#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZC3H12A	80149	hgsc.bcm.edu	37	1	37948521	37948521	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr1:37948521A>T	ENST00000373087.6	+	6	1225	c.1109A>T	c.(1108-1110)gAg>gTg	p.E370V		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGCTAACAGAGAGTGAGCAG	0.617																																					p.E370V		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.A1109T						PASS	.						23.0	25.0	25.0					1																	37948521		2203	4300	6503	SO:0001583	missense	80149	exon6			TAACAGAGAGTGA		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.1109A>T	chr1.hg19:g.37948521A>T	ENSP00000362179:p.Glu370Val	233.0	0.0	.		104.0	71.0	.	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	hg19	CCDS417.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.662428	0.47572	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.25250	1.81	5.13	5.13	0.70059	.	1.008150	0.07957	N	0.981764	T	0.28830	0.0715	L	0.60455	1.87	0.36399	D	0.862973	P;B	0.38335	0.627;0.031	B;B	0.32928	0.155;0.014	T	0.27123	-1.0083	10	0.48119	T	0.1	-22.1084	13.5216	0.61572	1.0:0.0:0.0:0.0	.	165;370	B3KSD3;Q5D1E8	.;ZC12A_HUMAN	V	370	ENSP00000362179:E370V	ENSP00000362174:E370V	E	+	2	0	ZC3H12A	37721108	1.000000	0.71417	0.333000	0.25482	0.669000	0.39330	4.655000	0.61476	1.917000	0.55516	0.459000	0.35465	GAG	.	.	.	none		0.617	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
SWT1	54823	hgsc.bcm.edu	37	1	185159736	185159736	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr1:185159736C>G	ENST00000367500.4	+	10	1650	c.1485C>G	c.(1483-1485)caC>caG	p.H495Q	SWT1_ENST00000367501.3_Missense_Mutation_p.H495Q	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	495	PINc.									breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						GTCTCCAGCACCAGGAATTAT	0.313																																					p.H495Q		Atlas-SNP	.											.	SWT1	88	.	0			c.C1485G						PASS	.						163.0	146.0	152.0					1																	185159736		2203	4300	6503	SO:0001583	missense	54823	exon10			CCAGCACCAGGAA	AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1485C>G	chr1.hg19:g.185159736C>G	ENSP00000356470:p.His495Gln	109.0	0.0	.		83.0	59.0	.	NM_017673	Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	ENST00000367500.4	hg19	CCDS1367.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883969	0.33255	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.16597	2.33;2.33	5.52	1.03	0.20045	Nucleotide binding protein, PINc (1);	0.064362	0.64402	D	0.000004	T	0.05593	0.0147	N	0.02011	-0.69	0.26460	N	0.97547	P	0.36048	0.534	B	0.32677	0.15	T	0.29058	-1.0024	10	0.72032	D	0.01	.	8.4892	0.33089	0.0:0.5494:0.0:0.4506	.	495	Q5T5J6	SWT1_HUMAN	Q	495	ENSP00000356471:H495Q;ENSP00000356470:H495Q	ENSP00000356470:H495Q	H	+	3	2	SWT1	183426359	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	0.853000	0.27777	0.291000	0.22468	-0.254000	0.11334	CAC	.	.	.	none		0.313	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085790.1	NM_017673	
POLR1A	25885	hgsc.bcm.edu	37	2	86327152	86327152	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr2:86327152C>T	ENST00000263857.6	-	2	599	c.221G>A	c.(220-222)tGt>tAt	p.C74Y	POLR1A_ENST00000409681.1_Missense_Mutation_p.C74Y			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	74					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GTGCCCAGAACAGTTGCTGAA	0.567																																					p.C74Y		Atlas-SNP	.											.	POLR1A	137	.	0			c.G221A						PASS	.						90.0	95.0	93.0					2																	86327152		2027	4187	6214	SO:0001583	missense	25885	exon2			CCAGAACAGTTGC	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.221G>A	chr2.hg19:g.86327152C>T	ENSP00000263857:p.Cys74Tyr	111.0	0.0	.		129.0	6.0	.	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	hg19	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023496	0.75390	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.30981	1.51;1.51	5.78	5.78	0.91487	RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.93328	3.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76523	-0.2928	10	0.87932	D	0	-22.7322	19.9976	0.97389	0.0:1.0:0.0:0.0	.	74;74	B9ZVN9;O95602	.;RPA1_HUMAN	Y	74	ENSP00000263857:C74Y;ENSP00000386300:C74Y	ENSP00000263857:C74Y	C	-	2	0	POLR1A	86180663	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	7.268000	0.78473	2.737000	0.93849	0.563000	0.77884	TGT	.	.	.	none		0.567	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
SLC6A3	6531	hgsc.bcm.edu	37	5	1420693	1420693	+	Silent	SNP	G	G	A			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr5:1420693G>A	ENST00000270349.9	-	6	1045	c.918C>T	c.(916-918)tgC>tgT	p.C306C	SLC6A3_ENST00000453492.2_Silent_p.C306C	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	306					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CAGACGCCTCGCAGAGCCGGT	0.592																																					p.C306C		Atlas-SNP	.											.	SLC6A3	102	.	0			c.C918T						PASS	.						120.0	108.0	112.0					5																	1420693		2203	4300	6503	SO:0001819	synonymous_variant	6531	exon6			CGCCTCGCAGAGC		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.918C>T	chr5.hg19:g.1420693G>A		70.0	0.0	.		58.0	27.0	.	NM_001044	A2RUN4|Q14996	Silent	SNP	ENST00000270349.9	hg19	CCDS3863.1																																																																																			.	.	.	none		0.592	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
SGK223	157285	hgsc.bcm.edu	37	8	8235196	8235196	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr8:8235196C>A	ENST00000520004.1	-	3	987	c.723G>T	c.(721-723)agG>agT	p.R241S	SGK223_ENST00000330777.4_Missense_Mutation_p.R241S			Q86YV5	SG223_HUMAN		241							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGGGCGAGCACCTTTGATCAC	0.647																																					p.R241S	GBM(34;731 755 10259 33573 33867)	Atlas-SNP	.											.	.	.	.	0			c.G723T						PASS	.						47.0	54.0	51.0					8																	8235196		1994	4165	6159	SO:0001583	missense	0	exon2			CGAGCACCTTTGA																												ENST00000520004.1:c.723G>T	chr8.hg19:g.8235196C>A	ENSP00000428054:p.Arg241Ser	130.0	0.0	.		77.0	8.0	.	NM_001080826	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	hg19	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812405	0.70912	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59224	0.28;0.28	5.55	4.61	0.57282	.	0.853255	0.09935	N	0.736705	T	0.60287	0.2257	L	0.29908	0.895	0.30458	N	0.774609	D	0.59357	0.985	P	0.58620	0.842	T	0.51568	-0.8689	10	0.28530	T	0.3	.	11.8792	0.52564	0.0:0.8245:0.1755:0.0	.	241	Q86YV5	SG223_HUMAN	S	241	ENSP00000330930:R241S;ENSP00000428054:R241S	ENSP00000330930:R241S	R	-	3	2	AC068353.1	8272606	0.832000	0.29368	1.000000	0.80357	0.860000	0.49131	1.246000	0.32803	2.780000	0.95670	0.655000	0.94253	AGG	.	.	.	none		0.647	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
TRAPPC9	83696	hgsc.bcm.edu	37	8	140898201	140898201	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr8:140898201G>A	ENST00000438773.2	-	21	3110	c.2977C>T	c.(2977-2979)Cgc>Tgc	p.R993C	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.R1091C|TRAPPC9_ENST00000522504.1_5'UTR|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.R984C	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	993					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TCGCCACTGCGCTTCAGGGAG	0.617																																					p.R1091C		Atlas-SNP	.											.	TRAPPC9	114	.	0			c.C3271T						PASS	.						24.0	23.0	24.0					8																	140898201		2195	4284	6479	SO:0001583	missense	83696	exon21			CACTGCGCTTCAG	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2977C>T	chr8.hg19:g.140898201G>A	ENSP00000405060:p.Arg993Cys	381.0	0.0	.		204.0	153.0	.	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	hg19	CCDS55278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.028987|4.028987	0.75504|0.75504	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000520857|ENST00000389328;ENST00000389327;ENST00000438773	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67581|0.67581	0.2908|0.2908	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.87578	.|0.998;0.997	T|T	0.67654|0.67654	-0.5615|-0.5615	5|9	.|0.49607	.|T	.|0.09	.|.	17.0314|17.0314	0.86462|0.86462	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|993;1091	.|Q96Q05;Q96Q05-2	.|TPPC9_HUMAN;.	V|C	836|1091;984;993	.|.	.|ENSP00000373978:R984C	A|R	-|-	2|1	0|0	TRAPPC9|TRAPPC9	140967383|140967383	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.577000|0.577000	0.36160|0.36160	5.425000|5.425000	0.66470|0.66470	2.620000|2.620000	0.88729|0.88729	0.655000|0.655000	0.94253|0.94253	GCG|CGC	.	.	.	none		0.617	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
DDI1	414301	hgsc.bcm.edu	37	11	103907571	103907571	+	Silent	SNP	C	C	T			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr11:103907571C>T	ENST00000302259.3	+	1	264	c.21C>T	c.(19-21)tgC>tgT	p.C7C	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	7	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.						aspartic-type endopeptidase activity (GO:0004190)	p.C7C(1)		central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CCGTGTACTGCGTGCGGAGGG	0.682																																					p.C7C		Atlas-SNP	.											DDI1_ENST00000302259,colon,carcinoma,0,3	DDI1	222	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C21T						PASS	.						74.0	84.0	80.0					11																	103907571		2202	4299	6501	SO:0001819	synonymous_variant	414301	exon1			GTACTGCGTGCGG		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.21C>T	chr11.hg19:g.103907571C>T		87.0	0.0	.		113.0	47.0	.	NM_001001711	Q7Z4U6|Q8WTS3	Silent	SNP	ENST00000302259.3	hg19	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528853	0.27387	.	.	ENSG00000170962	ENST00000529268	T	0.27402	1.67	5.08	-10.2	0.00374	.	.	.	.	.	T	0.23171	0.0560	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50346	-0.8839	6	0.08599	T	0.76	-24.1506	19.4154	0.94694	0.0:0.7017:0.0:0.2983	.	.	.	.	T	62	ENSP00000432909:A62T	ENSP00000432909:A62T	A	-	1	0	PDGFD	103412781	0.972000	0.33761	0.139000	0.22197	0.856000	0.48823	0.059000	0.14322	-2.678000	0.00410	-0.742000	0.03525	GCA	.	.	.	none		0.682	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
SAV1	60485	hgsc.bcm.edu	37	14	51131969	51131969	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr14:51131969C>A	ENST00000324679.4	-	2	826	c.463G>T	c.(463-465)Gac>Tac	p.D155Y	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	155					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					TATCTGTAGTCTTCATGTGCA	0.378																																					p.D155Y		Atlas-SNP	.											.	SAV1	18	.	0			c.G463T						PASS	.						38.0	40.0	39.0					14																	51131969		2199	4291	6490	SO:0001583	missense	60485	exon2			TGTAGTCTTCATG	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.463G>T	chr14.hg19:g.51131969C>A	ENSP00000324729:p.Asp155Tyr	454.0	1.0	.		303.0	177.0	.	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	ENST00000324679.4	hg19	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.498931	0.64298	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862;ENST00000553731	T;T	0.52295	0.67;0.72	5.29	5.29	0.74685	.	0.090564	0.85682	D	0.000000	T	0.44850	0.1313	L	0.29908	0.895	0.51482	D	0.999924	P	0.50943	0.94	P	0.48030	0.564	T	0.22312	-1.0220	10	0.25751	T	0.34	-4.7833	17.9319	0.88999	0.0:1.0:0.0:0.0	.	155	Q9H4B6	SAV1_HUMAN	Y	87;155;122;39	ENSP00000451492:D87Y;ENSP00000324729:D155Y	ENSP00000324729:D155Y	D	-	1	0	SAV1	50201719	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	4.615000	0.61190	2.467000	0.83353	0.563000	0.77884	GAC	.	.	.	none		0.378	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
YLPM1	56252	hgsc.bcm.edu	37	14	75276483	75276483	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr14:75276483A>T	ENST00000552421.1	+	6	2928	c.2804A>T	c.(2803-2805)gAt>gTt	p.D935V	YLPM1_ENST00000325680.7_Missense_Mutation_p.D1641V|YLPM1_ENST00000238571.3_Missense_Mutation_p.D1446V			P49750	YLPM1_HUMAN	YLP motif containing 1	1446	Arg-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CAGACTGTTGATTATGGCCAT	0.488																																					p.D1641V		Atlas-SNP	.											.	YLPM1	298	.	0			c.A4922T						PASS	.						57.0	53.0	54.0					14																	75276483		1963	4149	6112	SO:0001583	missense	56252	exon7			CTGTTGATTATGG	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.2804A>T	chr14.hg19:g.75276483A>T	ENSP00000447921:p.Asp935Val	208.0	1.0	.		133.0	82.0	.	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	hg19		.	.	.	.	.	.	.	.	.	.	A	19.26	3.794011	0.70452	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571;ENST00000423680;ENST00000547879	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000010	T	0.66346	0.2780	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.70615	-0.4823	9	0.87932	D	0	-10.8543	15.2838	0.73810	1.0:0.0:0.0:0.0	.	1446;1641	P49750-3;P49750-4	.;.	V	935;1641;1446;1354;50	.	ENSP00000238571:D1446V	D	+	2	0	YLPM1	74346236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.204000	0.89741	2.001000	0.58596	0.482000	0.46254	GAT	.	.	.	none		0.488	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
GPRC5C	55890	hgsc.bcm.edu	37	17	72443056	72443056	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr17:72443056C>A	ENST00000392627.1	+	4	2476	c.1350C>A	c.(1348-1350)aaC>aaA	p.N450K	GPRC5C_ENST00000392629.2_Missense_Mutation_p.N417K|GPRC5C_ENST00000582873.1_3'UTR|GPRC5C_ENST00000342648.5_Missense_Mutation_p.N90K|GPRC5C_ENST00000481232.1_3'UTR	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	405					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						GCAGTGCCAACTCGACCCTGC	0.612																																					p.N450K		Atlas-SNP	.											.	GPRC5C	92	.	0			c.C1350A						PASS	.						68.0	69.0	69.0					17																	72443056		2203	4300	6503	SO:0001583	missense	55890	exon4			TGCCAACTCGACC	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.1350C>A	chr17.hg19:g.72443056C>A	ENSP00000376403:p.Asn450Lys	117.0	0.0	.		98.0	4.0	.	NM_022036	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	ENST00000392627.1	hg19	CCDS11699.1	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884630	0.72410	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000262616;ENST00000392629;ENST00000392628	T	0.18810	2.19	5.59	2.49	0.30216	.	0.514125	0.20704	N	0.087204	T	0.34279	0.0892	L	0.44542	1.39	0.39978	D	0.974872	D;P;P;P	0.89917	1.0;0.919;0.842;0.902	D;B;B;B	0.76575	0.988;0.324;0.257;0.442	T	0.05419	-1.0886	10	0.72032	D	0.01	-19.0092	9.4257	0.38578	0.0:0.761:0.0:0.239	.	116;405;405;417	Q9NXI0;A8MXZ4;Q9NQ84;Q9NQ84-2	.;.;GPC5C_HUMAN;.	K	405;450;116;417;405	ENSP00000376405:N417K	ENSP00000262616:N116K	N	+	3	2	GPRC5C	69954651	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	1.637000	0.37155	0.301000	0.22738	0.561000	0.74099	AAC	.	.	.	none		0.612	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145094.2		
POLRMT	5442	hgsc.bcm.edu	37	19	621197	621197	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr19:621197C>G	ENST00000588649.2	-	10	2585	c.2501G>C	c.(2500-2502)gGc>gCc	p.G834A	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	834	Mediates interaction with TEFM.				gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGTGCGGGCCGAGCGGGCG	0.706																																					p.G834A		Atlas-SNP	.											.	POLRMT	91	.	0			c.G2501C						PASS	.						21.0	26.0	24.0					19																	621197		2196	4294	6490	SO:0001583	missense	5442	exon10			TGCGGGCCGAGCG		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.2501G>C	chr19.hg19:g.621197C>G	ENSP00000465759:p.Gly834Ala	112.0	0.0	.		87.0	5.0	.	NM_005035	O60370	Missense_Mutation	SNP	ENST00000588649.2	hg19	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	17.17	3.322127	0.60634	.	.	ENSG00000099821	ENST00000215591	T	0.55413	0.52	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.82089	0.4961	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89045	0.3451	10	0.87932	D	0	-42.5618	16.1611	0.81712	0.0:1.0:0.0:0.0	.	834	O00411	RPOM_HUMAN	A	834	ENSP00000215591:G834A	ENSP00000215591:G834A	G	-	2	0	POLRMT	572197	1.000000	0.71417	0.071000	0.20095	0.151000	0.21798	7.070000	0.76763	2.283000	0.76528	0.455000	0.32223	GGC	.	.	.	none		0.706	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
RBM10	8241	hgsc.bcm.edu	37	X	47030582	47030582	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chrX:47030582G>T	ENST00000377604.3	+	4	1099	c.357G>T	c.(355-357)gaG>gaT	p.E119D	RBM10_ENST00000329236.7_Intron|RBM10_ENST00000345781.6_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	119	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						aggaggaggaggatgaggagg	0.662																																					p.E184D	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.G552T						PASS	.						20.0	19.0	19.0					X																	47030582		2202	4294	6496	SO:0001583	missense	8241	exon4			GGAGGAGGATGAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.357G>T	chrX.hg19:g.47030582G>T	ENSP00000366829:p.Glu119Asp	81.0	0.0	.		75.0	4.0	.	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	7.514	0.655267	0.14580	.	.	ENSG00000182872	ENST00000377604	T	0.11169	2.8	3.1	1.15	0.20763	Nucleotide-binding, alpha-beta plait (1);	0.859005	0.09469	N	0.797951	T	0.04815	0.0130	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38628	-0.9652	10	0.11182	T	0.66	-1.7872	6.9396	0.24486	0.0:0.0:0.4873:0.5127	.	184;119;119	Q7Z3D7;P98175-2;P98175	.;.;RBM10_HUMAN	D	119	ENSP00000366829:E119D	ENSP00000366829:E119D	E	+	3	2	RBM10	46915526	1.000000	0.71417	0.776000	0.31678	0.914000	0.54420	0.961000	0.29267	0.165000	0.19558	0.502000	0.49764	GAG	.	.	.	none		0.662	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
MT-CYB	4519	hgsc.bcm.edu	37	M	14992	14992	+	Silent	SNP	T	T	C			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chrM:14992T>C	ENST00000361789.2	+	1	246	c.246T>C	c.(244-246)ctT>ctC	p.L82L	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	82					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ATCCGCTACCTTCACGCCAAT	0.473																																					p.L82L		Atlas-SNP	.											.	.	.	.	0			c.T246C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CTACCTTCACGCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.246T>C	chrM.hg19:g.14992T>C		31.0	0.0	.		30.0	18.0	.	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	hg19																																																																																				.	.	.	none		0.473	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SAV1	60485	hgsc.bcm.edu	37	14	51131967	51131967	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr14:51131967delG	ENST00000324679.4	-	2	828	c.465delC	c.(463-465)gacfs	p.D155fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	155					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					AATATCTGTAGTCTTCATGTG	0.383																																					p.Y156fs		Atlas-INDEL	.											.	SAV1	18	.	0			c.466delT						PASS	.						36.0	38.0	37.0					14																	51131967		2200	4290	6490	SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.465delC	chr14.hg19:g.51131967delG	ENSP00000324729:p.Asp155fs	449.0	0.0	0		300.0	176.0	0.586667	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Frame_Shift_Del	DEL	ENST00000324679.4	hg19	CCDS9701.1																																																																																			.	.	.	none		0.383	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
SAV1	60485	hgsc.bcm.edu	37	14	51131967	51131969	+	In_Frame_Del	DEL	GTC	GTC	-			TCGA-G7-A8LC-01A-11D-A35Z-10	TCGA-G7-A8LC-10A-01D-A35Z-10	GTC	GTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	de876c49-d506-4de1-aad0-0136b35dd6f6	394bdf7b-2234-462d-839c-0a6177ffd570	g.chr14:51131967_51131969delGTC	ENST00000324679.4	-	2	826_828	c.463_465delGAC	c.(463-465)gacdel	p.D155del	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	155					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					AATATCTGTAGTCTTCATGTGCA	0.379																																					p.155_156del		Pindel	.											.	SAV1	18	.	0			c.464_466del						PASS	.																																			SO:0001651	inframe_deletion	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.463_465delGAC	chr14.hg19:g.51131967_51131969delGTC	ENSP00000324729:p.Asp155del	454.0	0.0	.		303.0	86.0	0.284	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	In_Frame_Del	DEL	ENST00000324679.4	hg19	CCDS9701.1																																																																																			.	.	.	none		0.379	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
