#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHB2	2048	hgsc.bcm.edu	37	1	23234542	23234542	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr1:23234542C>A	ENST00000400191.3	+	12	2251	c.2233C>A	c.(2233-2235)Cgt>Agt	p.R745S	EPHB2_ENST00000374627.1_Missense_Mutation_p.R740S|EPHB2_ENST00000374632.3_Missense_Mutation_p.R746S|EPHB2_ENST00000374630.3_Missense_Mutation_p.R745S	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	745	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.R745C(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CTATGTTCACCGTGACCTGGC	0.557																																					p.R746S		Atlas-SNP	.											EPHB2,NS,carcinoma,-1,1	EPHB2	257	.	1	Substitution - Missense(1)	stomach(1)	c.C2236A						PASS	.						188.0	166.0	173.0					1																	23234542		2203	4300	6503	SO:0001583	missense	2048	exon12			GTTCACCGTGACC	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2233C>A	chr1.hg19:g.23234542C>A	ENSP00000383053:p.Arg745Ser	199.0	1.0	.		140.0	6.0	.	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	hg19		.	.	.	.	.	.	.	.	.	.	C	25.9	4.681019	0.88542	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88	5.32	4.37	0.52481	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89643	0.6774	H	0.95504	3.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.91974	0.5589	10	0.87932	D	0	.	14.3622	0.66779	0.1478:0.8522:0.0:0.0	.	687;745;763;746	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	S	687;745;745;746;740	ENSP00000363761:R745S;ENSP00000383053:R745S;ENSP00000363763:R746S;ENSP00000363758:R740S	ENSP00000363755:R687S	R	+	1	0	EPHB2	23107129	1.000000	0.71417	0.997000	0.53966	0.870000	0.49936	5.909000	0.69923	2.778000	0.95560	0.650000	0.86243	CGT	.	.	.	none		0.557	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
AGL	178	hgsc.bcm.edu	37	1	100346675	100346675	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr1:100346675C>G	ENST00000294724.4	+	15	2421	c.1943C>G	c.(1942-1944)tCt>tGt	p.S648C	AGL_ENST00000361302.3_Missense_Mutation_p.S632C|AGL_ENST00000370165.3_Missense_Mutation_p.S648C|AGL_ENST00000361522.4_Missense_Mutation_p.S631C|AGL_ENST00000370163.3_Missense_Mutation_p.S648C|AGL_ENST00000370161.2_Missense_Mutation_p.S632C|AGL_ENST00000361915.3_Missense_Mutation_p.S648C	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	648					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ACAATTGTTTCTATGGCATGT	0.368																																					p.S648C		Atlas-SNP	.											.	AGL	137	.	0			c.C1943G						PASS	.						180.0	165.0	170.0					1																	100346675		2203	4300	6503	SO:0001583	missense	178	exon15			TTGTTTCTATGGC	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.1943C>G	chr1.hg19:g.100346675C>G	ENSP00000294724:p.Ser648Cys	104.0	0.0	.		96.0	44.0	.	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	hg19	CCDS759.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.355191	0.41700	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	6.01	6.01	0.97437	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.049923	0.85682	D	0.000000	D	0.89681	0.6785	M	0.62723	1.935	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.72625	0.978;0.978;0.95	D	0.90138	0.4211	10	0.87932	D	0	.	15.6295	0.76893	0.0:0.9327:0.0:0.0673	.	631;632;648	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	C	648;648;648;648;632;632;631	ENSP00000355106:S648C;ENSP00000359184:S648C;ENSP00000359182:S648C;ENSP00000294724:S648C;ENSP00000354971:S632C;ENSP00000359180:S632C;ENSP00000354635:S631C	ENSP00000294724:S648C	S	+	2	0	AGL	100119263	1.000000	0.71417	0.805000	0.32314	0.062000	0.15995	5.550000	0.67268	2.850000	0.98022	0.655000	0.94253	TCT	.	.	.	none		0.368	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
PRRC2C	23215	hgsc.bcm.edu	37	1	171535917	171535917	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr1:171535917G>A	ENST00000338920.4	+	22	6724	c.6487G>A	c.(6487-6489)Gaa>Aaa	p.E2163K	PRRC2C_ENST00000426496.2_Missense_Mutation_p.E2163K|PRRC2C_ENST00000367742.3_Missense_Mutation_p.E2165K|PRRC2C_ENST00000392078.3_Missense_Mutation_p.E2165K	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2163					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										AGCAGTCTCAGAAATGTCTAC	0.448																																					p.E2163K		Atlas-SNP	.											.	.	.	.	0			c.G6487A						PASS	.						77.0	69.0	71.0					1																	171535917		2203	4300	6503	SO:0001583	missense	23215	exon22			GTCTCAGAAATGT	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6487G>A	chr1.hg19:g.171535917G>A	ENSP00000343629:p.Glu2163Lys	49.0	0.0	.		37.0	11.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	18.45	3.627687	0.66901	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.03124	4.25;4.04;4.27;4.27	5.6	5.6	0.85130	.	0.000000	0.46145	D	0.000303	T	0.10551	0.0258	L	0.59436	1.845	0.58432	D	0.999995	D	0.89917	1.0	D	0.85130	0.997	T	0.12372	-1.0550	10	0.36615	T	0.2	.	19.6251	0.95674	0.0:0.0:1.0:0.0	.	2163	Q9Y520-4	.	K	2165;2117;2163;2165;2163;1920	ENSP00000375928:E2165K;ENSP00000410219:E2163K;ENSP00000356716:E2165K;ENSP00000343629:E2163K	ENSP00000343629:E2163K	E	+	1	0	PRRC2C	169802541	1.000000	0.71417	0.992000	0.48379	0.510000	0.34073	9.236000	0.95360	2.636000	0.89361	0.655000	0.94253	GAA	.	.	.	none		0.448	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
AGT	183	hgsc.bcm.edu	37	1	230841797	230841797	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr1:230841797A>T	ENST00000366667.4	-	3	1220	c.1006T>A	c.(1006-1008)Ttc>Atc	p.F336I		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	336					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTCTCAGTGAAGGGCACTTGA	0.562																																					p.F336I		Atlas-SNP	.											.	AGT	62	.	0			c.T1006A						PASS	.						110.0	104.0	106.0					1																	230841797		2203	4300	6503	SO:0001583	missense	183	exon3			CAGTGAAGGGCAC	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1006T>A	chr1.hg19:g.230841797A>T	ENSP00000355627:p.Phe336Ile	146.0	0.0	.		126.0	57.0	.	NM_000029	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	hg19	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	A	8.200	0.797970	0.16327	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.84800	-1.9	5.17	-4.42	0.03579	Serpin domain (3);	0.408163	0.24752	N	0.035897	T	0.66005	0.2746	N	0.14661	0.345	0.09310	N	1	B;B;B	0.26258	0.094;0.145;0.094	B;B;B	0.25140	0.044;0.058;0.044	T	0.54556	-0.8276	10	0.34782	T	0.22	.	7.5483	0.27781	0.1397:0.142:0.6158:0.1025	.	336;336;336	B0ZBE2;B2R5S1;P01019	.;.;ANGT_HUMAN	I	336;254	ENSP00000355627:F336I	ENSP00000355627:F336I	F	-	1	0	AGT	228908420	0.002000	0.14202	0.012000	0.15200	0.007000	0.05969	-0.319000	0.08039	-0.831000	0.04256	-0.250000	0.11733	TTC	.	.	.	none		0.562	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	
PUM2	23369	hgsc.bcm.edu	37	2	20518349	20518349	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr2:20518349C>T	ENST00000361078.2	-	2	131	c.109G>A	c.(109-111)Ggc>Agc	p.G37S	PUM2_ENST00000536417.1_Intron|PUM2_ENST00000319801.5_Missense_Mutation_p.G37S|PUM2_ENST00000338086.5_Missense_Mutation_p.G37S|PUM2_ENST00000420234.1_5'UTR|PUM2_ENST00000403432.1_Missense_Mutation_p.G37S			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	37	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAATATGCCTTTTTGTCCA	0.338																																					p.G37S		Atlas-SNP	.											.	PUM2	91	.	0			c.G109A						PASS	.						142.0	131.0	135.0					2																	20518349		2203	4300	6503	SO:0001583	missense	23369	exon2			ATATGCCTTTTTG	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.109G>A	chr2.hg19:g.20518349C>T	ENSP00000354370:p.Gly37Ser	108.0	0.0	.		91.0	35.0	.	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	hg19		.	.	.	.	.	.	.	.	.	.	C	16.75	3.210343	0.58343	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000403432;ENST00000442400	T;T;T;T	0.21031	2.03;2.31;2.21;2.03	5.74	0.167	0.15006	.	0.151206	0.64402	N	0.000016	T	0.17152	0.0412	L	0.49350	1.555	0.80722	D	1	B;B	0.20459	0.0;0.045	B;B	0.20184	0.001;0.028	T	0.05500	-1.0881	10	0.54805	T	0.06	-0.9827	7.59	0.28015	0.1096:0.6213:0.0:0.2691	.	37;37	B7ZL34;Q8TB72-3	.;.	S	37	ENSP00000338173:G37S;ENSP00000354370:G37S;ENSP00000326746:G37S;ENSP00000385992:G37S	ENSP00000326746:G37S	G	-	1	0	PUM2	20381830	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	3.338000	0.52128	0.071000	0.16664	-0.948000	0.02665	GGC	.	.	.	none		0.338	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
ANKRD44	91526	hgsc.bcm.edu	37	2	197986231	197986231	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr2:197986231T>C	ENST00000328737.2	-	8	732	c.656A>G	c.(655-657)cAc>cGc	p.H219R	ANKRD44_ENST00000539527.1_Missense_Mutation_p.H172R|ANKRD44_ENST00000409153.1_Missense_Mutation_p.H244R|ANKRD44_ENST00000450567.1_Missense_Mutation_p.H219R|ANKRD44_ENST00000337207.5_Missense_Mutation_p.H219R|ANKRD44_ENST00000282272.8_Missense_Mutation_p.H236R|ANKRD44_ENST00000409919.1_Missense_Mutation_p.H244R			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	244										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCAGGCGATGTGAAGCGCTGT	0.433																																					p.H244R		Atlas-SNP	.											.	ANKRD44	281	.	0			c.A731G						PASS	.						155.0	117.0	130.0					2																	197986231		2203	4300	6503	SO:0001583	missense	91526	exon8			GCGATGTGAAGCG	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.656A>G	chr2.hg19:g.197986231T>C	ENSP00000331516:p.His219Arg	54.0	0.0	.		50.0	18.0	.	NM_153697	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	hg19		.	.	.	.	.	.	.	.	.	.	T	22.1	4.245633	0.80024	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000409153;ENST00000539527;ENST00000409919	T;T;T;T;T;T;T;T	0.79554	-0.56;-0.56;-1.28;-1.28;-1.28;-0.56;-1.28;-1.28	5.14	5.14	0.70334	.	0.105903	0.64402	D	0.000004	D	0.90287	0.6962	M	0.85630	2.765	0.58432	D	0.999999	D;D	0.89917	1.0;0.99	D;D	0.81914	0.995;0.968	D	0.91903	0.5533	10	0.87932	D	0	.	15.4162	0.74970	0.0:0.0:0.0:1.0	.	172;244	F5H682;Q8N8A2-3	.;.	R	41;236;219;219;219;244;172;244	ENSP00000403415:H41R;ENSP00000282272:H236R;ENSP00000331516:H219R;ENSP00000402420:H219R;ENSP00000338794:H219R;ENSP00000387141:H244R;ENSP00000437825:H172R;ENSP00000387233:H244R	ENSP00000282272:H236R	H	-	2	0	ANKRD44	197694476	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.825000	0.86693	2.285000	0.76669	0.533000	0.62120	CAC	.	.	.	none		0.433	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
FZD5	7855	hgsc.bcm.edu	37	2	208632800	208632800	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr2:208632800A>G	ENST00000295417.3	-	2	1217	c.664T>C	c.(664-666)Tgc>Cgc	p.C222R		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	222					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		GGCTGGTAGCAGGGTACCGCG	0.632																																					p.C222R		Atlas-SNP	.											.	FZD5	22	.	0			c.T664C						PASS	.						54.0	52.0	52.0					2																	208632800		2203	4300	6503	SO:0001583	missense	7855	exon2			GGTAGCAGGGTAC	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.664T>C	chr2.hg19:g.208632800A>G	ENSP00000354607:p.Cys222Arg	25.0	0.0	.		24.0	11.0	.	NM_003468	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	hg19	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701621	0.68501	.	.	ENSG00000163251	ENST00000295417	D	0.90197	-2.63	5.05	5.05	0.67936	.	0.051032	0.85682	D	0.000000	D	0.94706	0.8292	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.95299	0.8402	10	0.87932	D	0	.	14.4703	0.67512	1.0:0.0:0.0:0.0	.	222	Q13467	FZD5_HUMAN	R	222	ENSP00000354607:C222R	ENSP00000354607:C222R	C	-	1	0	FZD5	208341045	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.339000	0.96797	1.908000	0.55244	0.459000	0.35465	TGC	.	.	.	none		0.632	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
CCDC13	152206	hgsc.bcm.edu	37	3	42777251	42777251	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:42777251C>A	ENST00000310232.6	-	10	1402	c.1319G>T	c.(1318-1320)cGg>cTg	p.R440L	CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	440										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TTTGGCCTCCCGCTCAGCTAC	0.602																																					p.R440L		Atlas-SNP	.											.	CCDC13	71	.	0			c.G1319T						PASS	.						119.0	104.0	109.0					3																	42777251		2203	4300	6503	SO:0001583	missense	152206	exon10			GCCTCCCGCTCAG	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1319G>T	chr3.hg19:g.42777251C>A	ENSP00000309836:p.Arg440Leu	154.0	0.0	.		207.0	11.0	.	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.700694	0.68501	.	.	ENSG00000244607	ENST00000310232	T	0.27720	1.65	5.03	5.03	0.67393	.	0.085006	0.47852	D	0.000217	T	0.55353	0.1915	M	0.75447	2.3	0.38311	D	0.943263	D	0.89917	1.0	D	0.76071	0.987	T	0.57207	-0.7851	10	0.30078	T	0.28	.	17.144	0.86761	0.0:1.0:0.0:0.0	.	440	Q8IYE1	CCD13_HUMAN	L	440	ENSP00000309836:R440L	ENSP00000309836:R440L	R	-	2	0	CCDC13	42752255	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.131000	0.57970	2.345000	0.79718	0.511000	0.50034	CGG	.	.	.	none		0.602	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
ALS2CL	259173	hgsc.bcm.edu	37	3	46713506	46713506	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:46713506C>A	ENST00000318962.4	-	24	2635	c.2552G>T	c.(2551-2553)cGg>cTg	p.R851L	ALS2CL_ENST00000415953.1_Missense_Mutation_p.R851L|ALS2CL_ENST00000383742.3_Missense_Mutation_p.R198L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	851	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CAGCTTCTCCCGTGGGTCCAC	0.642																																					p.R851L		Atlas-SNP	.											.	ALS2CL	78	.	0			c.G2552T						PASS	.						96.0	89.0	92.0					3																	46713506		2203	4300	6503	SO:0001583	missense	259173	exon24			TTCTCCCGTGGGT	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2552G>T	chr3.hg19:g.46713506C>A	ENSP00000313670:p.Arg851Leu	160.0	0.0	.		185.0	10.0	.	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	hg19	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660329	0.67586	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.31510	1.49;1.49;1.49	5.29	5.29	0.74685	Vacuolar sorting protein 9 (2);	0.248448	0.27415	N	0.019472	T	0.27524	0.0676	N	0.22421	0.69	0.32113	N	0.589045	P	0.45283	0.855	P	0.48304	0.573	T	0.28138	-1.0053	10	0.51188	T	0.08	.	9.9532	0.41651	0.0:0.9073:0.0:0.0927	.	851	Q60I27	AL2CL_HUMAN	L	851;851;198	ENSP00000313670:R851L;ENSP00000413223:R851L;ENSP00000373248:R198L	ENSP00000313670:R851L	R	-	2	0	ALS2CL	46688510	0.665000	0.27466	0.923000	0.36655	0.988000	0.76386	2.220000	0.42908	2.465000	0.83290	0.650000	0.86243	CGG	.	.	.	none		0.642	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
KIAA1407	57577	hgsc.bcm.edu	37	3	113721375	113721375	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:113721375C>A	ENST00000295878.3	-	12	2135	c.1989G>T	c.(1987-1989)gaG>gaT	p.E663D	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	663										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GAATTGCTCTCTCTTCCATAG	0.318																																					p.E663D		Atlas-SNP	.											.	KIAA1407	80	.	0			c.G1989T						PASS	.						90.0	83.0	86.0					3																	113721375		2202	4299	6501	SO:0001583	missense	57577	exon12			TGCTCTCTCTTCC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1989G>T	chr3.hg19:g.113721375C>A	ENSP00000295878:p.Glu663Asp	51.0	0.0	.		108.0	34.0	.	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	hg19	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887102	0.33348	.	.	ENSG00000163617	ENST00000295878	T	0.35048	1.33	5.35	4.48	0.54585	.	1.585750	0.04130	N	0.317747	T	0.61299	0.2336	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.35101	-0.9802	10	0.59425	D	0.04	.	9.6228	0.39732	0.0:0.8395:0.0:0.1605	.	663	Q8NCU4	K1407_HUMAN	D	663	ENSP00000295878:E663D	ENSP00000295878:E663D	E	-	3	2	KIAA1407	115204065	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.489000	0.22387	1.635000	0.50512	0.655000	0.94253	GAG	.	.	.	none		0.318	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
POLQ	10721	hgsc.bcm.edu	37	3	121217327	121217327	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:121217327T>G	ENST00000264233.5	-	13	2278	c.2150A>C	c.(2149-2151)aAa>aCa	p.K717T		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	717					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CGTTTACCTTTTATGGATGGC	0.453								DNA polymerases (catalytic subunits)																													p.K717T	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.A2150C						PASS	.						164.0	147.0	153.0					3																	121217327		2203	4300	6503	SO:0001583	missense	10721	exon13			TACCTTTTATGGA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.2150A>C	chr3.hg19:g.121217327T>G	ENSP00000264233:p.Lys717Thr	170.0	0.0	.		221.0	118.0	.	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369837	0.82573	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.53857	0.6	5.83	5.83	0.93111	.	0.049703	0.85682	D	0.000000	T	0.69584	0.3127	M	0.85945	2.785	0.49582	D	0.999802	D	0.57257	0.979	P	0.58130	0.833	T	0.75199	-0.3402	10	0.87932	D	0	.	10.5218	0.44922	0.0:0.072:0.0:0.928	.	717	O75417	DPOLQ_HUMAN	T	340;717;853	ENSP00000264233:K717T	ENSP00000264233:K717T	K	-	2	0	POLQ	122700017	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.866000	0.69590	2.212000	0.71576	0.533000	0.62120	AAA	.	.	.	none		0.453	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
IQCJ	654502	hgsc.bcm.edu	37	3	158980472	158980472	+	Splice_Site	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:158980472C>A	ENST00000451172.1	+	4	396	c.291C>A	c.(289-291)ccC>ccA	p.P97P	IQCJ_ENST00000482126.1_Splice_Site_p.P70P|IQCJ-SCHIP1_ENST00000485419.1_Splice_Site_p.P97P|IQCJ-SCHIP1_ENST00000476809.1_Splice_Site_p.P70P|IQCJ-SCHIP1_ENST00000467442.1_3'UTR|IQCJ_ENST00000397832.2_Silent_p.P97P	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	97										cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GCAGCACACCCGTGAGTGTCA	0.517																																					p.P97P		Atlas-SNP	.											IQCJ-SCHIP1,NS,carcinoma,0,2	IQCJ	28	.	0			c.C291A						PASS	.						114.0	113.0	113.0					3																	158980472		2005	4175	6180	SO:0001630	splice_region_variant	654502	exon4			CACACCCGTGAGT	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.291+1C>A	chr3.hg19:g.158980472C>A		151.0	0.0	.		172.0	7.0	.	NM_001042705	B7ZMM2|B9EH97|Q1A5X5	Silent	SNP	ENST00000451172.1	hg19	CCDS46946.1																																																																																			.	.	.	none		0.517	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1	Silent
SEC62	7095	hgsc.bcm.edu	37	3	169706125	169706125	+	Silent	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:169706125C>T	ENST00000337002.4	+	7	766	c.708C>T	c.(706-708)gcC>gcT	p.A236A	SEC62_ENST00000470355.1_3'UTR|SEC62_ENST00000480708.1_Silent_p.A236A|SEC62-AS1_ENST00000479626.1_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	236					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						GTTTTGTAGCCAGTATTCTTC	0.433																																					p.A236A		Atlas-SNP	.											.	SEC62	27	.	0			c.C708T						PASS	.						208.0	189.0	195.0					3																	169706125		2203	4300	6503	SO:0001819	synonymous_variant	7095	exon7			TGTAGCCAGTATT	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.708C>T	chr3.hg19:g.169706125C>T		150.0	0.0	.		180.0	49.0	.	NM_003262	D3DNQ0|O00682|O00729	Silent	SNP	ENST00000337002.4	hg19	CCDS3210.1																																																																																			.	.	.	none		0.433	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1		
ACAP2	23527	hgsc.bcm.edu	37	3	195006526	195006526	+	Splice_Site	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:195006526T>C	ENST00000326793.6	-	22	2465	c.2235A>G	c.(2233-2235)ccA>ccG	p.P745P		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	745					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						AATATTGACCTGGCTGTCCAT	0.313																																					p.P745P		Atlas-SNP	.											.	ACAP2	72	.	0			c.A2235G						PASS	.						131.0	120.0	124.0					3																	195006526		2203	4299	6502	SO:0001630	splice_region_variant	23527	exon22			TTGACCTGGCTGT		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.2236+1A>G	chr3.hg19:g.195006526T>C		63.0	0.0	.		81.0	15.0	.	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Silent	SNP	ENST00000326793.6	hg19	CCDS33924.1																																																																																			.	.	.	none		0.313	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	Silent
LMLN	89782	hgsc.bcm.edu	37	3	197687145	197687145	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr3:197687145G>A	ENST00000330198.4	+	1	75	c.53G>A	c.(52-54)gGt>gAt	p.G18D	IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank|LMLN_ENST00000482695.1_Silent_p.G6G|LMLN_ENST00000420910.2_Missense_Mutation_p.G18D|LMLN_ENST00000332636.5_Silent_p.G6G	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	18					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		GGAGGAGTGGGTTACTCGGGC	0.736																																					p.G18D		Atlas-SNP	.											.	LMLN	53	.	0			c.G53A						PASS	.						21.0	26.0	25.0					3																	197687145		2199	4297	6496	SO:0001583	missense	89782	exon1			GAGTGGGTTACTC	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.53G>A	chr3.hg19:g.197687145G>A	ENSP00000328829:p.Gly18Asp	47.0	0.0	.		61.0	13.0	.	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	hg19	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349097	0.24426	.	.	ENSG00000185621	ENST00000330198;ENST00000420910	T;T	0.45276	0.92;0.9	3.66	0.764	0.18465	.	0.675595	0.12533	N	0.460640	T	0.22044	0.0531	N	0.19112	0.55	0.09310	N	0.999994	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.16012	-1.0417	10	0.36615	T	0.2	-0.6469	2.1617	0.03827	0.1124:0.1977:0.4859:0.204	.	18;18	Q96KR4;F8WB28	LMLN_HUMAN;.	D	18	ENSP00000328829:G18D;ENSP00000410926:G18D	ENSP00000328829:G18D	G	+	2	0	LMLN	199171542	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	0.016000	0.13377	0.154000	0.19237	0.456000	0.33151	GGT	.	.	.	none		0.736	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
TET2	54790	hgsc.bcm.edu	37	4	106157461	106157461	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr4:106157461G>T	ENST00000540549.1	+	3	3222	c.2362G>T	c.(2362-2364)Gaa>Taa	p.E788*	TET2_ENST00000305737.2_Nonsense_Mutation_p.E788*|TET2_ENST00000513237.1_Nonsense_Mutation_p.E809*|TET2_ENST00000380013.4_Nonsense_Mutation_p.E788*|TET2_ENST00000413648.2_Nonsense_Mutation_p.E788*|TET2_ENST00000394764.1_Nonsense_Mutation_p.E788*|TET2_ENST00000545826.1_Nonsense_Mutation_p.E788*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	788	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.E788K(1)|p.E788*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TTTTCATGGTGAAAATCAGTA	0.393			"""Mis N, F"""		MDS																																p.E788X		Atlas-SNP	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	TET2,NS,haematopoietic_neoplasm,0,2	TET2	1762	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(2)	c.G2362T						PASS	.						57.0	60.0	59.0					4																	106157461		2203	4300	6503	SO:0001587	stop_gained	54790	exon3			CATGGTGAAAATC	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2362G>T	chr4.hg19:g.106157461G>T	ENSP00000442788:p.Glu788*	43.0	0.0	.		49.0	24.0	.	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	ENST00000540549.1	hg19	CCDS47120.1	.	.	.	.	.	.	.	.	.	.	G	42	9.661685	0.99231	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	.	.	.	5.91	5.91	0.95273	.	16.416400	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	.	.	.	X	788;788;788;809;788;788;788	.	ENSP00000265149:E788X	E	+	1	0	TET2	106376910	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	4.534000	0.60622	2.793000	0.96121	0.655000	0.94253	GAA	.	.	.	none		0.393	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
FAT1	2195	hgsc.bcm.edu	37	4	187530418	187530418	+	Silent	SNP	T	T	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr4:187530418T>A	ENST00000441802.2	-	16	10334	c.10125A>T	c.(10123-10125)atA>atT	p.I3375I		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3375	Cadherin 31. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGTTGCCATCTATAATTGAGT	0.478										HNSCC(5;0.00058)																											p.I3375I	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.A10125T						PASS	.						126.0	121.0	123.0					4																	187530418		1933	4136	6069	SO:0001819	synonymous_variant	2195	exon16			GCCATCTATAATT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10125A>T	chr4.hg19:g.187530418T>A		73.0	0.0	.		82.0	32.0	.	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.	.	none		0.478	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
AGGF1	55109	hgsc.bcm.edu	37	5	76344781	76344781	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr5:76344781C>A	ENST00000312916.7	+	8	1716	c.1334C>A	c.(1333-1335)aCt>aAt	p.T445N		NM_018046.4	NP_060516.2	Q8N302	AGGF1_HUMAN	angiogenic factor with G patch and FHA domains 1	445	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|RNA processing (GO:0006396)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	nucleic acid binding (GO:0003676)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	20		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		ATGGAACATACTCTCCGAATC	0.294																																					p.T445N		Atlas-SNP	.											.	AGGF1	71	.	0			c.C1334A						PASS	.						97.0	106.0	103.0					5																	76344781		2203	4295	6498	SO:0001583	missense	55109	exon8			AACATACTCTCCG	AK001145	CCDS4035.1	5q13.3	2013-10-11			ENSG00000164252	ENSG00000164252		"""G patch domain containing"""	24684	protein-coding gene	gene with protein product		608464				18564129, 17103452	Standard	NM_018046		Approved	VG5Q, HSU84971, FLJ10283, GPATC7, GPATCH7	uc003ket.3	Q8N302	OTTHUMG00000102132	ENST00000312916.7:c.1334C>A	chr5.hg19:g.76344781C>A	ENSP00000316109:p.Thr445Asn	150.0	0.0	.		179.0	82.0	.	NM_018046	O00581|Q53YS3|Q9BU84|Q9NW66	Missense_Mutation	SNP	ENST00000312916.7	hg19	CCDS4035.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028459	0.54790	.	.	ENSG00000164252	ENST00000312916	T	0.39592	1.07	4.64	4.64	0.57946	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.105294	0.64402	D	0.000003	T	0.41627	0.1167	N	0.17723	0.515	0.80722	D	1	P	0.51653	0.947	P	0.52424	0.698	T	0.36286	-0.9754	10	0.44086	T	0.13	-4.4424	16.8258	0.85930	0.0:1.0:0.0:0.0	.	445	Q8N302	AGGF1_HUMAN	N	445	ENSP00000316109:T445N	ENSP00000316109:T445N	T	+	2	0	AGGF1	76380537	1.000000	0.71417	0.987000	0.45799	0.743000	0.42351	7.194000	0.77789	2.285000	0.76669	0.305000	0.20034	ACT	.	.	.	none		0.294	AGGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219971.2	NM_018046	
NME5	8382	hgsc.bcm.edu	37	5	137474385	137474386	+	Nonsense_Mutation	DNP	CC	CC	AG			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr5:137474385_137474386CC>AG	ENST00000265191.2	-	2	133_134	c.84_85GG>CT	c.(82-87)gaGGag>gaCTag	p.28_29EE>D*		NM_003551.2	NP_003542.1	P56597	NDK5_HUMAN	NME/NM23 family member 5	28					cilium assembly (GO:0042384)|CTP biosynthetic process (GO:0006241)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|nucleoside metabolic process (GO:0009116)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)|ventricular system development (GO:0021591)	sperm flagellum (GO:0036126)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)			kidney(1)|large_intestine(1)|lung(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TCTTGTATCTCCTCCTCTTTGT	0.371																																					p.E29X|p.E28D		Atlas-SNP	.											NME5,NS,carcinoma,0,1|.	NME5	15	.	0			c.G85T|c.G84C						PASS	.																																			SO:0001587	stop_gained	8382	exon2			GTATCTCCTCCTC|TATCTCCTCCTCT	Y14992	CCDS4197.1	5q31.2	2012-05-18	2012-05-18		ENSG00000112981	ENSG00000112981			7853	protein-coding gene	gene with protein product	"""radial spoke 23 homolog (Chlamydomonas)"""	603575	"""non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)"""			9742940, 19852809	Standard	NM_003551		Approved	nm23-H5, RSPH23	uc003lce.3	P56597	OTTHUMG00000129207	ENST00000265191.2:c.84_85delinsAG	chr5.hg19:g.137474385_137474386delinsAG	ENSP00000265191:p.E28_E29delinsD*	67.0	2.0|0.0	.		66.0	33.0	.	NM_003551	B2R5G7	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000265191.2	hg19	CCDS4197.1																																																																																			.	.	.	none		0.371	NME5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251286.1	NM_003551	
PCDH12	51294	hgsc.bcm.edu	37	5	141336615	141336615	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr5:141336615C>T	ENST00000231484.3	-	1	2012	c.802G>A	c.(802-804)Gcc>Acc	p.A268T	PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	268	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A268T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTCTGTGGCGGTCAGTTTT	0.527																																					p.A268T		Atlas-SNP	.											PCDH12,bladder,carcinoma,0,2	PCDH12	133	.	1	Substitution - Missense(1)	large_intestine(1)	c.G802A						PASS	.						97.0	95.0	96.0					5																	141336615		2203	4300	6503	SO:0001583	missense	51294	exon1			CTGTGGCGGTCAG	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.802G>A	chr5.hg19:g.141336615C>T	ENSP00000231484:p.Ala268Thr	76.0	0.0	.		97.0	37.0	.	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	ENST00000231484.3	hg19	CCDS4269.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727645	0.89390	.	.	ENSG00000113555	ENST00000231484	T	0.61392	0.11	5.32	5.32	0.75619	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.82190	0.4983	M	0.93283	3.4	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.86437	0.1764	10	0.87932	D	0	.	16.5409	0.84384	0.0:1.0:0.0:0.0	.	268	Q9NPG4	PCD12_HUMAN	T	268	ENSP00000231484:A268T	ENSP00000231484:A268T	A	-	1	0	PCDH12	141316799	1.000000	0.71417	0.991000	0.47740	0.932000	0.56968	7.651000	0.83577	2.767000	0.95098	0.655000	0.94253	GCC	.	.	.	none		0.527	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
PHYKPL	85007	hgsc.bcm.edu	37	5	177642285	177642285	+	Silent	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr5:177642285C>T	ENST00000308158.5	-	9	1308	c.1074G>A	c.(1072-1074)ggG>ggA	p.G358G	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	358						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	ACCTGACATCCCCGACGATGG	0.567																																					p.G358G		Atlas-SNP	.											.	AGXT2L2	51	.	0			c.G1074A						PASS	.						42.0	39.0	40.0					5																	177642285		2203	4300	6503	SO:0001819	synonymous_variant	85007	exon9			GACATCCCCGACG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1074G>A	chr5.hg19:g.177642285C>T		62.0	0.0	.		53.0	27.0	.	NM_153373	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	hg19	CCDS4434.1																																																																																			.	.	.	none		0.567	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
KCTD20	222658	hgsc.bcm.edu	37	6	36454734	36454734	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr6:36454734C>T	ENST00000373731.2	+	8	1433	c.1042C>T	c.(1042-1044)Cgc>Tgc	p.R348C	KCTD20_ENST00000449081.2_Missense_Mutation_p.R182C|KCTD20_ENST00000544295.1_Missense_Mutation_p.R102C|KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000536244.1_Missense_Mutation_p.R203C	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	348					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						TTATGTACAACGCCCCTTCAT	0.463																																					p.R348C		Atlas-SNP	.											.	KCTD20	37	.	0			c.C1042T						PASS	.						90.0	96.0	94.0					6																	36454734		2203	4300	6503	SO:0001583	missense	222658	exon8			GTACAACGCCCCT	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.1042C>T	chr6.hg19:g.36454734C>T	ENSP00000362836:p.Arg348Cys	182.0	0.0	.		119.0	45.0	.	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	hg19	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701883	0.88924	.	.	ENSG00000112078	ENST00000373731;ENST00000544295;ENST00000449081;ENST00000536244	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	6.03	6.03	0.97812	.	0.061169	0.64402	N	0.000003	D	0.87148	0.6105	L	0.53561	1.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.87043	0.2142	10	0.56958	D	0.05	-18.2215	15.2928	0.73879	0.14:0.86:0.0:0.0	.	182;348	Q7Z5Y7-2;Q7Z5Y7	.;KCD20_HUMAN	C	348;102;182;203	ENSP00000362836:R348C;ENSP00000440150:R102C;ENSP00000412205:R182C;ENSP00000439118:R203C	ENSP00000362836:R348C	R	+	1	0	KCTD20	36562712	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.971000	0.40530	2.861000	0.98227	0.655000	0.94253	CGC	.	.	.	none		0.463	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
ULBP1	80329	hgsc.bcm.edu	37	6	150289835	150289835	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr6:150289835C>A	ENST00000229708.3	+	2	221	c.178C>A	c.(178-180)Cct>Act	p.P60T		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	60	MHC class I alpha-1 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GGATGAAAGGCCTTTTCTTCA	0.453																																					p.P60T		Atlas-SNP	.											.	ULBP1	25	.	0			c.C178A						PASS	.						133.0	133.0	133.0					6																	150289835		2203	4300	6503	SO:0001583	missense	80329	exon2			GAAAGGCCTTTTC	AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.178C>A	chr6.hg19:g.150289835C>A	ENSP00000229708:p.Pro60Thr	213.0	0.0	.		192.0	90.0	.	NM_025218	Q5VY81|Q8IZW3|Q8IZX6	Missense_Mutation	SNP	ENST00000229708.3	hg19	CCDS5223.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.109641	0.00353	.	.	ENSG00000111981	ENST00000367345;ENST00000229708	T;T	0.00682	5.86;5.86	2.2	-4.39	0.03611	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.00144	0.0004	N	0.11927	0.2	0.09310	N	1	B	0.10296	0.003	B	0.17098	0.017	T	0.45101	-0.9284	9	0.72032	D	0.01	.	1.2925	0.02063	0.2296:0.3696:0.2522:0.1487	.	60	Q9BZM6	N2DL1_HUMAN	T	60	ENSP00000356314:P60T;ENSP00000229708:P60T	ENSP00000229708:P60T	P	+	1	0	ULBP1	150331528	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-4.865000	0.00176	-2.597000	0.00453	-0.834000	0.03071	CCT	.	.	.	none		0.453	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042677.2		
MLLT4	4301	hgsc.bcm.edu	37	6	168344092	168344092	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr6:168344092T>A	ENST00000447894.2	+	24	3155	c.3155T>A	c.(3154-3156)cTa>cAa	p.L1052Q	MLLT4_ENST00000366806.2_Missense_Mutation_p.L1052Q|MLLT4_ENST00000507679.1_3'UTR|MLLT4_ENST00000344191.4_Missense_Mutation_p.L1052Q|MLLT4_ENST00000400822.3_Missense_Mutation_p.L1051Q|MLLT4_ENST00000351017.4_Missense_Mutation_p.L1059Q|MLLT4_ENST00000392112.1_Missense_Mutation_p.L1035Q|MLLT4_ENST00000392108.3_Missense_Mutation_p.L1052Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1052	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GATGGACGTCTAGCTGCAGGT	0.458			T	MLL	AL																																p.L1052Q		Atlas-SNP	.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	351	.	0			c.T3155A						PASS	.						244.0	221.0	229.0					6																	168344092		2203	4300	6503	SO:0001583	missense	4301	exon24			GACGTCTAGCTGC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3155T>A	chr6.hg19:g.168344092T>A	ENSP00000404595:p.Leu1052Gln	233.0	0.0	.		250.0	105.0	.	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.7	4.441746	0.83993	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.18	5.18	0.71444	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000010	T	0.76751	0.4031	H	0.97983	4.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.998;0.997	D	0.86288	0.1672	10	0.87932	D	0	-11.2076	15.0548	0.71904	0.0:0.0:0.0:1.0	.	1052;1051;1052;1036	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	Q	1052;1059;1052;1052;1035;1052;1051;1052	ENSP00000341118:L1052Q;ENSP00000252692:L1059Q;ENSP00000375956:L1052Q;ENSP00000355771:L1052Q;ENSP00000375960:L1035Q;ENSP00000383623:L1051Q;ENSP00000404595:L1052Q	ENSP00000345834:L1052Q	L	+	2	0	MLLT4	168086941	1.000000	0.71417	0.015000	0.15790	0.985000	0.73830	7.440000	0.80464	1.954000	0.56735	0.528000	0.53228	CTA	.	.	.	none		0.458	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
C7orf26	79034	hgsc.bcm.edu	37	7	6639834	6639834	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr7:6639834T>G	ENST00000344417.5	+	4	1222	c.955T>G	c.(955-957)Ttc>Gtc	p.F319V	C7orf26_ENST00000359073.5_Missense_Mutation_p.F222V|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	319										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		GCTGATCCTCTTCGACCACAT	0.582																																					p.F319V		Atlas-SNP	.											.	C7orf26	33	.	0			c.T955G						PASS	.						59.0	52.0	54.0					7																	6639834		2203	4300	6503	SO:0001583	missense	79034	exon4			ATCCTCTTCGACC	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.955T>G	chr7.hg19:g.6639834T>G	ENSP00000340220:p.Phe319Val	48.0	0.0	.		46.0	29.0	.	NM_024067	Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	hg19	CCDS5353.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.95|10.95	1.496091|1.496091	0.26774|0.26774	.|.	.|.	ENSG00000146576|ENSG00000146576	ENST00000344417;ENST00000359073|ENST00000445375	T;T|T	0.39997|0.40756	1.05;1.05|1.02	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.213127|.	0.53938|.	D|.	0.000054|.	T|T	0.30103|0.30103	0.0754|0.0754	N|N	0.19112|0.19112	0.55|0.55	0.29914|0.29914	N|N	0.823337|0.823337	B;B|.	0.17038|.	0.02;0.02|.	B;B|.	0.14023|.	0.004;0.01|.	T|T	0.12344|0.12344	-1.0551|-1.0551	10|7	0.14656|0.09084	T|T	0.56|0.74	-26.1927|-26.1927	13.6493|13.6493	0.62301|0.62301	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	222;319|.	Q96N11-2;Q96N11|.	.;CG026_HUMAN|.	V|R	319;222|56	ENSP00000340220:F319V;ENSP00000351974:F222V|ENSP00000390166:L56R	ENSP00000340220:F319V|ENSP00000390166:L56R	F|L	+|+	1|2	0|0	C7orf26|C7orf26	6606359|6606359	1.000000|1.000000	0.71417|0.71417	0.466000|0.466000	0.27168|0.27168	0.709000|0.709000	0.40893|0.40893	3.987000|3.987000	0.56944|0.56944	2.268000|2.268000	0.75426|0.75426	0.454000|0.454000	0.30748|0.30748	TTC|CTT	.	.	.	none		0.582	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246844.2	NM_024067	
ASB4	51666	hgsc.bcm.edu	37	7	95125264	95125264	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr7:95125264G>A	ENST00000325885.5	+	2	453	c.382G>A	c.(382-384)Gat>Aat	p.D128N	ASB4_ENST00000257621.4_3'UTR|ASB4_ENST00000428113.1_Missense_Mutation_p.D128N	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	128					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			GATCCTCTGTGATCGTGGGGC	0.458																																					p.D128N		Atlas-SNP	.											.	ASB4	52	.	0			c.G382A						PASS	.						210.0	156.0	175.0					7																	95125264		2203	4300	6503	SO:0001583	missense	51666	exon2			CTCTGTGATCGTG	AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.382G>A	chr7.hg19:g.95125264G>A	ENSP00000321388:p.Asp128Asn	101.0	0.0	.		112.0	23.0	.	NM_016116	A4D1H6|O14586|Q14D68|Q8TBT2	Missense_Mutation	SNP	ENST00000325885.5	hg19	CCDS5641.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.692526	0.30052	.	.	ENSG00000005981	ENST00000325885;ENST00000428113	T;T	0.65364	-0.15;-0.15	5.35	5.35	0.76521	Ankyrin repeat-containing domain (3);	0.260422	0.44688	D	0.000432	T	0.48822	0.1521	L	0.38531	1.155	0.33932	D	0.642157	B;B	0.15141	0.009;0.012	B;B	0.15052	0.012;0.011	T	0.56062	-0.8041	10	0.45353	T	0.12	-7.733	7.2877	0.26348	0.2046:0.0:0.7954:0.0	.	128;128	Q9Y574;Q14D68	ASB4_HUMAN;.	N	128	ENSP00000321388:D128N;ENSP00000397070:D128N	ENSP00000321388:D128N	D	+	1	0	ASB4	94963200	1.000000	0.71417	1.000000	0.80357	0.292000	0.27327	3.865000	0.56033	2.680000	0.91292	0.655000	0.94253	GAT	.	.	.	none		0.458	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2	NM_016116	
NRCAM	4897	hgsc.bcm.edu	37	7	107808822	107808822	+	Silent	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr7:107808822G>A	ENST00000425651.2	-	26	3212	c.3213C>T	c.(3211-3213)agC>agT	p.S1071S	NRCAM_ENST00000379028.3_Silent_p.S1071S|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000379022.4_Silent_p.S1071S|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1071	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CAGTAAGATTGCTGATCCTGG	0.363																																					p.S1071S		Atlas-SNP	.											.	NRCAM	267	.	0			c.C3213T						PASS	.						71.0	68.0	69.0					7																	107808822		1891	4119	6010	SO:0001819	synonymous_variant	4897	exon26			AAGATTGCTGATC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3213C>T	chr7.hg19:g.107808822G>A		66.0	0.0	.		81.0	27.0	.	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	G	9.798	1.179809	0.21787	.	.	ENSG00000091129	ENST00000445634	.	.	.	5.75	1.63	0.23807	.	.	.	.	.	T	0.55433	0.1920	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49624	-0.8920	4	.	.	.	.	7.8556	0.29480	0.0:0.3328:0.2964:0.3708	.	.	.	.	V	21	.	.	A	-	2	0	NRCAM	107596058	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.272000	0.33109	0.762000	0.33152	0.650000	0.86243	GCA	.	.	.	none		0.363	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
CHD7	55636	hgsc.bcm.edu	37	8	61654762	61654762	+	Silent	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr8:61654762T>C	ENST00000423902.2	+	2	1250	c.771T>C	c.(769-771)caT>caC	p.H257H	CHD7_ENST00000525508.1_Silent_p.H257H|CHD7_ENST00000524602.1_Silent_p.H257H	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	257					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AGCAGTTCCATCACCACCCCT	0.582																																					p.H257H		Atlas-SNP	.											.	CHD7	534	.	0			c.T771C						PASS	.						119.0	122.0	121.0					8																	61654762		2099	4221	6320	SO:0001819	synonymous_variant	55636	exon2			GTTCCATCACCAC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.771T>C	chr8.hg19:g.61654762T>C		258.0	1.0	.		218.0	89.0	.	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	hg19	CCDS47865.1																																																																																			.	.	.	none		0.582	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
GTF3C5	9328	hgsc.bcm.edu	37	9	135917679	135917680	+	Missense_Mutation	DNP	TT	TT	AA			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr9:135917679_135917680TT>AA	ENST00000372097.5	+	2	682_683	c.359_360TT>AA	c.(358-360)aTT>aAA	p.I120K	GTF3C5_ENST00000342018.8_Missense_Mutation_p.I120K|GTF3C5_ENST00000485692.1_Intron|GTF3C5_ENST00000372108.5_Missense_Mutation_p.I120K|GTF3C5_ENST00000372095.5_Intron|GTF3C5_ENST00000372099.6_Missense_Mutation_p.I111K	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	120					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		ATCTCCACCATTTACAAATTTC	0.535																																					p.I120N|p.I120I		Atlas-SNP	.											.	GTF3C5	46	.	0			c.T359A|c.T360A						PASS	.																																			SO:0001583	missense	9328	exon2			CCACCATTTACAA|CACCATTTACAAA	AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	Exception_encountered	chr9.hg19:g.135917679_135917680delinsAA	ENSP00000361169:p.Ile120Lys	120.0|119.0	0.0	.		97.0|94.0	36.0|35.0	.	NM_012087	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation|Silent	SNP	ENST00000372097.5	hg19	CCDS6958.1																																																																																			.	.	.	none		0.535	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
CACNA1B	774	hgsc.bcm.edu	37	9	140943670	140943670	+	Silent	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr9:140943670T>C	ENST00000371372.1	+	24	3758	c.3613T>C	c.(3613-3615)Ttg>Ctg	p.L1205L	CACNA1B_ENST00000371355.4_Silent_p.L1206L|CACNA1B_ENST00000277551.2_Silent_p.L1205L|CACNA1B_ENST00000371357.1_Silent_p.L1206L|CACNA1B_ENST00000277549.5_Silent_p.L397L|CACNA1B_ENST00000371363.1_Silent_p.L1205L|CACNA1B_ENST00000545473.1_3'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1205					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GATGATCGACTTGGGACTGCT	0.527																																					p.L1205L		Atlas-SNP	.											.	CACNA1B	266	.	0			c.T3613C						PASS	.						177.0	173.0	174.0					9																	140943670		2047	4198	6245	SO:0001819	synonymous_variant	774	exon24			ATCGACTTGGGAC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3613T>C	chr9.hg19:g.140943670T>C		89.0	0.0	.		88.0	38.0	.	NM_001243812	B1AQK5	Silent	SNP	ENST00000371372.1	hg19	CCDS59522.1																																																																																			.	.	.	none		0.527	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
DIP2C	22982	hgsc.bcm.edu	37	10	375449	375449	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr10:375449A>T	ENST00000280886.6	-	30	3764	c.3677T>A	c.(3676-3678)gTc>gAc	p.V1226D		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1226						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CGTGTCTCGGACTTTGTACTG	0.577																																					p.V1226D		Atlas-SNP	.											.	DIP2C	195	.	0			c.T3677A						PASS	.						64.0	55.0	58.0					10																	375449		2203	4300	6503	SO:0001583	missense	22982	exon30			TCTCGGACTTTGT	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3677T>A	chr10.hg19:g.375449A>T	ENSP00000280886:p.Val1226Asp	32.0	0.0	.		54.0	24.0	.	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	hg19	CCDS7054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.376544|5.376544	0.95945|0.95945	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.51574	.|0.7	5.84|5.84	5.84|5.84	0.93424|0.93424	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67211|0.67211	0.2869|0.2869	M|M	0.67397|0.67397	2.05|2.05	0.80722|0.80722	D|D	1|1	.|D	.|0.60575	.|0.988	.|D	.|0.71656	.|0.974	T|T	0.69749|0.69749	-0.5061|-0.5061	5|10	.|0.66056	.|D	.|0.02	-39.2182|-39.2182	16.2141|16.2141	0.82191|0.82191	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1226	.|Q9Y2E4	.|DIP2C_HUMAN	R|D	31|1226;151;75	.|ENSP00000280886:V1226D	.|ENSP00000280886:V1226D	S|V	-|-	3|2	2|0	DIP2C|DIP2C	365449|365449	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.841000|0.841000	0.47740|0.47740	9.339000|9.339000	0.96797|0.96797	2.230000|2.230000	0.72887|0.72887	0.528000|0.528000	0.53228|0.53228	AGT|GTC	.	.	.	none		0.577	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
ZEB1	6935	hgsc.bcm.edu	37	10	31812949	31812949	+	Missense_Mutation	SNP	G	G	T	rs35653460		TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr10:31812949G>T	ENST00000320985.10	+	8	2800	c.2690G>T	c.(2689-2691)cGg>cTg	p.R897L	ZEB1_ENST00000560721.2_Missense_Mutation_p.R877L|ZEB1_ENST00000446923.2_Missense_Mutation_p.R881L|ZEB1_ENST00000542815.3_Missense_Mutation_p.R830L|ZEB1_ENST00000361642.5_Missense_Mutation_p.R898L			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	897					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R897Q(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				AAGAAAATGCGGAAGACAGAA	0.373																																					p.R898L	Ovarian(40;423 959 14296 36701 49589)	Atlas-SNP	.											ZEB1,rectum,carcinoma,0,1	ZEB1	173	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2693T						PASS	.						111.0	111.0	111.0					10																	31812949		2203	4300	6503	SO:0001583	missense	6935	exon8			AAATGCGGAAGAC	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2690G>T	chr10.hg19:g.31812949G>T	ENSP00000319248:p.Arg897Leu	140.0	0.0	.		147.0	59.0	.	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	hg19	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777667	0.70107	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000543514;ENST00000446923	T;T;T;T;T	0.07327	3.2;3.2;3.2;3.2;3.2	5.72	4.8	0.61643	.	0.369405	0.21055	N	0.080939	T	0.15435	0.0372	L	0.27053	0.805	0.41478	D	0.988147	D;P;B;P;P	0.69078	0.997;0.826;0.208;0.826;0.826	D;B;B;B;B	0.69824	0.966;0.334;0.09;0.334;0.177	T	0.02901	-1.1096	10	0.52906	T	0.07	-12.9237	10.1047	0.42526	0.071:0.1383:0.7907:0.0	.	830;881;877;898;897	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	L	679;897;898;892;830;897;877;788;881	ENSP00000444282:R679L;ENSP00000354487:R898L;ENSP00000444891:R830L;ENSP00000319248:R897L;ENSP00000391612:R881L	ENSP00000319248:R897L	R	+	2	0	ZEB1	31852955	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.665000	0.68052	1.410000	0.46936	0.585000	0.79938	CGG	.	G|0.987;A|0.013	.	alt		0.373	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
SEC23IP	11196	hgsc.bcm.edu	37	10	121692658	121692658	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr10:121692658T>C	ENST00000369075.3	+	17	2972	c.2900T>C	c.(2899-2901)cTt>cCt	p.L967P	SEC23IP_ENST00000543134.1_Missense_Mutation_p.L756P|SEC23IP_ENST00000475542.1_3'UTR	NM_007190.3	NP_009121.1	Q9Y6Y8	S23IP_HUMAN	SEC23 interacting protein	967	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				acrosome assembly (GO:0001675)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|single fertilization (GO:0007338)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear endoplasmic reticulum (GO:0097038)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	36		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		CTTTTCGCTCTTCAGAGTCAC	0.383																																					p.L967P		Atlas-SNP	.											.	SEC23IP	100	.	0			c.T2900C						PASS	.						128.0	125.0	126.0					10																	121692658		2203	4300	6503	SO:0001583	missense	11196	exon17			TCGCTCTTCAGAG	AB019435	CCDS7618.1	10q26.11-q26.12	2013-01-10			ENSG00000107651	ENSG00000107651		"""Sterile alpha motif (SAM) domain containing"""	17018	protein-coding gene	gene with protein product						10400679	Standard	NM_007190		Approved	p125	uc001leu.2	Q9Y6Y8	OTTHUMG00000019161	ENST00000369075.3:c.2900T>C	chr10.hg19:g.121692658T>C	ENSP00000358071:p.Leu967Pro	128.0	0.0	.		152.0	68.0	.	NM_007190	D3DRD2|Q8IXH5|Q9BUK5	Missense_Mutation	SNP	ENST00000369075.3	hg19	CCDS7618.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.667691	0.67814	.	.	ENSG00000107651	ENST00000369075;ENST00000543134	T;T	0.39406	1.08;1.12	5.28	4.14	0.48551	DDHD (2);	0.000000	0.85682	D	0.000000	T	0.65831	0.2729	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.991;0.998	T	0.69254	-0.5193	10	0.62326	D	0.03	-23.9312	11.2264	0.48886	0.0:0.0726:0.0:0.9274	.	756;967	F5H0L8;Q9Y6Y8	.;S23IP_HUMAN	P	967;756	ENSP00000358071:L967P;ENSP00000438773:L756P	ENSP00000358071:L967P	L	+	2	0	SEC23IP	121682648	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.655000	0.83696	0.950000	0.37743	-0.256000	0.11100	CTT	.	.	.	none		0.383	SEC23IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050688.1		
DOCK1	1793	hgsc.bcm.edu	37	10	128788791	128788791	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr10:128788791C>G	ENST00000280333.6	+	6	506	c.397C>G	c.(397-399)Ctt>Gtt	p.L133V		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	133					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ATCACAAATTCTTTCTGGAAC	0.393																																					p.L133V		Atlas-SNP	.											.	DOCK1	188	.	0			c.C397G						PASS	.						109.0	103.0	105.0					10																	128788791		1909	4134	6043	SO:0001583	missense	1793	exon6			CAAATTCTTTCTG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.397C>G	chr10.hg19:g.128788791C>G	ENSP00000280333:p.Leu133Val	48.0	0.0	.		29.0	12.0	.	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	hg19		.	.	.	.	.	.	.	.	.	.	C	14.43	2.532331	0.45073	.	.	ENSG00000150760	ENST00000280333	T	0.47177	0.85	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000001	T	0.47911	0.1471	L	0.61218	1.895	0.53688	D	0.999978	B;B	0.28850	0.122;0.225	B;B	0.26202	0.067;0.061	T	0.52366	-0.8585	10	0.51188	T	0.08	.	17.7282	0.88370	0.0:1.0:0.0:0.0	.	133;133	B2RUU3;Q14185	.;DOCK1_HUMAN	V	133	ENSP00000280333:L133V	ENSP00000280333:L133V	L	+	1	0	DOCK1	128678781	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	4.454000	0.60068	2.510000	0.84645	0.555000	0.69702	CTT	.	.	.	none		0.393	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
OR56A1	120796	hgsc.bcm.edu	37	11	6048449	6048449	+	Silent	SNP	A	A	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr11:6048449A>G	ENST00000316650.5	-	1	522	c.486T>C	c.(484-486)ctT>ctC	p.L162L		NM_001001917.2	NP_001001917.2	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A, member 1	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(22)|ovary(2)	33		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGGTGCAGTAAGAAGCGCAT	0.498																																					p.L162L		Atlas-SNP	.											.	OR56A1	73	.	0			c.T486C						PASS	.						142.0	125.0	131.0					11																	6048449		2201	4296	6497	SO:0001819	synonymous_variant	120796	exon1			TGCAGTAAGAAGC	AB065821	CCDS31405.1	11p15.4	2012-08-09			ENSG00000180934	ENSG00000180934		"""GPCR / Class A : Olfactory receptors"""	14781	protein-coding gene	gene with protein product							Standard	NM_001001917		Approved		uc010qzw.2	Q8NGH5	OTTHUMG00000165377	ENST00000316650.5:c.486T>C	chr11.hg19:g.6048449A>G		148.0	0.0	.		125.0	56.0	.	NM_001001917	B2RNI2|Q6IFL0	Silent	SNP	ENST00000316650.5	hg19	CCDS31405.1																																																																																			.	.	.	none		0.498	OR56A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383757.1	NM_001001917	
VWF	7450	hgsc.bcm.edu	37	12	6143881	6143881	+	Silent	SNP	G	G	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr12:6143881G>T	ENST00000261405.5	-	20	2912	c.2658C>A	c.(2656-2658)ccC>ccA	p.P886P		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	886	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GGCACTCCCCGGGGAACAGGT	0.602																																					p.P886P		Atlas-SNP	.											.	VWF	338	.	0			c.C2658A						PASS	.						154.0	126.0	136.0					12																	6143881		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon20			CTCCCCGGGGAAC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2658C>A	chr12.hg19:g.6143881G>T		105.0	0.0	.		129.0	6.0	.	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.	.	none		0.602	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
MLF2	8079	hgsc.bcm.edu	37	12	6859057	6859057	+	Silent	SNP	C	C	A	rs201104363	byFrequency	TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr12:6859057C>A	ENST00000203630.5	-	7	1160	c.516G>T	c.(514-516)acG>acT	p.T172T	MLF2_ENST00000539187.1_Silent_p.T172T|MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000435120.1_Silent_p.T172T|MLF2_ENST00000542154.1_Silent_p.T172T			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	172					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.T172T(1)		kidney(2)|large_intestine(3)|lung(4)	9						CCTGGTCCCCCGTGCGATGGT	0.612																																					p.T172T		Atlas-SNP	.											MLF2,NS,carcinoma,0,1	MLF2	26	.	1	Substitution - coding silent(1)	lung(1)	c.G516T						PASS	.						109.0	91.0	97.0					12																	6859057		2203	4300	6503	SO:0001819	synonymous_variant	8079	exon7			GTCCCCCGTGCGA	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.516G>T	chr12.hg19:g.6859057C>A		109.0	0.0	.		131.0	6.0	.	NM_005439		Silent	SNP	ENST00000203630.5	hg19	CCDS8559.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502929	0.26949	.	.	ENSG00000089693	ENST00000537126	.	.	.	5.83	-11.7	0.00046	.	.	.	.	.	T	0.63034	0.2477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.80908	-0.1172	5	0.87932	D	0	.	11.3127	0.49372	0.0696:0.0898:0.1311:0.7095	.	.	.	.	L	183	.	ENSP00000439789:R183L	R	-	2	0	MLF2	6729318	0.000000	0.05858	0.093000	0.20910	0.970000	0.65996	-2.378000	0.01068	-3.057000	0.00258	-1.069000	0.02264	CGG	.	C|0.999;T|0.001	.	alt		0.612	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400733.2		
C2CD5	9847	hgsc.bcm.edu	37	12	22623804	22623804	+	Silent	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr12:22623804C>T	ENST00000333957.4	-	21	2655	c.2400G>A	c.(2398-2400)caG>caA	p.Q800Q	C2CD5_ENST00000545552.1_Silent_p.Q813Q|C2CD5_ENST00000542676.1_Silent_p.Q800Q|C2CD5_ENST00000446597.1_Silent_p.Q800Q|C2CD5_ENST00000536386.1_Silent_p.Q802Q|C2CD5_ENST00000544930.1_Silent_p.Q615Q|C2CD5_ENST00000396028.2_Silent_p.Q791Q	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	800					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										TTTGTAAAGCCTGATTTTTGT	0.343																																					p.Q800Q		Atlas-SNP	.											.	.	.	.	0			c.G2400A						PASS	.						159.0	149.0	152.0					12																	22623804		2203	4299	6502	SO:0001819	synonymous_variant	9847	exon21			TAAAGCCTGATTT	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2400G>A	chr12.hg19:g.22623804C>T		78.0	0.0	.		93.0	27.0	.	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	8.519	0.868292	0.17250	.	.	ENSG00000111731	ENST00000539615	.	.	.	4.99	3.02	0.34903	.	.	.	.	.	T	0.47691	0.1459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39881	-0.9592	4	.	.	.	-10.4578	4.4442	0.11589	0.0:0.6458:0.0:0.3542	.	.	.	.	K	84	.	.	R	-	2	0	KIAA0528	22515071	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.959000	0.40412	1.338000	0.45544	0.591000	0.81541	AGG	.	.	.	none		0.343	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
ITGB7	3695	hgsc.bcm.edu	37	12	53586547	53586547	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr12:53586547T>C	ENST00000267082.5	-	13	2105	c.1874A>G	c.(1873-1875)cAg>cGg	p.Q625R	ITGB7_ENST00000550743.2_Intron|ITGB7_ENST00000338737.4_Intron|ITGB7_ENST00000422257.3_Missense_Mutation_p.Q625R	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	625	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTCCAAGCACTGGCAGCGGTT	0.597																																					p.Q625R		Atlas-SNP	.											.	ITGB7	60	.	0			c.A1874G						PASS	.						117.0	95.0	102.0					12																	53586547		2203	4300	6503	SO:0001583	missense	3695	exon13			AAGCACTGGCAGC		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1874A>G	chr12.hg19:g.53586547T>C	ENSP00000267082:p.Gln625Arg	75.0	0.0	.		106.0	65.0	.	NM_000889	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	hg19	CCDS8849.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.372998	0.42105	.	.	ENSG00000139626	ENST00000422257;ENST00000267082	D;D	0.94046	-3.34;-3.34	5.13	5.13	0.70059	EGF, extracellular (1);	0.000000	0.40385	N	0.001119	D	0.87533	0.6201	N	0.20685	0.6	0.80722	D	1	P	0.40515	0.719	B	0.39258	0.295	D	0.86926	0.2070	10	0.30078	T	0.28	.	14.3146	0.66440	0.0:0.0:0.0:1.0	.	625	P26010	ITB7_HUMAN	R	625	ENSP00000408741:Q625R;ENSP00000267082:Q625R	ENSP00000267082:Q625R	Q	-	2	0	ITGB7	51872814	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	1.901000	0.39838	2.087000	0.62958	0.454000	0.30748	CAG	.	.	.	none		0.597	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
SHMT2	6472	hgsc.bcm.edu	37	12	57625342	57625342	+	Splice_Site	SNP	A	A	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr12:57625342A>G	ENST00000328923.3	+	3	762	c.310A>G	c.(310-312)Aga>Gga	p.R104G	SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Splice_Site_p.R83G|SHMT2_ENST00000557487.1_Splice_Site_p.R104G|SHMT2_ENST00000449049.3_Splice_Site_p.R83G|SHMT2_ENST00000414700.3_Splice_Site_p.R83G|SHMT2_ENST00000393827.4_Intron	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	104					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TCCTGGCAAGAGGTGAGGGCT	0.597																																					p.R104G	Esophageal Squamous(150;1369 2416 49071 49364)	Atlas-SNP	.											.	SHMT2	40	.	0			c.A310G						PASS	.						55.0	52.0	53.0					12																	57625342		2203	4300	6503	SO:0001630	splice_region_variant	6472	exon3			GGCAAGAGGTGAG	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.311+1A>G	chr12.hg19:g.57625342A>G		58.0	0.0	.		92.0	4.0	.	NM_005412	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	hg19	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.700417	0.88924	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000556689;ENST00000414700;ENST00000557703;ENST00000553529;ENST00000554310;ENST00000557427;ENST00000553474;ENST00000555773;ENST00000554975;ENST00000449049;ENST00000556737	T;T;T;T;T;T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	4.71	4.71	0.59529	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.094386	0.64402	D	0.000001	D	0.85048	0.5608	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	D	0.90665	0.4593	10	0.87932	D	0	.	13.611	0.62078	1.0:0.0:0.0:0.0	.	104;104	Q8N1A5;P34897	.;GLYM_HUMAN	G	104;104;104;83;83;83;83;83;83;83;83;83;83	ENSP00000333667:R104G;ENSP00000452315:R104G;ENSP00000452035:R104G;ENSP00000406881:R83G;ENSP00000450452:R83G;ENSP00000452161:R83G;ENSP00000450893:R83G;ENSP00000452045:R83G;ENSP00000452419:R83G;ENSP00000451968:R83G;ENSP00000452404:R83G;ENSP00000413770:R83G;ENSP00000451495:R83G	ENSP00000333667:R104G	R	+	1	2	SHMT2	55911609	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.024000	0.70857	2.128000	0.65567	0.459000	0.35465	AGA	.	.	.	none		0.597	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	Missense_Mutation
FSCB	84075	hgsc.bcm.edu	37	14	44975261	44975261	+	Silent	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr14:44975261C>T	ENST00000340446.4	-	1	1221	c.930G>A	c.(928-930)gcG>gcA	p.A310A	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	310						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CAGAATTCTCCGCAACTGCAG	0.527																																					p.A310A		Atlas-SNP	.											.	FSCB	173	.	0			c.G930A						PASS	.						48.0	51.0	50.0					14																	44975261		2203	4300	6503	SO:0001819	synonymous_variant	84075	exon1			ATTCTCCGCAACT	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.930G>A	chr14.hg19:g.44975261C>T		88.0	0.0	.		88.0	38.0	.	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	ENST00000340446.4	hg19	CCDS9679.1																																																																																			.	.	.	none		0.527	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
TDP1	55775	hgsc.bcm.edu	37	14	90429932	90429932	+	Silent	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr14:90429932G>A	ENST00000335725.4	+	3	724	c.474G>A	c.(472-474)ctG>ctA	p.L158L	TDP1_ENST00000393452.3_Silent_p.L158L|TDP1_ENST00000555565.1_Intron|TDP1_ENST00000555880.1_Silent_p.L158L|TDP1_ENST00000393454.2_Silent_p.L158L|TDP1_ENST00000357382.3_5'UTR	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	158					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		GGGACATGCTGGATAAAGGGA	0.512								Repair of DNA-protein crosslinks																													p.L158L		Atlas-SNP	.											.	TDP1	47	.	0			c.G474A						PASS	.						63.0	59.0	60.0					14																	90429932		2203	4300	6503	SO:0001819	synonymous_variant	55775	exon3			CATGCTGGATAAA	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.474G>A	chr14.hg19:g.90429932G>A		137.0	0.0	.		125.0	51.0	.	NM_018319	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	ENST00000335725.4	hg19	CCDS9888.1																																																																																			.	.	.	none		0.512	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319	
SRRM2	23524	hgsc.bcm.edu	37	16	2814253	2814253	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr16:2814253G>A	ENST00000301740.8	+	11	4273	c.3724G>A	c.(3724-3726)Gta>Ata	p.V1242I		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1242	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AATGGAGGTGGTAGAGAAGTC	0.443																																					p.V1242I		Atlas-SNP	.											.	SRRM2	263	.	0			c.G3724A						PASS	.						106.0	113.0	111.0					16																	2814253		2198	4300	6498	SO:0001583	missense	23524	exon11			GAGGTGGTAGAGA	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3724G>A	chr16.hg19:g.2814253G>A	ENSP00000301740:p.Val1242Ile	221.0	0.0	.		303.0	72.0	.	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	G	3.875	-0.027037	0.07589	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.24350	1.86	6.17	2.02	0.26589	.	0.793322	0.11547	N	0.553197	T	0.13713	0.0332	N	0.16478	0.41	0.09310	N	0.999996	B	0.06786	0.001	B	0.06405	0.002	T	0.33292	-0.9874	10	0.20519	T	0.43	0.1551	6.7948	0.23719	0.375:0.0:0.625:0.0	.	1242	Q9UQ35	SRRM2_HUMAN	I	1242;1242;494	ENSP00000301740:V1242I	ENSP00000301740:V1242I	V	+	1	0	SRRM2	2754254	0.001000	0.12720	0.868000	0.34077	0.982000	0.71751	-0.011000	0.12721	0.445000	0.26639	0.655000	0.94253	GTA	.	.	.	none		0.443	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SRCAP	10847	hgsc.bcm.edu	37	16	30735227	30735227	+	Silent	SNP	A	A	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr16:30735227A>C	ENST00000262518.4	+	25	4867	c.4482A>C	c.(4480-4482)gcA>gcC	p.A1494A	SRCAP_ENST00000395059.2_Silent_p.A1432A|SRCAP_ENST00000344771.4_Silent_p.A1336A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1494	Pro-rich.			A -> Q (in Ref. 6; AAD39760). {ECO:0000305}.	histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCTCCTTGGCACCATCTGGTG	0.587																																					p.A1494A		Atlas-SNP	.											.	SRCAP	298	.	0			c.A4482C						PASS	.						113.0	102.0	106.0					16																	30735227		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon25			CTTGGCACCATCT	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4482A>C	chr16.hg19:g.30735227A>C		133.0	0.0	.		165.0	8.0	.	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.	.	none		0.587	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
C16orf86	388284	hgsc.bcm.edu	37	16	67702137	67702137	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr16:67702137C>G	ENST00000403458.4	+	4	743	c.588C>G	c.(586-588)taC>taG	p.Y196*	ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602644.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	196										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		TGTACCAGTACGTCAACTATT	0.667											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y196X		Atlas-SNP	.											.	C16orf86	20	.	0			c.C588G						PASS	.						15.0	16.0	16.0					16																	67702137		2190	4293	6483	SO:0001587	stop_gained	388284	exon4			CCAGTACGTCAAC		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.588C>G	chr16.hg19:g.67702137C>G	ENSP00000384117:p.Tyr196*	25.0	0.0	.	1101	32.0	18.0	.	NM_001012984	B5MCW6	Nonsense_Mutation	SNP	ENST00000403458.4	hg19	CCDS32468.2	.	.	.	.	.	.	.	.	.	.	C	32	5.154005	0.94645	.	.	ENSG00000159761	ENST00000403458	.	.	.	5.95	2.97	0.34412	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8901	9.6968	0.40163	0.0:0.7838:0.0:0.2162	.	.	.	.	X	196	.	ENSP00000384117:Y196X	Y	+	3	2	C16orf86	66259638	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	0.259000	0.18405	0.426000	0.26116	0.563000	0.77884	TAC	.	.	.	none		0.667	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
SCARF1	8578	hgsc.bcm.edu	37	17	1538231	1538231	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:1538231T>C	ENST00000263071.4	-	11	2363	c.2314A>G	c.(2314-2316)Aga>Gga	p.R772G	SCARF1_ENST00000348987.3_Missense_Mutation_p.R686G|SCARF1_ENST00000571272.1_3'UTR	NM_003693.2|NM_145350.1	NP_003684.2|NP_663325.1	Q14162	SREC_HUMAN	scavenger receptor class F, member 1	772	Gly-rich.				cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|dendrite development (GO:0016358)|neuron remodeling (GO:0016322)|positive regulation of axon regeneration (GO:0048680)|positive regulation of neuron projection development (GO:0010976)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|kidney(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TCCTCTGGTCTGACTGCCATA	0.657																																					p.R772G		Atlas-SNP	.											.	SCARF1	46	.	0			c.A2314G						PASS	.						34.0	39.0	37.0					17																	1538231		2203	4298	6501	SO:0001583	missense	8578	exon11			CTGGTCTGACTGC	D63483	CCDS11007.1, CCDS45564.1	17p13.3	2008-07-18			ENSG00000074660	ENSG00000074660			16820	protein-coding gene	gene with protein product	"""scavenger receptor expressed by endothelial cells"", ""acetyl LDL receptor"""	607873				9395444, 8590280	Standard	NM_003693		Approved	SREC, KIAA0149	uc002fsz.2	Q14162	OTTHUMG00000090555	ENST00000263071.4:c.2314A>G	chr17.hg19:g.1538231T>C	ENSP00000263071:p.Arg772Gly	75.0	0.0	.		87.0	51.0	.	NM_003693	A8MQ05|O43701|Q8NHD2|Q8NHD3|Q8NHD4|Q8NHD5	Missense_Mutation	SNP	ENST00000263071.4	hg19	CCDS11007.1	.	.	.	.	.	.	.	.	.	.	t	9.073	0.997418	0.19043	.	.	ENSG00000074660	ENST00000263071;ENST00000348987	T;T	0.20463	2.07;2.77	4.68	-1.08	0.09936	.	0.960477	0.08537	N	0.931174	T	0.08980	0.0222	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.38993	-0.9635	10	0.24483	T	0.36	-2.2932	9.7539	0.40492	0.0:0.3094:0.0:0.6906	.	686;772	Q14162-2;Q14162	.;SREC_HUMAN	G	772;686	ENSP00000263071:R772G;ENSP00000323964:R686G	ENSP00000263071:R772G	R	-	1	2	SCARF1	1484981	0.000000	0.05858	0.004000	0.12327	0.092000	0.18411	-0.431000	0.06965	-0.332000	0.08489	0.450000	0.29827	AGA	.	.	.	none		0.657	SCARF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207081.4	NM_003693	
CAMKK1	84254	hgsc.bcm.edu	37	17	3788622	3788622	+	Splice_Site	SNP	C	C	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:3788622C>G	ENST00000348335.2	-	2	508	c.360G>C	c.(358-360)gaG>gaC	p.E120D	CAMKK1_ENST00000381771.2_Splice_Site_p.E120D|CAMKK1_ENST00000158166.5_Splice_Site_p.E120D|CAMKK1_ENST00000381769.2_Splice_Site_p.E147D	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	120					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		CCCCACCAACCTCTGCATCTG	0.622																																					p.E120D		Atlas-SNP	.											.	CAMKK1	70	.	0			c.G360C						PASS	.						12.0	15.0	14.0					17																	3788622		2182	4265	6447	SO:0001630	splice_region_variant	84254	exon2			ACCAACCTCTGCA	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.360+1G>C	chr17.hg19:g.3788622C>G		39.0	0.0	.		46.0	14.0	.	NM_032294	Q9BQH3	Missense_Mutation	SNP	ENST00000348335.2	hg19	CCDS11038.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677258	0.29783	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.246503	0.41938	D	0.000799	T	0.31513	0.0799	N	0.19112	0.55	0.44316	D	0.997194	B;B	0.13145	0.007;0.002	B;B	0.14578	0.011;0.005	T	0.11494	-1.0585	9	.	.	.	-39.5364	12.0428	0.53462	0.1724:0.8276:0.0:0.0	.	120;120	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	D	147;120;120;120	ENSP00000371188:E147D;ENSP00000323118:E120D;ENSP00000371190:E120D;ENSP00000158166:E120D	.	E	-	3	2	CAMKK1	3735371	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	2.413000	0.44618	2.632000	0.89209	0.491000	0.48974	GAG	.	.	.	none		0.622	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207	Missense_Mutation
ZNF232	7775	hgsc.bcm.edu	37	17	5009512	5009512	+	Silent	SNP	A	A	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:5009512A>G	ENST00000250076.3	-	5	1596	c.942T>C	c.(940-942)taT>taC	p.Y314Y	ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Silent_p.Y305Y|ZNF232_ENST00000575538.1_5'Flank	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	287					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GATGTGAGTTATAAATGAAGG	0.428																																					p.Y314Y		Atlas-SNP	.											.	ZNF232	42	.	0			c.T942C						PASS	.						111.0	110.0	111.0					17																	5009512		2203	4300	6503	SO:0001819	synonymous_variant	7775	exon5			TGAGTTATAAATG	AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.942T>C	chr17.hg19:g.5009512A>G		136.0	0.0	.		188.0	47.0	.	NM_014519		Silent	SNP	ENST00000250076.3	hg19	CCDS11068.1																																																																																			.	.	.	none		0.428	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519	
SENP3	26168	hgsc.bcm.edu	37	17	7468055	7468055	+	Missense_Mutation	SNP	G	G	T	rs544419637		TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:7468055G>T	ENST00000429205.2	+	3	878	c.829G>T	c.(829-831)Ggg>Tgg	p.G277W	SENP3_ENST00000321337.7_Missense_Mutation_p.G277W|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000578868.1_3'UTR			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	277						cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				GTGCAGCATCGGGGACCATGT	0.617																																					p.G277W		Atlas-SNP	.											.	SENP3	18	.	0			c.G829T						PASS	.						48.0	50.0	49.0					17																	7468055		1964	4161	6125	SO:0001583	missense	26168	exon3			AGCATCGGGGACC	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.829G>T	chr17.hg19:g.7468055G>T	ENSP00000403712:p.Gly277Trp	92.0	0.0	.		129.0	7.0	.	NM_015670	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Missense_Mutation	SNP	ENST00000429205.2	hg19		.	.	.	.	.	.	.	.	.	.	G	19.94	3.920082	0.73098	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	T;T	0.57752	0.38;0.39	5.98	5.98	0.97165	.	0.000000	0.64402	D	0.000019	T	0.59432	0.2193	N	0.19112	0.55	0.42176	D	0.99166	D	0.89917	1.0	D	0.87578	0.998	T	0.60591	-0.7233	10	0.48119	T	0.1	-14.5285	15.9367	0.79717	0.0:0.0:1.0:0.0	.	277	Q9H4L4	SENP3_HUMAN	W	277	ENSP00000314029:G277W;ENSP00000403712:G277W	ENSP00000314029:G277W	G	+	1	0	SENP3	7408779	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.877000	0.69675	2.837000	0.97791	0.591000	0.81541	GGG	.	.	.	none		0.617	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670	
SLC13A2	9058	hgsc.bcm.edu	37	17	26818545	26818545	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:26818545G>A	ENST00000314669.5	+	5	1085	c.665G>A	c.(664-666)aGc>aAc	p.S222N	SLC13A2_ENST00000537681.1_Missense_Mutation_p.S151N|SLC13A2_ENST00000444914.3_Missense_Mutation_p.S271N|SLC13A2_ENST00000545060.1_Missense_Mutation_p.S179N	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	222					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CAGTGCATGAGCCTGTGCGTG	0.617																																					p.S271N		Atlas-SNP	.											.	SLC13A2	125	.	0			c.G812A						PASS	.						69.0	64.0	66.0					17																	26818545		2203	4300	6503	SO:0001583	missense	9058	exon5			GCATGAGCCTGTG	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.665G>A	chr17.hg19:g.26818545G>A	ENSP00000316202:p.Ser222Asn	131.0	0.0	.		150.0	46.0	.	NM_001145975	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	hg19	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.265898	0.40095	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000541739;ENST00000537681	T;T;T;T	0.03124	4.04;4.04;4.04;4.04	5.62	4.63	0.57726	.	0.200462	0.64402	D	0.000010	T	0.14227	0.0344	M	0.81341	2.54	0.42186	D	0.991709	D;B;B;B;B	0.65815	0.995;0.007;0.041;0.138;0.041	P;B;B;B;B	0.62560	0.904;0.098;0.081;0.073;0.081	T	0.01621	-1.1310	10	0.35671	T	0.21	-13.5366	9.6615	0.39958	0.0762:0.413:0.5108:0.0	.	179;271;178;151;222	F5GWV6;E7ETH5;B4E1M6;G3V1L2;Q13183	.;.;.;.;S13A2_HUMAN	N	222;271;179;178;151	ENSP00000316202:S222N;ENSP00000392411:S271N;ENSP00000441935:S179N;ENSP00000440802:S151N	ENSP00000316202:S222N	S	+	2	0	SLC13A2	23842672	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	2.293000	0.43558	1.346000	0.45694	0.557000	0.71058	AGC	.	.	.	none		0.617	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984	
SPAG5	10615	hgsc.bcm.edu	37	17	26919846	26919846	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:26919846T>C	ENST00000321765.5	-	3	748	c.416A>G	c.(415-417)cAg>cGg	p.Q139R		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	139					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					GTCTTGTTGCTGCCCCAGTGG	0.453																																					p.Q139R		Atlas-SNP	.											.	SPAG5	92	.	0			c.A416G						PASS	.						190.0	176.0	180.0					17																	26919846		2203	4300	6503	SO:0001583	missense	10615	exon3			TGTTGCTGCCCCA	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.416A>G	chr17.hg19:g.26919846T>C	ENSP00000323300:p.Gln139Arg	185.0	0.0	.		253.0	145.0	.	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	hg19	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	T	6.118	0.390021	0.11581	.	.	ENSG00000076382	ENST00000321765	T	0.25912	1.77	5.94	2.35	0.29111	.	0.760636	0.11855	N	0.522906	T	0.23210	0.0561	M	0.67953	2.075	0.25392	N	0.988515	P	0.49090	0.919	B	0.39738	0.308	T	0.32322	-0.9911	10	0.87932	D	0	-0.1373	3.1967	0.06635	0.1858:0.187:0.0:0.6271	.	139	Q96R06	SPAG5_HUMAN	R	139	ENSP00000323300:Q139R	ENSP00000323300:Q139R	Q	-	2	0	SPAG5	23943973	0.917000	0.31117	0.981000	0.43875	0.152000	0.21847	0.898000	0.28404	1.069000	0.40788	0.533000	0.62120	CAG	.	.	.	none		0.453	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
CTAGE1	64693	hgsc.bcm.edu	37	18	19997258	19997258	+	5'Flank	SNP	G	G	A	rs372127240		TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr18:19997258G>A	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.R173W			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					ATCTCCAACCGTTCTTCATTC	0.388																																					p.R173W		Atlas-SNP	.											CTAGE1_ENST00000391403,colon,carcinoma,0,2	CTAGE1	146	.	0			c.C517T						PASS	.	G	TRP/ARG	0,4314		0,0,2157	95.0	100.0	99.0		517	0.9	0.0	18		99	2,8574		0,2,4286	no	missense	CTAGE1	NM_172241.2	101	0,2,6443	AA,AG,GG		0.0233,0.0,0.0155	probably-damaging	173/746	19997258	2,12888	2157	4288	6445	SO:0001631	upstream_gene_variant	64693	exon1			CCAACCGTTCTTC	AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			chr18.hg19:g.19997258G>A	Exception_encountered	253.0	0.0	.		169.0	71.0	.	NM_172241	B0YIZ3	Missense_Mutation	SNP	ENST00000525417.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.14	1.849249	0.32699	0.0	2.33E-4	ENSG00000212710	ENST00000391403	T	0.29655	1.56	0.909	0.909	0.19332	.	.	.	.	.	T	0.47581	0.1453	M	0.78637	2.42	0.09310	N	1	D	0.76494	0.999	D	0.64321	0.924	T	0.22941	-1.0202	8	.	.	.	.	5.2011	0.15264	0.0:0.0:1.0:0.0	.	173	Q96RT6	CTGE2_HUMAN	W	173	ENSP00000375220:R173W	.	R	-	1	2	CTAGE1	18251256	0.980000	0.34600	0.003000	0.11579	0.004000	0.04260	0.579000	0.23788	0.776000	0.33473	0.449000	0.29647	CGG	.	.	.	weak		0.388	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241	
LGI4	163175	hgsc.bcm.edu	37	19	35617247	35617247	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr19:35617247A>G	ENST00000310123.3	-	8	1745	c.1226T>C	c.(1225-1227)gTc>gCc	p.V409A	LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000392225.3_Missense_Mutation_p.S435P	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	409					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TGTGGCATAGACATCCTCGGC	0.682																																					p.V409A		Atlas-SNP	.											.	LGI4	32	.	0			c.T1226C						PASS	.						35.0	32.0	33.0					19																	35617247		2203	4300	6503	SO:0001583	missense	163175	exon8			GCATAGACATCCT	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.1226T>C	chr19.hg19:g.35617247A>G	ENSP00000312273:p.Val409Ala	30.0	0.0	.		36.0	17.0	.	NM_139284	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	hg19	CCDS12444.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.1|21.1	4.097418|4.097418	0.76870|0.76870	.|.	.|.	ENSG00000153902|ENSG00000153902	ENST00000392225|ENST00000310123;ENST00000437421	T|T	0.68331|0.78595	-0.32|-1.19	4.66|4.66	4.66|4.66	0.58398|0.58398	.|.	.|0.000000	.|0.52532	.|D	.|0.000079	D|D	0.84261|0.84261	0.5433|0.5433	L|L	0.58583|0.58583	1.82|1.82	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.85130	.|0.997;0.997	T|T	0.83349|0.83349	-0.0004|-0.0004	7|10	0.87932|0.37606	D|T	0|0.19	.|.	12.0653|12.0653	0.53583|0.53583	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|320;409	.|Q658V8;Q8N135	.|.;LGI4_HUMAN	P|A	435|409	ENSP00000376059:S435P|ENSP00000312273:V409A	ENSP00000376059:S435P|ENSP00000312273:V409A	S|V	-|-	1|2	0|0	LGI4|LGI4	40309087|40309087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.386000|7.386000	0.79775|0.79775	1.745000|1.745000	0.51790|0.51790	0.477000|0.477000	0.44152|0.44152	TCT|GTC	.	.	.	none		0.682	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
ZNF546	339327	hgsc.bcm.edu	37	19	40520846	40520846	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr19:40520846G>A	ENST00000347077.4	+	7	1885	c.1669G>A	c.(1669-1671)Gaa>Aaa	p.E557K	ZNF546_ENST00000600094.1_Missense_Mutation_p.E531K|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGAATGTAAGGAATGTGGGAA	0.388																																					p.E557K		Atlas-SNP	.											.	ZNF546	93	.	0			c.G1669A						PASS	.						61.0	59.0	59.0					19																	40520846		2203	4300	6503	SO:0001583	missense	339327	exon7			TGTAAGGAATGTG	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1669G>A	chr19.hg19:g.40520846G>A	ENSP00000339823:p.Glu557Lys	74.0	0.0	.		84.0	45.0	.	NM_178544	A8K913	Missense_Mutation	SNP	ENST00000347077.4	hg19	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	g	15.69	2.907182	0.52333	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.07327	3.2	3.0	-0.424	0.12321	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06781	0.0173	L	0.41415	1.275	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.35624	-0.9781	9	0.56958	D	0.05	.	4.6522	0.12601	0.23:0.1839:0.5862:0.0	.	557	Q86UE3	ZN546_HUMAN	K	557;166	ENSP00000339823:E557K	ENSP00000339823:E557K	E	+	1	0	ZNF546	45212686	0.001000	0.12720	0.990000	0.47175	0.997000	0.91878	0.499000	0.22546	-0.002000	0.14469	0.655000	0.94253	GAA	.	.	.	none		0.388	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
EGLN2	112398	hgsc.bcm.edu	37	19	41306603	41306603	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr19:41306603T>A	ENST00000593726.1	+	1	1154	c.126T>A	c.(124-126)tgT>tgA	p.C42*	RAB4B-EGLN2_ENST00000594136.1_3'UTR|CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000303961.4_Nonsense_Mutation_p.C42*|EGLN2_ENST00000406058.2_Nonsense_Mutation_p.C42*|EGLN2_ENST00000594140.1_5'Flank			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	42					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	ACCTGCCCTGTCCCCTGCTCC	0.652																																					p.C42X		Atlas-SNP	.											.	EGLN2	31	.	0			c.T126A						PASS	.						55.0	47.0	50.0					19																	41306603		2203	4300	6503	SO:0001587	stop_gained	112398	exon2			GCCCTGTCCCCTG	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.126T>A	chr19.hg19:g.41306603T>A	ENSP00000469686:p.Cys42*	56.0	0.0	.		52.0	15.0	.	NM_053046	A8K5S0|Q8WWY4|Q9BV14	Nonsense_Mutation	SNP	ENST00000593726.1	hg19	CCDS12567.1	.	.	.	.	.	.	.	.	.	.	T	38	6.815813	0.97861	.	.	ENSG00000171570	ENST00000303961;ENST00000406058	.	.	.	4.15	1.91	0.25777	.	0.092299	0.46758	D	0.000268	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0525	7.5512	0.27798	0.0:0.1918:0.0:0.8082	.	.	.	.	X	42	.	ENSP00000307080:C42X	C	+	3	2	EGLN2	45998443	0.372000	0.25064	0.976000	0.42696	0.984000	0.73092	0.337000	0.19841	0.198000	0.20407	0.402000	0.26972	TGT	.	.	.	none		0.652	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463218.1		
SLC24A3	57419	hgsc.bcm.edu	37	20	19665982	19665982	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr20:19665982C>T	ENST00000328041.6	+	12	1498	c.1301C>T	c.(1300-1302)cCg>cTg	p.P434L		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	434					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						gatgaagGACCGTACACACCA	0.488																																					p.P434L		Atlas-SNP	.											.	SLC24A3	92	.	0			c.C1301T						PASS	.						166.0	142.0	150.0					20																	19665982		2203	4300	6503	SO:0001583	missense	57419	exon12			AAGGACCGTACAC	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1301C>T	chr20.hg19:g.19665982C>T	ENSP00000333519:p.Pro434Leu	102.0	0.0	.		106.0	41.0	.	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Missense_Mutation	SNP	ENST00000328041.6	hg19	CCDS13140.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287750	0.40494	.	.	ENSG00000185052	ENST00000328041	T	0.62498	0.02	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	T	0.62036	0.2395	M	0.61703	1.905	0.80722	D	1	B	0.17667	0.023	B	0.12837	0.008	T	0.56486	-0.7971	9	.	.	.	.	19.3646	0.94456	0.0:1.0:0.0:0.0	.	434	Q9HC58	NCKX3_HUMAN	L	434	ENSP00000333519:P434L	.	P	+	2	0	SLC24A3	19613982	1.000000	0.71417	0.833000	0.33012	0.408000	0.30992	7.465000	0.80898	2.668000	0.90789	0.563000	0.77884	CCG	.	.	.	none		0.488	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47641990	47641990	+	Silent	SNP	C	C	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr20:47641990C>T	ENST00000371917.4	+	36	4896	c.4896C>T	c.(4894-4896)taC>taT	p.Y1632Y		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1632					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ACTCCAATTACGAGCAGCGGA	0.473																																					p.Y1632Y	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.C4896T						PASS	.						97.0	80.0	85.0					20																	47641990		2203	4300	6503	SO:0001819	synonymous_variant	10564	exon36			CAATTACGAGCAG	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.4896C>T	chr20.hg19:g.47641990C>T		90.0	0.0	.		66.0	27.0	.	NM_006420	Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	hg19	CCDS13411.1																																																																																			.	.	.	none		0.473	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
KRTAP10-3	386682	hgsc.bcm.edu	37	21	45978008	45978008	+	Silent	SNP	G	G	A			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr21:45978008G>A	ENST00000391620.1	-	1	635	c.591C>T	c.(589-591)ctC>ctT	p.L197L	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	197	18 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						GGCGGCAGAGGAGGGACACGC	0.701																																					p.L197L		Atlas-SNP	.											.	KRTAP10-3	17	.	0			c.C591T						PASS	.						29.0	35.0	33.0					21																	45978008		2199	4295	6494	SO:0001819	synonymous_variant	386682	exon1			GCAGAGGAGGGAC	AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.591C>T	chr21.hg19:g.45978008G>A		68.0	0.0	.		33.0	16.0	.	NM_198696	A3KN67|Q70LJ4	Silent	SNP	ENST00000391620.1	hg19	CCDS42956.1																																																																																			.	.	.	none		0.701	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128031.1		
BNC2	54796	hgsc.bcm.edu	37	9	16552614	16552615	+	In_Frame_Ins	INS	-	-	GAA			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr9:16552614_16552615insGAA	ENST00000380672.4	-	5	639_640	c.582_583insTTC	c.(580-585)ttcagc>ttcTTCagc	p.194_195insF	BNC2_ENST00000545497.1_In_Frame_Ins_p.99_100insF|BNC2_ENST00000380667.2_In_Frame_Ins_p.127_128insF|BNC2_ENST00000380666.2_In_Frame_Ins_p.194_195insF	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TTCAGGACGCTGAAGAGACGGT	0.55																																					p.S195delinsFS		Atlas-INDEL	.											BNC2,NS,carcinoma,0,1	BNC2	166	.	0			c.583_584insTTC						PASS	.																																			SO:0001652	inframe_insertion	54796	exon5			.	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.580_582dupTTC	chr9.hg19:g.16552615_16552617dupGAA	ENSP00000370047:p.Phe194_Phe194dup	90.0	0.0	0		77.0	17.0	0.220779	NM_017637		In_Frame_Ins	INS	ENST00000380672.4	hg19	CCDS6482.2																																																																																			.	.	.	none		0.550	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
SMARCB1	6598	hgsc.bcm.edu	37	22	24175838	24175839	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr22:24175838_24175839insT	ENST00000263121.7	+	8	1262_1263	c.1066_1067insT	c.(1066-1068)ctgfs	p.L356fs	SMARCB1_ENST00000407422.3_Frame_Shift_Ins_p.L347fs|SMARCB1_ENST00000407082.3_Frame_Shift_Ins_p.L310fs|SMARCB1_ENST00000344921.6_Frame_Shift_Ins_p.L365fs|DERL3_ENST00000464023.1_5'Flank	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	356					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				GCTGGAGACTCTGACAGACGCT	0.629			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.L356fs		Atlas-INDEL	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1	586	.	3	Unknown(2)|Deletion - In frame(1)	central_nervous_system(3)	c.1066_1067insT						PASS	.																																			SO:0001589	frameshift_variant	6598	exon8			.	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.1067dupT	chr22.hg19:g.24175839_24175839dupT	ENSP00000263121:p.Leu356fs	149.0	0.0	0		111.0	91.0	0.81982	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Frame_Shift_Ins	INS	ENST00000263121.7	hg19	CCDS13817.1																																																																																			.	.	.	none		0.629	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
NME5	8382	hgsc.bcm.edu	37	5	137474383	137474383	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr5:137474383delC	ENST00000265191.2	-	2	136	c.87delG	c.(85-87)gagfs	p.E29fs		NM_003551.2	NP_003542.1	P56597	NDK5_HUMAN	NME/NM23 family member 5	29					cilium assembly (GO:0042384)|CTP biosynthetic process (GO:0006241)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|nucleoside metabolic process (GO:0009116)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)|ventricular system development (GO:0021591)	sperm flagellum (GO:0036126)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)			kidney(1)|large_intestine(1)|lung(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TATCTTGTATCTCCTCCTCTT	0.368																																					p.I30fs		Atlas-INDEL	.											.	NME5	15	.	0			c.88delA						PASS	.						140.0	128.0	132.0					5																	137474383		2203	4300	6503	SO:0001589	frameshift_variant	8382	exon2			.	Y14992	CCDS4197.1	5q31.2	2012-05-18	2012-05-18		ENSG00000112981	ENSG00000112981			7853	protein-coding gene	gene with protein product	"""radial spoke 23 homolog (Chlamydomonas)"""	603575	"""non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)"""			9742940, 19852809	Standard	NM_003551		Approved	nm23-H5, RSPH23	uc003lce.3	P56597	OTTHUMG00000129207	ENST00000265191.2:c.87delG	chr5.hg19:g.137474383delC	ENSP00000265191:p.Glu29fs	64.0	0.0	0		63.0	32.0	0.507937	NM_003551	B2R5G7	Frame_Shift_Del	DEL	ENST00000265191.2	hg19	CCDS4197.1																																																																																			.	.	.	none		0.368	NME5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251286.1	NM_003551	
FRYL	285527	hgsc.bcm.edu	37	4	48598002	48598003	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr4:48598002_48598003delTT	ENST00000503238.1	-	11	1049_1050	c.1050_1051delAA	c.(1048-1053)aaaatgfs	p.KM350fs	FRYL_ENST00000507711.1_Frame_Shift_Del_p.KM350fs|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000506685.1_Frame_Shift_Del_p.KM56fs|FRYL_ENST00000358350.4_Frame_Shift_Del_p.KM350fs|FRYL_ENST00000537810.1_Frame_Shift_Del_p.KM350fs			O94915	FRYL_HUMAN	FRY-like	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACTCGAGACATTTTCGGATCTT	0.302																																					p.351_351del		Atlas-INDEL	.											.	FRYL	242	.	0			c.1051_1052del						PASS	.																																			SO:0001589	frameshift_variant	285527	exon14			.	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1050_1051delAA	chr4.hg19:g.48598004_48598005delTT	ENSP00000426064:p.Lys350fs	54.0	0.0	0		64.0	18.0	0.28125	NM_015030	O95640|Q8WTZ5|Q9NT40	Frame_Shift_Del	DEL	ENST00000503238.1	hg19	CCDS43227.1																																																																																			.	.	.	none		0.302	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
FAM20A	54757	hgsc.bcm.edu	37	17	66538845	66538846	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr17:66538845_66538846delAA	ENST00000592554.1	-	6	1639_1640	c.917_918delTT	c.(916-918)tttfs	p.F306fs	PRKAR1A_ENST00000588188.2_Intron|AC079210.1_ENST00000600820.1_5'Flank|FAM20A_ENST00000226094.5_5'UTR	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	306					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					CTGGAGAGACAAAGAAAACACT	0.525																																					p.306_307del		Atlas-INDEL	.											.	FAM20A	35	.	0			c.918_919del						PASS	.																																			SO:0001589	frameshift_variant	54757	exon6			.	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.917_918delTT	chr17.hg19:g.66538845_66538846delAA	ENSP00000468308:p.Phe306fs	102.0	0.0	0		131.0	30.0	0.229008	NM_017565	B2RN47|B2RN49|Q9UF95	Frame_Shift_Del	DEL	ENST00000592554.1	hg19	CCDS11679.1																																																																																			.	.	.	none		0.525	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
VPS9D1	9605	hgsc.bcm.edu	37	16	89775318	89775318	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GL-6846-01A-11D-1961-08	TCGA-GL-6846-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	98a51f37-1d5f-4db0-b785-b751168bf46e	631ce65b-a92f-4c3c-b0eb-c2e13249edd7	g.chr16:89775318delG	ENST00000389386.3	-	13	1768	c.1644delC	c.(1642-1644)cccfs	p.P548fs	VPS9D1_ENST00000565452.1_5'Flank|VPS9D1_ENST00000561976.1_Frame_Shift_Del_p.P478fs|VPS9D1-AS1_ENST00000562866.1_RNA	NM_004913.2	NP_004904.2	Q9Y2B5	VP9D1_HUMAN	VPS9 domain containing 1	548	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				ATP synthesis coupled proton transport (GO:0015986)		GTPase activator activity (GO:0005096)|transporter activity (GO:0005215)										CCTCTGGGGTGGGGCAGTAGT	0.682																																					p.T549fs		Atlas-INDEL	.											.	.	.	.	0			c.1645delA						PASS	.						13.0	16.0	15.0					16																	89775318		1928	4125	6053	SO:0001589	frameshift_variant	9605	exon13			.	AB018551	CCDS42220.1	16q24.3	2012-10-09	2012-10-09	2012-10-09	ENSG00000075399	ENSG00000075399			13526	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 7"""	C16orf7		10231027	Standard	NM_004913		Approved	ATP-BL	uc002fom.1	Q9Y2B5	OTTHUMG00000173219	ENST00000389386.3:c.1644delC	chr16.hg19:g.89775318delG	ENSP00000374037:p.Pro548fs	27.0	0.0	0		29.0	12.0	0.413793	NM_004913		Frame_Shift_Del	DEL	ENST00000389386.3	hg19	CCDS42220.1																																																																																			.	.	.	none		0.682	VPS9D1-002	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422508.1	NM_004913	
