#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LMNA	4000	hgsc.bcm.edu	37	1	156084843	156084843	+	Missense_Mutation	SNP	A	A	G	rs58436778		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr1:156084843A>G	ENST00000368300.4	+	1	346	c.134A>G	c.(133-135)tAc>tGc	p.Y45C	LMNA_ENST00000347559.2_Missense_Mutation_p.Y45C|LMNA_ENST00000361308.4_Missense_Mutation_p.Y45C|LMNA_ENST00000368301.2_Missense_Mutation_p.Y45C|LMNA_ENST00000368299.3_Missense_Mutation_p.Y45C	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	45	Coil 1A.|Interaction with MLIP.|Rod.		Y -> C (in EDMD2; dbSNP:rs58436778). {ECO:0000269|PubMed:10939567, ECO:0000269|PubMed:20848652}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TTGGCGGTCTACATCGACCGT	0.657									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.Y45C		Atlas-SNP	.											.	LMNA	31	.	0			c.A134G	GRCh37	CM002044	LMNA	M	rs58436778	PASS	.						39.0	32.0	34.0					1																	156084843		2193	4298	6491	SO:0001583	missense	4000	exon1	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	CGGTCTACATCGA	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.134A>G	chr1.hg19:g.156084843A>G	ENSP00000357283:p.Tyr45Cys	231.0	0.0	.		316.0	93.0	.	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	ENST00000368300.4	hg19	CCDS1129.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.501352	0.85176	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355	D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47	4.77	3.65	0.41850	Filament (1);	0.000000	0.52532	D	0.000066	D	0.97670	0.9236	H	0.97829	4.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.87578	0.997;0.998;0.996;0.995	D	0.97223	0.9879	10	0.87932	D	0	.	8.5522	0.33458	0.9076:0.0:0.0924:0.0	rs58436778	45;45;45;45	Q6UYC3;P02545;P02545-3;P02545-2	.;LMNA_HUMAN;.;.	C	45	ENSP00000357284:Y45C;ENSP00000292304:Y45C;ENSP00000355292:Y45C;ENSP00000357283:Y45C;ENSP00000357282:Y45C	ENSP00000292302:Y45C	Y	+	2	0	LMNA	154351467	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.097000	0.94193	0.860000	0.35481	0.379000	0.24179	TAC	.	.	.	weak		0.657	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
XPR1	9213	hgsc.bcm.edu	37	1	180843054	180843054	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr1:180843054T>G	ENST00000367590.4	+	13	1982	c.1784T>G	c.(1783-1785)gTc>gGc	p.V595G	XPR1_ENST00000367589.3_Missense_Mutation_p.V530G	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	595	EXS. {ECO:0000255|PROSITE- ProRule:PRU00712}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						ATTGCTACTGTCTTTGCCCCA	0.378																																					p.V595G		Atlas-SNP	.											.	XPR1	76	.	0			c.T1784G						PASS	.						117.0	101.0	107.0					1																	180843054		2203	4300	6503	SO:0001583	missense	9213	exon13			CTACTGTCTTTGC	AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1784T>G	chr1.hg19:g.180843054T>G	ENSP00000356562:p.Val595Gly	82.0	0.0	.		117.0	42.0	.	NM_004736	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	ENST00000367590.4	hg19	CCDS1340.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587089	0.66105	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	T;T	0.48836	0.8;0.8	5.43	5.43	0.79202	EXS, C-terminal (2);	0.059107	0.64402	D	0.000002	T	0.50803	0.1637	M	0.70842	2.15	0.80722	D	1	B;B	0.28258	0.082;0.205	B;B	0.29176	0.059;0.099	T	0.54918	-0.8221	10	0.87932	D	0	-12.1075	15.1311	0.72523	0.0:0.0:0.0:1.0	.	530;595	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	G	595;530	ENSP00000356562:V595G;ENSP00000356561:V530G	ENSP00000356561:V530G	V	+	2	0	XPR1	179109677	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.917000	0.87498	2.068000	0.61886	0.528000	0.53228	GTC	.	.	.	none		0.378	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084996.2	NM_004736	
OBSCN	84033	hgsc.bcm.edu	37	1	228560567	228560567	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr1:228560567C>G	ENST00000422127.1	+	94	22132	c.22088C>G	c.(22087-22089)gCa>gGa	p.A7363G	OBSCN_ENST00000570156.2_Missense_Mutation_p.A8320G|OBSCN_ENST00000366707.4_Missense_Mutation_p.A4997G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7363					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCCCCACGCAGGCCTGGAG	0.692																																					p.A8320G		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C24959G						PASS	.						16.0	20.0	18.0					1																	228560567		2187	4287	6474	SO:0001583	missense	84033	exon105			CCCACGCAGGCCT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22088C>G	chr1.hg19:g.228560567C>G	ENSP00000409493:p.Ala7363Gly	120.0	0.0	.		175.0	58.0	.	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360250	0.41801	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.62788	0.0;0.05	5.1	2.18	0.27775	.	.	.	.	.	T	0.38904	0.1058	L	0.27053	0.805	0.09310	N	0.99999	P	0.47106	0.89	B	0.35413	0.202	T	0.16988	-1.0384	9	0.32370	T	0.25	.	4.1869	0.10402	0.1709:0.563:0.0:0.2661	.	7363	Q5VST9	OBSCN_HUMAN	G	7363;4997	ENSP00000409493:A7363G;ENSP00000355668:A4997G	ENSP00000355668:A4997G	A	+	2	0	OBSCN	226627190	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.817000	0.27281	0.179000	0.19938	0.491000	0.48974	GCA	.	.	.	none		0.692	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
USP34	9736	hgsc.bcm.edu	37	2	61522309	61522309	+	Silent	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:61522309C>T	ENST00000398571.2	-	31	4447	c.4371G>A	c.(4369-4371)gaG>gaA	p.E1457E		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1457					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTACCGTAGACTCCCTCCTTA	0.323																																					p.E1457E		Atlas-SNP	.											.	USP34	334	.	0			c.G4371A						PASS	.						128.0	124.0	125.0					2																	61522309		1817	4082	5899	SO:0001819	synonymous_variant	9736	exon31			CGTAGACTCCCTC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4371G>A	chr2.hg19:g.61522309C>T		192.0	0.0	.		175.0	9.0	.	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.	.	none		0.323	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CNTNAP5	129684	hgsc.bcm.edu	37	2	125405341	125405341	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:125405341A>T	ENST00000431078.1	+	13	2244	c.1880A>T	c.(1879-1881)aAg>aTg	p.K627M		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	627	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCAGAGGACAAGATCTGGACA	0.542																																					p.K627M		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.A1880T						PASS	.						38.0	38.0	38.0					2																	125405341		2104	4237	6341	SO:0001583	missense	129684	exon13			AGGACAAGATCTG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1880A>T	chr2.hg19:g.125405341A>T	ENSP00000399013:p.Lys627Met	220.0	0.0	.		202.0	87.0	.	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.792842	0.70452	.	.	ENSG00000155052	ENST00000431078	T	0.21734	1.99	5.5	2.95	0.34219	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.53938	D	0.000058	T	0.46718	0.1407	M	0.82630	2.6	0.53688	D	0.999978	D	0.89917	1.0	D	0.87578	0.998	T	0.50092	-0.8868	10	0.59425	D	0.04	.	11.46	0.50204	0.7146:0.2854:0.0:0.0	.	627	Q8WYK1	CNTP5_HUMAN	M	627	ENSP00000399013:K627M	ENSP00000399013:K627M	K	+	2	0	CNTNAP5	125121811	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	6.020000	0.70826	0.905000	0.36596	0.459000	0.35465	AAG	.	.	.	none		0.542	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
NCKAP5	344148	hgsc.bcm.edu	37	2	133540804	133540804	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:133540804T>C	ENST00000409261.1	-	14	3953	c.3580A>G	c.(3580-3582)Aag>Gag	p.K1194E	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.K1194E|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1194										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GCTGGATTCTTGGAGTCCTCT	0.493																																					p.K1194E		Atlas-SNP	.											.	NCKAP5	322	.	0			c.A3580G						PASS	.						76.0	75.0	76.0					2																	133540804		1925	4142	6067	SO:0001583	missense	344148	exon14			GATTCTTGGAGTC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3580A>G	chr2.hg19:g.133540804T>C	ENSP00000387128:p.Lys1194Glu	93.0	0.0	.		114.0	22.0	.	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.068687	0.36470	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.09723	2.95;2.95	5.26	-2.18	0.07037	.	1.587860	0.04759	U	0.425865	T	0.04634	0.0126	N	0.19112	0.55	0.09310	N	1	B	0.29301	0.241	B	0.21917	0.037	T	0.29971	-0.9994	10	0.07175	T	0.84	.	1.3436	0.02159	0.246:0.3735:0.136:0.2446	.	1194	O14513	NCKP5_HUMAN	E	1194	ENSP00000387128:K1194E;ENSP00000380603:K1194E	ENSP00000380603:K1194E	K	-	1	0	NCKAP5	133257274	0.000000	0.05858	0.000000	0.03702	0.328000	0.28507	-1.569000	0.02142	0.017000	0.15025	0.533000	0.62120	AAG	.	.	.	none		0.493	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
R3HDM1	23518	hgsc.bcm.edu	37	2	136399272	136399272	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:136399272A>T	ENST00000264160.4	+	15	1756	c.1386A>T	c.(1384-1386)caA>caT	p.Q462H	R3HDM1_ENST00000443537.2_Intron|R3HDM1_ENST00000410054.1_Missense_Mutation_p.Q406H|R3HDM1_ENST00000409606.1_Missense_Mutation_p.Q462H|R3HDM1_ENST00000409478.1_Intron|R3HDM1_ENST00000329971.3_Intron	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	462							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		TAAATGGGCAAGTCGCATCTC	0.507																																					p.Q462H		Atlas-SNP	.											.	R3HDM1	84	.	0			c.A1386T						PASS	.						170.0	153.0	159.0					2																	136399272		2203	4300	6503	SO:0001583	missense	23518	exon15			TGGGCAAGTCGCA	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.1386A>T	chr2.hg19:g.136399272A>T	ENSP00000264160:p.Gln462His	73.0	0.0	.		87.0	19.0	.	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	hg19	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.68|17.68	3.448457|3.448457	0.63178|0.63178	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000264160;ENST00000410054;ENST00000409606|ENST00000429703	T;T;T|.	0.51574|.	0.7;0.7;0.7|.	5.57|5.57	4.35|4.35	0.52113|0.52113	.|.	0.325147|.	0.34652|.	N|.	0.003798|.	T|T	0.62171|0.62171	0.2406|0.2406	L|L	0.52905|0.52905	1.665|1.665	0.80722|0.80722	D|D	1|1	P;D;B|.	0.56521|.	0.877;0.976;0.412|.	B;P;B|.	0.48030|.	0.365;0.564;0.259|.	T|T	0.60642|0.60642	-0.7223|-0.7223	10|5	0.38643|.	T|.	0.18|.	-3.87|-3.87	12.3297|12.3297	0.55033|0.55033	0.859:0.141:0.0:0.0|0.859:0.141:0.0:0.0	.|.	462;406;462|.	E9PBB4;E9PG42;Q15032|.	.;.;R3HD1_HUMAN|.	H|C	462;406;462|151	ENSP00000264160:Q462H;ENSP00000386877:Q406H;ENSP00000387010:Q462H|.	ENSP00000264160:Q462H|.	Q|S	+|+	3|1	2|0	R3HDM1|R3HDM1	136115742|136115742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.456000|2.456000	0.44997|0.44997	2.120000|2.120000	0.65058|0.65058	0.533000|0.533000	0.62120|0.62120	CAA|AGT	.	.	.	none		0.507	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
KIF5C	3800	hgsc.bcm.edu	37	2	149853801	149853801	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:149853801C>A	ENST00000435030.1	+	18	2415	c.2047C>A	c.(2047-2049)Cag>Aag	p.Q683K	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.Q588K|KIF5C_ENST00000397413.1_Missense_Mutation_p.Q451K			O60282	KIF5C_HUMAN	kinesin family member 5C	683					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGTCAGCTTCCAGGATAAGGA	0.413																																					p.Q683K		Atlas-SNP	.											.	KIF5C	166	.	0			c.C2047A						PASS	.						109.0	109.0	109.0					2																	149853801		2024	4196	6220	SO:0001583	missense	3800	exon18			AGCTTCCAGGATA	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2047C>A	chr2.hg19:g.149853801C>A	ENSP00000393379:p.Gln683Lys	293.0	0.0	.		337.0	152.0	.	NM_004522	O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	hg19		.	.	.	.	.	.	.	.	.	.	C	7.928	0.740082	0.15642	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	T;T;T	0.75260	-0.92;-0.92;-0.92	5.76	5.76	0.90799	.	0.201457	0.41938	D	0.000798	T	0.61035	0.2315	.	.	.	0.24214	N	0.995461	B;B	0.09022	0.0;0.002	B;B	0.09377	0.0;0.004	T	0.43702	-0.9375	8	.	.	.	.	14.6636	0.68891	0.1799:0.8201:0.0:0.0	.	683;249	O60282;Q3LIE3	KIF5C_HUMAN;.	K	683;588;586;451	ENSP00000393379:Q683K;ENSP00000410115:Q588K;ENSP00000380560:Q451K	.	Q	+	1	0	KIF5C	149562047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.589000	0.46145	2.713000	0.92767	0.655000	0.94253	CAG	.	.	.	none		0.413	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
NCL	4691	hgsc.bcm.edu	37	2	232325488	232325488	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:232325488C>G	ENST00000322723.4	-	4	943	c.703G>C	c.(703-705)Gat>Cat	p.D235H	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	235	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		tcatcttcatcctcaGCCACG	0.453																																					p.D235H		Atlas-SNP	.											.	NCL	80	.	0			c.G703C						PASS	.						267.0	223.0	238.0					2																	232325488		2203	4300	6503	SO:0001583	missense	4691	exon4			CTTCATCCTCAGC		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.703G>C	chr2.hg19:g.232325488C>G	ENSP00000318195:p.Asp235His	75.0	0.0	.		72.0	9.0	.	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.771179	0.31320	.	.	ENSG00000115053	ENST00000322723	T	0.21932	1.98	5.46	5.46	0.80206	.	0.531595	0.21728	N	0.070002	T	0.21801	0.0525	L	0.43152	1.355	0.42567	D	0.993167	P	0.37955	0.612	B	0.37833	0.259	T	0.02333	-1.1175	10	0.66056	D	0.02	-6.147	13.9111	0.63866	0.1619:0.8381:0.0:0.0	.	235	P19338	NUCL_HUMAN	H	235	ENSP00000318195:D235H	ENSP00000318195:D235H	D	-	1	0	NCL	232033732	0.996000	0.38824	0.963000	0.40424	0.124000	0.20399	4.189000	0.58358	2.570000	0.86706	0.644000	0.83932	GAT	.	.	.	none		0.453	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
PER2	8864	hgsc.bcm.edu	37	2	239164455	239164455	+	Silent	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:239164455C>T	ENST00000254657.3	-	18	2442	c.2163G>A	c.(2161-2163)aaG>aaA	p.K721K	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	721	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGCCCAGCTTCTTGAAGGGCT	0.562																																					p.K721K		Atlas-SNP	.											.	PER2	85	.	0			c.G2163A						PASS	.						84.0	89.0	87.0					2																	239164455		2203	4300	6503	SO:0001819	synonymous_variant	8864	exon18			CAGCTTCTTGAAG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2163G>A	chr2.hg19:g.239164455C>T		151.0	0.0	.		117.0	48.0	.	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	hg19	CCDS2528.1																																																																																			.	.	.	none		0.562	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
HACL1	26061	hgsc.bcm.edu	37	3	15616583	15616583	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr3:15616583C>A	ENST00000321169.5	-	10	1177	c.810G>T	c.(808-810)ttG>ttT	p.L270F	HACL1_ENST00000435217.2_Intron|HACL1_ENST00000451445.2_Missense_Mutation_p.L188F|HACL1_ENST00000456194.2_Missense_Mutation_p.L243F|HACL1_ENST00000457447.2_Missense_Mutation_p.L244F	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	270					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						CAGCAAATTGCAAAGCCCTAT	0.303																																					p.L270F		Atlas-SNP	.											.	HACL1	33	.	0			c.G810T						PASS	.						54.0	54.0	54.0					3																	15616583		2203	4300	6503	SO:0001583	missense	26061	exon10			AAATTGCAAAGCC	AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.810G>T	chr3.hg19:g.15616583C>A	ENSP00000323811:p.Leu270Phe	457.0	0.0	.		472.0	196.0	.	NM_012260	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	hg19	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359593	0.61403	.	.	ENSG00000131373	ENST00000321169;ENST00000451445;ENST00000456194;ENST00000457447	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.77	2.98	0.34508	Thiamine pyrophosphate enzyme, central domain (1);	0.000000	0.85682	D	0.000000	T	0.71256	0.3318	M	0.91920	3.255	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.72520	-0.4268	10	0.87932	D	0	.	9.0828	0.36563	0.0:0.6275:0.0:0.3725	.	188;244;243;270	B4DXI5;E9PEN4;B4DWI1;Q9UJ83	.;.;.;HACL1_HUMAN	F	270;188;243;244	ENSP00000323811:L270F;ENSP00000403656:L188F;ENSP00000390699:L243F;ENSP00000404883:L244F	ENSP00000323811:L270F	L	-	3	2	HACL1	15591587	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	1.302000	0.33459	0.340000	0.23745	0.650000	0.86243	TTG	.	.	.	none		0.303	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3	NM_012260	
COPB2	9276	hgsc.bcm.edu	37	3	139092573	139092573	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr3:139092573C>T	ENST00000333188.5	-	8	1010	c.829G>A	c.(829-831)Gtg>Atg	p.V277M	COPB2_ENST00000507777.1_Missense_Mutation_p.V248M	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	277					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.V277L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						AGACTGGCCACGCACCATACC	0.433																																					p.V277M		Atlas-SNP	.											COPB2,NS,carcinoma,0,1	COPB2	80	.	1	Substitution - Missense(1)	endometrium(1)	c.G829A						PASS	.						156.0	128.0	138.0					3																	139092573		2203	4300	6503	SO:0001583	missense	9276	exon8			TGGCCACGCACCA	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.829G>A	chr3.hg19:g.139092573C>T	ENSP00000329419:p.Val277Met	98.0	1.0	.		138.0	43.0	.	NM_004766	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	hg19	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290256	0.59976	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	T;T	0.22743	2.07;1.94	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.15392	0.0371	N	0.16016	0.355	0.80722	D	1	B	0.25272	0.122	B	0.19391	0.025	T	0.05920	-1.0856	10	0.41790	T	0.15	-2.1291	18.8549	0.92247	0.0:1.0:0.0:0.0	.	277	P35606	COPB2_HUMAN	M	277;248	ENSP00000329419:V277M;ENSP00000422295:V248M	ENSP00000329419:V277M	V	-	1	0	COPB2	140575263	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.942000	0.56614	2.512000	0.84698	0.655000	0.94253	GTG	.	.	.	none		0.433	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
FSTL4	23105	hgsc.bcm.edu	37	5	132556553	132556553	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr5:132556553T>G	ENST00000265342.7	-	12	1594	c.1345A>C	c.(1345-1347)Agc>Cgc	p.S449R	FSTL4_ENST00000507112.1_5'UTR|CTB-49A3.2_ENST00000509051.1_RNA|CTB-49A3.2_ENST00000502776.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	449						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTTCCCACGCTGAGGCCTGGG	0.562																																					p.S449R		Atlas-SNP	.											.	FSTL4	74	.	0			c.A1345C						PASS	.						110.0	98.0	102.0					5																	132556553		2203	4300	6503	SO:0001583	missense	23105	exon12			CCACGCTGAGGCC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1345A>C	chr5.hg19:g.132556553T>G	ENSP00000265342:p.Ser449Arg	120.0	0.0	.		109.0	43.0	.	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	hg19	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057526	0.76074	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.60299	0.2	5.35	4.18	0.49190	.	0.079177	0.85682	D	0.000000	T	0.68311	0.2987	L	0.53249	1.67	0.54753	D	0.999988	D;D	0.89917	1.0;0.996	D;D	0.74348	0.983;0.943	T	0.67385	-0.5684	10	0.48119	T	0.1	-13.6265	10.6069	0.45400	0.0:0.0757:0.0:0.9243	.	449;98	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	R	449;280	ENSP00000265342:S449R	ENSP00000265342:S449R	S	-	1	0	FSTL4	132584452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.123000	0.50453	0.980000	0.38523	0.482000	0.46254	AGC	.	.	.	none		0.562	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
PCDHA9	9752	hgsc.bcm.edu	37	5	140229249	140229249	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr5:140229249C>T	ENST00000532602.1	+	1	2202	c.1169C>T	c.(1168-1170)aCg>aTg	p.T390M	PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.T390M|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	390	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCCCTGACGCCCCACGTC	0.562																																					p.T390M	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.C1169T						PASS	.						112.0	101.0	105.0					5																	140229249		2196	4274	6470	SO:0001583	missense	9752	exon1			CCCTGACGCCCCA	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1169C>T	chr5.hg19:g.140229249C>T	ENSP00000436042:p.Thr390Met	177.0	0.0	.		194.0	84.0	.	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	hg19	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837550	0.32513	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53206	0.63;0.63	3.6	0.613	0.17597	Cadherin (4);Cadherin-like (1);	0.730603	0.10108	U	0.715048	T	0.25121	0.0610	L	0.29908	0.895	0.09310	N	1	P;B	0.44260	0.83;0.421	B;B	0.33254	0.16;0.034	T	0.12218	-1.0556	10	0.33141	T	0.24	.	2.2108	0.03947	0.2563:0.4568:0.1254:0.1615	.	390;390	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	M	390	ENSP00000436042:T390M;ENSP00000367362:T390M	ENSP00000367362:T390M	T	+	2	0	PCDHA9	140209433	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-2.560000	0.00921	-0.019000	0.14055	0.313000	0.20887	ACG	.	.	.	none		0.562	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
ZNF184	7738	hgsc.bcm.edu	37	6	27419747	27419747	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr6:27419747C>G	ENST00000211936.6	-	6	1875	c.1591G>C	c.(1591-1593)Gaa>Caa	p.E531Q	ZNF184_ENST00000377419.1_Missense_Mutation_p.E531Q	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TCTTTACATTCATAAGCTTTC	0.383																																					p.E531Q		Atlas-SNP	.											.	ZNF184	89	.	0			c.G1591C						PASS	.						65.0	67.0	66.0					6																	27419747		2203	4299	6502	SO:0001583	missense	7738	exon6			TACATTCATAAGC	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1591G>C	chr6.hg19:g.27419747C>G	ENSP00000211936:p.Glu531Gln	46.0	0.0	.		54.0	12.0	.	NM_007149	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	hg19	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.347859	0.41599	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.35973	1.28;1.28	5.18	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000106	T	0.10337	0.0253	N	0.11341	0.13	0.19300	N	0.99997	P	0.42961	0.795	B	0.42138	0.377	T	0.05305	-1.0893	10	0.48119	T	0.1	.	8.7945	0.34872	0.1669:0.6716:0.1615:0.0	.	531	Q99676	ZN184_HUMAN	Q	531;531;447	ENSP00000211936:E531Q;ENSP00000366636:E531Q	ENSP00000211936:E531Q	E	-	1	0	ZNF184	27527726	0.000000	0.05858	1.000000	0.80357	0.988000	0.76386	-1.449000	0.02392	2.696000	0.92011	0.591000	0.81541	GAA	.	.	.	none		0.383	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
TAF8	129685	hgsc.bcm.edu	37	6	42025251	42025251	+	Splice_Site	SNP	G	G	A	rs554917914	byFrequency	TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr6:42025251G>A	ENST00000372977.3	+	5	507	c.489G>A	c.(487-489)ccG>ccA	p.P163P	TAF8_ENST00000494547.1_Splice_Site_p.P163P|TAF8_ENST00000482926.1_3'UTR|TAF8_ENST00000372982.4_Splice_Site_p.P163P|TAF8_ENST00000372978.3_Silent_p.P163P|TAF8_ENST00000456846.2_Splice_Site_p.P163P|TAF8_ENST00000465926.1_Splice_Site_p.P100P	NM_138572.2	NP_612639.2	Q7Z7C8	TAF8_HUMAN	TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa	163					cell differentiation (GO:0030154)|inner cell mass cell proliferation (GO:0001833)|maintenance of protein location in nucleus (GO:0051457)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fat cell differentiation (GO:0045598)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|transcription factor TFIID complex (GO:0005669)				endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00179)			TCAAAACTCCGGTGAGTGATG	0.572													G|||	3	0.000599042	0.0023	0.0	5008	,	,		16681	0.0		0.0	False		,,,				2504	0.0				p.P163P		Atlas-SNP	.											.	TAF8	25	.	0			c.G489A						PASS	.						66.0	68.0	68.0					6																	42025251		2003	4177	6180	SO:0001630	splice_region_variant	129685	exon5			AACTCCGGTGAGT	AK057383	CCDS43462.1	6p21.1	2008-10-23	2007-07-30	2007-07-30	ENSG00000137413	ENSG00000137413			17300	protein-coding gene	gene with protein product		609514	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa"", ""taube nuss homolog (mouse)"""	TBN			Standard	NM_138572		Approved	FLJ32821, TAF(II)43	uc003ors.3	Q7Z7C8	OTTHUMG00000014692	ENST00000372977.3:c.489+1G>A	chr6.hg19:g.42025251G>A		112.0	0.0	.		78.0	67.0	.	NM_138572	Q5T0K1|Q8N4R9|Q96M52	Silent	SNP	ENST00000372977.3	hg19	CCDS43462.1																																																																																			.	.	.	none		0.572	TAF8-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357901.1	NM_138572	Silent
SERAC1	84947	hgsc.bcm.edu	37	6	158565380	158565380	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr6:158565380C>T	ENST00000367104.3	-	7	691	c.560G>A	c.(559-561)aGt>aAt	p.S187N	SERAC1_ENST00000367102.2_Missense_Mutation_p.S187N|SERAC1_ENST00000367101.1_Missense_Mutation_p.S187N	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	187					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		GCGAAGATCACTCTCTTCGCT	0.328																																					p.S187N		Atlas-SNP	.											.	SERAC1	31	.	0			c.G560A						PASS	.						85.0	87.0	87.0					6																	158565380		2203	4300	6503	SO:0001583	missense	84947	exon7			AGATCACTCTCTT	BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.560G>A	chr6.hg19:g.158565380C>T	ENSP00000356071:p.Ser187Asn	249.0	0.0	.		229.0	101.0	.	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	hg19	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.645153	0.47258	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.67865	-0.29;-0.29;-0.29	5.8	2.87	0.33458	Armadillo-like helical (1);	0.320817	0.37955	N	0.001871	T	0.38108	0.1028	L	0.44542	1.39	0.27038	N	0.964089	P	0.36465	0.554	B	0.30105	0.111	T	0.38478	-0.9659	10	0.56958	D	0.05	-16.1029	11.2274	0.48892	0.12:0.3136:0.5664:0.0	.	187	Q96JX3	SRAC1_HUMAN	N	187	ENSP00000356069:S187N;ENSP00000356071:S187N;ENSP00000356068:S187N	ENSP00000356068:S187N	S	-	2	0	SERAC1	158485368	0.990000	0.36364	0.998000	0.56505	0.997000	0.91878	1.940000	0.40223	2.227000	0.72691	0.460000	0.39030	AGT	.	.	.	none		0.328	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
DPY19L1	23333	hgsc.bcm.edu	37	7	34979806	34979806	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr7:34979806T>C	ENST00000310974.4	-	19	1748	c.1604A>G	c.(1603-1605)cAa>cGa	p.Q535R	MIR548N_ENST00000408742.1_RNA	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	535						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						AAGTTCTTCTTGGGGCAAATT	0.328																																					p.Q535R		Atlas-SNP	.											.	DPY19L1	56	.	0			c.A1604G						PASS	.						75.0	61.0	65.0					7																	34979806		1804	4072	5876	SO:0001583	missense	23333	exon19			TCTTCTTGGGGCA	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1604A>G	chr7.hg19:g.34979806T>C	ENSP00000308695:p.Gln535Arg	52.0	0.0	.		47.0	15.0	.	NM_015283	O94954|Q4G151	Missense_Mutation	SNP	ENST00000310974.4	hg19	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.210972	0.58343	.	.	ENSG00000173852	ENST00000310974	T	0.55930	0.49	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.84433	2.695	0.58432	D	0.999998	D	0.64830	0.994	D	0.76575	0.988	T	0.73075	-0.4097	10	0.24483	T	0.36	-10.8889	14.1743	0.65529	0.0:0.0:0.0:1.0	.	535	Q2PZI1	D19L1_HUMAN	R	535	ENSP00000308695:Q535R	ENSP00000308695:Q535R	Q	-	2	0	DPY19L1	34946331	1.000000	0.71417	0.990000	0.47175	0.069000	0.16628	7.972000	0.88022	2.009000	0.58944	0.482000	0.46254	CAA	.	.	.	none		0.328	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		
ZNF713	349075	hgsc.bcm.edu	37	7	56007671	56007671	+	Missense_Mutation	SNP	G	G	A	rs371670199		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr7:56007671G>A	ENST00000429591.2	+	4	1303	c.1265G>A	c.(1264-1266)cGc>cAc	p.R422H	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAAACTGTTCGCCACAGTCCT	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		16485	0.0		0.001	False		,,,				2504	0.0				p.R422H		Atlas-SNP	.											.	ZNF713	47	.	0			c.G1265A						PASS	.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	46.0	48.0	47.0		1265	2.7	0.0	7		47	0,8600		0,0,4300	no	missense	ZNF713	NM_182633.1	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	422/431	56007671	1,13005	2203	4300	6503	SO:0001583	missense	349075	exon4			CTGTTCGCCACAG	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.1265G>A	chr7.hg19:g.56007671G>A	ENSP00000416662:p.Arg422His	77.0	0.0	.		90.0	23.0	.	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	hg19	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	G	2.378	-0.342694	0.05243	2.27E-4	0.0	ENSG00000178665	ENST00000429591	T	0.06449	3.3	3.54	2.66	0.31614	.	0.625593	0.14282	N	0.329436	T	0.04679	0.0127	L	0.32530	0.975	0.09310	N	1	B	0.30824	0.296	B	0.22601	0.04	T	0.35871	-0.9771	10	0.72032	D	0.01	.	4.9192	0.13862	0.1194:0.2201:0.6605:0.0	.	422	Q8N859	ZN713_HUMAN	H	422	ENSP00000416662:R422H	ENSP00000416662:R422H	R	+	2	0	ZNF713	55975165	0.000000	0.05858	0.003000	0.11579	0.058000	0.15608	0.306000	0.19279	1.064000	0.40671	0.467000	0.42956	CGC	.	.	.	weak		0.388	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
MUC17	140453	hgsc.bcm.edu	37	7	100679220	100679220	+	Missense_Mutation	SNP	C	C	T	rs374713003		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr7:100679220C>T	ENST00000306151.4	+	3	4587	c.4523C>T	c.(4522-4524)aCg>aTg	p.T1508M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1508	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCAATCTCAACGCCTAGTGAA	0.473																																					p.T1508M		Atlas-SNP	.											.	MUC17	804	.	0			c.C4523T						PASS	.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	209.0	197.0	201.0		4523	-0.1	0.0	7		201	1,8599	1.2+/-3.3	0,1,4299	no	missense	MUC17	NM_001040105.1	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	1508/4494	100679220	2,13004	2203	4300	6503	SO:0001583	missense	140453	exon3			TCTCAACGCCTAG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4523C>T	chr7.hg19:g.100679220C>T	ENSP00000302716:p.Thr1508Met	93.0	0.0	.		80.0	44.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	0.032	-1.330977	0.01298	2.27E-4	1.16E-4	ENSG00000169876	ENST00000306151	T	0.03330	3.97	0.922	-0.0705	0.13747	.	.	.	.	.	T	0.04092	0.0114	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.53185	0.72	T	0.45454	-0.9260	9	0.32370	T	0.25	.	4.9293	0.13909	0.0:0.6094:0.3906:0.0	.	1508	Q685J3	MUC17_HUMAN	M	1508	ENSP00000302716:T1508M	ENSP00000302716:T1508M	T	+	2	0	MUC17	100465940	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.062000	0.14389	0.011000	0.14865	-1.865000	0.00557	ACG	.	.	.	weak		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
EPHB6	2051	hgsc.bcm.edu	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S		Atlas-SNP	.											.	EPHB6	168	.	0			c.C516T						PASS	.						83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	chr7.hg19:g.142562074C>T		87.0	0.0	.		89.0	5.0	.	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.	.	none		0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
DPP6	1804	hgsc.bcm.edu	37	7	154598747	154598747	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr7:154598747G>T	ENST00000377770.3	+	16	1732	c.1591G>T	c.(1591-1593)Gac>Tac	p.D531Y	DPP6_ENST00000332007.3_Missense_Mutation_p.D469Y|DPP6_ENST00000404039.1_Missense_Mutation_p.D467Y|DPP6_ENST00000427557.1_Missense_Mutation_p.D424Y			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	531					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCTCTCCTGTGACCTGGTTGA	0.592																																					p.D531Y	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.G1591T						PASS	.						138.0	142.0	141.0					7																	154598747		2134	4247	6381	SO:0001583	missense	1804	exon16			TCCTGTGACCTGG	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1591G>T	chr7.hg19:g.154598747G>T	ENSP00000367001:p.Asp531Tyr	50.0	0.0	.		60.0	11.0	.	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	G	18.43	3.622636	0.66787	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	4.8	4.8	0.61643	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.243493	0.39759	N	0.001271	T	0.53722	0.1814	M	0.74258	2.255	0.58432	D	0.999999	P;P;D;D	0.59357	0.943;0.954;0.985;0.985	P;P;P;P	0.61477	0.886;0.823;0.889;0.889	T	0.60089	-0.7331	10	0.72032	D	0.01	-38.514	16.667	0.85255	0.0:0.0:1.0:0.0	.	424;469;531;467	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	Y	467;531;469;424	ENSP00000385578:D467Y;ENSP00000367001:D531Y;ENSP00000328226:D469Y;ENSP00000397303:D424Y	ENSP00000328226:D469Y	D	+	1	0	DPP6	154229680	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	8.294000	0.89934	2.177000	0.69029	0.655000	0.94253	GAC	.	.	.	none		0.592	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
RIMS2	9699	hgsc.bcm.edu	37	8	104924348	104924348	+	Missense_Mutation	SNP	G	G	A	rs375138135		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr8:104924348G>A	ENST00000436393.2	+	4	1335	c.1094G>A	c.(1093-1095)cGt>cAt	p.R365H	RIMS2_ENST00000262231.10_Missense_Mutation_p.R442H|RIMS2_ENST00000406091.3_Missense_Mutation_p.R587H|RIMS2_ENST00000507740.1_Missense_Mutation_p.R395H			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	665					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R395H(1)|p.R670H(1)|p.R365H(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTAAATAAGCGTCTAAAAGAT	0.353										HNSCC(12;0.0054)																											p.R587H		Atlas-SNP	.											RIMS2_ENST00000507740,NS,carcinoma,0,13	RIMS2	1357	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1760A						PASS	.	G	HIS/ARG,HIS/ARG	1,3687		0,1,1843	119.0	116.0	117.0		1760,1184	5.9	1.0	8		117	1,8175		0,1,4087	no	missense,missense	RIMS2	NM_001100117.2,NM_014677.4	29,29	0,2,5930	AA,AG,GG		0.0122,0.0271,0.0169	probably-damaging,probably-damaging	587/1350,395/1164	104924348	2,11862	1844	4088	5932	SO:0001583	missense	9699	exon6			ATAAGCGTCTAAA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1094G>A	chr8.hg19:g.104924348G>A	ENSP00000390665:p.Arg365His	130.0	0.0	.		138.0	35.0	.	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	hg19		.	.	.	.	.	.	.	.	.	.	G	35	5.445035	0.96187	2.71E-4	1.22E-4	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.21031	2.03;2.52;2.15;2.22;2.2;2.14;2.53	5.92	5.92	0.95590	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.44644	0.1303	L	0.49778	1.585	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.997;0.999;0.998;1.0	D;D;D;D;D	0.81914	0.977;0.977;0.992;0.98;0.995	T	0.14254	-1.0479	9	0.66056	D	0.02	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	665;365;442;395;587	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	H	587;618;587;665;395;442;395;395;365	ENSP00000427018:R587H;ENSP00000384892:R587H;ENSP00000425205:R395H;ENSP00000262231:R442H;ENSP00000423559:R395H;ENSP00000386228:R395H;ENSP00000390665:R365H	ENSP00000262231:R442H	R	+	2	0	RIMS2	104993524	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	7.833000	0.86765	2.822000	0.97130	0.650000	0.86243	CGT	.	.	.	weak		0.353	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
TBC1D31	93594	hgsc.bcm.edu	37	8	124109586	124109586	+	Silent	SNP	A	A	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr8:124109586A>C	ENST00000287380.1	+	6	826	c.736A>C	c.(736-738)Agg>Cgg	p.R246R	TBC1D31_ENST00000522420.1_Silent_p.R141R|TBC1D31_ENST00000327098.5_Silent_p.R246R|TBC1D31_ENST00000521676.1_Silent_p.R141R|TBC1D31_ENST00000378080.2_Silent_p.R141R|TBC1D31_ENST00000309336.3_Silent_p.R246R	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	246						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										CTTGGAAGCTAGGCAGCTCTT	0.423																																					p.R246R		Atlas-SNP	.											.	WDR67	97	.	0			c.A736C						PASS	.						131.0	118.0	122.0					8																	124109586		2203	4300	6503	SO:0001819	synonymous_variant	93594	exon6			GAAGCTAGGCAGC	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.736A>C	chr8.hg19:g.124109586A>C		97.0	0.0	.		121.0	38.0	.	NM_001145088	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Silent	SNP	ENST00000287380.1	hg19	CCDS6338.1																																																																																			.	.	.	none		0.423	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381721.1	NM_145647	
MAMDC2	256691	hgsc.bcm.edu	37	9	72728040	72728040	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr9:72728040G>C	ENST00000377182.4	+	5	1252	c.635G>C	c.(634-636)aGt>aCt	p.S212T	MAMDC2-AS1_ENST00000414515.3_RNA|MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	212	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						ACCTTCAAGAGTGAACTGGGT	0.493																																					p.S212T		Atlas-SNP	.											.	MAMDC2	55	.	0			c.G635C						PASS	.						84.0	76.0	79.0					9																	72728040		2203	4300	6503	SO:0001583	missense	256691	exon5			TCAAGAGTGAACT	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.635G>C	chr9.hg19:g.72728040G>C	ENSP00000366387:p.Ser212Thr	106.0	0.0	.		87.0	33.0	.	NM_153267	Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	ENST00000377182.4	hg19	CCDS6631.1	.	.	.	.	.	.	.	.	.	.	G	7.048	0.563812	0.13498	.	.	ENSG00000165072	ENST00000377182	T	0.02140	4.43	5.72	2.73	0.32206	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.205916	0.64402	D	0.000017	T	0.01627	0.0052	N	0.24115	0.695	0.26934	N	0.966406	B	0.16603	0.018	B	0.20955	0.032	T	0.48175	-0.9058	10	0.06625	T	0.88	-7.9371	9.2328	0.37448	0.4469:0.0:0.5531:0.0	.	212	Q7Z304	MAMC2_HUMAN	T	212	ENSP00000366387:S212T	ENSP00000366387:S212T	S	+	2	0	MAMDC2	71917860	1.000000	0.71417	0.994000	0.49952	0.750000	0.42670	0.641000	0.24720	0.275000	0.22094	-0.379000	0.06801	AGT	.	.	.	none		0.493	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267	
NOL8	55035	hgsc.bcm.edu	37	9	95077665	95077665	+	Silent	SNP	A	A	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr9:95077665A>G	ENST00000535387.1	-	6	1241	c.1242T>C	c.(1240-1242)aaT>aaC	p.N414N	NOL8_ENST00000358855.4_Silent_p.N346N|NOL8_ENST00000545558.1_Silent_p.N414N|NOL8_ENST00000442668.2_Silent_p.N414N|NOL8_ENST00000542053.1_Silent_p.N346N					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						AGTTTTCTCTATTTTTGAAAG	0.313																																					p.N414N		Atlas-SNP	.											.	NOL8	118	.	0			c.T1242C						PASS	.						25.0	21.0	22.0					9																	95077665		1802	4054	5856	SO:0001819	synonymous_variant	55035	exon7			TTCTCTATTTTTG	AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.1242T>C	chr9.hg19:g.95077665A>G		83.0	0.0	.		68.0	39.0	.	NM_017948		Silent	SNP	ENST00000535387.1	hg19	CCDS47993.1																																																																																			.	.	.	none		0.313	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053082.2	NM_017948	
KIAA1462	57608	hgsc.bcm.edu	37	10	30317816	30317816	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr10:30317816C>T	ENST00000375377.1	-	3	1362	c.1261G>A	c.(1261-1263)Gtt>Att	p.V421I		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	421					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						ATGTACTGAACGAAGCCGTCA	0.517																																					p.V421I		Atlas-SNP	.											.	KIAA1462	162	.	0			c.G1261A						PASS	.						76.0	80.0	78.0					10																	30317816		1946	4138	6084	SO:0001583	missense	57608	exon3			ACTGAACGAAGCC	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1261G>A	chr10.hg19:g.30317816C>T	ENSP00000364526:p.Val421Ile	107.0	0.0	.		104.0	9.0	.	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	hg19	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118022	0.37339	.	.	ENSG00000165757	ENST00000375377	T	0.16743	2.32	5.42	2.49	0.30216	.	0.321071	0.29900	N	0.010915	T	0.08980	0.0222	N	0.13327	0.33	0.32893	D	0.512148	D	0.60575	0.988	B	0.40636	0.335	T	0.22487	-1.0215	10	0.27785	T	0.31	-9.6829	10.3754	0.44079	0.0:0.7798:0.0:0.2202	.	421	Q9P266	K1462_HUMAN	I	421	ENSP00000364526:V421I	ENSP00000364526:V421I	V	-	1	0	KIAA1462	30357822	0.030000	0.19436	0.038000	0.18304	0.183000	0.23260	0.262000	0.18460	0.645000	0.30675	0.561000	0.74099	GTT	.	.	.	none		0.517	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
PARD3	56288	hgsc.bcm.edu	37	10	34673133	34673133	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr10:34673133G>A	ENST00000374789.3	-	8	1265	c.940C>T	c.(940-942)Cat>Tat	p.H314Y	PARD3_ENST00000544292.1_Missense_Mutation_p.H44Y|PARD3_ENST00000340077.5_Missense_Mutation_p.H314Y|PARD3_ENST00000374776.1_Missense_Mutation_p.H314Y|PARD3_ENST00000374790.3_Missense_Mutation_p.H270Y|PARD3_ENST00000374773.1_Missense_Mutation_p.H314Y|PARD3_ENST00000545693.1_Missense_Mutation_p.H314Y|PARD3_ENST00000350537.4_Missense_Mutation_p.H314Y|PARD3_ENST00000545260.1_Missense_Mutation_p.H270Y|PARD3_ENST00000374788.3_Missense_Mutation_p.H314Y|PARD3_ENST00000346874.4_Missense_Mutation_p.H314Y|PARD3_ENST00000374794.3_Missense_Mutation_p.H270Y	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	314	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				AGATTTTCATGTTCAGCTTTA	0.388																																					p.H314Y		Atlas-SNP	.											.	PARD3	131	.	0			c.C940T						PASS	.						180.0	160.0	167.0					10																	34673133		2203	4300	6503	SO:0001583	missense	56288	exon8			TTTCATGTTCAGC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.940C>T	chr10.hg19:g.34673133G>A	ENSP00000363921:p.His314Tyr	78.0	0.0	.		85.0	12.0	.	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	hg19	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.256229	0.59321	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7	5.68	5.68	0.88126	PDZ/DHR/GLGF (3);	0.290697	0.40554	N	0.001075	T	0.19805	0.0476	N	0.08118	0	0.28529	N	0.91269	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.22541	0.017;0.028;0.019;0.017;0.019;0.017;0.017;0.01;0.01;0.01;0.059;0.071;0.008;0.017	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.28849	0.051;0.049;0.051;0.095;0.095;0.051;0.095;0.007;0.044;0.044;0.095;0.028;0.095;0.095	T	0.26849	-1.0091	10	0.87932	D	0	.	20.1615	0.98135	0.0:0.0:1.0:0.0	.	270;270;314;314;314;314;314;314;270;314;314;314;314;44	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.	Y	314;270;314;314;314;270;314;270;314;314;314;44	ENSP00000443147:H314Y;ENSP00000440857:H270Y;ENSP00000363921:H314Y;ENSP00000363920:H314Y;ENSP00000340591:H314Y;ENSP00000363926:H270Y;ENSP00000311986:H314Y;ENSP00000363922:H270Y;ENSP00000363908:H314Y;ENSP00000341844:H314Y;ENSP00000363905:H314Y;ENSP00000444429:H44Y	ENSP00000341844:H314Y	H	-	1	0	PARD3	34713139	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.220000	0.78008	2.835000	0.97688	0.650000	0.86243	CAT	.	.	.	none		0.388	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						PASS	.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		452.0	0.0	.		400.0	18.0	.	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.	.	none		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
FGF4	2249	hgsc.bcm.edu	37	11	69588117	69588117	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr11:69588117G>A	ENST00000168712.1	-	3	899	c.581C>T	c.(580-582)tCg>tTg	p.S194L	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_5'UTR	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	194					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	CATGGTGGGCGACACTCGGTT	0.612																																					p.S194L		Atlas-SNP	.											FGF4,NS,lymphoid_neoplasm,0,1	FGF4	13	.	0			c.C581T						PASS	.						178.0	149.0	159.0					11																	69588117		2200	4294	6494	SO:0001583	missense	2249	exon3			GTGGGCGACACTC	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.581C>T	chr11.hg19:g.69588117G>A	ENSP00000168712:p.Ser194Leu	221.0	0.0	.		174.0	82.0	.	NM_002007	B7U994	Missense_Mutation	SNP	ENST00000168712.1	hg19	CCDS8194.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788207	0.90367	.	.	ENSG00000075388	ENST00000168712	D	0.81659	-1.52	5.81	5.81	0.92471	.	0.000000	0.41194	D	0.000936	D	0.90082	0.6902	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.89179	0.3542	9	.	.	.	.	20.074	0.97736	0.0:0.0:1.0:0.0	.	194	P08620	FGF4_HUMAN	L	194	ENSP00000168712:S194L	.	S	-	2	0	FGF4	69297298	1.000000	0.71417	0.948000	0.38648	0.350000	0.29205	9.026000	0.93700	2.746000	0.94184	0.655000	0.94253	TCG	.	.	.	none		0.612	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007	
MAML2	84441	hgsc.bcm.edu	37	11	95825257	95825257	+	Silent	SNP	T	T	C	rs575986134	byFrequency	TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr11:95825257T>C	ENST00000524717.1	-	2	3222	c.1938A>G	c.(1936-1938)caA>caG	p.Q646Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	646					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgttgttgctgct	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								T|||	5	0.000998403	0.0	0.0	5008	,	,		17451	0.005		0.0	False		,,,				2504	0.0				p.Q646Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,colon,carcinoma,0,1	MAML2	94	.	0			c.A1938G						PASS	.						37.0	42.0	40.0					11																	95825257		2095	4114	6209	SO:0001819	synonymous_variant	84441	exon2			CTGCTGTTGTTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1938A>G	chr11.hg19:g.95825257T>C		70.0	1.0	.		53.0	3.0	.	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.	.	none		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
AVPR1A	552	hgsc.bcm.edu	37	12	63544413	63544413	+	Silent	SNP	G	G	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr12:63544413G>C	ENST00000299178.2	-	1	309	c.204C>G	c.(202-204)ggC>ggG	p.G68G		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	68					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CGCTGCTGTTGCCCAGCACGG	0.682																																					p.G68G		Atlas-SNP	.											.	AVPR1A	85	.	0			c.C204G						PASS	.						32.0	29.0	30.0					12																	63544413		2203	4298	6501	SO:0001819	synonymous_variant	552	exon1			GCTGTTGCCCAGC	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.204C>G	chr12.hg19:g.63544413G>C		76.0	0.0	.		115.0	21.0	.	NM_000706		Silent	SNP	ENST00000299178.2	hg19	CCDS8965.1																																																																																			.	.	.	none		0.682	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
SPERT	220082	hgsc.bcm.edu	37	13	46287523	46287523	+	Silent	SNP	G	G	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr13:46287523G>A	ENST00000310521.1	+	3	443	c.363G>A	c.(361-363)gtG>gtA	p.V121V	SPERT_ENST00000378966.3_Silent_p.V85V	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	121						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CGCCGCGGGTGCAGCTCAGCG	0.627																																					p.V121V		Atlas-SNP	.											.	SPERT	54	.	0			c.G363A						PASS	.						63.0	67.0	66.0					13																	46287523		2203	4300	6503	SO:0001819	synonymous_variant	220082	exon3			GCGGGTGCAGCTC	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.363G>A	chr13.hg19:g.46287523G>A		144.0	0.0	.		76.0	62.0	.	NM_152719	A8K8I5|Q8NHV2	Silent	SNP	ENST00000310521.1	hg19	CCDS9399.1																																																																																			.	.	.	none		0.627	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
KCNJ12	3768	hgsc.bcm.edu	37	17	21318791	21318791	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr17:21318791T>A	ENST00000583088.1	+	3	1032	c.137T>A	c.(136-138)tTc>tAc	p.F46Y	KCNJ12_ENST00000331718.5_Missense_Mutation_p.F46Y	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	46					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CGCAACCGCTTCGTCAAGAAG	0.612										Prostate(3;0.18)																											p.F46Y		Atlas-SNP	.											.	.	.	.	0			c.T137A						PASS	.						151.0	107.0	122.0					17																	21318791		2203	4300	6503	SO:0001583	missense	100134444	exon3			ACCGCTTCGTCAA	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.137T>A	chr17.hg19:g.21318791T>A	ENSP00000463778:p.Phe46Tyr	108.0	0.0	.		125.0	14.0	.	NM_001194958	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	hg19	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.075785	0.76415	.	.	ENSG00000184185	ENST00000331718	T	0.60424	0.19	5.33	5.33	0.75918	Potassium channel, inwardly rectifying, Kir, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72391	0.3454	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.75484	0.986	T	0.69669	-0.5083	10	0.23891	T	0.37	.	15.3028	0.73966	0.0:0.0:0.0:1.0	.	46	Q14500	IRK12_HUMAN	Y	46	ENSP00000328150:F46Y	ENSP00000328150:F46Y	F	+	2	0	KCNJ12	21259384	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	7.898000	0.87363	2.027000	0.59764	0.482000	0.46254	TTC	.	.	.	none		0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
MYO9B	4650	hgsc.bcm.edu	37	19	17305947	17305947	+	Silent	SNP	G	G	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:17305947G>T	ENST00000594824.1	+	22	3858	c.3711G>T	c.(3709-3711)acG>acT	p.T1237T	MYO9B_ENST00000397274.2_Silent_p.T1237T|MYO9B_ENST00000595618.1_Silent_p.T1237T			Q13459	MYO9B_HUMAN	myosin IXB	1237	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CTGAGAAGACGCTGCCCAGTG	0.647																																					p.T1237T		Atlas-SNP	.											.	MYO9B	264	.	0			c.G3711T						PASS	.						20.0	26.0	25.0					19																	17305947		1929	4131	6060	SO:0001819	synonymous_variant	4650	exon22			GAAGACGCTGCCC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.3711G>T	chr19.hg19:g.17305947G>T		162.0	0.0	.		116.0	5.0	.	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	hg19																																																																																				.	.	.	none		0.647	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
DMKN	93099	hgsc.bcm.edu	37	19	36004269	36004269	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:36004269C>T	ENST00000339686.3	-	1	285	c.109G>A	c.(109-111)Gag>Aag	p.E37K	DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000419602.1_Missense_Mutation_p.E37K|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000424570.2_Missense_Mutation_p.E37K|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.E37K|DMKN_ENST00000451297.2_Missense_Mutation_p.E37K|DMKN_ENST00000418261.1_Missense_Mutation_p.E37K|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.E37K|DMKN_ENST00000447113.2_Missense_Mutation_p.E37K|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	37	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCAAGGGCCTCCCCAATATTT	0.667																																					p.E37K		Atlas-SNP	.											.	DMKN	116	.	0			c.G109A						PASS	.						56.0	60.0	59.0					19																	36004269		2203	4300	6503	SO:0001583	missense	93099	exon1			GGGCCTCCCCAAT	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.109G>A	chr19.hg19:g.36004269C>T	ENSP00000342012:p.Glu37Lys	39.0	0.0	.		44.0	9.0	.	NM_001190347	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	hg19	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719708	0.68844	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.19105	2.67;2.45;2.43;2.18;2.19;2.18;2.19;2.17	4.37	3.31	0.37934	.	.	.	.	.	T	0.37652	0.1011	L	0.59436	1.845	0.09310	N	1	D;P;P;D;D;D;D	0.58268	0.982;0.811;0.811;0.982;0.965;0.965;0.982	P;P;P;P;P;P;P	0.60789	0.82;0.879;0.879;0.82;0.709;0.709;0.82	T	0.11397	-1.0589	9	0.72032	D	0.01	-6.5769	11.2325	0.48920	0.1848:0.8152:0.0:0.0	.	37;37;37;37;37;37;37	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	K	37	ENSP00000342012:E37K;ENSP00000405503:E37K;ENSP00000391036:E37K;ENSP00000394908:E37K;ENSP00000415277:E37K;ENSP00000414743:E37K;ENSP00000388404:E37K;ENSP00000409513:E37K	ENSP00000342012:E37K	E	-	1	0	DMKN	40696109	0.530000	0.26330	0.096000	0.21009	0.111000	0.19643	3.083000	0.50136	0.811000	0.34303	0.491000	0.48974	GAG	.	.	.	none		0.667	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
PRMT1	3276	hgsc.bcm.edu	37	19	50185321	50185321	+	Splice_Site	SNP	G	G	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:50185321G>A	ENST00000391851.4	+	3	422	c.293G>A	c.(292-294)gGg>gAg	p.G98E	MIR5088_ENST00000581740.1_RNA|PRMT1_ENST00000532489.1_Splice_Site_p.G70E|PRMT1_ENST00000454376.2_Splice_Site_p.G116E	NM_198318.4	NP_938074.2	Q99873	ANM1_HUMAN	protein arginine methyltransferase 1	106	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell surface receptor signaling pathway (GO:0007166)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of megakaryocyte differentiation (GO:0045653)|neuron projection development (GO:0031175)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|protein methylation (GO:0006479)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|identical protein binding (GO:0042802)|methyltransferase activity (GO:0008168)|N-methyltransferase activity (GO:0008170)|poly(A) RNA binding (GO:0044822)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(2)	12		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		AAGGTCATCGGGGTGAGTCTC	0.677																																					p.G116E		Atlas-SNP	.											.	PRMT1	31	.	0			c.G347A						PASS	.						35.0	39.0	38.0					19																	50185321		2202	4299	6501	SO:0001630	splice_region_variant	3276	exon4			TCATCGGGGTGAG	D66904	CCDS42592.1, CCDS46145.1, CCDS74425.1	19q13	2014-06-12	2006-02-16	2006-02-16	ENSG00000126457	ENSG00000126457	2.1.1.125	"""Protein arginine methyltransferases"""	5187	protein-coding gene	gene with protein product		602950	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 2"", ""HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)"""	HRMT1L2		9545638	Standard	NM_001207042		Approved	HCP1, ANM1	uc010enf.2	Q99873	OTTHUMG00000167568	ENST00000391851.4:c.294+1G>A	chr19.hg19:g.50185321G>A		89.0	0.0	.		85.0	40.0	.	NM_001536	B4E3C3|G5E9B6|Q15529|Q2VP93|Q6LEU5|Q8WUW5|Q99872|Q99874|Q9NZ04|Q9NZ05|Q9NZ06	Missense_Mutation	SNP	ENST00000391851.4	hg19	CCDS42592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.278157|4.278157	0.80692|0.80692	.|.	.|.	ENSG00000126457|ENSG00000126457	ENST00000529284;ENST00000532489;ENST00000527382;ENST00000534465;ENST00000391851;ENST00000449059;ENST00000454376;ENST00000529836;ENST00000526224;ENST00000527412|ENST00000524771	T;T;T;T;T;T;T;T;T|T	0.43294|0.43688	0.95;0.95;0.95;0.95;0.95;0.95;1.26;0.95;1.26|0.94	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.78272|0.78272	0.4257|0.4257	H|H	0.98525|0.98525	4.255|4.255	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.999;0.999;0.999;0.999|.	D;D;D;D|.	0.76575|.	0.988;0.984;0.972;0.972|.	D|D	0.86699|0.86699	0.1928|0.1928	10|8	0.87932|0.87932	D|D	0|0	0.0459|0.0459	15.9171|15.9171	0.79527|0.79527	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	106;70;98;92|.	Q99873;E9PKG1;G5E9B6;Q99873-2|.	ANM1_HUMAN;.;.;.|.	E|R	70;70;70;70;98;92;116;92;70;95|126	ENSP00000432349:G70E;ENSP00000433556:G70E;ENSP00000432538:G70E;ENSP00000431957:G70E;ENSP00000375724:G98E;ENSP00000406162:G116E;ENSP00000437273:G92E;ENSP00000432788:G70E;ENSP00000436732:G95E|ENSP00000433480:G126R	ENSP00000375724:G98E|ENSP00000433480:G126R	G|G	+|+	2|1	0|0	PRMT1|PRMT1	54877133|54877133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.455000|0.455000	0.32408|0.32408	9.271000|9.271000	0.95698|0.95698	2.629000|2.629000	0.89072|0.89072	0.643000|0.643000	0.83706|0.83706	GGG|GGA	.	.	.	none		0.677	PRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395065.1	NM_001536	Missense_Mutation
ZNF816	125893	hgsc.bcm.edu	37	19	53453491	53453491	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:53453491C>G	ENST00000357666.4	-	5	1837	c.1537G>C	c.(1537-1539)Gaa>Caa	p.E513Q	ZNF816_ENST00000434371.2_Intron|ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000444460.2_Missense_Mutation_p.E513Q	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	513					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TTGTCACATTCTTCACATTTG	0.388																																					p.E513Q		Atlas-SNP	.											.	ZNF816	73	.	0			c.G1537C						PASS	.						104.0	106.0	105.0					19																	53453491		2203	4300	6503	SO:0001583	missense	125893	exon4			CACATTCTTCACA	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.1537G>C	chr19.hg19:g.53453491C>G	ENSP00000350295:p.Glu513Gln	74.0	0.0	.		68.0	7.0	.	NM_001202457	A8K7H5|Q3KR39|Q659B3	Missense_Mutation	SNP	ENST00000357666.4	hg19	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	-	10.66	1.412249	0.25465	.	.	ENSG00000180257	ENST00000357666;ENST00000444460	T;T	0.07444	3.19;3.19	1.85	-1.03	0.10102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08802	0.0218	N	0.04746	-0.17	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.36407	-0.9749	9	0.36615	T	0.2	.	5.6179	0.17442	0.0:0.6528:0.2006:0.1466	.	513	Q0VGE8	ZN816_HUMAN	Q	513	ENSP00000350295:E513Q;ENSP00000403266:E513Q	ENSP00000350295:E513Q	E	-	1	0	ZNF816	58145303	0.000000	0.05858	0.013000	0.15412	0.291000	0.27294	-0.583000	0.05807	0.106000	0.17784	0.313000	0.20887	GAA	.	.	.	none		0.388	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
RFPL4A	342931	hgsc.bcm.edu	37	19	56274128	56274128	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:56274128C>A	ENST00000434937.2	+	3	622	c.451C>A	c.(451-453)Cat>Aat	p.H151N		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	151	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TTCCGGCCGCCATTACTGGGA	0.572																																					p.H151N		Atlas-SNP	.											.	RFPL4A	8	.	0			c.C451A						PASS	.						14.0	15.0	15.0					19																	56274128		682	1565	2247	SO:0001583	missense	342931	exon3			GGCCGCCATTACT		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.451C>A	chr19.hg19:g.56274128C>A	ENSP00000392936:p.His151Asn	391.0	0.0	.		392.0	85.0	.	NM_001145014		Missense_Mutation	SNP	ENST00000434937.2	hg19	CCDS46201.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209783	0.58343	.	.	ENSG00000223638	ENST00000434937	T	0.69561	-0.41	2.64	2.64	0.31445	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	D	0.87759	0.6258	H	0.98786	4.33	0.36622	D	0.875824	D	0.89917	1.0	D	0.97110	1.0	D	0.92272	0.5826	9	0.87932	D	0	-21.9465	11.4291	0.50029	0.0:1.0:0.0:0.0	.	151	A6NLU0	RFPLA_HUMAN	N	151	ENSP00000392936:H151N	ENSP00000392936:H151N	H	+	1	0	RFPL4A	60965940	0.000000	0.05858	0.092000	0.20876	0.014000	0.08584	0.133000	0.15912	1.769000	0.52152	0.655000	0.94253	CAT	.	.	.	none		0.572	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384184.1	XM_292796	
NLRP4	147945	hgsc.bcm.edu	37	19	56388499	56388499	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr19:56388499T>C	ENST00000301295.6	+	8	3085	c.2663T>C	c.(2662-2664)cTg>cCg	p.L888P	NLRP4_ENST00000587891.1_Missense_Mutation_p.L813P|NLRP4_ENST00000346986.5_Missense_Mutation_p.L832P	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	888					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGTCGGGCTCTGACGCATACG	0.493																																					p.L888P		Atlas-SNP	.											.	NLRP4	331	.	0			c.T2663C						PASS	.						203.0	192.0	196.0					19																	56388499		2203	4300	6503	SO:0001583	missense	147945	exon8			GGGCTCTGACGCA	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2663T>C	chr19.hg19:g.56388499T>C	ENSP00000301295:p.Leu888Pro	159.0	0.0	.		116.0	37.0	.	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	hg19	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	T	14.24	2.477580	0.44044	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.71103	-0.02;-0.54	3.91	3.91	0.45181	.	.	.	.	.	D	0.86928	0.6051	H	0.94222	3.51	0.19300	N	0.99997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.991;0.979	T	0.77395	-0.2604	9	0.87932	D	0	.	9.35	0.38131	0.0:0.0:0.0:1.0	.	832;813;888	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	P	888;832	ENSP00000301295:L888P;ENSP00000344787:L832P	ENSP00000301295:L888P	L	+	2	0	NLRP4	61080311	0.059000	0.20769	0.007000	0.13788	0.014000	0.08584	3.482000	0.53186	1.783000	0.52377	0.477000	0.44152	CTG	.	.	.	none		0.493	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
LRRN4	164312	hgsc.bcm.edu	37	20	6031523	6031523	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr20:6031523G>T	ENST00000378858.4	-	3	986	c.762C>A	c.(760-762)aaC>aaA	p.N254K		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	254					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GCTGCTGCAGGTTGGGGGTCA	0.552																																					p.N254K		Atlas-SNP	.											.	LRRN4	54	.	0			c.C762A						PASS	.						133.0	123.0	127.0					20																	6031523		2203	4300	6503	SO:0001583	missense	164312	exon3			CTGCAGGTTGGGG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.762C>A	chr20.hg19:g.6031523G>T	ENSP00000368135:p.Asn254Lys	191.0	0.0	.		165.0	101.0	.	NM_152611	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	hg19	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001798	0.35320	.	.	ENSG00000125872	ENST00000378858	T	0.56444	0.46	5.68	2.15	0.27550	.	0.506545	0.19230	N	0.119428	T	0.41834	0.1176	L	0.41632	1.29	0.24473	N	0.994383	B;B	0.30146	0.27;0.027	B;B	0.34931	0.192;0.034	T	0.29579	-1.0007	10	0.36615	T	0.2	-7.2773	7.64	0.28288	0.1127:0.472:0.4153:0.0	.	254;254	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	K	254	ENSP00000368135:N254K	ENSP00000368135:N254K	N	-	3	2	LRRN4	5979523	0.000000	0.05858	0.617000	0.29091	0.888000	0.51559	-0.500000	0.06405	0.740000	0.32651	0.491000	0.48974	AAC	.	.	.	none		0.552	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
CD93	22918	hgsc.bcm.edu	37	20	23065706	23065706	+	Missense_Mutation	SNP	G	G	A	rs139005135		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr20:23065706G>A	ENST00000246006.4	-	1	1271	c.1124C>T	c.(1123-1125)cCg>cTg	p.P375L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	375	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AGGACCGCCCGGCTCATAGCC	0.632																																					p.P375L		Atlas-SNP	.											.	CD93	84	.	0			c.C1124T						PASS	.	G	LEU/PRO	0,4406		0,0,2203	41.0	43.0	42.0		1124	3.9	0.2	20	dbSNP_134	42	2,8598	2.2+/-6.3	0,2,4298	no	missense	CD93	NM_012072.3	98	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	375/653	23065706	2,13004	2203	4300	6503	SO:0001583	missense	22918	exon1			CCGCCCGGCTCAT	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1124C>T	chr20.hg19:g.23065706G>A	ENSP00000246006:p.Pro375Leu	170.0	0.0	.		154.0	67.0	.	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	hg19	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	4.744	0.138295	0.09083	0.0	2.33E-4	ENSG00000125810	ENST00000246006	T	0.20332	2.08	4.89	3.94	0.45596	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.203167	0.34879	N	0.003614	T	0.07324	0.0185	N	0.02158	-0.66	0.09310	N	0.999998	B	0.18968	0.032	B	0.09377	0.004	T	0.30966	-0.9960	10	0.22109	T	0.4	-10.0711	9.2402	0.37491	0.1733:0.0:0.8267:0.0	.	375	Q9NPY3	C1QR1_HUMAN	L	375	ENSP00000246006:P375L	ENSP00000246006:P375L	P	-	2	0	CD93	23013706	0.010000	0.17322	0.222000	0.23844	0.169000	0.22640	1.721000	0.38032	1.423000	0.47198	0.650000	0.86243	CCG	.	G|1.000;A|0.000	0.000	weak		0.632	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
SIM2	6493	hgsc.bcm.edu	37	21	38115795	38115795	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr21:38115795T>C	ENST00000290399.6	+	9	1719	c.1106T>C	c.(1105-1107)tTa>tCa	p.L369S	SIM2_ENST00000430056.3_Missense_Mutation_p.L369S	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	369	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						ACTAGGAAATTAGTGAAACCC	0.498																																					p.L369S		Atlas-SNP	.											.	SIM2	55	.	0			c.T1106C						PASS	.						166.0	164.0	164.0					21																	38115795		2203	4300	6503	SO:0001583	missense	6493	exon9			GGAAATTAGTGAA		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.1106T>C	chr21.hg19:g.38115795T>C	ENSP00000290399:p.Leu369Ser	234.0	0.0	.		230.0	96.0	.	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Missense_Mutation	SNP	ENST00000290399.6	hg19	CCDS13646.1	.	.	.	.	.	.	.	.	.	.	T	0.039	-1.293915	0.01375	.	.	ENSG00000159263	ENST00000290399;ENST00000430056	T;T	0.24723	1.84;1.84	4.43	2.05	0.26809	Single-minded, C-terminal (2);	1.087690	0.07148	N	0.848635	T	0.10852	0.0265	N	0.04508	-0.205	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.09377	0.004;0.002	T	0.32534	-0.9903	10	0.08837	T	0.75	.	7.0238	0.24928	0.0:0.3703:0.0:0.6297	.	369;369	Q14190;Q14190-2	SIM2_HUMAN;.	S	369	ENSP00000290399:L369S;ENSP00000404176:L369S	ENSP00000290399:L369S	L	+	2	0	SIM2	37037665	0.999000	0.42202	0.232000	0.24009	0.491000	0.33493	1.380000	0.34351	0.659000	0.30945	0.334000	0.21626	TTA	.	.	.	none		0.498	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
PCNT	5116	hgsc.bcm.edu	37	21	47831608	47831608	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr21:47831608A>G	ENST00000359568.5	+	28	5728	c.5621A>G	c.(5620-5622)aAt>aGt	p.N1874S	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1874					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GCCGAGAGAAATTTAGAAATC	0.622																																					p.N1874S		Atlas-SNP	.											.	PCNT	283	.	0			c.A5621G						PASS	.						30.0	34.0	33.0					21																	47831608		2196	4292	6488	SO:0001583	missense	5116	exon28			AGAGAAATTTAGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.5621A>G	chr21.hg19:g.47831608A>G	ENSP00000352572:p.Asn1874Ser	130.0	0.0	.		125.0	56.0	.	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	hg19	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.545363	0.45280	.	.	ENSG00000160299	ENST00000359568	T	0.01464	4.86	5.07	5.07	0.68467	.	0.489448	0.15283	N	0.270570	T	0.01287	0.0042	N	0.08118	0	0.20764	N	0.99985	B;B	0.25272	0.122;0.074	B;B	0.21708	0.036;0.016	T	0.50600	-0.8809	10	0.13108	T	0.6	.	13.4209	0.60996	1.0:0.0:0.0:0.0	.	1756;1874	O95613-2;O95613	.;PCNT_HUMAN	S	1874	ENSP00000352572:N1874S	ENSP00000352572:N1874S	N	+	2	0	PCNT	46656036	0.995000	0.38212	0.015000	0.15790	0.019000	0.09904	2.831000	0.48144	2.219000	0.72066	0.533000	0.62120	AAT	.	.	.	none		0.622	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
AR	367	hgsc.bcm.edu	37	X	66765164	66765164	+	Missense_Mutation	SNP	A	A	T			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chrX:66765164A>T	ENST00000374690.3	+	1	700	c.176A>T	c.(175-177)cAg>cTg	p.Q59L	AR_ENST00000504326.1_Missense_Mutation_p.Q59L|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q59L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	59	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTgcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q59L		Atlas-SNP	.											.	AR	249	.	0			c.A176T						PASS	.						7.0	10.0	9.0					X																	66765164		2055	4063	6118	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	TGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.176A>T	chrX.hg19:g.66765164A>T	ENSP00000363822:p.Gln59Leu	72.0	0.0	.		119.0	16.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	12.32	1.901651	0.33535	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69175	-0.38;-0.38;-0.38	.	.	.	.	1.117170	0.06949	N	0.814177	T	0.47060	0.1425	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.31724	-0.9933	8	0.13108	T	0.6	.	.	.	.	.	59;59	E7EVX6;D3YPQ2	.;.	L	59	ENSP00000363822:Q59L;ENSP00000421155:Q59L;ENSP00000379359:Q59L	ENSP00000363822:Q59L	Q	+	2	0	AR	66681889	0.995000	0.38212	0.864000	0.33941	0.503000	0.33858	0.245000	0.18142	0.000000	0.14550	0.000000	0.15137	CAG	.	.	.	none		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765222	66765223	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chrX:66765222_66765223GC>AG	ENST00000374690.3	+	1	758_759	c.234_235GC>AG	c.(232-237)caGCag>caAGag	p.Q79E	AR_ENST00000504326.1_Missense_Mutation_p.Q79E|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q79E	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	78	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcaagagac	0.653									Androgen Insensitivity Syndrome																												p.Q78Q|p.Q79E		Atlas-SNP	.											.	AR	249	.	0			c.G234A|c.C235G						PASS	.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCAGCAGCAGCAA|CAGCAGCAGCAAG	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	chrX.hg19:g.66765222_66765223delinsAG	ENSP00000363822:p.Gln79Glu	92.0|94.0	0.0	.		150.0|152.0	12.0	.	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent|Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.	.	none		0.653	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
SMARCA1	6594	hgsc.bcm.edu	37	X	128652406	128652406	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chrX:128652406G>A	ENST00000371122.4	-	2	322	c.193C>T	c.(193-195)Caa>Taa	p.Q65*	SMARCA1_ENST00000371123.1_Nonsense_Mutation_p.Q65*|SMARCA1_ENST00000478420.1_5'UTR|SMARCA1_ENST00000371121.3_Nonsense_Mutation_p.Q65*	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	65					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						AGTTTGAGTTGAAATGAAGAA	0.358																																					p.Q65X		Atlas-SNP	.											.	SMARCA1	126	.	0			c.C193T						PASS	.						92.0	79.0	83.0					X																	128652406		2202	4299	6501	SO:0001587	stop_gained	6594	exon2			TGAGTTGAAATGA	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.193C>T	chrX.hg19:g.128652406G>A	ENSP00000360163:p.Gln65*	253.0	0.0	.		213.0	193.0	.	NM_139035	Q5JV41|Q5JV42	Nonsense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	G	36	5.879507	0.97062	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	.	.	.	5.13	5.13	0.70059	.	0.574317	0.14333	N	0.326218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-2.2867	12.401	0.55412	0.0:0.1644:0.8356:0.0	.	.	.	.	X	65;65;65;44	.	ENSP00000360162:Q65X	Q	-	1	0	SMARCA1	128480087	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	5.851000	0.69481	2.092000	0.63282	0.513000	0.50165	CAA	.	.	.	none		0.358	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
MT-ND4	4538	hgsc.bcm.edu	37	M	10809	10809	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chrM:10809T>C	ENST00000361381.2	+	1	50	c.50T>C	c.(49-51)cTt>cCt	p.L17P	MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	17					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACTGACATGACTTTCCAAAAA	0.363																																					p.L17P		Atlas-SNP	.											.	.	.	.	0			c.T50C						PASS	.																																			SO:0001583	missense	0	exon1			CATGACTTTCCAA			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.50T>C	chrM.hg19:g.10809T>C	ENSP00000354961:p.Leu17Pro	20.0	0.0	.		37.0	5.0	.	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.	.	none		0.363	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
ANK2	287	hgsc.bcm.edu	37	4	114257900	114257915	+	Frame_Shift_Del	DEL	AGATGCACCAACCTTA	AGATGCACCAACCTTA	-			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	AGATGCACCAACCTTA	AGATGCACCAACCTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr4:114257900_114257915delAGATGCACCAACCTTA	ENST00000357077.4	+	31	3812_3827	c.3759_3774delAGATGCACCAACCTTA	c.(3757-3774)ggagatgcaccaaccttafs	p.GDAPTL1253fs	ANK2_ENST00000509550.1_Frame_Shift_Del_p.GDAPTL429fs|ANK2_ENST00000504887.1_3'UTR|ANK2_ENST00000506722.1_Frame_Shift_Del_p.GDAPTL1244fs|ANK2_ENST00000264366.6_Frame_Shift_Del_p.GDAPTL1220fs|ANK2_ENST00000394537.3_Frame_Shift_Del_p.GDAPTL1253fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1253	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D1254D(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTTTGGGGGAGATGCACCAACCTTAAGATTACTAT	0.38																																					p.1253_1258del		Atlas-Indel,Pindel	.											.	ANK2	576	.	1	Substitution - coding silent(1)	lung(1)	c.3758_3773del						PASS	.																																			SO:0001589	frameshift_variant	287	exon31			.	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3759_3774delAGATGCACCAACCTTA	chr4.hg19:g.114257900_114257915delAGATGCACCAACCTTA	ENSP00000349588:p.Gly1253fs	158.0	0.0	0		66.0	41.0	0.621212	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	ENST00000357077.4	hg19	CCDS3702.1																																																																																			.	.	.	none		0.380	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
BAP1	8314	hgsc.bcm.edu	37	3	52437709	52437709	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr3:52437709delG	ENST00000460680.1	-	13	1923	c.1452delC	c.(1450-1452)cccfs	p.P484fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.P466fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	188					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GGGTGGGTGAGGGCTGCGAGT	0.612			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.S485fs	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.1453delT						PASS	.						42.0	45.0	44.0					3																	52437709		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon13			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1452delC	chr3.hg19:g.52437709delG	ENSP00000417132:p.Pro484fs	74.0	0.0	0		44.0	36.0	0.818182	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.	.	none		0.612	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CFAP36	112942	hgsc.bcm.edu	37	2	55772097	55772138	+	In_Frame_Del	DEL	AGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	AGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	-	rs545373910|rs528334905		TCGA-G7-A8LD-01A-11D-A35Z-10	TCGA-G7-A8LD-10A-01D-A35Z-10	AGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	AGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	755a9884-f632-4260-bf9d-a84b5d86aa87	632fa524-d179-4f7e-9cbc-b57a32d1fb38	g.chr2:55772097_55772138delAGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	ENST00000349456.4	+	10	1130_1171	c.982_1023delAGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	c.(982-1023)aggagattgcttgcagagaaactcaaagaagaagttattaatdel	p.RRLLAEKLKEEVIN328del	CCDC104_ENST00000339012.3_In_Frame_Del_p.RRLLAEKLKEEVIN353del|CCDC104_ENST00000407816.3_In_Frame_Del_p.RRLLAEKLKEEVIN299del			Q96G28	CFA36_HUMAN		328								p.I340T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATTACTAAAGAGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAATAAGTAATAAT	0.293																																					p.327_341del		Atlas-Indel,Pindel	.											.	CCDC104	35	.	1	Substitution - Missense(1)	kidney(1)	c.981_1022del						PASS	.																																			SO:0001651	inframe_deletion	112942	exon10			.																												ENST00000349456.4:c.982_1023delAGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	chr2.hg19:g.55772097_55772138delAGGAGATTGCTTGCAGAGAAACTCAAAGAAGAAGTTATTAAT	ENSP00000295117:p.Arg328_Asn341del	750.0	0.0	0		541.0	78.0	0.144177	NM_080667	Q53SF0|Q53ST9|Q6UY34	In_Frame_Del	DEL	ENST00000349456.4	hg19	CCDS1854.2																																																																																			.	.	.	none		0.293	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319610.2		
