#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTHFR	4524	hgsc.bcm.edu	37	1	11854058	11854058	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr1:11854058A>G	ENST00000376592.1	-	8	1564	c.1436T>C	c.(1435-1437)aTc>aCc	p.I479T	MTHFR_ENST00000376585.1_Missense_Mutation_p.I520T|MTHFR_ENST00000376583.3_Missense_Mutation_p.I520T|MTHFR_ENST00000376590.3_Missense_Mutation_p.I479T			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	479					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	GATGGTGAGGATGCCCTGGCG	0.652																																					p.I479T		Atlas-SNP	.											.	MTHFR	65	.	0			c.T1436C						PASS	.						98.0	102.0	100.0					1																	11854058		2203	4300	6503	SO:0001583	missense	4524	exon9			GTGAGGATGCCCT	BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.1436T>C	chr1.hg19:g.11854058A>G	ENSP00000365777:p.Ile479Thr	38.0	0.0	.		57.0	50.0	.	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	ENST00000376592.1	hg19	CCDS137.1	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660655	0.67586	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	4.71	4.71	0.59529	.	0.162118	0.56097	D	0.000037	T	0.68860	0.3047	M	0.81497	2.545	0.54753	D	0.999986	B;P	0.43938	0.072;0.822	B;B	0.40477	0.09;0.33	T	0.75605	-0.3260	10	0.72032	D	0.01	.	13.3979	0.60865	1.0:0.0:0.0:0.0	.	479;520	P42898;Q5SNW6	MTHR_HUMAN;.	T	479;520;479;520	ENSP00000365777:I479T;ENSP00000365767:I520T;ENSP00000365775:I479T;ENSP00000365770:I520T	ENSP00000365767:I520T	I	-	2	0	MTHFR	11776645	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	8.832000	0.92079	1.771000	0.52183	0.379000	0.24179	ATC	.	.	.	none		0.652	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
GJB3	2707	hgsc.bcm.edu	37	1	35251060	35251060	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr1:35251060G>A	ENST00000373366.2	+	2	1312	c.697G>A	c.(697-699)Gcc>Acc	p.A233T	GJB3_ENST00000373362.3_Missense_Mutation_p.A233T|RP1-34M23.5_ENST00000542839.1_RNA	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	233					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CTCGTCCTCCGCCAGCCGAGC	0.632																																					p.A233T		Atlas-SNP	.											GJB3,NS,carcinoma,0,1	GJB3	40	.	0			c.G697A						PASS	.						31.0	31.0	31.0					1																	35251060		2202	4300	6502	SO:0001583	missense	2707	exon2			TCCTCCGCCAGCC	BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.697G>A	chr1.hg19:g.35251060G>A	ENSP00000362464:p.Ala233Thr	163.0	0.0	.		189.0	39.0	.	NM_001005752	B2R790|Q2TAZ8	Missense_Mutation	SNP	ENST00000373366.2	hg19	CCDS384.1	.	.	.	.	.	.	.	.	.	.	G	2.744	-0.261542	0.05791	.	.	ENSG00000188910	ENST00000373366;ENST00000373362;ENST00000543647	D;D	0.97752	-4.52;-4.52	5.03	-10.1	0.00402	.	2.095770	0.02337	N	0.074477	D	0.91009	0.7172	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	D	0.83820	0.0246	10	0.12430	T	0.62	.	10.795	0.46455	0.0789:0.0641:0.538:0.319	.	233	O75712	CXB3_HUMAN	T	233;233;217	ENSP00000362464:A233T;ENSP00000362460:A233T	ENSP00000362460:A233T	A	+	1	0	GJB3	35023647	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.581000	0.05820	-3.943000	0.00089	-2.233000	0.00290	GCC	.	.	.	none		0.632	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011559.1	NM_024009	
DNM3	26052	hgsc.bcm.edu	37	1	172017810	172017810	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr1:172017810A>C	ENST00000355305.5	+	10	1412	c.1255A>C	c.(1255-1257)Aag>Cag	p.K419Q	DNM3_ENST00000520906.1_Missense_Mutation_p.K419Q|DNM3_ENST00000367731.1_Missense_Mutation_p.K419Q|DNM3_ENST00000358155.4_Missense_Mutation_p.K419Q|DNM3_ENST00000367733.2_Missense_Mutation_p.K419Q			Q9UQ16	DYN3_HUMAN	dynamin 3	419					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACAGATTGTAAAGTTGAAAGG	0.368																																					p.K419Q		Atlas-SNP	.											.	DNM3	85	.	0			c.A1255C						PASS	.						119.0	116.0	117.0					1																	172017810		1868	4101	5969	SO:0001583	missense	26052	exon10			ATTGTAAAGTTGA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1255A>C	chr1.hg19:g.172017810A>C	ENSP00000347457:p.Lys419Gln	218.0	0.0	.		318.0	246.0	.	NM_001136127	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	hg19		.	.	.	.	.	.	.	.	.	.	A	21.2	4.107156	0.77096	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	L	0.58669	1.825	0.54753	D	0.999988	B;P;B;B	0.36712	0.04;0.566;0.389;0.04	B;B;B;B	0.35278	0.199;0.198;0.198;0.14	T	0.60974	-0.7156	10	0.37606	T	0.19	.	15.0317	0.71713	1.0:0.0:0.0:0.0	.	419;419;419;419	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	Q	419;419;419;419;419;419;309	ENSP00000350876:K419Q;ENSP00000356707:K419Q;ENSP00000347457:K419Q;ENSP00000356705:K419Q;ENSP00000429701:K419Q;ENSP00000429416:K309Q	ENSP00000347457:K419Q	K	+	1	0	DNM3	170284433	1.000000	0.71417	0.969000	0.41365	0.792000	0.44763	9.287000	0.95975	2.137000	0.66172	0.460000	0.39030	AAG	.	.	.	none		0.368	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
PNPT1	87178	hgsc.bcm.edu	37	2	55863466	55863466	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:55863466T>C	ENST00000447944.2	-	28	2344	c.2258A>G	c.(2257-2259)cAg>cGg	p.Q753R		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	753					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGCTGGCGACTGAAGCACTTT	0.403																																					p.Q753R		Atlas-SNP	.											.	PNPT1	68	.	0			c.A2258G						PASS	.						95.0	85.0	88.0					2																	55863466		2203	4300	6503	SO:0001583	missense	87178	exon28			GGCGACTGAAGCA	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.2258A>G	chr2.hg19:g.55863466T>C	ENSP00000400646:p.Gln753Arg	34.0	0.0	.		71.0	28.0	.	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	hg19	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.665121	0.88251	.	.	ENSG00000138035	ENST00000447944	T	0.58358	0.34	5.95	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.52306	0.1726	L	0.34521	1.04	0.58432	D	0.999995	D	0.53462	0.96	P	0.53146	0.719	T	0.47699	-0.9097	10	0.35671	T	0.21	-4.4849	12.5042	0.55972	0.1252:0.0:0.0:0.8748	.	753	Q8TCS8	PNPT1_HUMAN	R	753	ENSP00000400646:Q753R	ENSP00000393953:Q753R	Q	-	2	0	PNPT1	55716970	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.397000	0.79903	1.050000	0.40346	0.533000	0.62120	CAG	.	.	.	none		0.403	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
LONRF2	164832	hgsc.bcm.edu	37	2	100916274	100916274	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:100916274A>G	ENST00000393437.3	-	5	1811	c.1172T>C	c.(1171-1173)cTt>cCt	p.L391P	LONRF2_ENST00000409647.1_Missense_Mutation_p.L148P	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	391							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						TGCTGTTGGAAGGATGCTTTC	0.443																																					p.L391P		Atlas-SNP	.											.	LONRF2	62	.	0			c.T1172C						PASS	.						92.0	88.0	89.0					2																	100916274		2203	4300	6503	SO:0001583	missense	164832	exon5			GTTGGAAGGATGC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1172T>C	chr2.hg19:g.100916274A>G	ENSP00000377086:p.Leu391Pro	62.0	0.0	.		126.0	41.0	.	NM_198461	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	hg19	CCDS2046.2	.	.	.	.	.	.	.	.	.	.	A	14.83	2.651892	0.47362	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.86562	-2.01;-2.14	4.49	3.34	0.38264	.	0.158304	0.41938	D	0.000786	T	0.77356	0.4118	L	0.29908	0.895	0.28049	N	0.933432	B	0.11235	0.004	B	0.10450	0.005	T	0.65755	-0.6091	10	0.32370	T	0.25	-8.8817	8.0404	0.30519	0.9068:0.0:0.0932:0.0	.	391	Q1L5Z9	LONF2_HUMAN	P	391;148	ENSP00000377086:L391P;ENSP00000386823:L148P	ENSP00000377086:L391P	L	-	2	0	LONRF2	100282706	1.000000	0.71417	0.002000	0.10522	0.252000	0.25951	3.729000	0.54999	1.650000	0.50662	0.454000	0.30748	CTT	.	.	.	none		0.443	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
ZC3H6	376940	hgsc.bcm.edu	37	2	113074893	113074893	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:113074893C>G	ENST00000409871.1	+	7	1361	c.960C>G	c.(958-960)aaC>aaG	p.N320K	ZC3H6_ENST00000343936.4_Missense_Mutation_p.N320K	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	320							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						AAGGAGAGAACTGCATTTATA	0.289																																					p.N320K		Atlas-SNP	.											.	ZC3H6	93	.	0			c.C960G						PASS	.						33.0	33.0	33.0					2																	113074893		1790	4047	5837	SO:0001583	missense	376940	exon7			AGAGAACTGCATT	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.960C>G	chr2.hg19:g.113074893C>G	ENSP00000386764:p.Asn320Lys	317.0	0.0	.		522.0	184.0	.	NM_198581	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	hg19	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824573	0.50739	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.30714	1.52;1.52	5.44	3.24	0.37175	Zinc finger, CCCH-type (2);	0.049261	0.85682	D	0.000000	T	0.39517	0.1081	L	0.31526	0.94	0.53688	D	0.999975	D	0.76494	0.999	D	0.75484	0.986	T	0.15407	-1.0438	10	0.44086	T	0.13	-23.3467	11.1044	0.48194	0.0:0.8062:0.0:0.1938	.	320	P61129	ZC3H6_HUMAN	K	320;320;297	ENSP00000386764:N320K;ENSP00000340298:N320K	ENSP00000340298:N320K	N	+	3	2	ZC3H6	112791364	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.550000	0.23345	1.437000	0.47472	0.585000	0.79938	AAC	.	.	.	none		0.289	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
PAX8	7849	hgsc.bcm.edu	37	2	113999196	113999196	+	Missense_Mutation	SNP	C	C	T	rs199890664		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:113999196C>T	ENST00000429538.3	-	7	903	c.709G>A	c.(709-711)Gag>Aag	p.E237K	AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000445745.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.E237K|AC016683.6_ENST00000422956.2_RNA|AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000436293.2_RNA|PAX8_ENST00000397647.3_Missense_Mutation_p.E237K|PAX8_ENST00000263335.7_Missense_Mutation_p.E237K|PAX8_ENST00000348715.5_Missense_Mutation_p.E237K|AC016683.6_ENST00000456685.1_RNA|RP11-65I12.1_ENST00000553319.1_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000333145.5_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	237					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						AATGGGCACTCGAGCGGCTCG	0.632			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.E237K	Ovarian(188;7 2067 9084 29802 29892)	Atlas-SNP	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42	.	0			c.G709A						PASS	.																																			SO:0001583	missense	7849	exon7			GGCACTCGAGCGG	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.709G>A	chr2.hg19:g.113999196C>T	ENSP00000395498:p.Glu237Lys	52.0	0.0	.		53.0	15.0	.	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	hg19	CCDS46398.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.24|19.24	3.789645|3.789645	0.70337|0.70337	.|.	.|.	ENSG00000125618|ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334|ENST00000468980	D;D;D;D;D|.	0.98633|.	-5.03;-5.04;-4.84;-4.29;-4.84|.	4.69|4.69	4.69|4.69	0.59074|0.59074	.|.	0.293300|.	0.36444|.	N|.	0.002600|.	T|T	0.72309|0.72309	0.3444|0.3444	M|M	0.66939|0.66939	2.045|2.045	0.48395|0.48395	D|D	0.999641|0.999641	P;P;P;D;D|.	0.69078|.	0.89;0.948;0.804;0.995;0.997|.	B;B;B;P;P|.	0.60236|.	0.117;0.325;0.039;0.871;0.811|.	T|T	0.72431|0.72431	-0.4296|-0.4296	10|5	0.87932|.	D|.	0|.	.|.	15.4542|15.4542	0.75299|0.75299	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	237;237;237;237;237|.	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4|.	.;.;PAX8_HUMAN;.;.|.	K|Q	237|22	ENSP00000263335:E237K;ENSP00000380768:E237K;ENSP00000314750:E237K;ENSP00000395498:E237K;ENSP00000263334:E237K|.	ENSP00000263334:E237K|.	E|R	-|-	1|2	0|0	PAX8|PAX8	113715666|113715666	1.000000|1.000000	0.71417|0.71417	0.935000|0.935000	0.37517|0.37517	0.537000|0.537000	0.34900|0.34900	6.414000|6.414000	0.73318|0.73318	2.334000|2.334000	0.79466|0.79466	0.650000|0.650000	0.86243|0.86243	GAG|CGA	.	C|0.999;G|0.001	.	alt		0.632	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
LRP2	4036	hgsc.bcm.edu	37	2	169997040	169997040	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:169997040A>C	ENST00000263816.3	-	72	13409	c.13124T>G	c.(13123-13125)aTc>aGc	p.I4375S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4375					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGGCAGGTTGATAGGCAGTTC	0.542																																					p.I4375S		Atlas-SNP	.											.	LRP2	751	.	0			c.T13124G						PASS	.						56.0	52.0	53.0					2																	169997040		2203	4300	6503	SO:0001583	missense	4036	exon72			AGGTTGATAGGCA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13124T>G	chr2.hg19:g.169997040A>C	ENSP00000263816:p.Ile4375Ser	35.0	0.0	.		51.0	17.0	.	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	6.611	0.481057	0.12581	.	.	ENSG00000081479	ENST00000263816	D	0.89343	-2.5	5.92	3.55	0.40652	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.636134	0.17247	N	0.181326	T	0.65186	0.2667	N	0.03967	-0.31	0.23120	N	0.998262	P	0.40144	0.704	B	0.33521	0.165	T	0.61098	-0.7131	10	0.09084	T	0.74	.	1.7437	0.02958	0.5346:0.0:0.1786:0.2868	.	4375	P98164	LRP2_HUMAN	S	4375	ENSP00000263816:I4375S	ENSP00000263816:I4375S	I	-	2	0	LRP2	169705286	1.000000	0.71417	0.008000	0.14137	0.035000	0.12851	5.532000	0.67154	1.044000	0.40200	-0.333000	0.08304	ATC	.	.	.	none		0.542	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
HAT1	8520	hgsc.bcm.edu	37	2	172848147	172848147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:172848147G>T	ENST00000264108.4	+	11	1177	c.1141G>T	c.(1141-1143)Gaa>Taa	p.E381*	SLC25A12_ENST00000472748.1_Intron|HAT1_ENST00000392584.1_Nonsense_Mutation_p.E296*	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	381					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			CAGACCAGAAGAACTGACAAA	0.358																																					p.E381X		Atlas-SNP	.											.	HAT1	40	.	0			c.G1141T						PASS	.						106.0	104.0	105.0					2																	172848147		2203	4300	6503	SO:0001587	stop_gained	8520	exon11			CCAGAAGAACTGA	AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.1141G>T	chr2.hg19:g.172848147G>T	ENSP00000264108:p.Glu381*	277.0	0.0	.		383.0	153.0	.	NM_003642	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Nonsense_Mutation	SNP	ENST00000264108.4	hg19	CCDS2245.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014466	0.93404	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	5.94	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.6532	15.5425	0.76066	0.0671:0.0:0.9329:0.0	.	.	.	.	X	296;381	.	ENSP00000264108:E381X	E	+	1	0	HAT1	172556393	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.368000	0.79567	2.807000	0.96579	0.591000	0.81541	GAA	.	.	.	none		0.358	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255377.1	NM_003642	
NEUROD1	4760	hgsc.bcm.edu	37	2	182543486	182543486	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:182543486G>C	ENST00000295108.3	-	2	559	c.102C>G	c.(100-102)caC>caG	p.H34Q	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	34					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.H34H(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGTCTGCCTCGTGCTCCTCGT	0.587																																					p.H34Q		Atlas-SNP	.											NEUROD1,NS,carcinoma,0,1	NEUROD1	67	.	1	Substitution - coding silent(1)	lung(1)	c.C102G						PASS	.						109.0	85.0	93.0					2																	182543486		2203	4300	6503	SO:0001583	missense	4760	exon2			TGCCTCGTGCTCC	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.102C>G	chr2.hg19:g.182543486G>C	ENSP00000295108:p.His34Gln	59.0	0.0	.		76.0	30.0	.	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	hg19	CCDS2283.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735132	0.30774	.	.	ENSG00000162992	ENST00000295108	D	0.94793	-3.52	5.37	-0.584	0.11702	.	0.307024	0.26665	N	0.023123	D	0.84065	0.5390	N	0.08118	0	0.36683	D	0.879175	B	0.06786	0.001	B	0.01281	0.0	T	0.71600	-0.4544	10	0.23891	T	0.37	-0.3395	9.7906	0.40704	0.451:0.0:0.549:0.0	.	34	Q13562	NDF1_HUMAN	Q	34	ENSP00000295108:H34Q	ENSP00000295108:H34Q	H	-	3	2	NEUROD1	182251731	0.991000	0.36638	0.994000	0.49952	0.988000	0.76386	0.165000	0.16564	-0.062000	0.13088	-0.157000	0.13467	CAC	.	.	.	none		0.587	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
PHF7	51533	hgsc.bcm.edu	37	3	52443594	52443594	+	5'Flank	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:52443594T>C	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Missense_Mutation_p.Y33C|BAP1_ENST00000296288.5_Missense_Mutation_p.Y33C	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		CTGAAGGTCGTAGATCTCCTC	0.612																																					p.Y33C		Atlas-SNP	.											.	BAP1	371	.	0			c.A98G						PASS	.						220.0	229.0	226.0					3																	52443594		2203	4300	6503	SO:0001631	upstream_gene_variant	8314	exon3			AGGTCGTAGATCT	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		chr3.hg19:g.52443594T>C	Exception_encountered	106.0	0.0	.		111.0	5.0	.	NM_004656	K4DI82	Missense_Mutation	SNP	ENST00000327906.3	hg19	CCDS2854.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.803049	0.90623	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.53206	0.63;0.63	4.97	4.97	0.65823	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	T	0.73845	0.3639	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80434	-0.1384	10	0.72032	D	0.01	-1.7504	14.6644	0.68896	0.0:0.0:0.0:1.0	.	33	Q92560	BAP1_HUMAN	C	33	ENSP00000417132:Y33C;ENSP00000296288:Y33C	ENSP00000296288:Y33C	Y	-	2	0	BAP1	52418634	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.825000	0.86693	1.875000	0.54330	0.533000	0.62120	TAC	.	.	.	none		0.612	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351155.1	NM_016483	
TMEM45A	55076	hgsc.bcm.edu	37	3	100295846	100295846	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:100295846C>A	ENST00000323523.4	+	6	1125	c.812C>A	c.(811-813)tCa>tAa	p.S271*	TMEM45A_ENST00000403410.1_Nonsense_Mutation_p.S287*	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	271						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						GAACAAGAATCAGAAGAAGAA	0.368																																					p.S271X		Atlas-SNP	.											.	TMEM45A	35	.	0			c.C812A						PASS	.						99.0	106.0	104.0					3																	100295846		2203	4300	6503	SO:0001587	stop_gained	55076	exon6			AAGAATCAGAAGA	AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.812C>A	chr3.hg19:g.100295846C>A	ENSP00000319009:p.Ser271*	43.0	0.0	.		83.0	28.0	.	NM_018004	Q53YW5	Nonsense_Mutation	SNP	ENST00000323523.4	hg19	CCDS2937.1	.	.	.	.	.	.	.	.	.	.	C	41	8.585272	0.98875	.	.	ENSG00000181458	ENST00000323523;ENST00000403410	.	.	.	6.17	5.22	0.72569	.	0.287576	0.35179	N	0.003392	.	.	.	.	.	.	0.45161	D	0.998178	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-4.5576	12.3932	0.55370	0.0:0.9157:0.0:0.0843	.	.	.	.	X	271;287	.	ENSP00000319009:S271X	S	+	2	0	TMEM45A	101778536	0.993000	0.37304	1.000000	0.80357	0.901000	0.52897	2.320000	0.43797	1.463000	0.47967	0.655000	0.94253	TCA	.	.	.	none		0.368	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317571.1	NM_018004	
EPHB3	2049	hgsc.bcm.edu	37	3	184299386	184299386	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:184299386C>G	ENST00000330394.2	+	16	3425	c.2973C>G	c.(2971-2973)aaC>aaG	p.N991K	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	991					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TGCAGATGAACCAGACGCTGC	0.622																																					p.N991K		Atlas-SNP	.											.	EPHB3	114	.	0			c.C2973G						PASS	.						45.0	41.0	42.0					3																	184299386		2203	4300	6503	SO:0001583	missense	2049	exon16			GATGAACCAGACG	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2973C>G	chr3.hg19:g.184299386C>G	ENSP00000332118:p.Asn991Lys	106.0	0.0	.		129.0	53.0	.	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	hg19	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269452	0.40095	.	.	ENSG00000182580	ENST00000330394	T	0.06142	3.34	4.36	4.36	0.52297	Sterile alpha motif/pointed domain (2);	0.098712	0.64402	D	0.000002	T	0.04272	0.0118	L	0.37561	1.115	0.58432	D	0.999999	P	0.43094	0.799	B	0.33339	0.162	T	0.50440	-0.8828	10	0.12103	T	0.63	.	10.4826	0.44702	0.0:0.9084:0.0:0.0916	.	991	P54753	EPHB3_HUMAN	K	991	ENSP00000332118:N991K	ENSP00000332118:N991K	N	+	3	2	EPHB3	185782080	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.060000	0.57477	2.378000	0.81104	0.643000	0.83706	AAC	.	.	.	none		0.622	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
LMLN	89782	hgsc.bcm.edu	37	3	197726166	197726166	+	Silent	SNP	G	G	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:197726166G>A	ENST00000330198.4	+	11	1207	c.1185G>A	c.(1183-1185)caG>caA	p.Q395Q	LMLN_ENST00000332636.5_Silent_p.Q343Q|LMLN_ENST00000482695.1_Silent_p.Q343Q|LMLN_ENST00000420910.2_Silent_p.Q395Q	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	395					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CTCACACTCAGAATCGAGTAC	0.388																																					p.Q395Q		Atlas-SNP	.											.	LMLN	53	.	0			c.G1185A						PASS	.						103.0	98.0	100.0					3																	197726166		2203	4300	6503	SO:0001819	synonymous_variant	89782	exon11			CACTCAGAATCGA	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.1185G>A	chr3.hg19:g.197726166G>A		41.0	0.0	.		58.0	25.0	.	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Silent	SNP	ENST00000330198.4	hg19	CCDS3332.1																																																																																			.	.	.	none		0.388	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
POU4F2	5458	hgsc.bcm.edu	37	4	147560466	147560466	+	Silent	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr4:147560466C>T	ENST00000281321.3	+	1	422	c.174C>T	c.(172-174)ggC>ggT	p.G58G	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	58	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					gtggcggcggcggcggcggcg	0.761																																					p.G58G		Atlas-SNP	.											.	POU4F2	83	.	0			c.C174T						PASS	.						2.0	3.0	3.0					4																	147560466		1299	2806	4105	SO:0001819	synonymous_variant	5458	exon1			CGGCGGCGGCGGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.174C>T	chr4.hg19:g.147560466C>T		49.0	0.0	.		109.0	7.0	.	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.	.	none		0.761	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
POU4F2	5458	hgsc.bcm.edu	37	4	147560484	147560484	+	Silent	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr4:147560484C>A	ENST00000281321.3	+	1	440	c.192C>A	c.(190-192)ggC>ggA	p.G64G	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	64	Poly-Gly.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					gcggcggcggcggcggcggag	0.771																																					p.G64G		Atlas-SNP	.											.	POU4F2	83	.	0			c.C192A						PASS	.						3.0	5.0	5.0					4																	147560484		1329	2897	4226	SO:0001819	synonymous_variant	5458	exon1			CGGCGGCGGCGGC	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.192C>A	chr4.hg19:g.147560484C>A		63.0	0.0	.		116.0	6.0	.	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	ENST00000281321.3	hg19	CCDS34074.1																																																																																			.	.	.	none		0.771	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
NEK1	4750	hgsc.bcm.edu	37	4	170354709	170354709	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr4:170354709T>G	ENST00000439128.2	-	27	3428	c.2788A>C	c.(2788-2790)Aca>Cca	p.T930P	NEK1_ENST00000507142.1_Missense_Mutation_p.T958P|NEK1_ENST00000511633.1_Missense_Mutation_p.T914P|NEK1_ENST00000512193.1_Missense_Mutation_p.T861P|NEK1_ENST00000510533.1_Missense_Mutation_p.T886P	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	930					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GTTTCCTTTGTTTCTTTTTCC	0.333																																					p.T958P		Atlas-SNP	.											.	NEK1	203	.	0			c.A2872C						PASS	.						174.0	163.0	166.0					4																	170354709		1841	4090	5931	SO:0001583	missense	4750	exon29			CCTTTGTTTCTTT	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.2788A>C	chr4.hg19:g.170354709T>G	ENSP00000408020:p.Thr930Pro	121.0	0.0	.		215.0	74.0	.	NM_001199397	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	hg19	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	t	10.02	1.235909	0.22626	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.70045	-0.45;-0.43;-0.44;-0.43;-0.43	5.65	-8.11	0.01082	.	0.921323	0.09246	N	0.828579	T	0.45175	0.1329	N	0.22421	0.69	0.09310	N	1	B;B;B;P;B	0.40250	0.002;0.116;0.0;0.709;0.0	B;B;B;B;B	0.41299	0.004;0.124;0.001;0.353;0.0	T	0.46843	-0.9162	10	0.41790	T	0.15	.	6.4416	0.21853	0.0893:0.4493:0.0913:0.3701	.	861;914;958;886;930	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	P	930;914;886;958;861	ENSP00000408020:T930P;ENSP00000423332:T914P;ENSP00000427653:T886P;ENSP00000424757:T958P;ENSP00000424938:T861P	ENSP00000408020:T930P	T	-	1	0	NEK1	170591284	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.517000	0.06275	-1.416000	0.02019	-2.057000	0.00402	ACA	.	.	.	none		0.333	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3		
AGXT2	64902	hgsc.bcm.edu	37	5	35014199	35014199	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr5:35014199C>T	ENST00000231420.6	-	10	1189	c.989G>A	c.(988-990)gGc>gAc	p.G330D		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	330					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GAAGTGAGAGCCCAACCTTCC	0.517																																					p.G330D		Atlas-SNP	.											.	AGXT2	89	.	0			c.G989A						PASS	.						123.0	109.0	114.0					5																	35014199		2203	4300	6503	SO:0001583	missense	64902	exon10			TGAGAGCCCAACC	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.989G>A	chr5.hg19:g.35014199C>T	ENSP00000231420:p.Gly330Asp	163.0	0.0	.		183.0	73.0	.	NM_031900	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	ENST00000231420.6	hg19	CCDS3908.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952520	0.92660	.	.	ENSG00000113492	ENST00000231420	D	0.94330	-3.4	5.88	5.88	0.94601	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98532	0.9510	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99293	1.0899	10	0.87932	D	0	-19.6355	19.8216	0.96599	0.0:1.0:0.0:0.0	.	330	Q9BYV1	AGT2_HUMAN	D	330	ENSP00000231420:G330D	ENSP00000231420:G330D	G	-	2	0	AGXT2	35049956	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	7.110000	0.77069	2.769000	0.95229	0.655000	0.94253	GGC	.	.	.	none		0.517	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140718667	140718667	+	Silent	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr5:140718667C>G	ENST00000394576.2	+	1	129	c.129C>G	c.(127-129)tcC>tcG	p.S43S	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	43	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAGGCTCCTTCGTAGGCA	0.607											OREG0016854	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S43S		Atlas-SNP	.											.	PCDHGA2	205	.	0			c.C129G						PASS	.						73.0	74.0	74.0					5																	140718667		2203	4300	6503	SO:0001819	synonymous_variant	56113	exon1			AGGCTCCTTCGTA	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.129C>G	chr5.hg19:g.140718667C>G		72.0	0.0	.	1658	77.0	34.0	.	NM_018915	Q52LL6|Q9Y5D5	Silent	SNP	ENST00000394576.2	hg19	CCDS47289.1																																																																																			.	.	.	none		0.607	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
NR3C1	2908	hgsc.bcm.edu	37	5	142662143	142662143	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr5:142662143G>C	ENST00000343796.2	-	8	3164	c.2171C>G	c.(2170-2172)tCt>tGt	p.S724C	NR3C1_ENST00000424646.2_Missense_Mutation_p.S698C|NR3C1_ENST00000503201.1_Missense_Mutation_p.S724C|NR3C1_ENST00000394464.2_Missense_Mutation_p.S724C|NR3C1_ENST00000416954.2_Missense_Mutation_p.S327C|NR3C1_ENST00000504572.1_Missense_Mutation_p.S725C|NR3C1_ENST00000231509.3_Missense_Mutation_p.S725C|NR3C1_ENST00000415690.2_Missense_Mutation_p.S724C|NR3C1_ENST00000394466.2_Missense_Mutation_p.S725C	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	724	Interaction with CLOCK.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TTCATGCATAGAATCCAAGAG	0.393																																					p.S725C		Atlas-SNP	.											NR3C1_ENST00000415690,NS,carcinoma,0,2	NR3C1	124	.	0			c.C2174G						PASS	.						107.0	103.0	104.0					5																	142662143		2203	4300	6503	SO:0001583	missense	2908	exon8			TGCATAGAATCCA	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.2171C>G	chr5.hg19:g.142662143G>C	ENSP00000343205:p.Ser724Cys	77.0	0.0	.		93.0	37.0	.	NM_001024094	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	hg19	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611957	0.87258	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;D;D;D;D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19	5.77	5.77	0.91146	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.97999	0.9341	M	0.70595	2.14	0.80722	D	1	D;P;D	0.89917	1.0;0.728;1.0	D;P;D	0.91635	0.997;0.55;0.999	D	0.98227	1.0481	10	0.72032	D	0.01	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	724;724;725	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	C	724;724;540;724;698;725;725;725;327;724	ENSP00000377977:S724C;ENSP00000343205:S724C;ENSP00000387672:S724C;ENSP00000405282:S698C;ENSP00000422518:S725C;ENSP00000377979:S725C;ENSP00000231509:S725C;ENSP00000404218:S327C;ENSP00000427672:S724C	ENSP00000231509:S725C	S	-	2	0	NR3C1	142642336	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.814000	0.86154	2.885000	0.99019	0.655000	0.94253	TCT	.	.	.	none		0.393	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
CPEB4	80315	hgsc.bcm.edu	37	5	173372036	173372036	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr5:173372036A>G	ENST00000265085.5	+	5	2803	c.1349A>G	c.(1348-1350)cAt>cGt	p.H450R	CPEB4_ENST00000517880.1_Missense_Mutation_p.H43R|CPEB4_ENST00000520867.1_Missense_Mutation_p.H425R|CPEB4_ENST00000519835.1_Missense_Mutation_p.H425R|CPEB4_ENST00000522336.1_Missense_Mutation_p.H60R|CPEB4_ENST00000334035.5_Missense_Mutation_p.H433R|CPEB4_ENST00000519467.1_3'UTR	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	450					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAGCCTCTTCATAGTGGCCTG	0.483																																					p.H450R		Atlas-SNP	.											.	CPEB4	54	.	0			c.A1349G						PASS	.						185.0	167.0	173.0					5																	173372036		2203	4300	6503	SO:0001583	missense	80315	exon5			CTCTTCATAGTGG	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1349A>G	chr5.hg19:g.173372036A>G	ENSP00000265085:p.His450Arg	150.0	0.0	.		179.0	71.0	.	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	ENST00000265085.5	hg19	CCDS4390.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.62|10.62	1.401584|1.401584	0.25291|0.25291	.|.	.|.	ENSG00000113742|ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835;ENST00000522336;ENST00000517880|ENST00000519152	T;T;T;T|.	0.41400|.	1.0;1.02;1.01;1.02|.	5.37|5.37	4.18|4.18	0.49190|0.49190	Nucleotide-binding, alpha-beta plait (1);|.	0.218399|.	0.46758|.	D|.	0.000271|.	T|T	0.35393|0.35393	0.0930|0.0930	N|N	0.08118|0.08118	0|0	0.35285|0.35285	D|D	0.781681|0.781681	B;B;P;B;P|.	0.38565|.	0.033;0.099;0.484;0.037;0.637|.	B;B;B;B;B|.	0.42188|.	0.072;0.028;0.379;0.039;0.379|.	T|T	0.42172|0.42172	-0.9467|-0.9467	10|5	0.22706|.	T|.	0.39|.	-19.4622|-19.4622	12.5823|12.5823	0.56397|0.56397	0.8611:0.1389:0.0:0.0|0.8611:0.1389:0.0:0.0	.|.	425;433;425;60;450|.	B7ZLQ8;Q17RY0-2;E5RJM0;E5RFP2;Q17RY0|.	.;.;.;.;CPEB4_HUMAN|.	R|V	450;425;433;425;60;43|128	ENSP00000265085:H450R;ENSP00000429092:H425R;ENSP00000334533:H433R;ENSP00000429048:H425R|.	ENSP00000265085:H450R|.	H|I	+|+	2|1	0|0	CPEB4|CPEB4	173304642|173304642	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.975000|0.975000	0.68041|0.68041	3.862000|3.862000	0.56009|0.56009	0.960000|0.960000	0.38005|0.38005	0.533000|0.533000	0.62120|0.62120	CAT|ATA	.	.	.	none		0.483	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
OR2B2	81697	hgsc.bcm.edu	37	6	27879766	27879766	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr6:27879766T>C	ENST00000303324.2	-	1	408	c.332A>G	c.(331-333)gAa>gGa	p.E111G		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						GAGAAGACATTCTGTGGAACC	0.468																																					p.E111G		Atlas-SNP	.											.	OR2B2	54	.	0			c.A332G						PASS	.						111.0	100.0	104.0					6																	27879766		2203	4300	6503	SO:0001583	missense	81697	exon1			AGACATTCTGTGG	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.332A>G	chr6.hg19:g.27879766T>C	ENSP00000304419:p.Glu111Gly	107.0	0.0	.		134.0	54.0	.	NM_033057	B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	ENST00000303324.2	hg19	CCDS4641.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.666670	0.47677	.	.	ENSG00000168131	ENST00000303324	T	0.02197	4.4	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	U	0.001307	T	0.10508	0.0257	H	0.94582	3.555	0.26114	N	0.980642	D	0.89917	1.0	D	0.85130	0.997	T	0.12400	-1.0549	10	0.87932	D	0	.	12.4261	0.55548	0.0:0.0:0.0:1.0	.	111	Q9GZK3	OR2B2_HUMAN	G	111	ENSP00000304419:E111G	ENSP00000304419:E111G	E	-	2	0	OR2B2	27987745	0.997000	0.39634	0.998000	0.56505	0.225000	0.24961	4.535000	0.60629	1.965000	0.57142	0.460000	0.39030	GAA	.	.	.	none		0.468	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1		
DST	667	hgsc.bcm.edu	37	6	56489406	56489406	+	Silent	SNP	T	T	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr6:56489406T>G	ENST00000361203.3	-	32	4225	c.4218A>C	c.(4216-4218)cgA>cgC	p.R1406R	DST_ENST00000370765.6_Silent_p.R1080R|DST_ENST00000370769.4_Silent_p.R1406R|DST_ENST00000370754.5_Silent_p.R1584R|DST_ENST00000312431.6_Silent_p.R1406R|DST_ENST00000446842.2_Silent_p.R1080R|DST_ENST00000421834.2_Silent_p.R1406R|DST_ENST00000518935.1_Silent_p.R1080R|DST_ENST00000244364.6_Silent_p.R1080R|DST_ENST00000370788.2_Silent_p.R1406R			Q03001	DYST_HUMAN	dystonin	1406					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGGCAGTATATCGAGTCCTTA	0.363																																					p.R1080R		Atlas-SNP	.											.	DST	1427	.	0			c.A3240C						PASS	.						74.0	70.0	71.0					6																	56489406		2203	4300	6503	SO:0001819	synonymous_variant	667	exon22			AGTATATCGAGTC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4218A>C	chr6.hg19:g.56489406T>G		30.0	0.0	.		44.0	16.0	.	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	T	9.003	0.980520	0.18812	.	.	ENSG00000151914	ENST00000522360	.	.	.	5.1	-4.23	0.03789	.	.	.	.	.	T	0.06005	0.0156	.	.	.	.	.	.	.	.	.	.	.	.	T	0.33394	-0.9870	3	.	.	.	.	1.4079	0.02284	0.1521:0.2852:0.1726:0.3901	.	.	.	.	A	78	.	.	D	-	2	0	DST	56597365	0.033000	0.19621	0.550000	0.28217	0.932000	0.56968	-0.736000	0.04882	-0.663000	0.05331	-0.147000	0.13772	GAT	.	.	.	none		0.363	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
FILIP1	27145	hgsc.bcm.edu	37	6	76024129	76024129	+	Silent	SNP	G	G	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr6:76024129G>T	ENST00000237172.7	-	5	1749	c.1419C>A	c.(1417-1419)gtC>gtA	p.V473V	FILIP1_ENST00000393004.2_Silent_p.V473V|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Silent_p.V374V	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	473										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CTCGACTCTTGACCACCTCCA	0.368																																					p.V473V		Atlas-SNP	.											.	FILIP1	173	.	0			c.C1419A						PASS	.						121.0	124.0	123.0					6																	76024129		2203	4300	6503	SO:0001819	synonymous_variant	27145	exon5			ACTCTTGACCACC	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1419C>A	chr6.hg19:g.76024129G>T		43.0	0.0	.		73.0	4.0	.	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	ENST00000237172.7	hg19	CCDS4984.1																																																																																			.	.	.	none		0.368	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
FAM26F	441168	hgsc.bcm.edu	37	6	116784681	116784681	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr6:116784681T>A	ENST00000368605.1	+	3	856	c.761T>A	c.(760-762)aTg>aAg	p.M254K	RP1-93H18.6_ENST00000476099.1_RNA|FAM26F_ENST00000368606.3_Missense_Mutation_p.M82K	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	254					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		ACTCCAAGCATGAAAGAGTGG	0.388																																					p.I254N		Atlas-SNP	.											.	FAM26F	12	.	0			c.T761A						PASS	.						131.0	136.0	134.0					6																	116784681		2203	4300	6503	SO:0001583	missense	441168	exon3			CAAGCATGAAAGA	AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.761T>A	chr6.hg19:g.116784681T>A	ENSP00000357594:p.Met254Lys	150.0	0.0	.		202.0	78.0	.	NM_001010919	B9EJB0|Q5R3K4	Missense_Mutation	SNP	ENST00000368605.1	hg19	CCDS34519.1	.	.	.	.	.	.	.	.	.	.	T	6.714	0.500482	0.12822	.	.	ENSG00000188820	ENST00000368606;ENST00000368605;ENST00000368604	T;T;T	0.28255	1.63;2.67;1.62	5.11	-6.95	0.01628	.	1.784060	0.02516	N	0.092072	T	0.05044	0.0135	L	0.44542	1.39	0.09310	N	1	B	0.11235	0.004	B	0.15870	0.014	T	0.14559	-1.0468	10	0.05959	T	0.93	2.8695	2.4451	0.04504	0.2029:0.3659:0.2782:0.153	.	254	Q5R3K3	FA26F_HUMAN	K	82;254;97	ENSP00000357595:M82K;ENSP00000357594:M254K;ENSP00000357593:M97K	ENSP00000357593:M97K	M	+	2	0	FAM26F	116891374	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.008000	0.12788	-0.776000	0.04578	-1.117000	0.02048	ATG	.	.	.	none		0.388	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041946.1	NM_001010919	
SLC2A12	154091	hgsc.bcm.edu	37	6	134349788	134349788	+	Missense_Mutation	SNP	T	T	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr6:134349788T>A	ENST00000275230.5	-	2	1330	c.1175A>T	c.(1174-1176)tAt>tTt	p.Y392F		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	392					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TCCTGGTCCATAAATCACAGA	0.448																																					p.Y392F	Melanoma(122;1663 1672 14489 35294 41228)	Atlas-SNP	.											.	SLC2A12	43	.	0			c.A1175T						PASS	.						156.0	146.0	149.0					6																	134349788		2203	4300	6503	SO:0001583	missense	154091	exon2			GGTCCATAAATCA	AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.1175A>T	chr6.hg19:g.134349788T>A	ENSP00000275230:p.Tyr392Phe	89.0	0.0	.		137.0	49.0	.	NM_145176	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	hg19	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	T	0.512	-0.866146	0.02590	.	.	ENSG00000146411	ENST00000275230	T	0.78364	-1.17	5.18	1.14	0.20703	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	7739.210000	0.00166	N	0.000000	T	0.45637	0.1352	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.29274	-1.0017	10	0.11485	T	0.65	-1.6437	10.178	0.42950	0.3829:0.0:0.0:0.6171	.	392	Q8TD20	GTR12_HUMAN	F	392	ENSP00000275230:Y392F	ENSP00000275230:Y392F	Y	-	2	0	SLC2A12	134391481	0.096000	0.21769	0.009000	0.14445	0.007000	0.05969	2.836000	0.48183	-0.037000	0.13646	0.383000	0.25322	TAT	.	.	.	none		0.448	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
MUC17	140453	hgsc.bcm.edu	37	7	100683876	100683876	+	Missense_Mutation	SNP	T	T	G	rs145514577		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr7:100683876T>G	ENST00000306151.4	+	3	9243	c.9179T>G	c.(9178-9180)aTt>aGt	p.I3060S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3060	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCAGTGGCCATTCCTGAGGCT	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		25521	0.0		0.001	False		,,,				2504	0.0				p.I3060S		Atlas-SNP	.											MUC17,NS,carcinoma,0,1	MUC17	804	.	0			c.T9179G						PASS	.						275.0	283.0	280.0					7																	100683876		2203	4300	6503	SO:0001583	missense	140453	exon3			TGGCCATTCCTGA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9179T>G	chr7.hg19:g.100683876T>G	ENSP00000302716:p.Ile3060Ser	37.0	1.0	.		53.0	6.0	.	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	N	0.327	-0.958208	0.02267	.	.	ENSG00000169876	ENST00000306151	T	0.02197	4.4	0.814	-0.258	0.12975	.	.	.	.	.	T	0.00998	0.0033	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.48681	-0.9014	9	0.17369	T	0.5	.	3.7091	0.08413	0.0:0.5408:0.2591:0.2001	.	3060	Q685J3	MUC17_HUMAN	S	3060	ENSP00000302716:I3060S	ENSP00000302716:I3060S	I	+	2	0	MUC17	100470596	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.610000	0.00209	-0.661000	0.05345	-2.058000	0.00401	ATT	.	.	.	weak		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MET	4233	hgsc.bcm.edu	37	7	116423413	116423413	+	Missense_Mutation	SNP	T	T	C	rs121913247		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr7:116423413T>C	ENST00000318493.6	+	19	3929	c.3742T>C	c.(3742-3744)Tat>Cat	p.Y1248H	MET_ENST00000539704.1_Missense_Mutation_p.Y100H|MET_ENST00000397752.3_Missense_Mutation_p.Y1230H			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.Y1248H(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAGAGACATGTATGATAAAGA	0.388			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.Y1248H		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	MET,rectum,carcinoma,-2,1	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.T3742C	GRCh37	CM992180	MET	M	rs121913247	PASS	.						105.0	99.0	101.0					7																	116423413		1843	4095	5938	SO:0001583	missense	4233	exon19	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	GACATGTATGATA	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3742T>C	chr7.hg19:g.116423413T>C	ENSP00000317272:p.Tyr1248His	110.0	1.0	.		242.0	129.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.622544	0.66787	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	D;D;D	0.83075	-1.68;-1.68;-1.68	5.46	5.46	0.80206	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90075	0.6900	M	0.68593	2.085	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91155	0.4956	10	0.87932	D	0	.	15.824	0.78683	0.0:0.0:0.0:1.0	.	1248;1230	P08581-2;P08581	.;MET_HUMAN	H	1230;1248;100	ENSP00000380860:Y1230H;ENSP00000317272:Y1248H;ENSP00000445020:Y100H	ENSP00000317272:Y1248H	Y	+	1	0	MET	116210649	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.145000	0.71769	2.197000	0.70478	0.460000	0.39030	TAT	.	.	.	weak		0.388	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
SSMEM1	136263	hgsc.bcm.edu	37	7	129847790	129847790	+	Missense_Mutation	SNP	C	C	T	rs371191805		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr7:129847790C>T	ENST00000297819.3	+	1	91	c.40C>T	c.(40-42)Ccc>Tcc	p.P14S	TMEM209_ENST00000462753.1_5'Flank|TMEM209_ENST00000473456.1_5'Flank|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_5'Flank|TMEM209_ENST00000397622.2_5'Flank	NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	14						integral component of membrane (GO:0016021)											GGTAGATCCTCCCCCAATACC	0.418																																					p.P14S		Atlas-SNP	.											.	.	.	.	0			c.C40T						PASS	.						207.0	196.0	200.0					7																	129847790		2203	4300	6503	SO:0001583	missense	0	exon1			GATCCTCCCCCAA	AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.40C>T	chr7.hg19:g.129847790C>T	ENSP00000297819:p.Pro14Ser	103.0	0.0	.		228.0	127.0	.	NM_145268		Missense_Mutation	SNP	ENST00000297819.3	hg19	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194977	0.58017	.	.	ENSG00000165120	ENST00000297819	T	0.61859	0.07	5.54	3.74	0.42951	.	0.325431	0.27206	N	0.020435	T	0.62600	0.2441	M	0.67953	2.075	0.36756	D	0.883021	D	0.55605	0.972	P	0.51806	0.68	T	0.70004	-0.4991	10	0.87932	D	0	-5.1446	8.6789	0.34196	0.0:0.8244:0.0:0.1756	.	14	Q8WWF3	CG045_HUMAN	S	14	ENSP00000297819:P14S	ENSP00000297819:P14S	P	+	1	0	C7orf45	129635026	0.971000	0.33674	0.986000	0.45419	0.468000	0.32798	2.491000	0.45303	0.831000	0.34780	-0.136000	0.14681	CCC	.	.	.	weak		0.418	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268	
KEL	3792	hgsc.bcm.edu	37	7	142636835	142636835	+	IGR	SNP	G	G	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr7:142636835G>C	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Missense_Mutation_p.E64D	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GCCAGACAGAGAAAACGCCCT	0.547																																					p.E64D		Atlas-SNP	.											.	C7orf34	34	.	0			c.G192C						PASS	.						48.0	53.0	51.0					7																	142636835		2203	4300	6503	SO:0001628	intergenic_variant	135927	exon1			GACAGAGAAAACG	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		chr7.hg19:g.142636835G>C		94.0	0.0	.		170.0	84.0	.	NM_178829	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	hg19	CCDS34766.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.95|12.95	2.090470|2.090470	0.36855|0.36855	.|.	.|.	ENSG00000165131|ENSG00000165131	ENST00000409607|ENST00000458732	.|.	.|.	.|.	3.5|3.5	-3.57|-3.57	0.04612|0.04612	.|.	1.113020|1.113020	0.06947|0.06947	N|N	0.813873|0.813873	T|T	0.30386|0.30386	0.0763|0.0763	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	B|.	0.20550|.	0.046|.	B|.	0.18871|.	0.023|.	T|T	0.35126|0.35126	-0.9801|-0.9801	9|7	0.34782|0.46703	T|T	0.22|0.11	-5.1258|-5.1258	4.2209|4.2209	0.10558|0.10558	0.3996:0.332:0.2685:0.0|0.3996:0.332:0.2685:0.0	.|.	39|.	Q96L11|.	CG034_HUMAN|.	D|Q	64|70	.|.	ENSP00000386450:E64D|ENSP00000401055:E70Q	E|E	+|+	3|1	2|0	C7orf34|C7orf34	142346957|142346957	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-1.159000|-1.159000	0.03150|0.03150	-0.937000|-0.937000	0.03719|0.03719	-0.387000|-0.387000	0.06579|0.06579	GAG|GAA	.	.	.	none		0.547	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
TSPYL5	85453	hgsc.bcm.edu	37	8	98289181	98289181	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr8:98289181A>C	ENST00000322128.3	-	1	995	c.892T>G	c.(892-894)Ttc>Gtc	p.F298V		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	298					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)				cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					TTGCGATCGAAGTAGAACTTG	0.473																																					p.F298V		Atlas-SNP	.											.	TSPYL5	48	.	0			c.T892G						PASS	.						83.0	84.0	84.0					8																	98289181		2203	4300	6503	SO:0001583	missense	85453	exon1			GATCGAAGTAGAA	AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.892T>G	chr8.hg19:g.98289181A>C	ENSP00000322802:p.Phe298Val	90.0	0.0	.		153.0	51.0	.	NM_033512	B3KRF0|Q9C0B3	Missense_Mutation	SNP	ENST00000322128.3	hg19	CCDS34927.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590837	0.66219	.	.	ENSG00000180543	ENST00000322128	T	0.78364	-1.17	4.4	4.4	0.53042	.	0.000000	0.38492	N	0.001675	D	0.90232	0.6946	H	0.95224	3.64	0.58432	D	0.999994	D	0.76494	0.999	D	0.77557	0.99	D	0.91872	0.5508	10	0.87932	D	0	-13.9906	10.3132	0.43721	1.0:0.0:0.0:0.0	.	298	Q86VY4	TSYL5_HUMAN	V	298	ENSP00000322802:F298V	ENSP00000322802:F298V	F	-	1	0	TSPYL5	98358357	1.000000	0.71417	0.993000	0.49108	0.775000	0.43874	5.386000	0.66238	2.211000	0.71520	0.460000	0.39030	TTC	.	.	.	none		0.473	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512	
TG	7038	hgsc.bcm.edu	37	8	134024148	134024148	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr8:134024148T>C	ENST00000220616.4	+	36	6305	c.6265T>C	c.(6265-6267)Tct>Cct	p.S2089P	TG_ENST00000377869.1_Missense_Mutation_p.S2032P|TG_ENST00000519543.1_Missense_Mutation_p.S222P|TG_ENST00000522523.1_3'UTR|TG_ENST00000542445.1_Missense_Mutation_p.S459P	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2089					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TCTCCTAGTGTCTCTGGACTC	0.527																																					p.S2089P		Atlas-SNP	.											.	TG	416	.	0			c.T6265C						PASS	.						407.0	366.0	380.0					8																	134024148		2203	4300	6503	SO:0001583	missense	7038	exon36			CTAGTGTCTCTGG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6265T>C	chr8.hg19:g.134024148T>C	ENSP00000220616:p.Ser2089Pro	46.0	0.0	.		66.0	32.0	.	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.504|8.504	0.864979|0.864979	0.17250|0.17250	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178	T;T;T;T|T	0.68903|0.68331	-0.15;-0.15;-0.36;-0.34|-0.32	5.58|5.58	-7.76|-7.76	0.01232|0.01232	.|.	0.909678|.	0.09285|.	N|.	0.823146|.	T|T	0.41650|0.41650	0.1168|0.1168	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;P|.	0.51240|.	0.08;0.024;0.943|.	B;B;P|.	0.44477|.	0.017;0.018;0.451|.	T|T	0.32268|0.32268	-0.9913|-0.9913	10|7	0.62326|0.23891	D|T	0.03|0.37	.|.	2.7412|2.7412	0.05254|0.05254	0.1687:0.1507:0.4783:0.2023|0.1687:0.1507:0.4783:0.2023	.|.	222;459;2089|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	P|A	2032;895;2089;459;222|544	ENSP00000367100:S2032P;ENSP00000220616:S2089P;ENSP00000441693:S459P;ENSP00000430430:S222P|ENSP00000430523:V544A	ENSP00000220616:S2089P|ENSP00000430523:V544A	S|V	+|+	1|2	0|0	TG|TG	134093330|134093330	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.055000|0.055000	0.15305|0.15305	-0.975000|-0.975000	0.03790|0.03790	-1.298000|-1.298000	0.02348|0.02348	0.460000|0.460000	0.39030|0.39030	TCT|GTC	.	.	.	none		0.527	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
CIZ1	25792	hgsc.bcm.edu	37	9	130939947	130939947	+	Silent	SNP	G	G	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr9:130939947G>T	ENST00000393608.1	-	10	1918	c.1716C>A	c.(1714-1716)ccC>ccA	p.P572P	CIZ1_ENST00000277465.4_Silent_p.P544P|CIZ1_ENST00000541172.1_Silent_p.P471P|CIZ1_ENST00000372954.1_Silent_p.P492P|CIZ1_ENST00000538431.1_Silent_p.P572P|CIZ1_ENST00000476727.2_Intron|CIZ1_ENST00000372948.3_Silent_p.P516P|CIZ1_ENST00000325721.8_Silent_p.P543P|CIZ1_ENST00000372938.5_Silent_p.P572P|CIZ1_ENST00000357558.5_Silent_p.P544P	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	572					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						CGGAGTCACTGGGGCGGGGGA	0.642																																					p.P602P		Atlas-SNP	.											.	CIZ1	75	.	0			c.C1806A						PASS	.						22.0	21.0	21.0					9																	130939947		2199	4297	6496	SO:0001819	synonymous_variant	25792	exon10			GTCACTGGGGCGG	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.1716C>A	chr9.hg19:g.130939947G>T		52.0	0.0	.		57.0	26.0	.	NM_001257975	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Silent	SNP	ENST00000393608.1	hg19	CCDS6894.1																																																																																			.	.	.	none		0.642	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
PRKCQ	5588	hgsc.bcm.edu	37	10	6557092	6557092	+	Silent	SNP	C	C	T	rs201768145		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr10:6557092C>T	ENST00000263125.5	-	2	105	c.6G>A	c.(4-6)tcG>tcA	p.S2S	PRKCQ_ENST00000539722.1_5'UTR|PRKCQ_ENST00000397176.2_Silent_p.S2S	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	2					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	GAAGAAATGGCGACATGGTTG	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		19940	0.0		0.0	False		,,,				2504	0.001				p.S2S	Ovarian(50;572 1126 10530 25349 30594)	Atlas-SNP	.											.	PRKCQ	113	.	0			c.G6A						PASS	.						64.0	66.0	65.0					10																	6557092		2203	4300	6503	SO:0001819	synonymous_variant	5588	exon2			AAATGGCGACATG	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.6G>A	chr10.hg19:g.6557092C>T		52.0	0.0	.		80.0	22.0	.	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Silent	SNP	ENST00000263125.5	hg19	CCDS7079.1																																																																																			.	C|0.999;T|0.001	0.001	weak		0.478	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
MICU1	10367	hgsc.bcm.edu	37	10	74127978	74127978	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr10:74127978C>G	ENST00000361114.5	-	12	1502	c.1406G>C	c.(1405-1407)tGg>tCg	p.W469S	MICU1_ENST00000398763.4_Missense_Mutation_p.W271S|MICU1_ENST00000401998.3_Missense_Mutation_p.W469S|MICU1_ENST00000418483.2_Missense_Mutation_p.W271S|MICU1_ENST00000398761.4_Missense_Mutation_p.W471S	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	469					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										AGCGAAGTCCCAGGCAGTTTC	0.572																																					p.W469S		Atlas-SNP	.											.	.	.	.	0			c.G1406C						PASS	.						79.0	81.0	80.0					10																	74127978		1926	4143	6069	SO:0001583	missense	10367	exon12			AAGTCCCAGGCAG	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.1406G>C	chr10.hg19:g.74127978C>G	ENSP00000354415:p.Trp469Ser	56.0	0.0	.		86.0	39.0	.	NM_001195518	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Missense_Mutation	SNP	ENST00000361114.5	hg19	CCDS55715.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.496041	0.64186	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998;ENST00000418483;ENST00000398763	T;T;T;T;T	0.80738	-1.38;-1.41;-1.38;0.93;0.94	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.75451	0.3851	L	0.36672	1.1	0.80722	D	1	B;B;B	0.24882	0.074;0.074;0.113	B;B;B	0.17433	0.012;0.012;0.018	T	0.68800	-0.5313	10	0.38643	T	0.18	.	20.3312	0.98718	0.0:1.0:0.0:0.0	.	271;271;469	Q9BPX6-4;Q9BPX6-5;Q9BPX6	.;.;MICU1_HUMAN	S	469;471;469;271;271	ENSP00000354415:W469S;ENSP00000381745:W471S;ENSP00000384068:W469S;ENSP00000402470:W271S;ENSP00000381747:W271S	ENSP00000354415:W469S	W	-	2	0	MICU1	73797984	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	7.792000	0.85828	2.797000	0.96272	0.655000	0.94253	TGG	.	.	.	none		0.572	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
TSPAN14	81619	hgsc.bcm.edu	37	10	82264502	82264502	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr10:82264502C>A	ENST00000429989.3	+	3	323	c.100C>A	c.(100-102)Ctt>Att	p.L34I	TSPAN14_ENST00000341863.6_Missense_Mutation_p.L34I|TSPAN14_ENST00000481124.1_Intron|TSPAN14_ENST00000372156.1_Missense_Mutation_p.L34I|TSPAN14_ENST00000372164.3_Intron|TSPAN14_ENST00000372158.1_Missense_Mutation_p.L34I	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14	34					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			AGTTGTCTTCCTTGGAGTCGG	0.512																																					p.L34I		Atlas-SNP	.											.	TSPAN14	29	.	0			c.C100A						PASS	.						210.0	176.0	188.0					10																	82264502		2203	4300	6503	SO:0001583	missense	81619	exon3			GTCTTCCTTGGAG	AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.100C>A	chr10.hg19:g.82264502C>A	ENSP00000396270:p.Leu34Ile	108.0	0.0	.		128.0	51.0	.	NM_030927	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	Missense_Mutation	SNP	ENST00000429989.3	hg19	CCDS7369.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118747	0.56505	.	.	ENSG00000108219	ENST00000429989;ENST00000372160;ENST00000372158;ENST00000341863;ENST00000372156	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.54	5.54	0.83059	.	0.056707	0.64402	D	0.000002	T	0.67590	0.2909	N	0.12569	0.235	0.54753	D	0.999986	B	0.14438	0.01	B	0.31245	0.126	T	0.63233	-0.6683	10	0.36615	T	0.2	-19.5088	10.4111	0.44294	0.0:0.9117:0.0:0.0883	.	34	Q8NG11	TSN14_HUMAN	I	34	ENSP00000396270:L34I;ENSP00000361231:L34I;ENSP00000344076:L34I;ENSP00000361229:L34I	ENSP00000344076:L34I	L	+	1	0	TSPAN14	82254482	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	2.970000	0.49240	2.623000	0.88846	0.561000	0.74099	CTT	.	.	.	none		0.512	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049081.2	NM_030927	
TCERG1L	256536	hgsc.bcm.edu	37	10	132896657	132896657	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr10:132896657T>G	ENST00000368642.4	-	11	1601	c.1516A>C	c.(1516-1518)Aaa>Caa	p.K506Q	RP11-462G8.3_ENST00000436942.1_RNA	NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	506										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TATTCTTCTTTTATTCTTGTC	0.328																																					p.K506Q		Atlas-SNP	.											.	TCERG1L	91	.	0			c.A1516C						PASS	.						61.0	52.0	55.0					10																	132896657		2132	4211	6343	SO:0001583	missense	256536	exon11			CTTCTTTTATTCT	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1516A>C	chr10.hg19:g.132896657T>G	ENSP00000357631:p.Lys506Gln	26.0	0.0	.		23.0	7.0	.	NM_174937	Q5VWI2|Q86XM8	Missense_Mutation	SNP	ENST00000368642.4	hg19	CCDS7662.2	.	.	.	.	.	.	.	.	.	.	T	14.93	2.683146	0.47991	.	.	ENSG00000176769	ENST00000368642	T	0.24723	1.84	4.71	4.71	0.59529	FF domain (2);	0.155083	0.40144	N	0.001180	T	0.23611	0.0571	L	0.33137	0.985	0.39116	D	0.961576	P	0.48764	0.915	B	0.44315	0.446	T	0.05370	-1.0889	10	0.49607	T	0.09	-6.5535	13.0047	0.58696	0.0:0.0:0.0:1.0	.	506	Q5VWI1	TCRGL_HUMAN	Q	506	ENSP00000357631:K506Q	ENSP00000357631:K506Q	K	-	1	0	TCERG1L	132786647	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.703000	0.54808	1.755000	0.51935	0.383000	0.25322	AAA	.	.	.	none		0.328	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091619.2	NM_174937	
PIDD1	55367	hgsc.bcm.edu	37	11	801091	801091	+	Silent	SNP	G	G	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:801091G>A	ENST00000347755.5	-	10	1801	c.1660C>T	c.(1660-1662)Ctg>Ttg	p.L554L	PIDD_ENST00000411829.2_Silent_p.L554L|PIDD_ENST00000534649.1_5'Flank	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CAGTACAACAGGTGCAGGCGG	0.662																																					p.L554L		Atlas-SNP	.											.	PIDD	76	.	0			c.C1660T						PASS	.						29.0	23.0	25.0					11																	801091		2184	4289	6473	SO:0001819	synonymous_variant	55367	exon10			ACAACAGGTGCAG																												ENST00000347755.5:c.1660C>T	chr11.hg19:g.801091G>A		99.0	0.0	.		127.0	51.0	.	NM_145887		Silent	SNP	ENST00000347755.5	hg19	CCDS7716.1																																																																																			.	.	.	none		0.662	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
CDKN1C	1028	hgsc.bcm.edu	37	11	2906711	2906711	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:2906711G>T	ENST00000414822.3	-	1	400	c.9C>A	c.(7-9)gaC>gaA	p.D3E	CDKN1C_ENST00000313407.6_Intron|CDKN1C_ENST00000430149.2_Missense_Mutation_p.D3E|CDKN1C_ENST00000380725.1_Intron|CDKN1C_ENST00000440480.2_Intron	NM_000076.2	NP_000067.1	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C (p57, Kip2)	3					adrenal gland development (GO:0030325)|aging (GO:0007568)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|digestive system development (GO:0055123)|embryonic placenta morphogenesis (GO:0060669)|genetic imprinting (GO:0071514)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|myeloid cell differentiation (GO:0030099)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of kinase activity (GO:0033673)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|skeletal system development (GO:0001501)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)			central_nervous_system(1)|lung(1)	2		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAGGGACGCGTCGGACATGG	0.692																																					p.D3E	GBM(111;59 1151 2497 5746 16112 18241 29216)	Atlas-SNP	.											.	CDKN1C	4	.	0			c.C9A						PASS	.						10.0	9.0	9.0					11																	2906711		2081	4104	6185	SO:0001583	missense	1028	exon1			GGACGCGTCGGAC	D64137	CCDS7738.1, CCDS44519.1	11p15.5	2014-09-17	2004-02-13		ENSG00000129757	ENSG00000129757			1786	protein-coding gene	gene with protein product		600856	"""Beckwith-Wiedemann syndrome"""	BWCR, BWS		7729684	Standard	NM_000076		Approved	P57, KIP2	uc001lws.4	P49918	OTTHUMG00000010040	ENST00000414822.3:c.9C>A	chr11.hg19:g.2906711G>T	ENSP00000413720:p.Asp3Glu	145.0	0.0	.		158.0	62.0	.	NM_000076		Missense_Mutation	SNP	ENST00000414822.3	hg19	CCDS7738.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160155	0.57368	.	.	ENSG00000129757	ENST00000414822;ENST00000430149	D;D	0.90900	-2.75;-2.75	2.34	1.37	0.22104	.	.	.	.	.	T	0.80839	0.4700	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	B	0.42625	0.393	T	0.77595	-0.2529	9	0.72032	D	0.01	.	8.4056	0.32612	0.1313:0.0:0.8687:0.0	.	3	P49918	CDN1C_HUMAN	E	3	ENSP00000413720:D3E;ENSP00000411552:D3E	ENSP00000413720:D3E	D	-	3	2	CDKN1C	2863287	1.000000	0.71417	0.820000	0.32676	0.754000	0.42855	3.513000	0.53414	0.317000	0.23160	0.305000	0.20034	GAC	.	.	.	none		0.692	CDKN1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027774.2	NM_000076	
NLRP14	338323	hgsc.bcm.edu	37	11	7063888	7063888	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:7063888A>C	ENST00000299481.4	+	4	977	c.631A>C	c.(631-633)Aag>Cag	p.K211Q		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	211	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCAGAGGTTTAAGTATGTTTT	0.468																																					p.K211Q		Atlas-SNP	.											.	NLRP14	187	.	0			c.A631C						PASS	.						86.0	89.0	88.0					11																	7063888		2201	4296	6497	SO:0001583	missense	338323	exon4			AGGTTTAAGTATG	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.631A>C	chr11.hg19:g.7063888A>C	ENSP00000299481:p.Lys211Gln	157.0	0.0	.		244.0	87.0	.	NM_176822	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	hg19	CCDS7776.1	.	.	.	.	.	.	.	.	.	.	A	6.311	0.425450	0.11987	.	.	ENSG00000158077	ENST00000299481	T	0.81078	-1.45	4.47	-6.77	0.01727	NACHT nucleoside triphosphatase (1);	3.128170	0.00879	N	0.002112	T	0.63616	0.2526	N	0.11023	0.085	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.54221	-0.8326	10	0.35671	T	0.21	.	11.4429	0.50107	0.1819:0.0:0.6906:0.1275	.	211	Q86W24	NAL14_HUMAN	Q	211	ENSP00000299481:K211Q	ENSP00000299481:K211Q	K	+	1	0	NLRP14	7020464	0.000000	0.05858	0.000000	0.03702	0.201000	0.24016	-0.397000	0.07269	-1.362000	0.02166	-0.417000	0.06048	AAG	.	.	.	none		0.468	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
SYT13	57586	hgsc.bcm.edu	37	11	45277403	45277403	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:45277403C>T	ENST00000020926.3	-	2	334	c.223G>A	c.(223-225)Gcc>Acc	p.A75T	CTD-2560E9.5_ENST00000531663.1_RNA|CTD-2560E9.5_ENST00000534342.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	75					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						TTGAGGAGGGCACGGGGCTGA	0.512																																					p.A75T		Atlas-SNP	.											.	SYT13	45	.	0			c.G223A						PASS	.						92.0	93.0	93.0					11																	45277403		2203	4299	6502	SO:0001583	missense	57586	exon2			GGAGGGCACGGGG	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.223G>A	chr11.hg19:g.45277403C>T	ENSP00000020926:p.Ala75Thr	99.0	0.0	.		143.0	45.0	.	NM_020826	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	hg19	CCDS31470.1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583492	0.28268	.	.	ENSG00000019505	ENST00000020926	T	0.07800	3.16	5.42	1.33	0.21861	.	0.374613	0.26542	N	0.023790	T	0.04634	0.0126	N	0.19112	0.55	0.18873	N	0.999988	B	0.14805	0.011	B	0.12837	0.008	T	0.40136	-0.9579	10	0.28530	T	0.3	.	5.7553	0.18170	0.0:0.5127:0.2665:0.2209	.	75	Q7L8C5	SYT13_HUMAN	T	75	ENSP00000020926:A75T	ENSP00000020926:A75T	A	-	1	0	SYT13	45233979	0.000000	0.05858	0.284000	0.24805	0.331000	0.28603	-0.652000	0.05366	0.051000	0.15978	-0.258000	0.10820	GCC	.	.	.	none		0.512	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826	
GDF3	9573	hgsc.bcm.edu	37	12	7842823	7842823	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:7842823C>G	ENST00000329913.3	-	2	793	c.746G>C	c.(745-747)aGg>aCg	p.R249T		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	249					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GGCTGCTCTCCTTTTCCGAGA	0.537																																					p.R249T		Atlas-SNP	.											.	GDF3	68	.	0			c.G746C						PASS	.						96.0	87.0	90.0					12																	7842823		2203	4300	6503	SO:0001583	missense	9573	exon2			GCTCTCCTTTTCC	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.746G>C	chr12.hg19:g.7842823C>G	ENSP00000331745:p.Arg249Thr	122.0	0.0	.		151.0	61.0	.	NM_020634	Q8NEJ4	Missense_Mutation	SNP	ENST00000329913.3	hg19	CCDS8581.1	.	.	.	.	.	.	.	.	.	.	C	9.046	0.990771	0.18966	.	.	ENSG00000184344	ENST00000329913	D	0.85171	-1.95	4.61	4.61	0.57282	Transforming growth factor-beta, C-terminal (1);	0.240498	0.47852	D	0.000210	D	0.91875	0.7428	M	0.90705	3.14	0.45366	D	0.998357	D	0.62365	0.991	D	0.63957	0.92	D	0.92487	0.5997	10	0.72032	D	0.01	.	9.051	0.36376	0.0:0.8988:0.0:0.1012	.	249	Q9NR23	GDF3_HUMAN	T	249	ENSP00000331745:R249T	ENSP00000331745:R249T	R	-	2	0	GDF3	7734090	0.177000	0.23109	0.988000	0.46212	0.114000	0.19823	0.441000	0.21611	2.285000	0.76669	0.561000	0.74099	AGG	.	.	.	none		0.537	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1		
OVCH1	341350	hgsc.bcm.edu	37	12	29608320	29608321	+	Missense_Mutation	DNP	GT	GT	CC			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:29608320_29608321GT>CC	ENST00000318184.5	-	20	2297_2298	c.2298_2299AC>GG	c.(2296-2301)ccACta>ccGGta	p.L767V	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	767	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CTACATACTAGTGGCCCACCAG	0.455																																					p.L767V|p.P766P		Atlas-SNP	.											.	OVCH1	195	.	0			c.C2299G|c.A2298G						PASS	.																																			SO:0001583	missense	341350	exon20			ATACTAGTGGCCC|TACTAGTGGCCCA	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2298_2299delinsCC	chr12.hg19:g.29608320_29608321delinsCC	ENSP00000326708:p.Leu767Val	247.0|243.0	0.0	.		339.0|335.0	123.0|121.0	.	NM_183378		Missense_Mutation|Silent	SNP	ENST00000318184.5	hg19																																																																																				.	.	.	none		0.455	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
IPO8	10526	hgsc.bcm.edu	37	12	30792659	30792659	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:30792659A>C	ENST00000256079.4	-	21	2617	c.2279T>G	c.(2278-2280)cTc>cGc	p.L760R	IPO8_ENST00000544829.1_Missense_Mutation_p.L555R	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	760					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTGAACGAAGAGTGGAATGCA	0.403																																					p.L760R		Atlas-SNP	.											.	IPO8	105	.	0			c.T2279G						PASS	.						84.0	80.0	81.0					12																	30792659		2203	4300	6503	SO:0001583	missense	10526	exon21			ACGAAGAGTGGAA	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2279T>G	chr12.hg19:g.30792659A>C	ENSP00000256079:p.Leu760Arg	55.0	0.0	.		87.0	41.0	.	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	hg19	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.052055	0.36181	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.66638	-0.22;-0.22	5.27	4.12	0.48240	Armadillo-like helical (1);Armadillo-type fold (1);	0.064281	0.64402	D	0.000005	T	0.73148	0.3550	L	0.52573	1.65	0.80722	D	1	P;D;B	0.89917	0.629;1.0;0.212	B;D;B	0.91635	0.411;0.999;0.15	T	0.67776	-0.5583	10	0.15952	T	0.53	-8.69	10.8138	0.46562	0.9249:0.0:0.0751:0.0	.	555;236;760	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	R	760;236;555	ENSP00000256079:L760R;ENSP00000444520:L555R	ENSP00000256079:L760R	L	-	2	0	IPO8	30683926	1.000000	0.71417	0.849000	0.33467	0.980000	0.70556	8.966000	0.93397	0.842000	0.35045	0.460000	0.39030	CTC	.	.	.	none		0.403	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
SLC2A13	114134	hgsc.bcm.edu	37	12	40158612	40158612	+	Nonsense_Mutation	SNP	G	G	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:40158612G>C	ENST00000280871.4	-	8	1544	c.1494C>G	c.(1492-1494)taC>taG	p.Y498*		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	498					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				GGCAGAAATTGTAAGCCCAAA	0.343										HNSCC(50;0.14)																											p.Y498X		Atlas-SNP	.											.	SLC2A13	91	.	0			c.C1494G						PASS	.						130.0	147.0	141.0					12																	40158612		2203	4300	6503	SO:0001587	stop_gained	114134	exon8			GAAATTGTAAGCC	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1494C>G	chr12.hg19:g.40158612G>C	ENSP00000280871:p.Tyr498*	91.0	0.0	.		136.0	40.0	.	NM_052885	Q17S07	Nonsense_Mutation	SNP	ENST00000280871.4	hg19	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	G	33	5.203671	0.95033	.	.	ENSG00000151229	ENST00000280871	.	.	.	5.12	1.25	0.21368	.	0.355074	0.30028	N	0.010593	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.089	8.9456	0.35756	0.5097:0.0:0.4903:0.0	.	.	.	.	X	498	.	ENSP00000280871:Y498X	Y	-	3	2	SLC2A13	38444879	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.673000	0.37534	0.197000	0.20387	-0.157000	0.13467	TAC	.	.	.	none		0.343	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
KMT2D	8085	hgsc.bcm.edu	37	12	49434397	49434397	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:49434397G>C	ENST00000301067.7	-	31	7155	c.7156C>G	c.(7156-7158)Cgg>Ggg	p.R2386G		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2386	Poly-Pro.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GGTTGGGGCCGAGGAGTCAAT	0.642																																					p.R2386G		Atlas-SNP	.											MLL2_ENST00000301067,NS,carcinoma,0,2	MLL2	1173	.	0			c.C7156G						PASS	.						22.0	27.0	25.0					12																	49434397		2046	4195	6241	SO:0001583	missense	8085	exon31			GGGGCCGAGGAGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7156C>G	chr12.hg19:g.49434397G>C	ENSP00000301067:p.Arg2386Gly	147.0	0.0	.		199.0	73.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	4.200	0.035884	0.08148	.	.	ENSG00000167548	ENST00000301067	D	0.84146	-1.81	5.21	3.18	0.36537	.	0.000000	0.34338	N	0.004047	D	0.85822	0.5786	L	0.48642	1.525	0.29050	N	0.884552	D	0.69078	0.997	P	0.54815	0.761	T	0.82159	-0.0595	10	0.87932	D	0	.	12.3552	0.55171	0.0:0.0:0.6054:0.3946	.	2386	O14686	MLL2_HUMAN	G	2386	ENSP00000301067:R2386G	ENSP00000301067:R2386G	R	-	1	2	MLL2	47720664	0.998000	0.40836	1.000000	0.80357	0.529000	0.34654	1.401000	0.34589	1.276000	0.44395	0.591000	0.81541	CGG	.	.	.	none		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
LRIG3	121227	hgsc.bcm.edu	37	12	59271539	59271539	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:59271539T>C	ENST00000320743.3	-	15	2465	c.2179A>G	c.(2179-2181)Aaa>Gaa	p.K727E	LRIG3_ENST00000379141.4_Missense_Mutation_p.K667E	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	727	Ig-like C2-type 3.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CAGTTCAGTTTAGGGGGAGGG	0.493			T	ROS1	NSCLC																																p.K727E		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.A2179G						PASS	.						114.0	111.0	112.0					12																	59271539		2203	4300	6503	SO:0001583	missense	121227	exon15			TCAGTTTAGGGGG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.2179A>G	chr12.hg19:g.59271539T>C	ENSP00000326759:p.Lys727Glu	56.0	0.0	.		90.0	42.0	.	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	T	9.226	1.034489	0.19590	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.65732	-0.17;-0.17	5.59	1.51	0.23008	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37715	N	0.001969	T	0.41558	0.1164	N	0.05554	-0.025	0.09310	N	1	B;B	0.23735	0.007;0.09	B;B	0.31442	0.038;0.13	T	0.28004	-1.0057	9	.	.	.	.	14.1036	0.65072	0.0:0.0:0.5152:0.4848	.	667;727	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	E	667;727	ENSP00000368436:K667E;ENSP00000326759:K727E	.	K	-	1	0	LRIG3	57557806	0.002000	0.14202	0.001000	0.08648	0.212000	0.24457	1.189000	0.32114	0.431000	0.26258	0.533000	0.62120	AAA	.	.	.	none		0.493	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
NAV3	89795	hgsc.bcm.edu	37	12	78400770	78400770	+	Silent	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:78400770C>A	ENST00000397909.2	+	8	1625	c.1452C>A	c.(1450-1452)gtC>gtA	p.V484V	NAV3_ENST00000536525.2_Silent_p.V484V|NAV3_ENST00000266692.7_Silent_p.V484V|NAV3_ENST00000228327.6_Silent_p.V484V			Q8IVL0	NAV3_HUMAN	neuron navigator 3	484						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AAAAACCAGTCAAAGAAGAGA	0.408										HNSCC(70;0.22)																											p.V484V		Atlas-SNP	.											.	NAV3	506	.	0			c.C1452A						PASS	.						72.0	71.0	71.0					12																	78400770		1859	4097	5956	SO:0001819	synonymous_variant	89795	exon8			ACCAGTCAAAGAA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1452C>A	chr12.hg19:g.78400770C>A		170.0	0.0	.		292.0	109.0	.	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	hg19																																																																																				.	.	.	none		0.408	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
PTPRQ	374462	hgsc.bcm.edu	37	12	80982096	80982096	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:80982096T>C	ENST00000266688.5	+	31	4462	c.4462T>C	c.(4462-4464)Tat>Cat	p.Y1488H	RP11-272K23.3_ENST00000550634.1_RNA			Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1534	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TCAATACCTCTATGAAGCTCA	0.363																																					p.Y1320H		Atlas-SNP	.											.	PTPRQ	119	.	0			c.T3958C						PASS	.						104.0	89.0	94.0					12																	80982096		692	1591	2283	SO:0001583	missense	374462	exon23			TACCTCTATGAAG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4462T>C	chr12.hg19:g.80982096T>C	ENSP00000266688:p.Tyr1488His	121.0	0.0	.		160.0	61.0	.	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.	.	.	.	.	.	.	.	.	.	T	8.385	0.838324	0.16891	.	.	ENSG00000139304	ENST00000266688	T	0.56776	0.44	5.35	5.35	0.76521	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54398	0.1856	.	.	.	0.33208	D	0.553024	P	0.48589	0.912	P	0.51487	0.671	T	0.59695	-0.7406	8	0.17832	T	0.49	.	14.821	0.70074	0.0:0.0:0.0:1.0	.	1534	Q9UMZ3	PTPRQ_HUMAN	H	1488	ENSP00000266688:Y1488H	ENSP00000266688:Y1488H	Y	+	1	0	PTPRQ	79506227	0.925000	0.31364	0.991000	0.47740	0.320000	0.28249	1.476000	0.35420	2.159000	0.67721	0.533000	0.62120	TAT	.	.	.	none		0.363	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
SALL2	6297	hgsc.bcm.edu	37	14	21993091	21993091	+	Silent	SNP	G	G	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr14:21993091G>A	ENST00000327430.3	-	2	1065	c.771C>T	c.(769-771)tcC>tcT	p.S257S	SALL2_ENST00000317492.5_Intron|AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Intron|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	257	Poly-Ser.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		aggaggaggaggaagaTGCCA	0.582																																					p.S257S		Atlas-SNP	.											.	SALL2	95	.	0			c.C771T						PASS	.						48.0	47.0	48.0					14																	21993091		2203	4300	6503	SO:0001819	synonymous_variant	6297	exon2			GGAGGAGGAAGAT	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.771C>T	chr14.hg19:g.21993091G>A		67.0	0.0	.		99.0	4.0	.	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Silent	SNP	ENST00000327430.3	hg19	CCDS32045.1																																																																																			.	.	.	none		0.582	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
RHBDL1	9028	hgsc.bcm.edu	37	16	726998	726998	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr16:726998C>T	ENST00000219551.2	+	3	676	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	LA16c-313D11.9_ENST00000567091.1_RNA|RHBDL1_ENST00000352681.3_Missense_Mutation_p.R152C|LA16c-313D11.9_ENST00000571933.1_RNA			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	217					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				TTACGGGGCCCGCCTCAACAA	0.682																																					p.R217C		Atlas-SNP	.											.	RHBDL1	14	.	0			c.C649T						PASS	.						63.0	67.0	66.0					16																	726998		2201	4298	6499	SO:0001583	missense	9028	exon3			GGGGCCCGCCTCA	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.649C>T	chr16.hg19:g.726998C>T	ENSP00000219551:p.Arg217Cys	84.0	0.0	.		99.0	46.0	.	NM_003961	A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	hg19	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.859017	0.32884	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.33216	1.46;1.42	3.99	3.99	0.46301	.	0.143249	0.42964	D	0.000631	T	0.22399	0.0540	N	0.08118	0	0.46981	D	0.999279	D;D;D	0.61080	0.989;0.977;0.958	P;B;P	0.50617	0.54;0.439;0.646	T	0.05099	-1.0906	10	0.56958	D	0.05	-18.8892	10.2818	0.43543	0.1975:0.8025:0.0:0.0	.	152;217;152	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	C	152;152;217	ENSP00000344206:R152C;ENSP00000219551:R217C	ENSP00000219551:R217C	R	+	1	0	RHBDL1	666999	0.811000	0.29063	0.683000	0.30040	0.029000	0.11900	1.737000	0.38197	2.062000	0.61559	0.557000	0.71058	CGC	.	.	.	none		0.682	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961	
GSG2	83903	hgsc.bcm.edu	37	17	3629517	3629517	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:3629517A>G	ENST00000325418.4	+	1	2307	c.2288A>G	c.(2287-2289)aAc>aGc	p.N763S	ITGAE_ENST00000571185.1_Intron|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	763	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										ACTAAATGTAACACTCCTGCC	0.443																																					p.N763S		Atlas-SNP	.											.	GSG2	48	.	0			c.A2288G						PASS	.						60.0	59.0	59.0					17																	3629517		2203	4300	6503	SO:0001583	missense	83903	exon1			AATGTAACACTCC	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.2288A>G	chr17.hg19:g.3629517A>G	ENSP00000325290:p.Asn763Ser	99.0	0.0	.		172.0	100.0	.	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	hg19	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	A	7.407	0.633968	0.14322	.	.	ENSG00000177602	ENST00000325418	T	0.05649	3.41	5.51	0.132	0.14762	Domain of unknown function DUF3635 (1);Protein kinase, catalytic domain (1);	0.858738	0.10326	N	0.688158	T	0.04048	0.0113	N	0.16708	0.43	0.09310	N	1	B	0.21452	0.056	B	0.12837	0.008	T	0.40869	-0.9540	10	0.87932	D	0	-5.7401	5.8033	0.18426	0.3914:0.428:0.1806:0.0	.	763	Q8TF76	HASP_HUMAN	S	763	ENSP00000325290:N763S	ENSP00000325290:N763S	N	+	2	0	GSG2	3576266	0.000000	0.05858	0.010000	0.14722	0.907000	0.53573	-0.231000	0.09069	0.131000	0.18576	0.533000	0.62120	AAC	.	.	.	none		0.443	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
DHX33	56919	hgsc.bcm.edu	37	17	5354241	5354241	+	Silent	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:5354241C>T	ENST00000225296.3	-	9	1610	c.1410G>A	c.(1408-1410)gcG>gcA	p.A470A	DHX33_ENST00000433302.3_Silent_p.A246A	NM_001199699.1|NM_020162.3	NP_001186628.1|NP_064547.2	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	470					positive regulation of transcription from RNA polymerase I promoter (GO:0045943)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|rDNA binding (GO:0000182)			breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						GGGCAATGGCCGCCTGAATGT	0.428																																					p.A470A		Atlas-SNP	.											.	DHX33	41	.	0			c.G1410A						PASS	.						124.0	119.0	120.0					17																	5354241		2203	4300	6503	SO:0001819	synonymous_variant	56919	exon9			AATGGCCGCCTGA	AL359945	CCDS11072.1	17p13	2003-06-13	2003-06-13	2003-06-13	ENSG00000005100	ENSG00000005100		"""DEAH-boxes"""	16718	protein-coding gene	gene with protein product		614405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33"""	DDX33			Standard	NM_020162		Approved	FLJ21972, DKFZp762F2011	uc002gca.3	Q9H6R0	OTTHUMG00000102041	ENST00000225296.3:c.1410G>A	chr17.hg19:g.5354241C>T		117.0	0.0	.		195.0	43.0	.	NM_020162	B4DHF9|Q4G149|Q5CZ73|Q9H5M9	Silent	SNP	ENST00000225296.3	hg19	CCDS11072.1																																																																																			.	.	.	none		0.428	DHX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219826.2	NM_020162	
ALOX12	239	hgsc.bcm.edu	37	17	6909258	6909258	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:6909258C>A	ENST00000251535.6	+	10	1383	c.1330C>A	c.(1330-1332)Cct>Act	p.P444T	AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399540.2_Intron|AC027763.2_ENST00000574377.1_Intron|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000573939.1_Intron|RP11-589P10.7_ENST00000572547.1_RNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	444	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CCTCTGTCCTCCTGACGACCT	0.617																																					p.P444T		Atlas-SNP	.											.	ALOX12	49	.	0			c.C1330A						PASS	.						71.0	69.0	70.0					17																	6909258		2203	4300	6503	SO:0001583	missense	239	exon10			TGTCCTCCTGACG	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1330C>A	chr17.hg19:g.6909258C>A	ENSP00000251535:p.Pro444Thr	30.0	0.0	.		66.0	16.0	.	NM_000697	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	hg19	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064434	0.76187	.	.	ENSG00000108839	ENST00000251535	D	0.89681	-2.55	5.3	5.3	0.74995	Lipoxygenase, C-terminal (3);	0.359698	0.28382	N	0.015542	D	0.94892	0.8349	M	0.91920	3.255	0.42564	D	0.993152	P	0.52842	0.956	P	0.59115	0.852	D	0.95770	0.8808	10	0.87932	D	0	-1.9879	16.4972	0.84248	0.0:1.0:0.0:0.0	.	444	P18054	LOX12_HUMAN	T	444	ENSP00000251535:P444T	ENSP00000251535:P444T	P	+	1	0	ALOX12	6849982	0.298000	0.24417	1.000000	0.80357	0.973000	0.67179	4.613000	0.61176	2.763000	0.94921	0.585000	0.79938	CCT	.	.	.	none		0.617	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
CISD3	284106	hgsc.bcm.edu	37	17	36889563	36889563	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:36889563C>T	ENST00000439660.2	+	4	363	c.239C>T	c.(238-240)aCt>aTt	p.T80I	RNA5SP440_ENST00000363245.1_RNA|CISD3_ENST00000578573.1_3'UTR	NM_001136498.1	NP_001129970.1	P0C7P0	CISD3_HUMAN	CDGSH iron sulfur domain 3	80						mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)			endometrium(2)	2						TTCCAACGCACTGGCCTATCT	0.627																																					p.T80I		Atlas-SNP	.											.	CISD3	12	.	0			c.C239T						PASS	.						63.0	52.0	56.0					17																	36889563		692	1591	2283	SO:0001583	missense	284106	exon4			AACGCACTGGCCT	AK097047	CCDS45662.1	17q12	2007-08-10				ENSG00000277972		"""CDGSH iron sulfur domain containing"""	27578	protein-coding gene	gene with protein product	"""mitoNEET related 2"""	611933				17376863, 17584744	Standard	NM_001136498		Approved	Miner2	uc010wds.1	P0C7P0		ENST00000439660.2:c.239C>T	chr17.hg19:g.36889563C>T	ENSP00000391402:p.Thr80Ile	62.0	0.0	.		108.0	55.0	.	NM_001136498		Missense_Mutation	SNP	ENST00000439660.2	hg19	CCDS45662.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005525	0.74932	.	.	ENSG00000230055	ENST00000439660	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	T	0.74959	0.3785	M	0.69358	2.11	0.39676	D	0.970821	D	0.76494	0.999	D	0.69824	0.966	T	0.72561	-0.4256	8	0.24483	T	0.36	-3.6503	14.6884	0.69065	0.0:1.0:0.0:0.0	.	80	P0C7P0	CISD3_HUMAN	I	80	.	ENSP00000391402:T80I	T	+	2	0	CISD3	34143089	0.672000	0.27530	1.000000	0.80357	0.961000	0.63080	2.466000	0.45084	2.527000	0.85204	0.455000	0.32223	ACT	.	.	.	none		0.627	CISD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441921.1		
MPP2	4355	hgsc.bcm.edu	37	17	41960406	41960406	+	Silent	SNP	C	C	G	rs553317360		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:41960406C>G	ENST00000461854.1	-	6	475	c.390G>C	c.(388-390)acG>acC	p.T130T	MPP2_ENST00000377184.3_Silent_p.T123T|MPP2_ENST00000473246.1_5'UTR|MPP2_ENST00000520305.1_5'UTR|MPP2_ENST00000536246.1_Silent_p.T95T|MPP2_ENST00000518766.1_Silent_p.T151T|MPP2_ENST00000269095.4_Silent_p.T106T|MPP2_ENST00000523501.1_Silent_p.T95T			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	130	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CAGAGTCGTGCGTCTCCAGGA	0.622													c|||	1	0.000199681	0.0	0.0	5008	,	,		14588	0.0		0.0	False		,,,				2504	0.001				p.T106T		Atlas-SNP	.											.	MPP2	67	.	0			c.G318C						PASS	.						30.0	28.0	29.0					17																	41960406		2203	4300	6503	SO:0001819	synonymous_variant	4355	exon5			GTCGTGCGTCTCC		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.390G>C	chr17.hg19:g.41960406C>G		59.0	0.0	.		122.0	13.0	.	NM_005374	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	ENST00000461854.1	hg19																																																																																				.	.	.	none		0.622	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374	
SCRN2	90507	hgsc.bcm.edu	37	17	45915920	45915920	+	Silent	SNP	A	A	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:45915920A>G	ENST00000290216.9	-	6	1040	c.915T>C	c.(913-915)ctT>ctC	p.L305L	SCRN2_ENST00000407215.3_Silent_p.L305L|SCRN2_ENST00000584123.1_Silent_p.L313L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	305						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						GCGTGGCGGTAAGAAAGTGCA	0.597																																					p.L305L		Atlas-SNP	.											.	SCRN2	35	.	0			c.T915C						PASS	.						97.0	97.0	97.0					17																	45915920		2203	4300	6503	SO:0001819	synonymous_variant	90507	exon6			GGCGGTAAGAAAG	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.915T>C	chr17.hg19:g.45915920A>G		76.0	0.0	.		121.0	35.0	.	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	hg19	CCDS11519.1																																																																																			.	.	.	none		0.597	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
ESCO1	114799	hgsc.bcm.edu	37	18	19112541	19112541	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr18:19112541C>A	ENST00000269214.5	-	11	3205	c.2268G>T	c.(2266-2268)tgG>tgT	p.W756C		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	756					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TTGAGCAGCACCAGGCTTTTT	0.433																																					p.W756C		Atlas-SNP	.											.	ESCO1	89	.	0			c.G2268T						PASS	.						156.0	148.0	151.0					18																	19112541		2203	4300	6503	SO:0001583	missense	114799	exon11			GCAGCACCAGGCT	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.2268G>T	chr18.hg19:g.19112541C>A	ENSP00000269214:p.Trp756Cys	79.0	0.0	.		105.0	41.0	.	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	hg19	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158408	0.78114	.	.	ENSG00000141446	ENST00000269214	T	0.60920	0.15	5.73	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.75664	0.3880	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76564	-0.2913	10	0.40728	T	0.16	-3.2526	16.7742	0.85546	0.0:0.8709:0.1291:0.0	.	756	Q5FWF5	ESCO1_HUMAN	C	756	ENSP00000269214:W756C	ENSP00000269214:W756C	W	-	3	0	ESCO1	17366539	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	1.409000	0.46915	-0.176000	0.13171	TGG	.	.	.	none		0.433	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
VAV1	7409	hgsc.bcm.edu	37	19	6821672	6821672	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr19:6821672G>A	ENST00000602142.1	+	3	443	c.361G>A	c.(361-363)Gcc>Acc	p.A121T	VAV1_ENST00000596764.1_Missense_Mutation_p.A121T|VAV1_ENST00000599806.1_Missense_Mutation_p.A66T|VAV1_ENST00000539284.1_Missense_Mutation_p.A56T|VAV1_ENST00000304076.2_Missense_Mutation_p.A121T	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	121					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GACCCCGATCGCCCAGAACAG	0.632																																					p.A121T		Atlas-SNP	.											VAV1,caecum,carcinoma,0,2	VAV1	140	.	0			c.G361A						PASS	.						85.0	74.0	78.0					19																	6821672		2203	4300	6503	SO:0001583	missense	7409	exon3			CCGATCGCCCAGA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.361G>A	chr19.hg19:g.6821672G>A	ENSP00000472929:p.Ala121Thr	80.0	1.0	.		127.0	43.0	.	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	hg19	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189377	0.78789	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.61274	0.12;0.12	4.34	4.34	0.51931	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	L	0.60845	1.875	0.54753	D	0.999986	D;D;D;P	0.89917	1.0;1.0;0.972;0.917	D;D;P;P	0.87578	0.998;0.997;0.691;0.486	T	0.73418	-0.3989	10	0.54805	T	0.06	.	14.377	0.66884	0.0:0.0:1.0:0.0	.	56;121;66;121	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	T	121;56	ENSP00000302269:A121T;ENSP00000443242:A56T	ENSP00000302269:A121T	A	+	1	0	VAV1	6772672	1.000000	0.71417	0.939000	0.37840	0.766000	0.43426	5.226000	0.65299	2.256000	0.74724	0.561000	0.74099	GCC	.	.	.	none		0.632	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
MUC16	94025	hgsc.bcm.edu	37	19	8961960	8961960	+	Missense_Mutation	SNP	C	C	T	rs200653636		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr19:8961960C>T	ENST00000397910.4	-	83	43620	c.43417G>A	c.(43417-43419)Ggt>Agt	p.G14473S	MUC16_ENST00000380951.5_Missense_Mutation_p.G1114S	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	22118	SEA 16. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACCAGGACACCGCAGATCAGG	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14224	0.0		0.0	False		,,,				2504	0.0				p.G14473S		Atlas-SNP	.											.	MUC16	4315	.	0			c.G43417A						PASS	.	T	SER/GLY	8,3914		0,8,1953	64.0	62.0	62.0		43417	1.3	0.0	19		62	1,8319		0,1,4159	yes	missense	MUC16	NM_024690.2	56	0,9,6112	TT,TC,CC		0.012,0.204,0.0735	probably-damaging	14473/14508	8961960	9,12233	1961	4160	6121	SO:0001583	missense	94025	exon83			GGACACCGCAGAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.43417G>A	chr19.hg19:g.8961960C>T	ENSP00000381008:p.Gly14473Ser	119.0	0.0	.		166.0	49.0	.	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	4.878	0.163110	0.09287	0.00204	1.2E-4	ENSG00000181143	ENST00000397910;ENST00000380951	T	0.01745	4.66	4.6	1.3	0.21679	.	.	.	.	.	T	0.01254	0.0041	N	0.14661	0.345	.	.	.	P;D	0.62365	0.645;0.991	B;P	0.44732	0.077;0.459	T	0.49735	-0.8908	8	0.13853	T	0.58	.	5.8157	0.18492	0.5313:0.3158:0.0:0.1529	.	22118;14473	Q8WXI7;B5ME49	MUC16_HUMAN;.	S	14473;1114	ENSP00000381008:G14473S	ENSP00000370338:G1114S	G	-	1	0	MUC16	8822960	0.824000	0.29247	0.012000	0.15200	0.002000	0.02628	1.549000	0.36212	0.064000	0.16427	-1.203000	0.01651	GGT	.	.	.	weak		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
DPF1	8193	hgsc.bcm.edu	37	19	38704380	38704380	+	Silent	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr19:38704380T>C	ENST00000420980.2	-	9	890	c.864A>G	c.(862-864)ttA>ttG	p.L288L	DPF1_ENST00000416611.1_Silent_p.L306L|DPF1_ENST00000414789.1_Silent_p.L250L|DPF1_ENST00000456296.1_Silent_p.L306L|DPF1_ENST00000355526.4_Silent_p.L332L|DPF1_ENST00000412732.1_Silent_p.L250L	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	288					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCGTGAATTGTAAACACGAGG	0.637																																					p.L332L		Atlas-SNP	.											.	DPF1	54	.	0			c.A996G						PASS	.						51.0	47.0	48.0					19																	38704380		2203	4300	6503	SO:0001819	synonymous_variant	8193	exon10			GAATTGTAAACAC	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.864A>G	chr19.hg19:g.38704380T>C		127.0	0.0	.		152.0	58.0	.	NM_001135155	B3KSY8|Q08AJ0	Silent	SNP	ENST00000420980.2	hg19	CCDS33008.2	.	.	.	.	.	.	.	.	.	.	T	9.663	1.144758	0.21288	.	.	ENSG00000011332	ENST00000355526	.	.	.	4.04	1.9	0.25705	.	.	.	.	.	T	0.51176	0.1659	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35724	-0.9777	4	.	.	.	0.8287	4.4001	0.11383	0.0:0.1899:0.1719:0.6382	.	.	.	.	A	325	.	.	T	-	1	0	DPF1	43396220	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	1.619000	0.36965	0.135000	0.18707	0.369000	0.22263	ACA	.	.	.	none		0.637	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347721.1		
CACNG8	59283	hgsc.bcm.edu	37	19	54485656	54485656	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr19:54485656C>G	ENST00000270458.2	+	4	934	c.831C>G	c.(829-831)agC>agG	p.S277R	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	277	Gly-rich.				calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CCCGCTCTAGCTCCCGCTCCA	0.766																																					p.S277R		Atlas-SNP	.											.	CACNG8	29	.	0			c.C831G						PASS	.						1.0	2.0	2.0					19																	54485656		1151	2686	3837	SO:0001583	missense	59283	exon4			CTCTAGCTCCCGC	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.831C>G	chr19.hg19:g.54485656C>G	ENSP00000270458:p.Ser277Arg	19.0	0.0	.		22.0	7.0	.	NM_031895	Q9BXT0|Q9BY23	Missense_Mutation	SNP	ENST00000270458.2	hg19	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	.	16.54	3.152958	0.57259	.	.	ENSG00000142408	ENST00000270458	T	0.53206	0.63	2.34	2.34	0.29019	.	0.139963	0.43110	U	0.000614	T	0.51873	0.1700	M	0.66297	2.02	0.33300	D	0.564723	D	0.59357	0.985	P	0.54889	0.763	T	0.61068	-0.7137	9	0.42905	T	0.14	.	5.3399	0.15979	0.0:0.8181:0.0:0.1819	.	277	Q8WXS5	CCG8_HUMAN	R	277	ENSP00000270458:S277R	ENSP00000270458:S277R	S	+	3	2	CACNG8	59177468	0.976000	0.34144	0.998000	0.56505	0.938000	0.57974	0.117000	0.15583	0.998000	0.38996	0.281000	0.19383	AGC	.	.	.	none		0.766	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3		
ZNF582	147948	hgsc.bcm.edu	37	19	56896344	56896344	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr19:56896344C>G	ENST00000301310.4	-	5	600	c.442G>C	c.(442-444)Gaa>Caa	p.E148Q	ZNF582_ENST00000586929.1_Missense_Mutation_p.E148Q|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		GTGGGCATTTCTTCATGTCTG	0.373																																					p.E148Q	Ovarian(183;1887 2032 4349 30507 51343)	Atlas-SNP	.											.	ZNF582	56	.	0			c.G442C						PASS	.						150.0	148.0	149.0					19																	56896344		2203	4300	6503	SO:0001583	missense	147948	exon5			GCATTTCTTCATG	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.442G>C	chr19.hg19:g.56896344C>G	ENSP00000301310:p.Glu148Gln	65.0	0.0	.		86.0	38.0	.	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	hg19	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.741982	0.49151	.	.	ENSG00000018869	ENST00000301310	T	0.06218	3.33	4.23	0.936	0.19488	.	0.214881	0.23477	N	0.047757	T	0.03053	0.0090	L	0.28054	0.825	0.09310	N	1	P;P	0.44877	0.845;0.845	B;B	0.36719	0.169;0.231	T	0.43653	-0.9378	10	0.15499	T	0.54	.	4.4024	0.11393	0.1595:0.5801:0.0:0.2603	.	148;179	Q96NG8;B4DQZ9	ZN582_HUMAN;.	Q	148	ENSP00000301310:E148Q	ENSP00000301310:E148Q	E	-	1	0	ZNF582	61588156	0.668000	0.27493	0.003000	0.11579	0.259000	0.26198	0.385000	0.20685	0.318000	0.23185	-0.282000	0.10007	GAA	.	.	.	none		0.373	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
ABHD12	26090	hgsc.bcm.edu	37	20	25282895	25282895	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr20:25282895T>C	ENST00000339157.5	-	12	1389	c.1117A>G	c.(1117-1119)Aaa>Gaa	p.K373E	ABHD12_ENST00000376542.3_Missense_Mutation_p.K373E	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	373					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						TAAATGTATTTGTGCCTGTAG	0.537																																					p.K373E		Atlas-SNP	.											.	ABHD12	46	.	0			c.A1117G						PASS	.						132.0	118.0	122.0					20																	25282895		2203	4300	6503	SO:0001583	missense	26090	exon12			TGTATTTGTGCCT	AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.1117A>G	chr20.hg19:g.25282895T>C	ENSP00000341408:p.Lys373Glu	70.0	0.0	.		90.0	38.0	.	NM_001042472	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	ENST00000339157.5	hg19	CCDS42857.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.416495	0.83449	.	.	ENSG00000100997	ENST00000376542;ENST00000339157;ENST00000526543	T;T	0.19938	2.11;2.11	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.75264	2.295	0.80722	D	1	P;D;D	0.71674	0.745;0.996;0.998	P;P;D	0.63283	0.475;0.82;0.913	T	0.26121	-1.0112	10	0.30854	T	0.27	-20.5607	14.6085	0.68498	0.0:0.0:0.0:1.0	.	335;373;373	Q8N2K0-3;Q8N2K0;Q8N2K0-2	.;ABD12_HUMAN;.	E	373;373;335	ENSP00000365725:K373E;ENSP00000341408:K373E	ENSP00000341408:K373E	K	-	1	0	ABHD12	25230895	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.218000	0.77991	2.116000	0.64780	0.459000	0.35465	AAA	.	.	.	none		0.537	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078423.2	NM_015600	
C22orf29	79680	hgsc.bcm.edu	37	22	19839753	19839753	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr22:19839753G>T	ENST00000405640.1	-	2	700	c.32C>A	c.(31-33)cCt>cAt	p.P11H	GNB1L_ENST00000329517.6_Intron|C22orf29_ENST00000407472.1_Missense_Mutation_p.P11H|GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000460402.1_Intron|C22orf29_ENST00000484072.1_Intron|C22orf29_ENST00000328554.4_Missense_Mutation_p.P11H|GNB1L_ENST00000403325.1_Intron			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	11					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)				NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					GGGAATGCGAGGGCCCTGCTG	0.637																																					p.P11H		Atlas-SNP	.											.	C22orf29	23	.	0			c.C32A						PASS	.						55.0	55.0	55.0					22																	19839753		2203	4298	6501	SO:0001583	missense	79680	exon3			ATGCGAGGGCCCT	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.32C>A	chr22.hg19:g.19839753G>T	ENSP00000384924:p.Pro11His	85.0	0.0	.		106.0	34.0	.	NM_024627	A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Missense_Mutation	SNP	ENST00000405640.1	hg19	CCDS13769.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291328	0.40494	.	.	ENSG00000215012	ENST00000407472;ENST00000328554;ENST00000405640;ENST00000416337	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	3.69	3.69	0.42338	.	.	.	.	.	T	0.33323	0.0859	N	0.08118	0	0.23221	N	0.998095	D	0.89917	1.0	D	0.72625	0.978	T	0.18745	-1.0327	9	0.72032	D	0.01	-8.3753	11.2466	0.49000	0.0:0.0:1.0:0.0	.	11	Q7L3V2	CV029_HUMAN	H	11	ENSP00000386111:P11H;ENSP00000330596:P11H;ENSP00000384924:P11H;ENSP00000392994:P11H	ENSP00000330596:P11H	P	-	2	0	C22orf29	18219753	0.103000	0.21917	0.544000	0.28141	0.013000	0.08279	0.397000	0.20883	2.358000	0.79984	0.655000	0.94253	CCT	.	.	.	none		0.637	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317290.2	NM_024627	
SSTR3	6753	hgsc.bcm.edu	37	22	37603060	37603060	+	Silent	SNP	G	G	T	rs144127697		TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr22:37603060G>T	ENST00000328544.3	-	2	1316	c.783C>A	c.(781-783)gcC>gcA	p.A261A	SSTR3_ENST00000402501.1_Silent_p.A261A	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	261					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCGCCACCACGGCCACCACCA	0.672																																					p.A261A		Atlas-SNP	.											.	SSTR3	42	.	0			c.C783A						PASS	.						70.0	57.0	61.0					22																	37603060		2203	4300	6503	SO:0001819	synonymous_variant	6753	exon2			CACCACGGCCACC		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.783C>A	chr22.hg19:g.37603060G>T		107.0	0.0	.		146.0	60.0	.	NM_001051	A8K550|Q53ZR7	Silent	SNP	ENST00000328544.3	hg19	CCDS13944.1																																																																																			.	G|1.000;A|0.000	.	alt		0.672	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318802.1		
HCFC1	3054	hgsc.bcm.edu	37	X	153216893	153216893	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chrX:153216893C>G	ENST00000310441.7	-	22	6391	c.5425G>C	c.(5425-5427)Gaa>Caa	p.E1809Q	HCFC1_ENST00000354233.3_Missense_Mutation_p.E1740Q|HCFC1_ENST00000369984.4_Missense_Mutation_p.E1854Q	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1809	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACTGGTTTTCCTTCTTCATG	0.542																																					p.E1809Q		Atlas-SNP	.											.	HCFC1	284	.	0			c.G5425C						PASS	.						217.0	225.0	222.0					X																	153216893		2051	4175	6226	SO:0001583	missense	3054	exon22			GGTTTTCCTTCTT		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5425G>C	chrX.hg19:g.153216893C>G	ENSP00000309555:p.Glu1809Gln	38.0	0.0	.		46.0	33.0	.	NM_005334	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	hg19	CCDS44020.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.10|19.10	3.761895|3.761895	0.69763|0.69763	.|.	.|.	ENSG00000172534|ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233|ENST00000444191	T;T;T|.	0.03689|.	3.84;3.85;3.85|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Fibronectin, type III (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74114|0.74114	0.3674|0.3674	M|M	0.68952|0.68952	2.095|2.095	0.47374|0.47374	D|D	0.999402|0.999402	D|.	0.64830|.	0.994|.	P|.	0.56960|.	0.81|.	T|T	0.73244|0.73244	-0.4044|-0.4044	10|5	0.41790|.	T|.	0.15|.	.|.	17.327|17.327	0.87251|0.87251	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1809|.	P51610|.	HCFC1_HUMAN|.	Q|A	1809;1854;1740|384	ENSP00000309555:E1809Q;ENSP00000359001:E1854Q;ENSP00000346174:E1740Q|.	ENSP00000309555:E1809Q|.	E|G	-|-	1|2	0|0	HCFC1|HCFC1	152870087|152870087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.703000|0.703000	0.40648|0.40648	7.328000|7.328000	0.79160|0.79160	2.359000|2.359000	0.80004|0.80004	0.525000|0.525000	0.51046|0.51046	GAA|GGA	.	.	.	none		0.542	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
CLP1	10978	hgsc.bcm.edu	37	11	57427119	57427121	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	TGA	TGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:57427119_57427121delTGA	ENST00000302731.4	+	2	291_293	c.171_173delTGA	c.(169-174)tttgat>ttt	p.D58del	CLP1_ENST00000529430.1_In_Frame_Del_p.D69del|CLP1_ENST00000533682.1_In_Frame_Del_p.D58del|CLP1_ENST00000525602.1_In_Frame_Del_p.D58del	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						AATTCACCTTTGATGCTGGTGCC	0.517																																					p.57_58del		Atlas-Indel,Pindel	.											.	CLP1	40	.	0			c.170_172del						PASS	.																																			SO:0001651	inframe_deletion	10978	exon2			.	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000302731.4:c.171_173delTGA	chr11.hg19:g.57427119_57427121delTGA	ENSP00000304704:p.Asp58del	168.0	0.0	0		241.0	83.0	0.344398	NM_001142597	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	In_Frame_Del	DEL	ENST00000302731.4	hg19	CCDS44600.1																																																																																			.	.	.	none		0.517	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000393465.1	NM_006831	
JAG1	182	hgsc.bcm.edu	37	20	10620302	10620302	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr20:10620302delT	ENST00000254958.5	-	26	4016	c.3501delA	c.(3499-3501)aaafs	p.K1167fs	JAG1_ENST00000423891.2_Frame_Shift_Del_p.K1008fs	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1167					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CAAACCGGGCTTTCTGCTGGT	0.493									Alagille Syndrome																												p.A1168fs		Atlas-Indel,Pindel	.											.	JAG1	213	.	0			c.3502delG						PASS	.						174.0	175.0	175.0					20																	10620302		2203	4300	6503	SO:0001589	frameshift_variant	182	exon26	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	.	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3501delA	chr20.hg19:g.10620302delT	ENSP00000254958:p.Lys1167fs	108.0	0.0	0		161.0	75.0	0.465839	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Frame_Shift_Del	DEL	ENST00000254958.5	hg19	CCDS13112.1																																																																																			.	.	.	none		0.493	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
C11orf24	53838	hgsc.bcm.edu	37	11	68029170	68029172	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr11:68029170_68029172delCTT	ENST00000304271.6	-	4	1693_1695	c.1291_1293delAAG	c.(1291-1293)aagdel	p.K431del	C11orf24_ENST00000533310.1_In_Frame_Del_p.K96del|C11orf24_ENST00000530166.1_5'Flank	NM_022338.3	NP_071733.1	Q96F05	CK024_HUMAN	chromosome 11 open reading frame 24	431						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)	13						GGGTGTAGTCCTTCTTCTTGTAG	0.557																																					p.431_432del	NSCLC(21;855 905 4198 36694)	Atlas-Indel,Pindel	.											.	C11orf24	35	.	0			c.1292_1294del						PASS	.			5,4259		2,1,2129						5.3	1.0			94	2,8252		0,2,4125	no	coding	C11orf24	NM_022338.3		2,3,6254	A1A1,A1R,RR		0.0242,0.1173,0.0559				7,12511				SO:0001651	inframe_deletion	53838	exon4			.	AF264781	CCDS8180.1, CCDS73338.1	11q13.2	2014-01-08			ENSG00000171067	ENSG00000171067			1174	protein-coding gene	gene with protein product		610880				11401438, 24312644	Standard	NM_022338		Approved	DM4E3	uc001onr.4	Q96F05	OTTHUMG00000167478	ENST00000304271.6:c.1291_1293delAAG	chr11.hg19:g.68029176_68029178delCTT	ENSP00000307264:p.Lys431del	93.0	0.0	0		125.0	44.0	0.352	NM_022338	Q9H2K4	In_Frame_Del	DEL	ENST00000304271.6	hg19	CCDS8180.1																																																																																			.	.	.	none		0.557	C11orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394750.1	NM_022338	
ZNF80	7634	hgsc.bcm.edu	37	3	113955534	113955536	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:113955534_113955536delCTC	ENST00000482457.2	-	1	889_891	c.386_388delGAG	c.(385-390)ggagag>gag	p.G129del	RP11-553L6.2_ENST00000493033.1_RNA|RP11-553L6.2_ENST00000481773.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				TAGGGCTTCTCTCCAGTGTGAAT	0.542																																					p.129_130del	GBM(23;986 1114 21716)	Atlas-Indel,Pindel	.											.	ZNF80	75	.	0			c.387_389del						PASS	.																																			SO:0001651	inframe_deletion	7634	exon1			.	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.386_388delGAG	chr3.hg19:g.113955534_113955536delCTC	ENSP00000417192:p.Gly129del	83.0	0.0	0		111.0	48.0	0.432432	NM_007136	Q6NSW4|Q6NT14	In_Frame_Del	DEL	ENST00000482457.2	hg19	CCDS2979.1																																																																																			.	.	.	none		0.542	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
FAT1	2195	hgsc.bcm.edu	37	4	187629813	187629814	+	In_Frame_Ins	INS	-	-	AAA			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr4:187629813_187629814insAAA	ENST00000441802.2	-	2	1377_1378	c.1168_1169insTTT	c.(1168-1170)aag>aTTTag	p.390_390K>I*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	390	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AGGAATGGCCTTTACCATGACC	0.386										HNSCC(5;0.00058)																											p.K390delinsIX	Colon(197;1040 2055 4143 4984 49344)	Atlas-Indel,Pindel	.											.	FAT1	500	.	0			c.1169_1170insTTT						PASS	.																																			SO:0001652	inframe_insertion	2195	exon2			.	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1168_1169insTTT	chr4.hg19:g.187629813_187629814insAAA	ENSP00000406229:p.Lys390delinsIle*	47.0	0.0	0		82.0	34.0	0.414634	NM_005245		In_Frame_Ins	INS	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.	.	none		0.386	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
NCKAP5	344148	hgsc.bcm.edu	37	2	133540450	133540451	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr2:133540450_133540451insA	ENST00000409261.1	-	14	4306_4307	c.3933_3934insT	c.(3931-3936)tctcttfs	p.L1312fs	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Frame_Shift_Ins_p.L1312fs	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1312										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGCCGGGTAAGAGAATTGCCTC	0.579																																					p.L1312fs		Atlas-Indel,Pindel	.											.	NCKAP5	322	.	0			c.3934_3935insT						PASS	.																																			SO:0001589	frameshift_variant	344148	exon14			.	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3934dupT	chr2.hg19:g.133540451_133540451dupA	ENSP00000387128:p.Leu1312fs	114.0	0.0	0		167.0	70.0	0.419162	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Frame_Shift_Ins	INS	ENST00000409261.1	hg19	CCDS46418.1																																																																																			.	.	.	none		0.579	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
RACGAP1	29127	hgsc.bcm.edu	37	12	50410456	50410456	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:50410456delG	ENST00000427314.2	-	4	266	c.43delC	c.(43-45)cttfs	p.L15fs	RACGAP1_ENST00000434422.1_Frame_Shift_Del_p.L15fs|RACGAP1_ENST00000454520.2_Frame_Shift_Del_p.L15fs|RACGAP1_ENST00000551016.1_Frame_Shift_Del_p.L15fs|RACGAP1_ENST00000312377.5_Frame_Shift_Del_p.L15fs|RACGAP1_ENST00000547905.1_Frame_Shift_Del_p.L15fs	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						CGGCGCACAAGCTGCTCAAAC	0.438																																					p.L15fs		Atlas-Indel,Pindel	.											.	RACGAP1	36	.	0			c.44delT						PASS	.						134.0	143.0	140.0					12																	50410456		2203	4300	6503	SO:0001589	frameshift_variant	29127	exon4			.		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.43delC	chr12.hg19:g.50410456delG	ENSP00000404190:p.Leu15fs	53.0	0.0	0		76.0	39.0	0.513158	NM_013277		Frame_Shift_Del	DEL	ENST00000427314.2	hg19	CCDS8795.1																																																																																			.	.	.	none		0.438	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
SLC2A13	114134	hgsc.bcm.edu	37	12	40441958	40441958	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr12:40441958delA	ENST00000280871.4	-	2	661	c.611delT	c.(610-612)ttafs	p.L204fs	SLC2A13_ENST00000380858.1_Frame_Shift_Del_p.L204fs	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	204					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TCGGCCTCTTAAATTGGGTGG	0.418										HNSCC(50;0.14)																											p.L204fs		Atlas-Indel,Pindel	.											.	SLC2A13	91	.	0			c.612delA						PASS	.						163.0	155.0	158.0					12																	40441958		2203	4300	6503	SO:0001589	frameshift_variant	114134	exon2			.	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.611delT	chr12.hg19:g.40441958delA	ENSP00000280871:p.Leu204fs	73.0	0.0	0		132.0	49.0	0.371212	NM_052885	Q17S07	Frame_Shift_Del	DEL	ENST00000280871.4	hg19	CCDS8736.2																																																																																			.	.	.	none		0.418	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
CTTNBP2	83992	hgsc.bcm.edu	37	7	117358121	117358122	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr7:117358121_117358122delGG	ENST00000160373.3	-	22	4787_4788	c.4696_4697delCC	c.(4696-4698)cctfs	p.P1566fs		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1566					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TGAAAGTACAGGGTTGTTTCCA	0.411																																					p.1566_1566del		Atlas-Indel,Pindel	.											.	CTTNBP2	200	.	0			c.4697_4698del						PASS	.																																			SO:0001589	frameshift_variant	83992	exon22			.		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4696_4697delCC	chr7.hg19:g.117358121_117358122delGG	ENSP00000160373:p.Pro1566fs	155.0	0.0	0		252.0	142.0	0.563492	NM_033427	O43389|Q7LG11|Q9C0A5	Frame_Shift_Del	DEL	ENST00000160373.3	hg19	CCDS5774.1																																																																																			.	.	.	none		0.411	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
TMEM174	134288	hgsc.bcm.edu	37	5	72469241	72469241	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr5:72469241delG	ENST00000296776.5	+	1	220	c.171delG	c.(169-171)atgfs	p.M57fs	TMEM174_ENST00000511737.1_3'UTR	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	57						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		TCACTGTCATGGGCTGGATCA	0.557																																					p.M57fs		Pindel	.											.	TMEM174	22	.	0			c.170delT						PASS	.						125.0	115.0	119.0					5																	72469241		2203	4300	6503	SO:0001589	frameshift_variant	134288	exon1			.	BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.171delG	chr5.hg19:g.72469241delG	ENSP00000296776:p.Met57fs	84.0	0.0	.		99.0	27.0	0.273	NM_153217	B2RDA0|Q96N81	Frame_Shift_Del	DEL	ENST00000296776.5	hg19	CCDS4018.1																																																																																			.	.	.	none		0.557	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254036.1	NM_153217	
MUC4	4585	hgsc.bcm.edu	37	3	195511736	195511783	+	In_Frame_Del	DEL	TGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	TGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	-	rs67146868|rs71291863|rs365279|rs575208142|rs199714873|rs75997030|rs554247192|rs71617316|rs74222070|rs556714667|rs391928|rs538604758|rs201069012	byFrequency	TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	TGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	TGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr3:195511736_195511783delTGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	ENST00000463781.3	-	2	7127_7174	c.6668_6715delTCCCTCTTCTTGTCACCGACACTTCCTCAGCATCCACAGGACAGGCCA	c.(6667-6717)atccctcttcttgtcaccgacacttcctcagcatccacaggacaggccacc>acc	p.IPLLVTDTSSASTGQA2223del	MUC4_ENST00000475231.1_In_Frame_Del_p.IPLLVTDTSSASTGQA2223del|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2235K(2)|p.P2224L(1)|p.V2227V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGAGGGGTGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGATGGCGTGACC	0.605																																					p.2223_2239del		Pindel	.											.	MUC4	1505	.	4	Substitution - Missense(3)|Substitution - coding silent(1)	skin(2)|prostate(1)|endometrium(1)	c.6669_6716del						PASS	.																																			SO:0001651	inframe_deletion	4585	exon2			.	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6668_6715delTCCCTCTTCTTGTCACCGACACTTCCTCAGCATCCACAGGACAGGCCA	chr3.hg19:g.195511736_195511783delTGGCCTGTCCTGTGGATGCTGAGGAAGTGTCGGTGACAAGAAGAGGGA	ENSP00000417498:p.Ile2223_Ala2238del	155.0	0.0	.		198.0	11.0	0.056	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.	.	none		0.605	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
RNF222	643904	hgsc.bcm.edu	37	17	8296546	8296546	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-A8LE-01A-11D-A35Z-10	TCGA-G7-A8LE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f304b920-e25e-445a-b834-d54c241d029b	e8d9c96d-cf86-4b29-ba93-23c5e8b4bd28	g.chr17:8296546delG	ENST00000399398.2	-	3	542	c.234delC	c.(232-234)cccfs	p.P78fs	RNF222_ENST00000344001.3_Frame_Shift_Del_p.P78fs	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	78						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						CCAGCATGGAGGGCCAGCGGG	0.677																																					p.S79fs		Pindel	.											.	RNF222	2	.	0			c.235delT						PASS	.						10.0	14.0	13.0					17																	8296546		690	1588	2278	SO:0001589	frameshift_variant	643904	exon3			.		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.234delC	chr17.hg19:g.8296546delG	ENSP00000382330:p.Pro78fs	123.0	0.0	.		192.0	62.0	0.323	NM_001146684		Frame_Shift_Del	DEL	ENST00000399398.2	hg19	CCDS45608.1																																																																																			.	.	.	none		0.677	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
