T>C	chr16.hg19:g.1259111T>C	ENSP00000334198:p.Leu1148Pro	904.0	1.0	.		837.0	286.0	.	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	T	18.95	3.732137	0.69189	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.88586	-2.4;-2.4	3.9	3.9	0.45041	.	0.585053	0.15998	N	0.234441	D	0.93913	0.8052	M	0.80616	2.505	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.981	D	0.93697	0.7012	10	0.87932	D	0	.	11.9149	0.52759	0.0:0.0:0.0:1.0	.	1148;1148	O95180-2;O95180	.;CAC1H_HUMAN	P	1148	ENSP00000334198:L1148P;ENSP00000351401:L1148P	ENSP00000334198:L1148P	L	+	2	0	CACNA1H	1199112	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	7.552000	0.82192	1.399000	0.46721	0.402000	0.26972	CTG	.	.	.	none		0.726	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CCDC64B	146439	hgsc.bcm.edu	37	16	3080512	3080512	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:3080512G>C	ENST00000572449.1	-	5	762	c.700C>G	c.(700-702)Ctg>Gtg	p.L234V	CCDC64B_ENST00000389347.4_Missense_Mutation_p.L234V|CCDC64B_ENST00000573514.1_Missense_Mutation_p.L27V|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	234										breast(1)|endometrium(2)|large_intestine(1)	4						GTGGTCTGCAGTCTGCCCTCA	0.672																																					p.L234V		Atlas-SNP	.											.	CCDC64B	19	.	0			c.C700G						PASS	.						28.0	32.0	31.0					16																	3080512		2073	4210	6283	SO:0001583	missense	146439	exon4			TCTGCAGTCTGCC	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.700C>G	chr16.hg19:g.3080512G>C	ENSP00000459043:p.Leu234Val	27.0	0.0	.		26.0	16.0	.	NM_001103175	Q658L9	Missense_Mutation	SNP	ENST00000572449.1	hg19	CCDS45393.1	.	.	.	.	.	.	.	.	.	.	G	0.241	-1.013631	0.02095	.	.	ENSG00000162069	ENST00000389347	T	0.33865	1.39	5.15	4.17	0.49024	.	0.191847	0.34386	N	0.004017	T	0.12433	0.0302	N	0.01048	-1.04	0.09310	N	0.999994	B	0.22541	0.071	B	0.23716	0.048	T	0.16600	-1.0397	10	0.10902	T	0.67	-15.3767	12.8777	0.57999	0.0:0.2062:0.7938:0.0	.	234	A1A5D9	BICR2_HUMAN	V	234	ENSP00000373998:L234V	ENSP00000373998:L234V	L	-	1	2	CCDC64B	3020513	0.541000	0.26417	0.878000	0.34440	0.080000	0.17528	2.133000	0.42093	2.420000	0.82092	0.491000	0.48974	CTG	.	.	.	none		0.672	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436991.1		
TMEM186	25880	hgsc.bcm.edu	37	16	8889985	8889985	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:8889985A>G	ENST00000333050.6	-	2	499	c.466T>C	c.(466-468)Tgt>Cgt	p.C156R	PMM2_ENST00000268261.4_5'Flank|PMM2_ENST00000539622.1_5'Flank|TMEM186_ENST00000564869.1_Intron|PMM2_ENST00000537352.1_5'Flank|PMM2_ENST00000569958.1_5'Flank|PMM2_ENST00000566983.1_Intron	NM_015421.3	NP_056236.2	Q96B77	TM186_HUMAN	transmembrane protein 186	156						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9						GCCATGGGACAGTATGTGTCC	0.542																																					p.C156R		Atlas-SNP	.											.	TMEM186	21	.	0			c.T466C						PASS	.						113.0	102.0	106.0					16																	8889985		2197	4300	6497	SO:0001583	missense	25880	exon2			TGGGACAGTATGT	BC015912	CCDS10535.1	16p13.2	2008-02-05	2007-02-08	2007-02-08	ENSG00000184857	ENSG00000184857			24530	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 51"""	C16orf51		11230166	Standard	NM_015421		Approved	DKFZP564K2062	uc002cze.3	Q96B77	OTTHUMG00000129696	ENST00000333050.6:c.466T>C	chr16.hg19:g.8889985A>G	ENSP00000331640:p.Cys156Arg	80.0	0.0	.		86.0	53.0	.	NM_015421	B2RAY0|Q9Y4T4	Missense_Mutation	SNP	ENST00000333050.6	hg19	CCDS10535.1	.	.	.	.	.	.	.	.	.	.	A	9.941	1.217610	0.22373	.	.	ENSG00000184857	ENST00000333050	T	0.41065	1.01	5.28	4.18	0.49190	.	0.000000	0.49916	D	0.000123	T	0.52661	0.1748	L	0.57536	1.79	0.28050	N	0.933414	D	0.69078	0.997	D	0.65010	0.931	T	0.50189	-0.8857	10	0.72032	D	0.01	-17.9481	5.5333	0.16997	0.7659:0.0:0.0825:0.1516	.	156	Q96B77	TM186_HUMAN	R	156	ENSP00000331640:C156R	ENSP00000331640:C156R	C	-	1	0	TMEM186	8797486	1.000000	0.71417	0.061000	0.19648	0.343000	0.28985	2.999000	0.49473	0.850000	0.35239	0.402000	0.26972	TGT	.	.	.	none		0.542	TMEM186-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251903.1	NM_015421	
PALB2	79728	hgsc.bcm.edu	37	16	23646629	23646629	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:23646629G>C	ENST00000261584.4	-	4	1390	c.1238C>G	c.(1237-1239)aCa>aGa	p.T413R		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	413	ChAM (Chromatin-association motif); required for chromatin association, mediates nucleosome association.|DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		CATGCTTCGTGTTGTTCTAAC	0.413			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																													p.T413R		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	.	PALB2	108	.	0			c.C1238G						PASS	.						80.0	83.0	82.0					16																	23646629		2197	4300	6497	SO:0001583	missense	79728	exon4			CTTCGTGTTGTTC		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1238C>G	chr16.hg19:g.23646629G>C	ENSP00000261584:p.Thr413Arg	91.0	0.0	.		80.0	28.0	.	NM_024675	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	ENST00000261584.4	hg19	CCDS32406.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376583	0.82682	.	.	ENSG00000083093	ENST00000261584	T	0.40756	1.02	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000003	T	0.65450	0.2692	M	0.72118	2.19	0.41484	D	0.988183	D	0.89917	1.0	D	0.97110	1.0	T	0.66937	-0.5797	10	0.72032	D	0.01	-18.1358	17.6312	0.88108	0.0:0.0:1.0:0.0	.	413	Q86YC2	PALB2_HUMAN	R	413	ENSP00000261584:T413R	ENSP00000261584:T413R	T	-	2	0	PALB2	23554130	1.000000	0.71417	0.991000	0.47740	0.957000	0.61999	6.967000	0.76079	2.836000	0.97738	0.655000	0.94253	ACA	.	.	.	none		0.413	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435287.2	NM_024675	
PDPR	55066	hgsc.bcm.edu	37	16	70190776	70190776	+	Silent	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:70190776G>C	ENST00000288050.4	+	19	3591	c.2634G>C	c.(2632-2634)ggG>ggC	p.G878G	RP11-296I10.3_ENST00000502126.1_RNA|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000568530.1_Silent_p.G878G|PDPR_ENST00000567046.1_Silent_p.G236G|PDPR_ENST00000398122.3_Silent_p.G778G|PDPR_ENST00000542659.1_Silent_p.G223G	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	878					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ACTTACATGGGAAGTGATGCC	0.582																																					p.G878G		Atlas-SNP	.											.	PDPR	66	.	0			c.G2634C						PASS	.						40.0	48.0	46.0					16																	70190776		2122	4228	6350	SO:0001819	synonymous_variant	55066	exon19			ACATGGGAAGTGA		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2634G>C	chr16.hg19:g.70190776G>C		66.0	0.0	.		93.0	36.0	.	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Silent	SNP	ENST00000288050.4	hg19	CCDS45520.1																																																																																			.	.	.	none		0.582	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
ATMIN	23300	hgsc.bcm.edu	37	16	81077147	81077147	+	Silent	SNP	A	A	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:81077147A>T	ENST00000299575.4	+	4	1068	c.1044A>T	c.(1042-1044)gtA>gtT	p.V348V	ATMIN_ENST00000566488.1_Silent_p.V192V|ATMIN_ENST00000564241.1_Silent_p.V192V|ATMIN_ENST00000539819.1_3'UTR	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	348	Required for formation of RAD51 foci.				cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						CCTTGTCAGTAGGAACCCTGA	0.512																																					p.V348V		Atlas-SNP	.											.	ATMIN	50	.	0			c.A1044T						PASS	.						52.0	52.0	52.0					16																	81077147		2202	4299	6501	SO:0001819	synonymous_variant	23300	exon4			GTCAGTAGGAACC	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1044A>T	chr16.hg19:g.81077147A>T		82.0	0.0	.		120.0	42.0	.	NM_015251	A8K4H8|Q68DC9	Silent	SNP	ENST00000299575.4	hg19	CCDS32494.1																																																																																			.	.	.	none		0.512	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432140.1	NM_015251	
TRPV3	162514	hgsc.bcm.edu	37	17	3446887	3446887	+	Missense_Mutation	SNP	T	T	C	rs372555157		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr17:3446887T>C	ENST00000576742.1	-	5	668	c.347A>G	c.(346-348)aAg>aGg	p.K116R	TRPV3_ENST00000572519.1_Missense_Mutation_p.K116R|TRPV3_ENST00000301365.4_Missense_Mutation_p.K116R	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	116					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CAGCCGCCTCTTTTTCCTCCT	0.552																																					p.K116R		Atlas-SNP	.											.	TRPV3	85	.	0			c.A347G						PASS	.						114.0	110.0	111.0					17																	3446887		2203	4300	6503	SO:0001583	missense	162514	exon5			CGCCTCTTTTTCC	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.347A>G	chr17.hg19:g.3446887T>C	ENSP00000461518:p.Lys116Arg	70.0	0.0	.		75.0	50.0	.	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	hg19	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	T	8.300	0.819676	0.16607	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.87334	-2.24	5.12	4.02	0.46733	.	0.077629	0.51477	D	0.000083	T	0.74268	0.3694	N	0.20986	0.625	0.22266	N	0.99924	B;B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B	0.06405	0.001;0.002;0.002;0.002;0.001;0.001;0.001	T	0.55835	-0.8078	10	0.18276	T	0.48	-9.2531	6.5943	0.22664	0.0:0.1588:0.0:0.8412	.	100;100;116;100;116;116;116	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	R	116;116;100	ENSP00000301365:K116R	ENSP00000301365:K116R	K	-	2	0	TRPV3	3393637	0.967000	0.33354	0.975000	0.42487	0.080000	0.17528	0.927000	0.28818	2.060000	0.61445	0.459000	0.35465	AAG	.	.	.	alt		0.552	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
RAI1	10743	hgsc.bcm.edu	37	17	17697105	17697105	+	Silent	SNP	G	G	A	rs398124422|rs587780431		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr17:17697105G>A	ENST00000353383.1	+	3	1312	c.843G>A	c.(841-843)caG>caA	p.Q281Q	RAI1_ENST00000261641.6_Silent_p.Q281Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	281	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		agcagcagcagcagcagcagc	0.632																																					p.Q281Q		Atlas-SNP	.											.	RAI1	121	.	0			c.G843A						PASS	.						20.0	25.0	24.0					17																	17697105		2020	4001	6021	SO:0001819	synonymous_variant	10743	exon3			GCAGCAGCAGCAG	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.843G>A	chr17.hg19:g.17697105G>A		73.0	0.0	.		87.0	4.0	.	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	ENST00000353383.1	hg19	CCDS11188.1																																																																																			.	.	.	none		0.632	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
DHX8	1659	hgsc.bcm.edu	37	17	41576230	41576230	+	Splice_Site	SNP	A	A	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr17:41576230A>T	ENST00000262415.3	+	10	1373	c.1301A>T	c.(1300-1302)gAt>gTt	p.D434V	DHX8_ENST00000540306.1_Splice_Site_p.D434V	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	434					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GGACTTTTAGATGAGGACCTT	0.383																																					p.D434V	NSCLC(56;1548 1661 49258 49987)	Atlas-SNP	.											.	DHX8	98	.	0			c.A1301T						PASS	.						61.0	59.0	60.0					17																	41576230		2203	4300	6503	SO:0001630	splice_region_variant	1659	exon10			TTTTAGATGAGGA	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1301-1A>T	chr17.hg19:g.41576230A>T		65.0	0.0	.		58.0	12.0	.	NM_004941		Missense_Mutation	SNP	ENST00000262415.3	hg19	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399319	0.62177	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.03607	3.87;3.88	5.19	5.19	0.71726	.	0.050805	0.85682	D	0.000000	T	0.05593	0.0147	L	0.46741	1.465	0.80722	D	1	B;B	0.27140	0.169;0.114	B;B	0.32211	0.142;0.035	T	0.44221	-0.9342	9	.	.	.	.	13.9181	0.63914	1.0:0.0:0.0:0.0	.	434;434	F5H658;Q14562	.;DHX8_HUMAN	V	434	ENSP00000437886:D434V;ENSP00000262415:D434V	.	D	+	2	0	DHX8	38931756	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.937000	0.92936	1.962000	0.57031	0.459000	0.35465	GAT	.	.	.	none		0.383	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		Missense_Mutation
ADAM11	4185	hgsc.bcm.edu	37	17	42855411	42855411	+	Missense_Mutation	SNP	C	C	T	rs149116155		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr17:42855411C>T	ENST00000200557.6	+	24	2331	c.2162C>T	c.(2161-2163)aCg>aTg	p.T721M	ADAM11_ENST00000535346.1_Missense_Mutation_p.T521M	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	721					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				TCCCCACCCACGGGGGAGACG	0.592																																					p.T721M		Atlas-SNP	.											.	ADAM11	118	.	0			c.C2162T						PASS	.	C	MET/THR	0,4406		0,0,2203	80.0	83.0	82.0		2162	4.9	1.0	17	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADAM11	NM_002390.4	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	721/770	42855411	1,13005	2203	4300	6503	SO:0001583	missense	4185	exon24			CACCCACGGGGGA	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.2162C>T	chr17.hg19:g.42855411C>T	ENSP00000200557:p.Thr721Met	79.0	0.0	.		62.0	13.0	.	NM_002390	Q14808|Q14809|Q14810	Missense_Mutation	SNP	ENST00000200557.6	hg19	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964645	0.53507	0.0	1.16E-4	ENSG00000073670	ENST00000200557;ENST00000535346	T;T	0.02177	4.41;4.79	4.93	4.93	0.64822	.	0.182174	0.45126	D	0.000384	T	0.05640	0.0148	L	0.55990	1.75	0.48452	D	0.999652	P;D	0.60160	0.88;0.987	B;P	0.48227	0.357;0.571	T	0.28170	-1.0052	10	0.66056	D	0.02	.	16.9062	0.86128	0.0:1.0:0.0:0.0	.	521;721	B4DKD2;O75078	.;ADA11_HUMAN	M	721;521	ENSP00000200557:T721M;ENSP00000443773:T521M	ENSP00000200557:T721M	T	+	2	0	ADAM11	40210937	0.108000	0.22018	0.976000	0.42696	0.742000	0.42306	2.312000	0.43726	2.279000	0.76181	0.561000	0.74099	ACG	.	C|1.000;T|0.000	0.000	weak		0.592	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
EPG5	57724	hgsc.bcm.edu	37	18	43519695	43519695	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr18:43519695T>C	ENST00000282041.5	-	10	2004	c.1970A>G	c.(1969-1971)cAt>cGt	p.H657R		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	657					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CTGTGCCCAATGGTCACTTAC	0.403																																					p.H657R		Atlas-SNP	.											.	EPG5	199	.	0			c.A1970G						PASS	.						85.0	77.0	80.0					18																	43519695		1901	4121	6022	SO:0001583	missense	57724	exon10			GCCCAATGGTCAC	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.1970A>G	chr18.hg19:g.43519695T>C	ENSP00000282041:p.His657Arg	128.0	0.0	.		133.0	51.0	.	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799468	0.50208	.	.	ENSG00000152223	ENST00000282041	T	0.11063	2.81	5.4	5.4	0.78164	.	0.430004	0.26832	N	0.022265	T	0.29716	0.0742	L	0.56769	1.78	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.00849	-1.1541	10	0.44086	T	0.13	-15.6279	15.423	0.75028	0.0:0.0:0.0:1.0	.	657;657	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	R	657	ENSP00000282041:H657R	ENSP00000282041:H657R	H	-	2	0	EPG5	41773693	1.000000	0.71417	0.998000	0.56505	0.049000	0.14656	7.318000	0.79029	2.037000	0.60232	0.379000	0.24179	CAT	.	.	.	none		0.403	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
CDH19	28513	hgsc.bcm.edu	37	18	64235858	64235858	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr18:64235858T>G	ENST00000540086.1	-	3	531	c.285A>C	c.(283-285)agA>agC	p.R95S	CDH19_ENST00000262150.2_Missense_Mutation_p.R95S	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	196	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				TGTCACCTGTTCTTTCATCAA	0.428																																					p.R95S		Atlas-SNP	.											.	CDH19	141	.	0			c.A285C						PASS	.						116.0	112.0	114.0					18																	64235858		2203	4299	6502	SO:0001583	missense	28513	exon3			ACCTGTTCTTTCA	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.285A>C	chr18.hg19:g.64235858T>G	ENSP00000439593:p.Arg95Ser	66.0	0.0	.		104.0	69.0	.	NM_021153	O15098	Missense_Mutation	SNP	ENST00000540086.1	hg19	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	T	11.37	1.618194	0.28801	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.50277	0.75;0.75	5.87	-0.598	0.11649	Cadherin (5);Cadherin-like (1);	0.944409	0.09075	N	0.852351	T	0.22859	0.0552	N	0.16833	0.445	0.09310	N	1	B;B	0.22909	0.077;0.056	B;B	0.24394	0.019;0.053	T	0.23797	-1.0178	10	0.07990	T	0.79	.	1.9256	0.03316	0.127:0.3108:0.1313:0.4309	.	95;95	F5H1K0;Q9H159	.;CAD19_HUMAN	S	95;95;40	ENSP00000262150:R95S;ENSP00000439593:R95S	ENSP00000262150:R95S	R	-	3	2	CDH19	62386838	0.000000	0.05858	0.089000	0.20774	0.978000	0.69477	-2.192000	0.01245	-0.084000	0.12595	0.482000	0.46254	AGA	.	.	.	none		0.428	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
ZNF236	7776	hgsc.bcm.edu	37	18	74617340	74617340	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr18:74617340C>A	ENST00000253159.8	+	13	2458	c.2260C>A	c.(2260-2262)Cta>Ata	p.L754I	ZNF236_ENST00000320610.9_Missense_Mutation_p.L756I	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	754					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TAAGACTTCACTAAATTGCAA	0.423																																					p.L754I		Atlas-SNP	.											.	ZNF236	325	.	0			c.C2260A						PASS	.						57.0	54.0	55.0					18																	74617340		1827	4079	5906	SO:0001583	missense	7776	exon13			ACTTCACTAAATT	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2260C>A	chr18.hg19:g.74617340C>A	ENSP00000253159:p.Leu754Ile	109.0	0.0	.		113.0	35.0	.	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	hg19	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872028	0.51695	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.07567	3.18;3.18	5.39	4.28	0.50868	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.084389	0.49916	D	0.000138	T	0.09113	0.0225	M	0.65975	2.015	0.20873	N	0.999835	P	0.44090	0.826	B	0.39152	0.292	T	0.25710	-1.0124	10	0.30854	T	0.27	.	6.6764	0.23095	0.0:0.7144:0.0:0.2856	.	754	Q9UL36	ZN236_HUMAN	I	754	ENSP00000253159:L754I;ENSP00000444524:L754I	ENSP00000253159:L754I	L	+	1	2	ZNF236	72746328	0.872000	0.30054	0.123000	0.21794	0.891000	0.51852	1.866000	0.39489	2.687000	0.91594	0.462000	0.41574	CTA	.	.	.	none		0.423	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
CLEC4G	339390	hgsc.bcm.edu	37	19	7794389	7794389	+	Splice_Site	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:7794389G>A	ENST00000328853.5	-	9	813	c.745C>T	c.(745-747)Cac>Tac	p.H249Y	CLEC4G_ENST00000598081.1_5'Flank	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	249	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						TGGTTCCAGTGGCTACAGGGG	0.592																																					p.H249Y	Esophageal Squamous(146;540 1807 3349 19438 30853)	Atlas-SNP	.											.	CLEC4G	18	.	0			c.C745T						PASS	.						44.0	41.0	42.0					19																	7794389		2203	4300	6503	SO:0001630	splice_region_variant	339390	exon9			TCCAGTGGCTACA	AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.744-1C>T	chr19.hg19:g.7794389G>A		58.0	0.0	.		31.0	14.0	.	NM_198492		Missense_Mutation	SNP	ENST00000328853.5	hg19	CCDS12185.1	.	.	.	.	.	.	.	.	.	.	G	2.885	-0.230863	0.05983	.	.	ENSG00000182566	ENST00000328853;ENST00000381308	T	0.16324	2.35	5.46	-1.35	0.09114	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.887861	0.09337	N	0.816099	T	0.05090	0.0136	N	0.03177	-0.4	0.30480	N	0.772422	B	0.15141	0.012	B	0.16722	0.016	T	0.46803	-0.9165	10	0.07990	T	0.79	.	2.7461	0.05268	0.326:0.0:0.3351:0.3389	.	249	Q6UXB4	CLC4G_HUMAN	Y	249;133	ENSP00000327599:H249Y	ENSP00000327599:H249Y	H	-	1	0	CLEC4G	7700389	0.996000	0.38824	1.000000	0.80357	0.184000	0.23303	0.063000	0.14410	0.262000	0.21774	-0.181000	0.13052	CAC	.	.	.	none		0.592	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461989.1	NM_198492	Missense_Mutation
SMARCA4	6597	hgsc.bcm.edu	37	19	11123641	11123641	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:11123641G>C	ENST00000429416.3	+	17	2572	c.2291G>C	c.(2290-2292)tGg>tCg	p.W764S	RN7SL192P_ENST00000584303.1_RNA|SMARCA4_ENST00000444061.3_Missense_Mutation_p.W764S|SMARCA4_ENST00000589677.1_Missense_Mutation_p.W764S|SMARCA4_ENST00000590574.1_Missense_Mutation_p.W764S|SMARCA4_ENST00000541122.2_Missense_Mutation_p.W764S|SMARCA4_ENST00000358026.2_Missense_Mutation_p.W764S|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000413806.3_Missense_Mutation_p.W764S|SMARCA4_ENST00000450717.3_Missense_Mutation_p.W764S|SMARCA4_ENST00000344626.4_Missense_Mutation_p.W764S	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	764					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GGTTTGGAGTGGCTGGTGTCC	0.592			"""F, N, Mis"""		NSCLC																																p.W764S		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G2291C						PASS	.						110.0	90.0	97.0					19																	11123641		2203	4300	6503	SO:0001583	missense	6597	exon16			TGGAGTGGCTGGT	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2291G>C	chr19.hg19:g.11123641G>C	ENSP00000395654:p.Trp764Ser	142.0	0.0	.		83.0	34.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452323	0.84209	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	4.73	4.73	0.59995	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.99650	4.68	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98997	1.0810	10	0.87932	D	0	-19.8408	16.6409	0.85098	0.0:0.0:1.0:0.0	.	764;764;764;764;764;764;764	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	S	764;764;828;764;764;764;764;764	ENSP00000395654:W764S;ENSP00000350720:W764S;ENSP00000343896:W764S;ENSP00000445036:W764S;ENSP00000392837:W764S;ENSP00000397783:W764S;ENSP00000414727:W764S	ENSP00000343896:W764S	W	+	2	0	SMARCA4	10984641	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.456000	0.83038	0.655000	0.94253	TGG	.	.	.	none		0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SMARCA4	6597	hgsc.bcm.edu	37	19	11141507	11141507	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:11141507G>C	ENST00000429416.3	+	26	3765	c.3484G>C	c.(3484-3486)Ggc>Cgc	p.G1162R	SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1162R|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1162R|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1162R|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1162R|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1162R|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1162R|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1162R|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1162R	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1162	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGGGGGGCTCGGCCTGAACCT	0.607			"""F, N, Mis"""		NSCLC																																p.G1162R		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,right_upper_lobe,carcinoma,0,2	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G3484C						PASS	.						24.0	25.0	25.0					19																	11141507		2197	4297	6494	SO:0001583	missense	6597	exon25			GGGCTCGGCCTGA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3484G>C	chr19.hg19:g.11141507G>C	ENSP00000395654:p.Gly1162Arg	83.0	0.0	.		46.0	18.0	.	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744411	0.89663	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97598	-4.45;-4.45;-4.45;-4.45;-4.45;-4.45;-4.45	4.59	4.59	0.56863	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99381	0.9782	H	0.99982	5.21	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97655	1.0157	10	0.87932	D	0	-37.1265	16.3247	0.82975	0.0:0.0:1.0:0.0	.	1162;1162;1162;1162;1162;382;1162;1162	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	R	1162;1162;1226;1162;1162;1162;1162;1162	ENSP00000395654:G1162R;ENSP00000350720:G1162R;ENSP00000343896:G1162R;ENSP00000445036:G1162R;ENSP00000392837:G1162R;ENSP00000397783:G1162R;ENSP00000414727:G1162R	ENSP00000343896:G1162R	G	+	1	0	SMARCA4	11002507	1.000000	0.71417	0.957000	0.39632	0.994000	0.84299	9.356000	0.97091	2.389000	0.81357	0.563000	0.77884	GGC	.	.	.	none		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
PLPPR2	64748	hgsc.bcm.edu	37	19	11470232	11470232	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:11470232C>A	ENST00000251473.5	+	4	467	c.91C>A	c.(91-93)Ctg>Atg	p.L31M	DKFZP761J1410_ENST00000591608.1_Intron|DKFZP761J1410_ENST00000586431.1_3'UTR	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CATTGTGATCCTGCTTGCTTA	0.612																																					p.L31M		Atlas-SNP	.											.	LPPR2	21	.	0			c.C91A						PASS	.						114.0	84.0	94.0					19																	11470232		2203	4300	6503	SO:0001583	missense	0	exon4			GTGATCCTGCTTG																												ENST00000251473.5:c.91C>A	chr19.hg19:g.11470232C>A	ENSP00000251473:p.Leu31Met	78.0	0.0	.		67.0	37.0	.	NM_022737		Missense_Mutation	SNP	ENST00000251473.5	hg19	CCDS12258.1	.	.	.	.	.	.	.	.	.	.	c	10.93	1.489114	0.26686	.	.	ENSG00000105520	ENST00000251473	T	0.42900	0.96	5.27	4.23	0.50019	.	0.088420	0.47455	D	0.000231	T	0.26521	0.0648	L	0.38838	1.175	0.80722	D	1	B	0.33379	0.41	B	0.25614	0.062	T	0.06534	-1.0821	10	0.27785	T	0.31	.	6.9598	0.24591	0.1712:0.7402:0.0:0.0886	.	31	Q96GM1	LPPR2_HUMAN	M	31	ENSP00000251473:L31M	ENSP00000251473:L31M	L	+	1	2	AC024575.1	11331232	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	1.458000	0.35223	1.229000	0.43630	0.443000	0.29094	CTG	.	.	.	none		0.612	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458779.1		
UNC13A	23025	hgsc.bcm.edu	37	19	17759377	17759377	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:17759377G>A	ENST00000519716.2	-	16	1678	c.1679C>T	c.(1678-1680)aCg>aTg	p.T560M	UNC13A_ENST00000252773.7_Missense_Mutation_p.T560M|UNC13A_ENST00000550896.1_Missense_Mutation_p.T558M|UNC13A_ENST00000428389.2_Missense_Mutation_p.T648M|UNC13A_ENST00000551649.1_Missense_Mutation_p.T560M|UNC13A_ENST00000552293.1_Missense_Mutation_p.T560M	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	560					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CGTGGTGGCCGTCCACACTTC	0.612																																					p.T560M		Atlas-SNP	.											.	UNC13A	299	.	0			c.C1679T						PASS	.						118.0	135.0	129.0					19																	17759377		2194	4299	6493	SO:0001583	missense	23025	exon15			GTGGCCGTCCACA	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1679C>T	chr19.hg19:g.17759377G>A	ENSP00000429562:p.Thr560Met	77.0	0.0	.		61.0	31.0	.	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	g	22.5	4.301507	0.81136	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	4.35	3.31	0.37934	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	U	0.000000	D	0.96259	0.8780	M	0.85859	2.78	0.45621	D	0.998556	D	0.89917	1.0	D	0.76071	0.987	D	0.95845	0.8869	10	0.87932	D	0	-20.4176	10.261	0.43427	0.1017:0.0:0.8983:0.0	.	560	Q9UPW8	UN13A_HUMAN	M	560;648;560;560;560;558	ENSP00000429562:T560M;ENSP00000400409:T648M;ENSP00000252773:T560M;ENSP00000447236:T560M;ENSP00000447572:T560M;ENSP00000446831:T558M	ENSP00000252773:T560M	T	-	2	0	UNC13A	17620377	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.567000	0.98161	0.941000	0.37499	0.486000	0.48141	ACG	.	.	.	none		0.612	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
RINL	126432	hgsc.bcm.edu	37	19	39360598	39360598	+	Silent	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:39360598G>T	ENST00000591812.1	-	9	1413	c.1327C>A	c.(1327-1329)Cga>Aga	p.R443R	RINL_ENST00000598904.1_Silent_p.R329R|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000602238.1_5'Flank|RINL_ENST00000340740.3_Silent_p.R329R			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	443	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						TTCTCGCCTCGAGCCAGGCCC	0.657											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R443R		Atlas-SNP	.											.	RINL	32	.	0			c.C1327A						PASS	.																																			SO:0001819	synonymous_variant	126432	exon9			CGCCTCGAGCCAG	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1327C>A	chr19.hg19:g.39360598G>T		62.0	0.0	.	885	53.0	19.0	.	NM_001195833	B4DPG5	Silent	SNP	ENST00000591812.1	hg19	CCDS59386.1																																																																																			.	.	.	none		0.657	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
LILRB5	10990	hgsc.bcm.edu	37	19	54758645	54758645	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:54758645G>T	ENST00000316219.5	-	6	1315	c.1208C>A	c.(1207-1209)cCc>cAc	p.P403H	LILRB5_ENST00000345866.6_Missense_Mutation_p.P303H|LILRB5_ENST00000449561.2_Missense_Mutation_p.P403H|LILRB5_ENST00000450632.1_Missense_Mutation_p.P394H	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	403	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGCAGGTAGGGGTAGGACCT	0.582																																					p.P403H		Atlas-SNP	.											.	LILRB5	176	.	0			c.C1208A						PASS	.						128.0	104.0	112.0					19																	54758645		2203	4300	6503	SO:0001583	missense	10990	exon6			AGGTAGGGGTAGG	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1208C>A	chr19.hg19:g.54758645G>T	ENSP00000320390:p.Pro403His	131.0	0.0	.		92.0	4.0	.	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	hg19	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741826	0.30865	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00940	5.52;5.52;5.52;5.52	2.54	0.34	0.15985	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.32671	N	0.005791	T	0.05547	0.0146	M	0.93898	3.47	0.09310	N	1	B;D;D;D;D	0.89917	0.33;1.0;1.0;1.0;1.0	B;D;D;D;D	0.85130	0.145;0.996;0.997;0.995;0.992	T	0.13045	-1.0524	10	0.87932	D	0	.	4.5013	0.11865	0.337:0.0:0.663:0.0	.	394;294;303;403;403	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	H	403;394;403;303	ENSP00000320390:P403H;ENSP00000414225:P394H;ENSP00000406478:P403H;ENSP00000263430:P303H	ENSP00000320390:P403H	P	-	2	0	LILRB5	59450457	0.103000	0.21917	0.011000	0.14972	0.001000	0.01503	1.890000	0.39728	0.163000	0.19507	-0.242000	0.12053	CCC	.	.	.	none		0.582	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
TMX4	56255	hgsc.bcm.edu	37	20	8000101	8000101	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr20:8000101C>A	ENST00000246024.2	-	1	375	c.160G>T	c.(160-162)Gag>Tag	p.E54*	RP5-971N18.3_ENST00000457707.1_RNA|RP5-971N18.3_ENST00000607924.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	54	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						AGCATCCACTCGCCCTCCATC	0.741																																					p.E54X		Atlas-SNP	.											.	TMX4	39	.	0			c.G160T						PASS	.						12.0	13.0	12.0					20																	8000101		2015	3902	5917	SO:0001587	stop_gained	56255	exon1			TCCACTCGCCCTC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.160G>T	chr20.hg19:g.8000101C>A	ENSP00000246024:p.Glu54*	141.0	0.0	.		135.0	48.0	.	NM_021156	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Nonsense_Mutation	SNP	ENST00000246024.2	hg19	CCDS13101.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588182	0.97684	.	.	ENSG00000125827	ENST00000246024;ENST00000527925	.	.	.	5.06	4.05	0.47172	.	0.179090	0.37577	N	0.002027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-11.8472	13.2749	0.60182	0.0:0.7474:0.2526:0.0	.	.	.	.	X	54	.	ENSP00000246024:E54X	E	-	1	0	TMX4	7948101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.196000	0.32198	2.340000	0.79590	0.563000	0.77884	GAG	.	.	.	none		0.741	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2	NM_021156	
TM9SF4	9777	hgsc.bcm.edu	37	20	30720849	30720849	+	Silent	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr20:30720849C>T	ENST00000398022.2	+	2	284	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	TM9SF4_ENST00000217315.5_5'UTR	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	17						integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GCTTTTCTCCCTGATGTGTGA	0.502																																					p.L17L		Atlas-SNP	.											.	TM9SF4	65	.	0			c.C49T						PASS	.						148.0	132.0	138.0					20																	30720849		2203	4300	6503	SO:0001819	synonymous_variant	9777	exon2			TTCTCCCTGATGT	BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.49C>T	chr20.hg19:g.30720849C>T		62.0	0.0	.		91.0	30.0	.	NM_014742	B0QYT7|Q9NUA3	Silent	SNP	ENST00000398022.2	hg19	CCDS13196.2																																																																																			.	.	.	none		0.502	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47585740	47585740	+	Silent	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr20:47585740G>A	ENST00000371917.4	+	9	1116	c.1116G>A	c.(1114-1116)aaG>aaA	p.K372K		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	372					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TTCTGCAGAAGGATGCCTTCC	0.552																																					p.K372K	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.G1116A						PASS	.						225.0	149.0	175.0					20																	47585740		2203	4300	6503	SO:0001819	synonymous_variant	10564	exon9			GCAGAAGGATGCC	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1116G>A	chr20.hg19:g.47585740G>A		150.0	0.0	.		183.0	8.0	.	NM_006420	Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	hg19	CCDS13411.1																																																																																			.	.	.	none		0.552	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
ZC3H7B	23264	hgsc.bcm.edu	37	22	41721848	41721848	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr22:41721848T>C	ENST00000352645.4	+	4	468	c.211T>C	c.(211-213)Tct>Cct	p.S71P	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.S71P	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	71					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CTACGCTGCCTCTGACCAGGT	0.582																																					p.S71P		Atlas-SNP	.											.	ZC3H7B	82	.	0			c.T211C						PASS	.						65.0	47.0	53.0					22																	41721848		2203	4300	6503	SO:0001583	missense	23264	exon4			GCTGCCTCTGACC		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.211T>C	chr22.hg19:g.41721848T>C	ENSP00000345793:p.Ser71Pro	134.0	0.0	.		137.0	90.0	.	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	hg19	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	T	17.48	3.401268	0.62288	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.60672	0.17;0.17	4.92	4.92	0.64577	Tetratricopeptide-like helical (1);	0.115329	0.64402	D	0.000012	T	0.72252	0.3437	L	0.58810	1.83	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;D	0.87578	0.983;0.998	T	0.75717	-0.3220	10	0.87932	D	0	-17.5682	14.5596	0.68126	0.0:0.0:0.0:1.0	.	71;71	Q9UGR2-2;Q9UGR2	.;Z3H7B_HUMAN	P	71	ENSP00000345793:S71P;ENSP00000263243:S71P	ENSP00000263243:S71P	S	+	1	0	ZC3H7B	40051794	1.000000	0.71417	0.986000	0.45419	0.501000	0.33797	4.196000	0.58407	1.842000	0.53543	0.459000	0.35465	TCT	.	.	.	none		0.582	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
GTSE1	51512	hgsc.bcm.edu	37	22	46704331	46704331	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr22:46704331G>A	ENST00000454366.1	+	4	465	c.253G>A	c.(253-255)Gag>Aag	p.E85K		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	66					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		GCCCACATCTGAGAGTCCCTT	0.507																																					p.E85K	GBM(153;542 1915 12487 29016 50495)	Atlas-SNP	.											.	GTSE1	100	.	0			c.G253A						PASS	.						103.0	114.0	110.0					22																	46704331		2203	4300	6503	SO:0001583	missense	51512	exon4			ACATCTGAGAGTC	AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.253G>A	chr22.hg19:g.46704331G>A	ENSP00000415430:p.Glu85Lys	126.0	0.0	.		118.0	68.0	.	NM_016426	B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	ENST00000454366.1	hg19	CCDS14074.2	.	.	.	.	.	.	.	.	.	.	G	15.71	2.915009	0.52546	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.08370	3.1	4.75	3.71	0.42584	.	1.192690	0.05519	N	0.561858	T	0.17023	0.0409	L	0.60455	1.87	0.09310	N	1	P	0.50819	0.939	P	0.46076	0.503	T	0.40776	-0.9545	10	0.45353	T	0.12	-1.6438	14.6257	0.68618	0.0:0.2767:0.7233:0.0	.	66	Q9NYZ3	GTSE1_HUMAN	K	85;45	ENSP00000415430:E85K	ENSP00000354634:E45K	E	+	1	0	GTSE1	45082995	0.032000	0.19561	0.002000	0.10522	0.012000	0.07955	2.316000	0.43761	1.287000	0.44583	0.655000	0.94253	GAG	.	.	.	none		0.507	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318360.2	NM_016426	
SHANK3	85358	hgsc.bcm.edu	37	22	51159620	51159620	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr22:51159620C>T	ENST00000414786.2	+	21	3544	c.3317C>T	c.(3316-3318)gCc>gTc	p.A1106V	SHANK3_ENST00000262795.3_Missense_Mutation_p.A1136V|SHANK3_ENST00000445220.2_Missense_Mutation_p.A1122V			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1120					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CGAGCTCTGGCCTCCCAGGCG	0.716																																					p.A1106V		Atlas-SNP	.											.	SHANK3	96	.	0			c.C3317T						PASS	.						8.0	10.0	10.0					22																	51159620		1962	4104	6066	SO:0001583	missense	85358	exon21			CTCTGGCCTCCCA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.3317C>T	chr22.hg19:g.51159620C>T	ENSP00000464552:p.Ala1106Val	63.0	0.0	.		61.0	40.0	.	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	C	17.70	3.454930	0.63290	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.17213	2.29;2.29	4.3	4.3	0.51218	.	0.114429	0.64402	D	0.000012	T	0.13415	0.0325	L	0.47716	1.5	0.22511	N	0.999032	B;P;B	0.43750	0.276;0.816;0.16	B;B;B	0.28553	0.045;0.091;0.039	T	0.23726	-1.0180	10	0.66056	D	0.02	.	14.2694	0.66143	0.0:1.0:0.0:0.0	.	1120;1121;1136	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	V	1136;1122	ENSP00000442518:A1136V;ENSP00000446078:A1122V	ENSP00000442518:A1136V	A	+	2	0	SHANK3	49506486	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	5.241000	0.65384	1.949000	0.56562	0.462000	0.41574	GCC	.	.	.	none		0.716	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
NRK	203447	hgsc.bcm.edu	37	X	105199587	105199587	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chrX:105199587G>A	ENST00000243300.9	+	29	5047	c.4744G>A	c.(4744-4746)Gtc>Atc	p.V1582I	NRK_ENST00000428173.2_Missense_Mutation_p.V1583I|NRK_ENST00000540278.1_Missense_Mutation_p.V163I	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1582					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAATTATGATGTCTAAAAGTT	0.363										HNSCC(51;0.14)																											p.V1582I		Atlas-SNP	.											.	NRK	321	.	0			c.G4744A						PASS	.						66.0	54.0	57.0					X																	105199587		1815	4062	5877	SO:0001583	missense	203447	exon29			TATGATGTCTAAA	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.4744G>A	chrX.hg19:g.105199587G>A	ENSP00000434830:p.Val1582Ile	136.0	0.0	.		92.0	87.0	.	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	hg19		.	.	.	.	.	.	.	.	.	.	G	12.10	1.837299	0.32513	.	.	ENSG00000123572	ENST00000243300;ENST00000428173;ENST00000540278	T;T;T	0.79454	-1.26;-1.27;1.32	5.28	3.47	0.39725	.	0.153157	0.30732	N	0.008995	T	0.60444	0.2269	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53892	-0.8374	10	0.87932	D	0	.	5.6294	0.17501	0.1834:0.0:0.6565:0.1601	.	163;1582	B7Z1I7;Q7Z2Y5	.;NRK_HUMAN	I	1582;1583;163	ENSP00000434830:V1582I;ENSP00000438378:V1583I;ENSP00000438148:V163I	ENSP00000434830:V1582I	V	+	1	0	NRK	105086243	0.551000	0.26497	0.730000	0.30809	0.001000	0.01503	1.968000	0.40500	0.510000	0.28216	-0.191000	0.12829	GTC	.	.	.	none		0.363	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
RGAG1	57529	hgsc.bcm.edu	37	X	109694786	109694786	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chrX:109694786C>T	ENST00000465301.2	+	3	1187	c.941C>T	c.(940-942)tCt>tTt	p.S314F	RGAG1_ENST00000540313.1_Missense_Mutation_p.S314F	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	314										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TTAATGTCATCTCCAGGCTCT	0.493																																					p.S314F		Atlas-SNP	.											.	RGAG1	168	.	0			c.C941T						PASS	.						249.0	222.0	231.0					X																	109694786		2203	4300	6503	SO:0001583	missense	57529	exon3			TGTCATCTCCAGG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.941C>T	chrX.hg19:g.109694786C>T	ENSP00000419786:p.Ser314Phe	68.0	0.0	.		44.0	43.0	.	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	hg19	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385067	0.25031	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.47177	0.85;0.85	4.05	1.28	0.21552	.	1.603010	0.04115	N	0.315270	T	0.28699	0.0711	N	0.08118	0	0.09310	N	1	B	0.21225	0.053	B	0.24541	0.054	T	0.21518	-1.0243	9	.	.	.	1.2964	7.3573	0.26727	0.0:0.6769:0.0:0.3231	.	314	Q8NET4	RGAG1_HUMAN	F	314	ENSP00000419786:S314F;ENSP00000441452:S314F	.	S	+	2	0	RGAG1	109581442	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	-0.492000	0.06467	0.128000	0.18479	0.600000	0.82982	TCT	.	.	.	none		0.493	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
EXOC4	60412	hgsc.bcm.edu	37	7	133059613	133059615	+	In_Frame_Del	DEL	GAC	GAC	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	GAC	GAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:133059613_133059615delGAC	ENST00000253861.4	+	7	1068_1070	c.1039_1041delGAC	c.(1039-1041)gacdel	p.D347del	EXOC4_ENST00000393161.2_In_Frame_Del_p.D347del|EXOC4_ENST00000539845.1_In_Frame_Del_p.D246del	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	347					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GTTACTGTTTGACAAGTTTAATG	0.438																																					p.346_347del		Atlas-Indel,Pindel	.											.	EXOC4	118	.	0			c.1038_1040del						PASS	.																																			SO:0001651	inframe_deletion	60412	exon7			.	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.1039_1041delGAC	chr7.hg19:g.133059613_133059615delGAC	ENSP00000253861:p.Asp347del	65.0	0.0	0		63.0	38.0	0.603175	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	In_Frame_Del	DEL	ENST00000253861.4	hg19	CCDS5829.1																																																																																			.	.	.	none		0.438	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
DDX11	1663	hgsc.bcm.edu	37	12	31237572	31237572	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:31237572delG	ENST00000407793.2	+	4	700	c.449delG	c.(448-450)aggfs	p.R150fs	DDX11_ENST00000542838.1_Frame_Shift_Del_p.R150fs|DDX11_ENST00000350437.4_Frame_Shift_Del_p.R150fs|DDX11_ENST00000545668.1_Frame_Shift_Del_p.R150fs|DDX11_ENST00000251758.5_Frame_Shift_Del_p.R150fs|DDX11_ENST00000228264.6_Frame_Shift_Del_p.R124fs	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	150	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CTGCAGCACAGGGTGCAGCTC	0.582										Multiple Myeloma(12;0.14)																											p.R150fs		Atlas-Indel,Pindel	.											.	DDX11	188	.	0			c.448delA						PASS	.						28.0	29.0	29.0					12																	31237572		2200	4271	6471	SO:0001589	frameshift_variant	1663	exon4			.	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.449delG	chr12.hg19:g.31237572delG	ENSP00000384703:p.Arg150fs	355.0	0.0	0		340.0	85.0	0.25	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Frame_Shift_Del	DEL	ENST00000407793.2	hg19	CCDS44856.1																																																																																			.	.	.	none		0.582	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
IL21R	50615	hgsc.bcm.edu	37	16	27448951	27448954	+	Frame_Shift_Del	DEL	ACAG	ACAG	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	ACAG	ACAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:27448951_27448954delACAG	ENST00000337929.3	+	4	768_771	c.295_298delACAG	c.(295-300)acagacfs	p.TD99fs	IL21R_ENST00000395754.4_Frame_Shift_Del_p.TD99fs|IL21R_ENST00000564089.1_Frame_Shift_Del_p.TD99fs|IL21R_ENST00000395755.1_Frame_Shift_Del_p.TD99fs	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	99	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						TGTCAACATCACAGACCAGTCTGG	0.559			T	BCL6	NHL																																p.120_121del		Atlas-Indel,Pindel	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.360_363del						PASS	.																																			SO:0001589	frameshift_variant	50615	exon5			.	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.295_298delACAG	chr16.hg19:g.27448951_27448954delACAG	ENSP00000338010:p.Thr99fs	108.0	0.0	0		98.0	51.0	0.520408	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Frame_Shift_Del	DEL	ENST00000337929.3	hg19	CCDS10630.1																																																																																			.	.	.	none		0.559	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
CDC37L1	55664	hgsc.bcm.edu	37	9	4701924	4701925	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr9:4701924_4701925insT	ENST00000381854.3	+	6	1010_1011	c.808_809insT	c.(808-810)gtafs	p.V270fs	CDC37L1_ENST00000381858.1_Frame_Shift_Ins_p.V270fs	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	270	Interaction with Hsp70.|Self-association and interaction with Hsp90.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		CAAGTCAAGAGTAAGACTTTAT	0.332																																					p.V270fs		Atlas-Indel,Pindel	.											.	CDC37L1	19	.	0			c.808_809insT						PASS	.																																			SO:0001589	frameshift_variant	55664	exon6			.	AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.809dupT	chr9.hg19:g.4701925_4701925dupT	ENSP00000371278:p.Val270fs	68.0	0.0	0		51.0	24.0	0.470588	NM_017913	B1AL70|Q9NWS3|Q9NX16	Frame_Shift_Ins	INS	ENST00000381854.3	hg19	CCDS6454.1																																																																																			.	.	.	none		0.332	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051564.1	NM_017913	
ANKRD11	29123	hgsc.bcm.edu	37	16	89371696	89371696	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:89371696delC	ENST00000301030.4	-	4	604	c.144delG	c.(142-144)gggfs	p.G48fs	ANKRD11_ENST00000378330.2_Frame_Shift_Del_p.G48fs|ANKRD11_ENST00000567736.1_5'UTR|ANKRD11_ENST00000563291.1_Frame_Shift_Del_p.G48fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	48					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCACCTCCTTCCCGCCATCGC	0.567																																					p.K49fs		Atlas-Indel,Pindel	.											.	ANKRD11	195	.	0			c.145delA						PASS	.						67.0	65.0	66.0					16																	89371696		2198	4300	6498	SO:0001589	frameshift_variant	29123	exon5			.	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.144delG	chr16.hg19:g.89371696delC	ENSP00000301030:p.Gly48fs	77.0	0.0	0		80.0	24.0	0.3	NM_001256182	Q6NTG1|Q6QMF8	Frame_Shift_Del	DEL	ENST00000301030.4	hg19	CCDS32513.1																																																																																			.	.	.	none		0.567	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
MUC16	94025	hgsc.bcm.edu	37	19	8969402	8969403	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr19:8969402_8969403insG	ENST00000397910.4	-	79	43144_43145	c.42941_42942insC	c.(42940-42942)ccafs	p.P14314fs	MUC16_ENST00000380951.5_Frame_Shift_Ins_p.P955fs	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14409	SEA 15. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCTGCTTGTTGGTTGATAAAC	0.421																																					p.P14314fs		Atlas-Indel,Pindel	.											.	MUC16	4315	.	0			c.42942_42943insC						PASS	.																																			SO:0001589	frameshift_variant	94025	exon79			.	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42942dupC	chr19.hg19:g.8969404_8969404dupG	ENSP00000381008:p.Pro14314fs	73.0	0.0	0		48.0	22.0	0.458333	NM_024690	Q6ZQW5|Q96RK2	Frame_Shift_Ins	INS	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.	.	none		0.421	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
UQCRC2	7385	hgsc.bcm.edu	37	16	21991981	21991981	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr16:21991981delT	ENST00000268379.4	+	13	2002	c.1238delT	c.(1237-1239)cttfs	p.L413fs	UQCRC2_ENST00000561553.1_Intron	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	413					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		TCCACAGTCCTTCAGCAGATT	0.408																																					p.L413fs	Colon(123;450 1645 12841 25393 45623)	Atlas-Indel,Pindel	.											.	UQCRC2	46	.	0			c.1237delC						PASS	.						144.0	136.0	139.0					16																	21991981		2198	4300	6498	SO:0001589	frameshift_variant	7385	exon13			.	J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.1238delT	chr16.hg19:g.21991981delT	ENSP00000268379:p.Leu413fs	73.0	0.0	0		79.0	20.0	0.253165	NM_003366	B3KSN4|Q9BQ05	Frame_Shift_Del	DEL	ENST00000268379.4	hg19	CCDS10601.1																																																																																			.	.	.	none		0.408	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254466.1	NM_003366	
MSH2	4436	hgsc.bcm.edu	37	2	47693891	47693892	+	Frame_Shift_Ins	INS	-	-	A	rs63750510|rs587779098		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:47693891_47693892insA	ENST00000233146.2	+	10	1828_1829	c.1605_1606insA	c.(1606-1608)aatfs	p.N536fs	MSH2_ENST00000406134.1_Frame_Shift_Ins_p.N536fs|MSH2_ENST00000543555.1_Frame_Shift_Ins_p.N470fs	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	536					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCCTTCGTAACAATAAAAACTT	0.347			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.N535fs		Atlas-Indel,Pindel	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	.	MSH2	198	.	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)	c.1605_1606insA						PASS	.																																			SO:0001589	frameshift_variant	4436	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	.	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1607dupA	chr2.hg19:g.47693893_47693893dupA	ENSP00000233146:p.Asn536fs	464.0	0.0	0		314.0	152.0	0.484076	NM_000251	B4E2Z2|O75488	Frame_Shift_Ins	INS	ENST00000233146.2	hg19	CCDS1834.1																																																																																			.	.	.	none		0.347	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250805.3		
DBF4	10926	hgsc.bcm.edu	37	7	87516694	87516695	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr7:87516694_87516695delAA	ENST00000265728.1	+	5	1005_1006	c.501_502delAA	c.(499-504)gtaaaafs	p.K168fs		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	168	BRCT 2.				DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				CATGGGGAGTAAAAATTCTTCA	0.287																																					p.167_167del		Atlas-Indel,Pindel	.											.	DBF4	67	.	0			c.500_501del						PASS	.																																			SO:0001589	frameshift_variant	10926	exon5			.	AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.501_502delAA	chr7.hg19:g.87516696_87516697delAA	ENSP00000265728:p.Lys168fs	200.0	0.0	0		223.0	131.0	0.587444	NM_006716	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Frame_Shift_Del	DEL	ENST00000265728.1	hg19	CCDS5611.1																																																																																			.	.	.	none		0.287	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253678.1	NM_006716	
HSD17B8	7923	hgsc.bcm.edu	37	6	33173952	33173953	+	Splice_Site	DEL	GG	GG	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr6:33173952_33173953delGG	ENST00000374662.3	+	7	720_721	c.693_694delGG	c.(691-696)gaggat>gaat	p.D232fs	HSD17B8_ENST00000469186.1_3'UTR|MIR219-1_ENST00000362166.1_RNA|RING1_ENST00000374656.4_5'Flank	NM_014234.4	NP_055049.1	Q92506	DHB8_HUMAN	hydroxysteroid (17-beta) dehydrogenase 8	232					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|fatty acid biosynthetic process (GO:0006633)	mitochondrial envelope (GO:0005740)|mitochondrial matrix (GO:0005759)|plasma membrane (GO:0005886)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	9						GGGACCCTGAGGGTGAGCACTG	0.49																																					p.231_231del		Atlas-Indel,Pindel	.											.	HSD17B8	20	.	0			c.692_693del						PASS	.																																			SO:0001630	splice_region_variant	7923	exon7			.	D82061	CCDS4769.1	6p21.3	2011-09-14	2002-02-19	2002-02-22	ENSG00000204228	ENSG00000204228	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	3554	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 30C, member 1"""	601417	"""FabG (beta-ketoacyl-[acyl-carrier-protein] reductase, E coli) like (E. coli)"""	FABGL		8812499, 19027726	Standard	NM_014234		Approved	HKE6, D6S2245E, RING2, KE6, H2-KE6, SDR30C1	uc003odi.2	Q92506	OTTHUMG00000031117	ENST00000374662.3:c.694+1GG>-	chr6.hg19:g.33173952_33173953delGG		149.0	0.0	0		82.0	42.0	0.512195	NM_014234	A6NLX7|Q5STP7|Q9UIQ1	Frame_Shift_Del	DEL	ENST00000374662.3	hg19	CCDS4769.1																																																																																			.	.	.	none		0.490	HSD17B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076196.1	NM_014234	Frame_Shift_Del
PCK1	5105	hgsc.bcm.edu	37	20	56138649	56138651	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr20:56138649_56138651delAGA	ENST00000319441.4	+	6	991_993	c.827_829delAGA	c.(826-831)gagaag>gag	p.K278del	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_In_Frame_Del_p.K146del	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	278					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCTGAGGGTGAGAAGAAGTACCT	0.562																																					p.276_276del		Atlas-Indel,Pindel	.											.	PCK1	95	.	0			c.826_828del						PASS	.																																			SO:0001651	inframe_deletion	5105	exon6			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.827_829delAGA	chr20.hg19:g.56138652_56138654delAGA	ENSP00000319814:p.Lys278del	106.0	0.0	0		136.0	40.0	0.294118	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	In_Frame_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.	.	none		0.562	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
POLN	353497	hgsc.bcm.edu	37	4	2210096	2210125	+	In_Frame_Del	DEL	GAGCTGATGCTCTTCTGTTTTTGGTCAGCA	GAGCTGATGCTCTTCTGTTTTTGGTCAGCA	-	rs34459048	byFrequency	TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	GAGCTGATGCTCTTCTGTTTTTGGTCAGCA	GAGCTGATGCTCTTCTGTTTTTGGTCAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr4:2210096_2210125delGAGCTGATGCTCTTCTGTTTTTGGTCAGCA	ENST00000511885.2	-	5	656_685	c.303_332delTGCTGACCAAAAACAGAAGAGCATCAGCTC	c.(301-333)tctgctgaccaaaaacagaagagcatcagctca>tca	p.101_111SADQKQKSISS>S	POLN_ENST00000382865.1_In_Frame_Del_p.101_111SADQKQKSISS>S|POLN_ENST00000515357.1_5'UTR			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	101					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			AAGAGTCAATGAGCTGATGCTCTTCTGTTTTTGGTCAGCAGACAGCTGAT	0.396								DNA polymerases (catalytic subunits)																													p.102_111del		Atlas-Indel,Pindel	.											.	POLN	82	.	0			c.304_333del						PASS	.																																			SO:0001651	inframe_deletion	353497	exon3			.	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.303_332delTGCTGACCAAAAACAGAAGAGCATCAGCTC	chr4.hg19:g.2210096_2210125delGAGCTGATGCTCTTCTGTTTTTGGTCAGCA	ENSP00000435506:p.Ser101_Ser110del	71.0	0.0	0		38.0	13.0	0.342105	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	In_Frame_Del	DEL	ENST00000511885.2	hg19	CCDS3360.1																																																																																			.	.	.	none		0.396	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
ACP2	53	hgsc.bcm.edu	37	11	47264636	47264637	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr11:47264636_47264637insA	ENST00000256997.3	-	9	1010_1011	c.894_895insT	c.(892-897)gatgtcfs	p.V299fs	ACP2_ENST00000525230.1_5'UTR|ACP2_ENST00000533929.1_Frame_Shift_Ins_p.V271fs|ACP2_ENST00000527256.1_Frame_Shift_Ins_p.V267fs|ACP2_ENST00000537863.1_Frame_Shift_Ins_p.V112fs|ACP2_ENST00000529444.1_Frame_Shift_Ins_p.V236fs	NM_001610.2	NP_001601.1	P11117	PPAL_HUMAN	acid phosphatase 2, lysosomal	299					dephosphorylation (GO:0016311)|lysosome organization (GO:0007040)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)	acid phosphatase activity (GO:0003993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10						CCATTGTAGACATCCAGTGCCA	0.584																																					p.V299fs	Melanoma(90;262 1440 11488 44828 48531)	Atlas-Indel,Pindel	.											.	ACP2	36	.	0			c.895_896insT						PASS	.																																			SO:0001589	frameshift_variant	53	exon9			.	X15525	CCDS7928.1, CCDS44583.1	11p11.2	2008-02-05			ENSG00000134575	ENSG00000134575	3.1.3.2		123	protein-coding gene	gene with protein product		171650				975882	Standard	NM_001610		Approved		uc001nei.3	P11117	OTTHUMG00000166949	ENST00000256997.3:c.895dupT	chr11.hg19:g.47264637_47264637dupA	ENSP00000256997:p.Val299fs	89.0	0.0	0		58.0	26.0	0.448276	NM_001610	E9PCI1|Q561W5|Q9BTU7	Frame_Shift_Ins	INS	ENST00000256997.3	hg19	CCDS7928.1																																																																																			.	.	.	none		0.584	ACP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392022.2	NM_001610	
NIPAL4	348938	hgsc.bcm.edu	37	5	156899945	156899945	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr5:156899945delA	ENST00000311946.7	+	6	1494	c.1378delA	c.(1378-1380)aaafs	p.K460fs	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Frame_Shift_Del_p.K441fs	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	460						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						AGAGAAACCCAAAGTATTTAT	0.458																																					p.P459fs		Atlas-Indel,Pindel	.											.	NIPAL4	48	.	0			c.1377delC						PASS	.						46.0	46.0	46.0					5																	156899945		1887	4106	5993	SO:0001589	frameshift_variant	348938	exon6			.	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1378delA	chr5.hg19:g.156899945delA	ENSP00000311687:p.Lys460fs	31.0	0.0	0		27.0	13.0	0.481481	NM_001099287	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Frame_Shift_Del	DEL	ENST00000311946.7	hg19	CCDS47328.1																																																																																			.	.	.	none		0.458	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
ATAD2B	54454	hgsc.bcm.edu	37	2	24086371	24086371	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr2:24086371delT	ENST00000238789.5	-	12	1702	c.1359delA	c.(1357-1359)gcafs	p.A453fs		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	453						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATTAGCTAATGCTCTGGCAA	0.398																																					p.L454X		Atlas-Indel,Pindel	.											.	ATAD2B	110	.	0			c.1360delT						PASS	.						34.0	32.0	33.0					2																	24086371		1837	4089	5926	SO:0001589	frameshift_variant	54454	exon12			.	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1359delA	chr2.hg19:g.24086371delT	ENSP00000238789:p.Ala453fs	208.0	0.0	0		191.0	91.0	0.47644	NM_017552	B9ZVQ5|Q6ZNA6|Q8N9E7	Frame_Shift_Del	DEL	ENST00000238789.5	hg19	CCDS46227.1																																																																																			.	.	.	none		0.398	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
KCNH3	23416	hgsc.bcm.edu	37	12	49942954	49942955	+	Frame_Shift_Ins	INS	-	-	CGGTGAGCCC	rs369285416		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr12:49942954_49942955insCGGTGAGCCC	ENST00000257981.6	+	8	1726_1727	c.1466_1467insCGGTGAGCCC	c.(1465-1470)ggcgccfs	p.A490fs		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	490					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						ATGCTCATCGGCGGTGAGCCCG	0.688																																					p.G489fs		Atlas-Indel,Pindel	.											.	KCNH3	88	.	0			c.1466_1467insCGGTGAGCCC						PASS	.																																			SO:0001589	frameshift_variant	23416	exon8			.	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	Exception_encountered	chr12.hg19:g.49942955_49942964dupCGGTGAGCCC	ENSP00000257981:p.Ala490fs	68.0	0.0	0		61.0	10.0	0.163934	NM_012284	Q9UQ06	Frame_Shift_Ins	INS	ENST00000257981.6	hg19	CCDS8786.1																																																																																			.	.	.	none		0.688	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
PLCD1	5333	hgsc.bcm.edu	37	3	38070995	38071000	+	Splice_Site	DEL	TCACCG	TCACCG	-	rs373017252		TCGA-G7-A8LB-01A-11D-A35Z-10	TCGA-G7-A8LB-10A-01D-A35Z-10	TCACCG	TCACCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f1beace3-f40d-4e2f-abff-815f257096c7	3c8d7f6b-ef32-4955-8113-91d246df62d4	g.chr3:38070995_38071000delTCACCG	ENST00000334661.4	-	1	253_257	c.31_35delCGGTGA	c.(31-36)cggtga>a	p.R*11del		NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	11					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CCAGGCACTCACCGTGCAGGGTCAGG	0.743																																					p.12_12del		Atlas-Indel,Pindel	.											.	PLCD1	87	.	0			c.34_34del						PASS	.																																			SO:0001630	splice_region_variant	5333	exon1			.		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.34+1CGGTGA>-	chr3.hg19:g.38070995_38071000delTCACCG		125.0	0.0	0		118.0	25.0	0.211864	NM_006225	B3KR14|Q86VN8	Frame_Shift_Del	DEL	ENST00000334661.4	hg19	CCDS2671.1																																																																																			.	.	.	none		0.743	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		In_Frame_Del
