#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MEGF6	1953	hgsc.bcm.edu	37	1	3511980	3511980	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:3511980A>G	ENST00000356575.4	-	3	524	c.298T>C	c.(298-300)Tat>Cat	p.Y100H		NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	100	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TCCGTGGTATACACCTGCCTG	0.632																																					p.Y100H	Ovarian(73;978 3658)	Atlas-SNP	.											.	MEGF6	91	.	0			c.T298C						PASS	.						36.0	44.0	41.0					1																	3511980		2027	4179	6206	SO:0001583	missense	1953	exon3			TGGTATACACCTG	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.298T>C	chr1.hg19:g.3511980A>G	ENSP00000348982:p.Tyr100His	105.0	0.0	.		117.0	41.0	.	NM_001409	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	hg19	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	a	15.35	2.806840	0.50421	.	.	ENSG00000162591	ENST00000356575	D	0.85258	-1.96	3.92	3.92	0.45320	EMI domain (1);	0.000000	0.64402	U	0.000003	D	0.84991	0.5595	M	0.76574	2.34	0.39571	D	0.969271	D	0.53312	0.959	P	0.46076	0.503	D	0.86605	0.1869	10	0.59425	D	0.04	-38.3019	9.703	0.40198	1.0:0.0:0.0:0.0	.	100	O75095	MEGF6_HUMAN	H	100	ENSP00000348982:Y100H	ENSP00000348982:Y100H	Y	-	1	0	MEGF6	3501840	1.000000	0.71417	0.906000	0.35671	0.306000	0.27790	6.186000	0.72026	1.726000	0.51525	0.398000	0.26397	TAT	.	.	.	none		0.632	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
TCEB3	6924	hgsc.bcm.edu	37	1	24080614	24080614	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:24080614A>C	ENST00000418390.2	+	6	1911	c.1640A>C	c.(1639-1641)gAa>gCa	p.E547A	TCEB3_ENST00000609199.1_Missense_Mutation_p.E521A	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	547					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CAGGAAGAAGAAGAAGCTGGA	0.473																																					p.E547A		Atlas-SNP	.											.	TCEB3	61	.	0			c.A1640C						PASS	.						107.0	99.0	102.0					1																	24080614		2203	4300	6503	SO:0001583	missense	6924	exon6			AAGAAGAAGAAGC	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1640A>C	chr1.hg19:g.24080614A>C	ENSP00000395574:p.Glu547Ala	124.0	0.0	.		120.0	42.0	.	NM_003198	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	hg19	CCDS239.2	.	.	.	.	.	.	.	.	.	.	A	23.4	4.405738	0.83230	.	.	ENSG00000011007	ENST00000418390	T	0.10382	2.88	5.71	5.71	0.89125	.	0.243724	0.31936	N	0.006831	T	0.15435	0.0372	M	0.70275	2.135	0.58432	D	0.999995	D	0.54397	0.966	B	0.42462	0.388	T	0.01269	-1.1400	10	0.72032	D	0.01	-23.7872	10.6424	0.45600	0.9197:0.0:0.0803:0.0	.	547	Q14241	ELOA1_HUMAN	A	547	ENSP00000395574:E547A	ENSP00000395574:E547A	E	+	2	0	TCEB3	23953201	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.929000	0.70096	2.179000	0.69175	0.379000	0.24179	GAA	.	.	.	none		0.473	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
PUM1	9698	hgsc.bcm.edu	37	1	31479871	31479871	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:31479871G>C	ENST00000257075.5	-	4	604	c.511C>G	c.(511-513)Caa>Gaa	p.Q171E	PUM1_ENST00000423018.2_Intron|PUM1_ENST00000440538.2_Missense_Mutation_p.Q171E|PUM1_ENST00000424085.2_Intron|PUM1_ENST00000373742.2_Intron|PUM1_ENST00000426105.2_Missense_Mutation_p.Q171E|PUM1_ENST00000373741.4_Missense_Mutation_p.Q207E|PUM1_ENST00000373747.3_Missense_Mutation_p.Q171E	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	171					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TCTCGCCATTGATCACCCAGG	0.418																																					p.Q171E		Atlas-SNP	.											.	PUM1	107	.	0			c.C511G						PASS	.						301.0	283.0	289.0					1																	31479871		2203	4300	6503	SO:0001583	missense	9698	exon4			GCCATTGATCACC	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.511C>G	chr1.hg19:g.31479871G>C	ENSP00000257075:p.Gln171Glu	340.0	0.0	.		363.0	122.0	.	NM_014676	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	hg19	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.154|3.154	-0.173618|-0.173618	0.06421|0.06421	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000257075;ENST00000373747;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000543952|ENST00000525843	T;T;T;T;T|.	0.17691|.	2.26;2.53;2.54;2.54;2.53|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|.	0.55800|.	0.1943|.	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.15473|.	0.002;0.013;0.001;0.001|.	B;B;B;B|.	0.12156|.	0.002;0.007;0.001;0.001|.	T|.	0.49513|.	-0.8932|.	10|.	0.05620|.	T|.	0.96|.	-4.9673|-4.9673	19.0513|19.0513	0.93046|0.93046	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	207;171;171;171|.	Q5T1Z8;Q14671-2;Q14671;E9PCJ0|.	.;.;PUM1_HUMAN;.|.	E|X	171;171;171;171;207;171|187	ENSP00000257075:Q171E;ENSP00000362852:Q171E;ENSP00000391723:Q171E;ENSP00000401777:Q171E;ENSP00000362846:Q207E|.	ENSP00000257075:Q171E|.	Q|S	-|-	1|2	0|0	PUM1|PUM1	31252458|31252458	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.482000|4.482000	0.60257|0.60257	2.736000|2.736000	0.93811|0.93811	0.557000|0.557000	0.71058|0.71058	CAA|TCA	.	.	.	none		0.418	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
CDC20	991	hgsc.bcm.edu	37	1	43828621	43828621	+	Splice_Site	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:43828621G>A	ENST00000372462.1	+	10	1524		c.e10-1		CDC20_ENST00000310955.6_Splice_Site|ELOVL1_ENST00000470769.1_5'Flank			Q12834	CDC20_HUMAN	cell division cycle 20						activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATTTGCTCCAGGTCACACATC	0.532																																					.	Esophageal Squamous(137;1154 1759 10362 10401 46925)	Atlas-SNP	.											.	CDC20	34	.	0			c.1322-1G>A						PASS	.						72.0	70.0	70.0					1																	43828621		2203	4300	6503	SO:0001630	splice_region_variant	991	exon11			GCTCCAGGTCACA	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.1322-1G>A	chr1.hg19:g.43828621G>A		112.0	0.0	.		146.0	61.0	.	NM_001255	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Splice_Site	SNP	ENST00000372462.1	hg19	CCDS484.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972600	0.74246	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	.	.	.	5.76	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7097	0.69222	0.0697:0.0:0.9303:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDC20	43601208	1.000000	0.71417	0.994000	0.49952	0.916000	0.54674	9.338000	0.96553	1.431000	0.47355	0.561000	0.74099	.	.	.	.	none		0.532	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019488.1	NM_001255	Intron
DBT	1629	hgsc.bcm.edu	37	1	100680458	100680458	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:100680458G>T	ENST00000370132.4	-	7	867	c.854C>A	c.(853-855)aCt>aAt	p.T285N	DBT_ENST00000370131.3_Missense_Mutation_p.T285N	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	285					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		AACCAGTTCAGTAAGGTCAAT	0.373																																					p.T285N		Atlas-SNP	.											.	DBT	39	.	0			c.C854A						PASS	.						77.0	73.0	75.0					1																	100680458		2203	4300	6503	SO:0001583	missense	1629	exon7			AGTTCAGTAAGGT	BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.854C>A	chr1.hg19:g.100680458G>T	ENSP00000359151:p.Thr285Asn	59.0	0.0	.		80.0	29.0	.	NM_001918	B2R811|Q5VVL8	Missense_Mutation	SNP	ENST00000370132.4	hg19	CCDS767.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275507	0.40294	.	.	ENSG00000137992	ENST00000543138;ENST00000370132;ENST00000370131	T;T	0.51325	0.71;0.71	5.44	4.53	0.55603	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.199950	0.51477	D	0.000096	T	0.38427	0.1040	M	0.81112	2.525	0.45634	D	0.99856	B;B	0.18310	0.002;0.027	B;B	0.24701	0.011;0.055	T	0.41875	-0.9484	10	0.42905	T	0.14	-14.8131	14.2831	0.66226	0.0716:0.0:0.9284:0.0	.	104;285	F5H1F9;P11182	.;ODB2_HUMAN	N	104;285;285	ENSP00000359151:T285N;ENSP00000359150:T285N	ENSP00000359150:T285N	T	-	2	0	DBT	100453046	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	3.303000	0.51858	1.299000	0.44798	0.655000	0.94253	ACT	.	.	.	none		0.373	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030101.2	NM_001918	
CELSR2	1952	hgsc.bcm.edu	37	1	109807126	109807126	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:109807126C>A	ENST00000271332.3	+	11	5401	c.5340C>A	c.(5338-5340)agC>agA	p.S1780R		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1780	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGGATCCCAGCCATGGGGAGA	0.617																																					p.S1780R	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-SNP	.											.	CELSR2	228	.	0			c.C5340A						PASS	.						162.0	141.0	148.0					1																	109807126		2203	4300	6503	SO:0001583	missense	1952	exon11			TCCCAGCCATGGG	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5340C>A	chr1.hg19:g.109807126C>A	ENSP00000271332:p.Ser1780Arg	148.0	0.0	.		184.0	71.0	.	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	hg19	CCDS796.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677071	0.29783	.	.	ENSG00000143126	ENST00000271332	T	0.69435	-0.4	4.79	3.85	0.44370	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.34366	0.0895	L	0.36672	1.1	0.41718	D	0.989496	B	0.14438	0.01	B	0.09377	0.004	T	0.17776	-1.0358	9	0.15952	T	0.53	.	10.7084	0.45969	0.1481:0.709:0.1429:0.0	.	1780	Q9HCU4	CELR2_HUMAN	R	1780	ENSP00000271332:S1780R	ENSP00000271332:S1780R	S	+	3	2	CELSR2	109608649	0.905000	0.30787	0.998000	0.56505	0.796000	0.44982	1.567000	0.36407	1.193000	0.43086	0.561000	0.74099	AGC	.	.	.	none		0.617	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHIA	27159	hgsc.bcm.edu	37	1	111862962	111862962	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:111862962C>T	ENST00000369740.1	+	12	1408	c.1305C>T	c.(1303-1305)aaC>aaT	p.N435N	CHIA_ENST00000343320.6_Silent_p.N435N|CHIA_ENST00000451398.2_Silent_p.N274N|CHIA_ENST00000353665.6_Silent_p.N274N|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Silent_p.N274N|CHIA_ENST00000430615.1_Silent_p.N327N	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	435	Chitin-binding type-2. {ECO:0000255|PROSITE-ProRule:PRU00144}.				apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TCAGAGCCAACGGCCTCTACC	0.597																																					p.N435N		Atlas-SNP	.											.	CHIA	115	.	0			c.C1305T						PASS	.						68.0	62.0	64.0					1																	111862962		2203	4300	6503	SO:0001819	synonymous_variant	27159	exon12			AGCCAACGGCCTC	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.1305C>T	chr1.hg19:g.111862962C>T		68.0	0.0	.		77.0	31.0	.	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	ENST00000369740.1	hg19	CCDS41368.1																																																																																			.	.	.	none		0.597	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
RSBN1	54665	hgsc.bcm.edu	37	1	114308975	114308975	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:114308975G>C	ENST00000261441.5	-	7	2099	c.2036C>G	c.(2035-2037)cCt>cGt	p.P679R	RSBN1_ENST00000369581.2_5'UTR	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	679						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GACATTTCTAGGGATGAAGTA	0.443																																					p.P679R		Atlas-SNP	.											.	RSBN1	71	.	0			c.C2036G						PASS	.						102.0	94.0	97.0					1																	114308975		2203	4300	6503	SO:0001583	missense	54665	exon7			TTTCTAGGGATGA	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.2036C>G	chr1.hg19:g.114308975G>C	ENSP00000261441:p.Pro679Arg	114.0	0.0	.		177.0	70.0	.	NM_018364	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Missense_Mutation	SNP	ENST00000261441.5	hg19	CCDS862.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.042164	0.75732	.	.	ENSG00000081019	ENST00000261441	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.81088	0.4750	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82230	-0.0560	9	0.87932	D	0	-8.3576	19.8965	0.96963	0.0:0.0:1.0:0.0	.	679	Q5VWQ0	RSBN1_HUMAN	R	679	.	ENSP00000261441:P679R	P	-	2	0	RSBN1	114110498	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.771000	0.95319	0.563000	0.77884	CCT	.	.	.	none		0.443	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
FLG	2312	hgsc.bcm.edu	37	1	152276023	152276023	+	Missense_Mutation	SNP	C	C	G	rs367989347		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:152276023C>G	ENST00000368799.1	-	3	11374	c.11339G>C	c.(11338-11340)aGg>aCg	p.R3780T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3780	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGTCCAGACCTATCTACCGA	0.577									Ichthyosis																												p.R3780T		Atlas-SNP	.											.	FLG	900	.	0			c.G11339C						PASS	.						359.0	347.0	351.0					1																	152276023		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	CCAGACCTATCTA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11339G>C	chr1.hg19:g.152276023C>G	ENSP00000357789:p.Arg3780Thr	567.0	0.0	.		744.0	264.0	.	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	C	3.380	-0.126622	0.06795	.	.	ENSG00000143631	ENST00000368799	T	0.01599	4.74	2.62	1.67	0.24075	.	.	.	.	.	T	0.00637	0.0021	L	0.52364	1.645	0.09310	N	1	B	0.18013	0.025	B	0.10450	0.005	T	0.44802	-0.9304	9	0.14656	T	0.56	-2.2716	7.2143	0.25951	0.0:0.6727:0.3273:0.0	.	3780	P20930	FILA_HUMAN	T	3780	ENSP00000357789:R3780T	ENSP00000357789:R3780T	R	-	2	0	FLG	150542647	0.000000	0.05858	0.007000	0.13788	0.002000	0.02628	-0.617000	0.05584	0.644000	0.30656	0.552000	0.68991	AGG	.	.	.	none		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
PRRC2C	23215	hgsc.bcm.edu	37	1	171527271	171527271	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:171527271T>C	ENST00000338920.4	+	19	6251	c.6014T>C	c.(6013-6015)aTc>aCc	p.I2005T	PRRC2C_ENST00000426496.2_Missense_Mutation_p.I2005T|PRRC2C_ENST00000367742.3_Missense_Mutation_p.I2007T|PRRC2C_ENST00000392078.3_Missense_Mutation_p.I2007T	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2005					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CTGAATGATATCTCTAAGAAA	0.423																																					p.I2005T		Atlas-SNP	.											.	.	.	.	0			c.T6014C						PASS	.						63.0	62.0	62.0					1																	171527271		2203	4300	6503	SO:0001583	missense	23215	exon19			ATGATATCTCTAA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.6014T>C	chr1.hg19:g.171527271T>C	ENSP00000343629:p.Ile2005Thr	77.0	0.0	.		85.0	34.0	.	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.38|16.38	3.105838|3.105838	0.56291|0.56291	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.03035|.	4.11;4.07;4.12;4.12|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	0.154856|.	0.29253|.	U|.	0.012694|.	T|T	0.58163|0.58163	0.2103|0.2103	L|L	0.51422|0.51422	1.61|1.61	0.45427|0.45427	D|D	0.998403|0.998403	B|.	0.30361|.	0.277|.	B|.	0.35470|.	0.203|.	T|T	0.58589|0.58589	-0.7610|-0.7610	10|5	0.66056|.	D|.	0.02|.	.|.	15.3486|15.3486	0.74363|0.74363	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2005|.	Q9Y520-4|.	.|.	T|P	2007;1959;2005;2007;2005;1762|553	ENSP00000375928:I2007T;ENSP00000410219:I2005T;ENSP00000356716:I2007T;ENSP00000343629:I2005T|.	ENSP00000343629:I2005T|.	I|S	+|+	2|1	0|0	PRRC2C|PRRC2C	169793895|169793895	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.878000|0.878000	0.50629|0.50629	6.663000|6.663000	0.74431|0.74431	2.013000|2.013000	0.59113|0.59113	0.451000|0.451000	0.29950|0.29950	ATC|TCT	.	.	.	none		0.423	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
MRPS14	63931	hgsc.bcm.edu	37	1	174987712	174987712	+	Splice_Site	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:174987712T>C	ENST00000476371.1	-	2	62	c.46A>G	c.(46-48)Atg>Gtg	p.M16V		NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14											large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						GAAGGAACCATCTGAAAGACA	0.448																																					p.M16V		Atlas-SNP	.											.	MRPS14	20	.	0			c.A46G						PASS	.						98.0	85.0	89.0					1																	174987712		2203	4300	6503	SO:0001630	splice_region_variant	63931	exon2			GAACCATCTGAAA	AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.46-1A>G	chr1.hg19:g.174987712T>C		72.0	0.0	.		88.0	35.0	.	NM_022100		Missense_Mutation	SNP	ENST00000476371.1	hg19	CCDS1316.1	.	.	.	.	.	.	.	.	.	.	T	0.064	-1.217425	0.01542	.	.	ENSG00000120333	ENST00000476371	.	.	.	5.67	-1.6	0.08426	.	0.671809	0.15704	N	0.248788	T	0.11707	0.0285	N	0.04043	-0.29	0.22745	N	0.998783	B	0.02656	0.0	B	0.01281	0.0	T	0.34601	-0.9822	9	0.02654	T	1	-0.3997	7.7061	0.28650	0.2345:0.5387:0.0:0.2267	.	16	O60783	RT14_HUMAN	V	16	.	ENSP00000420714:M16V	M	-	1	0	MRPS14	173254335	0.995000	0.38212	0.560000	0.28344	0.318000	0.28184	0.132000	0.15891	-0.280000	0.09154	-0.256000	0.11100	ATG	.	.	.	none		0.448	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084416.2	NM_022100	Missense_Mutation
TNR	7143	hgsc.bcm.edu	37	1	175355248	175355248	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:175355248G>C	ENST00000367674.2	-	8	2405	c.1697C>G	c.(1696-1698)cCt>cGt	p.P566R	TNR_ENST00000263525.2_Missense_Mutation_p.P566R			Q92752	TENR_HUMAN	tenascin R	566	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TCGGGAGCCAGGCCGCAGGGC	0.612																																					p.P566R		Atlas-SNP	.											.	TNR	399	.	0			c.C1697G						PASS	.						63.0	60.0	61.0					1																	175355248		2203	4300	6503	SO:0001583	missense	7143	exon8			GAGCCAGGCCGCA	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1697C>G	chr1.hg19:g.175355248G>C	ENSP00000356646:p.Pro566Arg	91.0	0.0	.		105.0	31.0	.	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710158	0.68730	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.68903	-0.36;-0.36	5.58	5.58	0.84498	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84964	0.5589	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86989	0.2109	10	0.72032	D	0.01	.	19.1714	0.93580	0.0:0.0:1.0:0.0	.	566	Q92752	TENR_HUMAN	R	566	ENSP00000356646:P566R;ENSP00000263525:P566R	ENSP00000263525:P566R	P	-	2	0	TNR	173621871	1.000000	0.71417	0.953000	0.39169	0.256000	0.26092	8.911000	0.92721	2.613000	0.88420	0.650000	0.86243	CCT	.	.	.	none		0.612	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
DHX9	1660	hgsc.bcm.edu	37	1	182856426	182856426	+	Missense_Mutation	SNP	G	G	C	rs571363823		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:182856426G>C	ENST00000367549.3	+	28	3780	c.3670G>C	c.(3670-3672)Ggt>Cgt	p.G1224R	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1224	NTD.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AGTTTCCCGAGGTGGCTTTAG	0.592																																					p.G1224R	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.G3670C						PASS	.						77.0	83.0	81.0					1																	182856426		1903	4120	6023	SO:0001583	missense	1660	exon28			TCCCGAGGTGGCT	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3670G>C	chr1.hg19:g.182856426G>C	ENSP00000356520:p.Gly1224Arg	103.0	0.0	.		136.0	58.0	.	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615017	0.28712	.	.	ENSG00000135829	ENST00000367549	D	0.98329	-4.87	3.88	2.96	0.34315	.	0.241496	0.34725	N	0.003731	D	0.94748	0.8305	L	0.27053	0.805	0.58432	D	0.999996	P;P	0.47106	0.89;0.83	P;P	0.44946	0.465;0.465	D	0.91260	0.5036	10	0.13470	T	0.59	.	9.1231	0.36799	0.1132:0.0:0.8868:0.0	.	503;1224	B3KU66;Q08211	.;DHX9_HUMAN	R	1224	ENSP00000356520:G1224R	ENSP00000356520:G1224R	G	+	1	0	DHX9	181123049	1.000000	0.71417	0.182000	0.23118	0.556000	0.35491	6.067000	0.71193	0.619000	0.30197	0.561000	0.74099	GGT	.	.	.	none		0.592	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
RGS18	64407	hgsc.bcm.edu	37	1	192128419	192128419	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:192128419C>T	ENST00000367460.3	+	2	370	c.189C>T	c.(187-189)tcC>tcT	p.S63S	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	63					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ACACCCGCTCCAGTAGATCTG	0.363																																					p.S63S		Atlas-SNP	.											.	RGS18	54	.	0			c.C189T						PASS	.						46.0	50.0	48.0					1																	192128419		2203	4300	6503	SO:0001819	synonymous_variant	64407	exon2			CCGCTCCAGTAGA	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.189C>T	chr1.hg19:g.192128419C>T		64.0	0.0	.		83.0	21.0	.	NM_130782	B2RD23	Silent	SNP	ENST00000367460.3	hg19	CCDS1374.1																																																																																			.	.	.	none		0.363	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782	
SIPA1L2	57568	hgsc.bcm.edu	37	1	232649814	232649814	+	Silent	SNP	A	A	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:232649814A>T	ENST00000366630.1	-	2	1630	c.1272T>A	c.(1270-1272)atT>atA	p.I424I	SIPA1L2_ENST00000262861.4_Silent_p.I424I			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	424					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GAGAGAGCGCAATCCGCCTGT	0.517																																					p.I424I		Atlas-SNP	.											.	SIPA1L2	218	.	0			c.T1272A						PASS	.						138.0	137.0	138.0					1																	232649814		1984	4161	6145	SO:0001819	synonymous_variant	57568	exon1			GAGCGCAATCCGC	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.1272T>A	chr1.hg19:g.232649814A>T		170.0	0.0	.		251.0	101.0	.	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	ENST00000366630.1	hg19	CCDS41474.1																																																																																			.	.	.	none		0.517	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
RASGRP3	25780	hgsc.bcm.edu	37	2	33768640	33768640	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:33768640G>C	ENST00000403687.3	+	13	2080	c.1340G>C	c.(1339-1341)aGt>aCt	p.S447T	RASGRP3_ENST00000482731.1_3'UTR|RASGRP3_ENST00000402538.3_Missense_Mutation_p.S447T|RASGRP3_ENST00000407811.1_Missense_Mutation_p.S446T	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	447	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					GACTTTGAAAGTATAGCTGCC	0.338																																					p.S447T		Atlas-SNP	.											.	RASGRP3	87	.	0			c.G1340C						PASS	.						100.0	93.0	95.0					2																	33768640		1824	4085	5909	SO:0001583	missense	25780	exon14			TTGAAAGTATAGC	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1340G>C	chr2.hg19:g.33768640G>C	ENSP00000384192:p.Ser447Thr	39.0	0.0	.		39.0	18.0	.	NM_170672	D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	hg19	CCDS46256.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250031	0.59212	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.69175	-0.38;-0.38;-0.38	5.54	5.54	0.83059	EF-hand-like domain (1);	0.096408	0.64402	D	0.000002	T	0.66626	0.2808	N	0.14661	0.345	0.38135	D	0.938277	P;P	0.51240	0.943;0.885	P;P	0.59288	0.855;0.599	T	0.65961	-0.6041	10	0.23302	T	0.38	-3.5489	19.4767	0.94992	0.0:0.0:1.0:0.0	.	446;447	D6W583;Q8IV61	.;GRP3_HUMAN	T	447;447;446	ENSP00000385886:S447T;ENSP00000384192:S447T;ENSP00000383917:S446T	ENSP00000385886:S447T	S	+	2	0	RASGRP3	33622144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.384000	0.52478	2.601000	0.87937	0.563000	0.77884	AGT	.	.	.	none		0.338	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	
STRN	6801	hgsc.bcm.edu	37	2	37129786	37129786	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:37129786T>G	ENST00000263918.4	-	5	608	c.600A>C	c.(598-600)aaA>aaC	p.K200N	STRN_ENST00000379213.2_Missense_Mutation_p.K188N	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	200					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				AGTCCTGATTTTTGTCATCTT	0.393																																					p.K200N		Atlas-SNP	.											.	STRN	71	.	0			c.A600C						PASS	.						204.0	187.0	193.0					2																	37129786		2203	4300	6503	SO:0001583	missense	6801	exon5			CTGATTTTTGTCA	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.600A>C	chr2.hg19:g.37129786T>G	ENSP00000263918:p.Lys200Asn	224.0	0.0	.		224.0	92.0	.	NM_003162	Q3KP65|Q53TQ8|Q9NP38	Missense_Mutation	SNP	ENST00000263918.4	hg19	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434771	0.43224	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	T;T	0.65732	-0.17;-0.17	5.25	4.1	0.47936	.	0.260012	0.36101	N	0.002786	T	0.52821	0.1758	L	0.47190	1.495	0.36799	D	0.885272	B;B	0.14012	0.009;0.001	B;B	0.12837	0.008;0.004	T	0.52682	-0.8543	10	0.32370	T	0.25	-7.8697	10.7081	0.45966	0.0:0.0746:0.0:0.9254	.	188;200	O43815-2;O43815	.;STRN_HUMAN	N	200;175;188	ENSP00000263918:K200N;ENSP00000368513:K188N	ENSP00000263918:K200N	K	-	3	2	STRN	36983290	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.314000	0.43743	0.848000	0.35191	0.533000	0.62120	AAA	.	.	.	none		0.393	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		
CNNM4	26504	hgsc.bcm.edu	37	2	97428005	97428005	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:97428005C>A	ENST00000377075.2	+	1	1367	c.1269C>A	c.(1267-1269)taC>taA	p.Y423*		NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	423	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						ATATTCTCTACGTCAAAGACT	0.502																																					p.Y423X		Atlas-SNP	.											.	CNNM4	48	.	0			c.C1269A						PASS	.						149.0	146.0	147.0					2																	97428005		2203	4300	6503	SO:0001587	stop_gained	26504	exon1			TCTCTACGTCAAA	AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.1269C>A	chr2.hg19:g.97428005C>A	ENSP00000366275:p.Tyr423*	217.0	0.0	.		209.0	74.0	.	NM_020184	B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Nonsense_Mutation	SNP	ENST00000377075.2	hg19	CCDS2024.2	.	.	.	.	.	.	.	.	.	.	C	35	5.425731	0.96131	.	.	ENSG00000158158	ENST00000377075	.	.	.	5.05	-5.28	0.02755	.	0.140382	0.49305	D	0.000151	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	9.3317	0.38025	0.1152:0.5507:0.0:0.3341	.	.	.	.	X	423	.	ENSP00000366275:Y423X	Y	+	3	2	CNNM4	96791732	0.008000	0.16893	0.908000	0.35775	0.975000	0.68041	-0.996000	0.03709	-1.113000	0.02981	-0.302000	0.09304	TAC	.	.	.	none		0.502	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252954.1	NM_020184	
TTN	7273	hgsc.bcm.edu	37	2	179599140	179599140	+	Silent	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:179599140A>G	ENST00000591111.1	-	50	14684	c.14460T>C	c.(14458-14460)ttT>ttC	p.F4820F	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342992.6_Silent_p.F3893F|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.F5137F			Q8WZ42	TITIN_HUMAN	titin	12201	Ig-like 28.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCACTATTAAACGAAAAGA	0.373																																					p.F5137F		Atlas-SNP	.											.	TTN	18412	.	0			c.T15411C						PASS	.						170.0	159.0	162.0					2																	179599140		1893	4123	6016	SO:0001819	synonymous_variant	7273	exon52			ACTATTAAACGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14460T>C	chr2.hg19:g.179599140A>G		185.0	0.0	.		232.0	81.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ANKRD44	91526	hgsc.bcm.edu	37	2	197889959	197889959	+	Silent	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:197889959T>C	ENST00000328737.2	-	17	1684	c.1608A>G	c.(1606-1608)gaA>gaG	p.E536E	ANKRD44_ENST00000450567.1_Silent_p.E536E|ANKRD44_ENST00000282272.8_Silent_p.E553E|ANKRD44_ENST00000337207.5_Silent_p.E536E			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	561										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CAGAATCTGATTCTTCAAATC	0.388																																					p.E561E		Atlas-SNP	.											.	ANKRD44	281	.	0			c.A1683G						PASS	.						133.0	118.0	123.0					2																	197889959		2203	4300	6503	SO:0001819	synonymous_variant	91526	exon17			ATCTGATTCTTCA	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1608A>G	chr2.hg19:g.197889959T>C		118.0	0.0	.		107.0	39.0	.	NM_001195144	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	ENST00000328737.2	hg19																																																																																				.	.	.	none		0.388	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
CARF	79800	hgsc.bcm.edu	37	2	203848266	203848266	+	Silent	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr2:203848266A>G	ENST00000402905.3	+	16	2418	c.2097A>G	c.(2095-2097)caA>caG	p.Q699Q	CARF_ENST00000545253.1_Silent_p.Q611Q|WDR12_ENST00000477723.1_Intron|CARF_ENST00000414439.1_Silent_p.Q597Q|CARF_ENST00000545262.1_Silent_p.Q623Q|CARF_ENST00000428585.1_Silent_p.Q623Q|CARF_ENST00000320443.8_Silent_p.Q699Q|CARF_ENST00000438828.2_Silent_p.Q699Q	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	699					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTGTGAGCCAAGTTAAACAAG	0.328																																					p.Q699Q		Atlas-SNP	.											.	ALS2CR8	56	.	0			c.A2097G						PASS	.						81.0	78.0	79.0					2																	203848266		1801	4076	5877	SO:0001819	synonymous_variant	79800	exon17			GAGCCAAGTTAAA	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.2097A>G	chr2.hg19:g.203848266A>G		111.0	0.0	.		93.0	33.0	.	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Silent	SNP	ENST00000402905.3	hg19	CCDS42801.1																																																																																			.	.	.	none		0.328	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
CAMP	820	hgsc.bcm.edu	37	3	48266893	48266893	+	Silent	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:48266893T>C	ENST00000576243.1	+	4	632	c.492T>C	c.(490-492)ctT>ctC	p.L164L	CAMP_ENST00000296435.2_Silent_p.L167L			P49913	CAMP_HUMAN	cathelicidin antimicrobial peptide	164					antibacterial humoral response (GO:0019731)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptidoglycan (GO:0071224)|cellular response to tumor necrosis factor (GO:0071356)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of growth of symbiont on or near host surface (GO:0044140)|phagosome maturation (GO:0090382)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	cell projection (GO:0042995)|cell wall (GO:0005618)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|specific granule (GO:0042581)				endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000614)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		TGCGGAATCTTGTACCCAGGA	0.453																																					p.L167L		Atlas-SNP	.											.	CAMP	12	.	0			c.T501C						PASS	.						103.0	113.0	109.0					3																	48266893		2203	4300	6503	SO:0001819	synonymous_variant	820	exon4			GAATCTTGTACCC	BC055089	CCDS2762.1, CCDS2762.2	3p21.3	2014-01-30			ENSG00000164047	ENSG00000164047		"""Endogenous ligands"""	1472	protein-coding gene	gene with protein product		600474				7624374	Standard	NM_004345		Approved	CAP18, FALL39, FALL-39, LL37	uc003csj.3	P49913	OTTHUMG00000133526	ENST00000576243.1:c.492T>C	chr3.hg19:g.48266893T>C		164.0	0.0	.		225.0	83.0	.	NM_004345	Q71SN9	Silent	SNP	ENST00000576243.1	hg19																																																																																				.	.	.	none		0.453	CAMP-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_004345	
IQCF2	389123	hgsc.bcm.edu	37	3	51897303	51897303	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:51897303T>C	ENST00000333127.3	+	3	441	c.412T>C	c.(412-414)Tgc>Cgc	p.C138R	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	138										endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ATGCCACAACTGCCAGACCTG	0.577																																					p.C138R		Atlas-SNP	.											.	IQCF2	21	.	0			c.T412C						PASS	.						120.0	113.0	116.0					3																	51897303		2203	4300	6503	SO:0001583	missense	389123	exon3			CACAACTGCCAGA	AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.412T>C	chr3.hg19:g.51897303T>C	ENSP00000329904:p.Cys138Arg	204.0	0.0	.		180.0	12.0	.	NM_203424		Missense_Mutation	SNP	ENST00000333127.3	hg19	CCDS2835.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928595	0.73327	.	.	ENSG00000184345	ENST00000333127	T	0.34859	1.34	5.22	5.22	0.72569	.	0.202993	0.36101	N	0.002800	T	0.52125	0.1715	L	0.58810	1.83	0.48696	D	0.999697	D	0.71674	0.998	D	0.64144	0.922	T	0.54761	-0.8245	10	0.87932	D	0	-16.5932	11.6771	0.51436	0.0:0.0:0.0:1.0	.	138	Q8IXL9	IQCF2_HUMAN	R	138	ENSP00000329904:C138R	ENSP00000329904:C138R	C	+	1	0	IQCF2	51872343	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	3.496000	0.53288	2.311000	0.77944	0.528000	0.53228	TGC	.	.	.	none		0.577	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346594.1	NM_203424	
ARHGEF3	50650	hgsc.bcm.edu	37	3	56779418	56779418	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:56779418T>G	ENST00000296315.3	-	7	853	c.685A>C	c.(685-687)Aag>Cag	p.K229Q	ARHGEF3_ENST00000495373.1_Missense_Mutation_p.K229Q|ARHGEF3_ENST00000413728.2_Missense_Mutation_p.K235Q|ARHGEF3_ENST00000497267.1_Missense_Mutation_p.K200Q|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.K261Q|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.K235Q	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	229	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TGATCTTGCTTTTTGTGGTCC	0.478																																					p.K261Q		Atlas-SNP	.											.	ARHGEF3	128	.	0			c.A781C						PASS	.						161.0	169.0	166.0					3																	56779418		2203	4300	6503	SO:0001583	missense	50650	exon10			CTTGCTTTTTGTG	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.685A>C	chr3.hg19:g.56779418T>G	ENSP00000296315:p.Lys229Gln	229.0	0.0	.		238.0	82.0	.	NM_001128615	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	hg19	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.943519	0.92593	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	5.85	5.85	0.93711	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.61813	0.2377	M	0.89601	3.045	0.80722	D	1	D;D;D;D;D;D;D	0.69078	0.966;0.968;0.992;0.984;0.98;0.997;0.98	P;P;P;P;P;D;P	0.63192	0.712;0.571;0.591;0.713;0.665;0.912;0.665	T	0.70669	-0.4808	10	0.87932	D	0	-14.323	16.5479	0.84454	0.0:0.0:0.0:1.0	.	235;200;27;229;261;229;235	E9PG37;E7EU49;Q9NR81-4;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;.;ARHG3_HUMAN;.	Q	229;261;235;235;200;229	ENSP00000296315:K229Q;ENSP00000341071:K261Q;ENSP00000410922:K235Q;ENSP00000420420:K235Q;ENSP00000418826:K200Q;ENSP00000417986:K229Q	ENSP00000296315:K229Q	K	-	1	0	ARHGEF3	56754458	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	AAG	.	.	.	none		0.478	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
C3orf14	57415	hgsc.bcm.edu	37	3	62317065	62317065	+	Silent	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:62317065T>A	ENST00000494481.1	+	5	557	c.243T>A	c.(241-243)gtT>gtA	p.V81V	C3orf14_ENST00000542214.1_Silent_p.V81V|C3orf14_ENST00000232519.5_Silent_p.V81V|C3orf14_ENST00000462069.1_Silent_p.V81V|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000490916.1_RNA			Q9HBI5	CC014_HUMAN	chromosome 3 open reading frame 14	81										central_nervous_system(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)		CTGAGGTGGTTTCTCTTGAGG	0.393																																					p.V81V		Atlas-SNP	.											.	C3orf14	10	.	0			c.T243A						PASS	.						102.0	101.0	102.0					3																	62317065		2203	4300	6503	SO:0001819	synonymous_variant	57415	exon4			GGTGGTTTCTCTT	AF236158	CCDS2896.1	3p14.2	2011-11-29			ENSG00000114405	ENSG00000114405			25024	protein-coding gene	gene with protein product						12477932	Standard	XM_005265338		Approved	HT021	uc003dlg.3	Q9HBI5	OTTHUMG00000158704	ENST00000494481.1:c.243T>A	chr3.hg19:g.62317065T>A		112.0	0.0	.		147.0	57.0	.	NM_020685	B2R9U0	Silent	SNP	ENST00000494481.1	hg19	CCDS2896.1																																																																																			.	.	.	none		0.393	C3orf14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351807.1	NM_020685	
CPOX	1371	hgsc.bcm.edu	37	3	98309567	98309567	+	Silent	SNP	A	A	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:98309567A>T	ENST00000264193.2	-	3	938	c.720T>A	c.(718-720)gcT>gcA	p.A240A		NM_000097.5	NP_000088.3	P36551	HEM6_HUMAN	coproporphyrinogen oxidase	240					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to arsenic-containing substance (GO:0046685)|response to insecticide (GO:0017085)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to methylmercury (GO:0051597)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	coproporphyrinogen oxidase activity (GO:0004109)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						TCACGCCCATAGCACAAAATG	0.388																																					p.A240A	Esophageal Squamous(75;7 1223 22300 43648 48951)	Atlas-SNP	.											.	CPOX	34	.	0			c.T720A						PASS	.						82.0	78.0	79.0					3																	98309567		2203	4300	6503	SO:0001819	synonymous_variant	1371	exon3			GCCCATAGCACAA	BC017210	CCDS2932.1	3q12	2012-10-02		2004-01-30		ENSG00000080819	1.3.3.3		2321	protein-coding gene	gene with protein product	"""coproporphyria"""	612732	"""coproporphyrinogen oxidase (coproporphyria, harderoporphyria)"""	CPO		7757079, 8407975	Standard	NM_000097		Approved	CPX, HCP	uc003dsx.3	P36551		ENST00000264193.2:c.720T>A	chr3.hg19:g.98309567A>T		99.0	0.0	.		88.0	22.0	.	NM_000097	A8K275|B4DSD5|Q14060|Q53F08|Q8IZ45|Q96AF3	Silent	SNP	ENST00000264193.2	hg19	CCDS2932.1																																																																																			.	.	.	none		0.388	CPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358900.1	NM_000097	
MCM2	4171	hgsc.bcm.edu	37	3	127340566	127340566	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:127340566A>G	ENST00000265056.7	+	16	2909	c.2665A>G	c.(2665-2667)Aac>Gac	p.N889D	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	889					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CTTCAGGATGAACAAGTTCAG	0.498																																					p.N889D		Atlas-SNP	.											.	MCM2	79	.	0			c.A2665G						PASS	.						100.0	95.0	96.0					3																	127340566		2203	4300	6503	SO:0001583	missense	4171	exon16			AGGATGAACAAGT	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2665A>G	chr3.hg19:g.127340566A>G	ENSP00000265056:p.Asn889Asp	77.0	0.0	.		82.0	4.0	.	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	hg19	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.42|19.42	3.824506|3.824506	0.71143|0.71143	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142|ENST00000491422	T|.	0.02421|.	4.3|.	5.38|5.38	4.22|4.22	0.49857|0.49857	.|.	0.132166|.	0.64402|.	D|.	0.000002|.	T|.	0.74261|.	0.3693|.	M|M	0.81239|0.81239	2.535|2.535	0.80722|0.80722	D|D	1|1	P;P;B|.	0.38788|.	0.51;0.647;0.419|.	B;P;P|.	0.50896|.	0.282;0.653;0.455|.	T|.	0.74717|.	-0.3571|.	10|.	0.51188|.	T|.	0.08|.	-40.2853|-40.2853	12.3561|12.3561	0.55176|0.55176	0.8518:0.1482:0.0:0.0|0.8518:0.1482:0.0:0.0	.|.	939;759;889|.	F5H1E9;B4DSV5;P49736|.	.;.;MCM2_HUMAN|.	D|W	889;793;939|820	ENSP00000265056:N889D|.	ENSP00000265056:N889D|.	N|X	+|+	1|3	0|0	MCM2|MCM2	128823256|128823256	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.487000|0.487000	0.33371|0.33371	5.837000|5.837000	0.69381|0.69381	0.882000|0.882000	0.36016|0.36016	0.260000|0.260000	0.18958|0.18958	AAC|TGA	.	.	.	none		0.498	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
PLSCR2	57047	hgsc.bcm.edu	37	3	146167110	146167110	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:146167110C>T	ENST00000497985.1	-	8	1186	c.747G>A	c.(745-747)aaG>aaA	p.K249K	PLSCR2_ENST00000336685.2_Silent_p.K176K	NM_001199978.1	NP_001186907.1	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	249					phospholipid scrambling (GO:0017121)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phospholipid scramblase activity (GO:0017128)			endometrium(2)|large_intestine(5)|lung(7)|stomach(1)	15						CAGACCAGTGCTTAGAAATCC	0.328																																					p.K249K		Atlas-SNP	.											.	PLSCR2	68	.	0			c.G747A						PASS	.						128.0	130.0	130.0					3																	146167110		2203	4300	6503	SO:0001819	synonymous_variant	57047	exon8			CCAGTGCTTAGAA		CCDS56284.1, CCDS3134.1, CCDS75029.1	3q24	2008-07-18			ENSG00000163746	ENSG00000163746			16494	protein-coding gene	gene with protein product		607610				10930526	Standard	NM_001199978		Approved		uc003evw.2	Q9NRY7	OTTHUMG00000159429	ENST00000497985.1:c.747G>A	chr3.hg19:g.146167110C>T		164.0	0.0	.		228.0	90.0	.	NM_001199978	B4DXC3|J3KR76|Q0VAQ1|Q6NSW9|Q7Z4L7	Silent	SNP	ENST00000497985.1	hg19	CCDS56284.1																																																																																			.	.	.	none		0.328	PLSCR2-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000355264.1	NM_020359	
MCCC1	56922	hgsc.bcm.edu	37	3	182789038	182789038	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:182789038T>C	ENST00000265594.4	-	6	745	c.599A>G	c.(598-600)tAt>tGt	p.Y200C	MCCC1_ENST00000539926.1_Missense_Mutation_p.Y65C|MCCC1_ENST00000492597.1_Missense_Mutation_p.Y91C	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	200	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CATGACAGGATAGCCAATTCT	0.463																																					p.Y200C		Atlas-SNP	.											.	MCCC1	87	.	0			c.A599G						PASS	.						100.0	101.0	101.0					3																	182789038		2203	4300	6503	SO:0001583	missense	56922	exon6			ACAGGATAGCCAA	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.599A>G	chr3.hg19:g.182789038T>C	ENSP00000265594:p.Tyr200Cys	103.0	0.0	.		129.0	30.0	.	NM_020166	Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	ENST00000265594.4	hg19	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081996	0.76528	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176;ENST00000448585;ENST00000541636	D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91	5.9	5.9	0.94986	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.053830	0.85682	D	0.000000	D	0.99242	0.9736	H	0.94698	3.57	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73708	0.975;0.975;0.981	D	0.99032	1.0821	10	0.87932	D	0	.	16.3322	0.83039	0.0:0.0:0.0:1.0	.	153;91;200	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	C	200;91;50;65;153;153;91	ENSP00000265594:Y200C;ENSP00000419898:Y91C;ENSP00000441253:Y65C;ENSP00000420433:Y153C	ENSP00000265594:Y200C	Y	-	2	0	MCCC1	184271732	1.000000	0.71417	0.605000	0.28930	0.929000	0.56500	5.693000	0.68264	2.251000	0.74343	0.528000	0.53228	TAT	.	.	.	none		0.463	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
CDKL2	8999	hgsc.bcm.edu	37	4	76529105	76529105	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr4:76529105T>A	ENST00000429927.2	-	6	1394	c.691A>T	c.(691-693)Aaa>Taa	p.K231*	CDKL2_ENST00000307465.4_Nonsense_Mutation_p.K231*	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	231	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ACAGGATTTTTATTAAAAAGC	0.388																																					p.K231X		Atlas-SNP	.											.	CDKL2	58	.	0			c.A691T						PASS	.						86.0	89.0	88.0					4																	76529105		2203	4300	6503	SO:0001587	stop_gained	8999	exon6			GATTTTTATTAAA	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.691A>T	chr4.hg19:g.76529105T>A	ENSP00000412365:p.Lys231*	127.0	0.0	.		113.0	46.0	.	NM_003948	B2R695	Nonsense_Mutation	SNP	ENST00000429927.2	hg19	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	T	42	9.693897	0.99240	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	.	.	.	5.14	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.029	11.3921	0.49820	0.0:0.0:0.1508:0.8492	.	.	.	.	X	231	.	ENSP00000306340:K231X	K	-	1	0	CDKL2	76748129	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.829000	0.62737	2.164000	0.68074	0.460000	0.39030	AAA	.	.	.	none		0.388	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
KIAA1109	84162	hgsc.bcm.edu	37	4	123202841	123202841	+	Missense_Mutation	SNP	G	G	C	rs115036597		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr4:123202841G>C	ENST00000264501.4	+	52	9322	c.8949G>C	c.(8947-8949)atG>atC	p.M2983I	KIAA1109_ENST00000388738.3_Missense_Mutation_p.M2983I|KIAA1109_ENST00000455637.1_Missense_Mutation_p.M2983I			Q2LD37	K1109_HUMAN	KIAA1109	2983					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TCAGTGCCATGTTAGATGGTA	0.383																																					p.M2983I		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G8949C						PASS	.						121.0	113.0	116.0					4																	123202841		1831	4099	5930	SO:0001583	missense	84162	exon50			TGCCATGTTAGAT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8949G>C	chr4.hg19:g.123202841G>C	ENSP00000264501:p.Met2983Ile	124.0	0.0	.		160.0	57.0	.	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.047|5.047	0.194277|0.194277	0.09599|0.09599	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000419325	T;T;T|.	0.20069|.	2.69;2.69;2.1|.	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33990|0.33990	0.0882|0.0882	N|N	0.04090|0.04090	-0.28|-0.28	0.43073|0.43073	D|D	0.994713|0.994713	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.08055|.	0.003;0.001|.	T|T	0.28138|0.28138	-1.0053|-1.0053	10|5	0.05436|.	T|.	0.98|.	.|.	12.6377|12.6377	0.56692|0.56692	0.0759:0.0:0.9241:0.0|0.0759:0.0:0.9241:0.0	.|.	2983;2983|.	Q2LD37-6;Q2LD37|.	.;K1109_HUMAN|.	I|L	2983|941	ENSP00000264501:M2983I;ENSP00000373390:M2983I;ENSP00000389925:M2983I|.	ENSP00000264501:M2983I|.	M|V	+|+	3|1	0|0	KIAA1109|KIAA1109	123422291|123422291	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	6.528000|6.528000	0.73807|0.73807	2.572000|2.572000	0.86782|0.86782	0.591000|0.591000	0.81541|0.81541	ATG|GTT	.	G|0.999;T|0.001	.	alt		0.383	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
MTRR	4552	hgsc.bcm.edu	37	5	7878202	7878202	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:7878202G>T	ENST00000264668.2	+	5	658	c.628G>T	c.(628-630)Gag>Tag	p.E210*	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Nonsense_Mutation_p.E183*	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	210	Hinge.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TGTGAAGTCAGAGCTGCTACA	0.478																																					p.E210X		Atlas-SNP	.											.	MTRR	74	.	0			c.G628T						PASS	.						82.0	77.0	78.0					5																	7878202		2203	4300	6503	SO:0001587	stop_gained	4552	exon5			AAGTCAGAGCTGC	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.628G>T	chr5.hg19:g.7878202G>T	ENSP00000264668:p.Glu210*	64.0	0.0	.		57.0	19.0	.	NM_024010	O60471|Q32MA9|Q7Z4M8	Nonsense_Mutation	SNP	ENST00000264668.2	hg19	CCDS3874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.92|11.92	1.783157|1.783157	0.31593|0.31593	.|.	.|.	ENSG00000124275|ENSG00000124275	ENST00000264668;ENST00000440940|ENST00000514220	.|.	.|.	.|.	5.91|5.91	3.14|3.14	0.36123|0.36123	.|.	1.215660|.	0.05458|.	N|.	0.550635|.	.|T	.|0.49898	.|0.1584	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999986|0.999986	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.38394	.|-0.9663	.|4	0.18276|.	T|.	0.48|.	-19.4083|-19.4083	15.3298|15.3298	0.74200|0.74200	0.0:0.4006:0.5994:0.0|0.0:0.4006:0.5994:0.0	.|.	.|.	.|.	.|.	X|I	210;183|111	.|.	ENSP00000264668:E210X|.	E|R	+|+	1|2	0|0	MTRR|MTRR	7931202|7931202	0.022000|0.022000	0.18835|0.18835	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	1.921000|1.921000	0.40035|0.40035	0.387000|0.387000	0.25024|0.25024	-0.127000|-0.127000	0.14921|0.14921	GAG|AGA	.	.	.	none		0.478	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
DROSHA	29102	hgsc.bcm.edu	37	5	31515239	31515239	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:31515239C>G	ENST00000511367.2	-	7	1390	c.1146G>C	c.(1144-1146)aaG>aaC	p.K382N	DROSHA_ENST00000442743.1_Missense_Mutation_p.K345N|DROSHA_ENST00000513349.1_Missense_Mutation_p.K345N|DROSHA_ENST00000344624.3_Missense_Mutation_p.K382N	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	382					defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						AGGTATAGTTCTTGTCTTTGC	0.478																																					p.K382N		Atlas-SNP	.											DROSHA,colon,carcinoma,0,1	DROSHA	130	.	0			c.G1146C						PASS	.						160.0	152.0	154.0					5																	31515239		1868	4097	5965	SO:0001583	missense	29102	exon7			ATAGTTCTTGTCT	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.1146G>C	chr5.hg19:g.31515239C>G	ENSP00000425979:p.Lys382Asn	148.0	0.0	.		178.0	63.0	.	NM_013235	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	hg19	CCDS47195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.68|16.68	3.189775|3.189775	0.57909|0.57909	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000512076|ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302	.|T;T;T;T;T	.|0.59083	.|0.29;0.29;0.29;0.29;0.29	5.64|5.64	4.78|4.78	0.61160|0.61160	.|.	.|0.048766	.|0.85682	.|D	.|0.000000	T|T	0.54303|0.54303	0.1850|0.1850	N|N	0.19112|0.19112	0.55|0.55	0.44098|0.44098	D|D	0.996864|0.996864	.|D;B;B	.|0.54964	.|0.969;0.421;0.421	.|P;B;B	.|0.55824	.|0.785;0.154;0.154	T|T	0.55560|0.55560	-0.8122|-0.8122	5|10	.|0.44086	.|T	.|0.13	-27.3211|-27.3211	11.1936|11.1936	0.48700|0.48700	0.0:0.8412:0.0:0.1588|0.0:0.8412:0.0:0.1588	.|.	.|314;345;382	.|Q9NRR4-2;E7EMP9;Q9NRR4	.|.;.;RNC_HUMAN	Q|N	144|382;382;345;345;307;338;149	.|ENSP00000425979:K382N;ENSP00000339845:K382N;ENSP00000409335:K345N;ENSP00000424161:K345N;ENSP00000428782:K149N	.|ENSP00000265075:K307N	E|K	-|-	1|3	0|2	DROSHA|DROSHA	31550996|31550996	0.980000|0.980000	0.34600|0.34600	0.968000|0.968000	0.41197|0.41197	0.798000|0.798000	0.45092|0.45092	0.552000|0.552000	0.23376|0.23376	1.395000|1.395000	0.46643|0.46643	0.561000|0.561000	0.74099|0.74099	GAA|AAG	.	.	.	none		0.478	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
CHD1	1105	hgsc.bcm.edu	37	5	98192299	98192299	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:98192299G>A	ENST00000284049.3	-	35	5067	c.4918C>T	c.(4918-4920)Cat>Tat	p.H1640Y		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1640	3 X 5 AA repeats of H-S-D-H-R.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TGGTCTGAATGTAACCGATGA	0.428																																					p.H1640Y		Atlas-SNP	.											.	CHD1	137	.	0			c.C4918T						PASS	.						136.0	128.0	131.0					5																	98192299		2203	4299	6502	SO:0001583	missense	1105	exon35			CTGAATGTAACCG	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.4918C>T	chr5.hg19:g.98192299G>A	ENSP00000284049:p.His1640Tyr	68.0	0.0	.		45.0	29.0	.	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	hg19	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	G	4.283	0.051605	0.08291	.	.	ENSG00000153922	ENST00000422663;ENST00000284049	D	0.89875	-2.58	5.21	5.21	0.72293	.	0.000000	0.34386	U	0.004006	D	0.86079	0.5847	M	0.65498	2.005	0.38271	D	0.942164	B	0.27882	0.192	B	0.22880	0.042	T	0.82969	-0.0193	10	0.02654	T	1	.	18.7493	0.91807	0.0:0.0:1.0:0.0	.	1640	O14646	CHD1_HUMAN	Y	230;1640	ENSP00000284049:H1640Y	ENSP00000284049:H1640Y	H	-	1	0	CHD1	98220199	1.000000	0.71417	0.970000	0.41538	0.993000	0.82548	2.914000	0.48797	2.407000	0.81776	0.655000	0.94253	CAT	.	.	.	none		0.428	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
PCDHGB2	56103	hgsc.bcm.edu	37	5	140741729	140741729	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:140741729G>A	ENST00000522605.1	+	1	2027	c.2027G>A	c.(2026-2028)aGc>aAc	p.S676N	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	676					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGACCTCAGCGACCGCCGG	0.602																																					p.S676N		Atlas-SNP	.											.	PCDHGB2	196	.	0			c.G2027A						PASS	.						54.0	59.0	57.0					5																	140741729		2031	4196	6227	SO:0001583	missense	56103	exon1			ACCTCAGCGACCG	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2027G>A	chr5.hg19:g.140741729G>A	ENSP00000429018:p.Ser676Asn	67.0	0.0	.		68.0	44.0	.	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	hg19	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	9.065	0.995573	0.19043	.	.	ENSG00000253910	ENST00000522605	T	0.51071	0.72	4.95	3.13	0.36017	.	.	.	.	.	T	0.39937	0.1097	L	0.53617	1.68	0.09310	N	1	B;B	0.24618	0.005;0.107	B;B	0.22601	0.021;0.04	T	0.22977	-1.0201	9	0.21014	T	0.42	.	9.109	0.36716	0.242:0.0:0.758:0.0	.	676;676	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	N	676	ENSP00000429018:S676N	ENSP00000429018:S676N	S	+	2	0	PCDHGB2	140721913	0.000000	0.05858	0.045000	0.18777	0.027000	0.11550	0.655000	0.24933	1.220000	0.43490	0.454000	0.30748	AGC	.	.	.	none		0.602	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
FLT4	2324	hgsc.bcm.edu	37	5	180030377	180030377	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:180030377C>T	ENST00000261937.6	-	30	3985	c.3907G>A	c.(3907-3909)Ggc>Agc	p.G1303S		NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1303					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACATTCTGGCCAGGTCCTTTA	0.617																																					p.G1303S	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.G3907A						PASS	.						24.0	26.0	25.0					5																	180030377		2203	4300	6503	SO:0001583	missense	2324	exon30			TCTGGCCAGGTCC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3907G>A	chr5.hg19:g.180030377C>T	ENSP00000261937:p.Gly1303Ser	27.0	0.0	.		47.0	17.0	.	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	hg19	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	9.313	1.056047	0.19907	.	.	ENSG00000037280	ENST00000261937	T	0.75050	-0.9	4.62	2.77	0.32553	.	.	.	.	.	T	0.50292	0.1607	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.42015	-0.9476	9	0.02654	T	1	.	1.1998	0.01882	0.2134:0.4115:0.2083:0.1668	.	1303	P35916	VGFR3_HUMAN	S	1303	ENSP00000261937:G1303S	ENSP00000261937:G1303S	G	-	1	0	FLT4	179962983	0.001000	0.12720	0.010000	0.14722	0.901000	0.52897	0.037000	0.13840	1.051000	0.40369	0.471000	0.43371	GGC	.	.	.	none		0.617	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
CDKAL1	54901	hgsc.bcm.edu	37	6	20548882	20548882	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr6:20548882T>G	ENST00000378610.1	+	2	242	c.232T>G	c.(232-234)Tca>Gca	p.S78A	CDKAL1_ENST00000378624.4_Intron|CDKAL1_ENST00000274695.4_Missense_Mutation_p.S78A			Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein 1-like 1	78	MTTase N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00780}.				maintenance of translational fidelity (GO:1990145)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|N6-threonylcarbomyladenosine methylthiotransferase activity (GO:0035598)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|stomach(1)	29	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			TCATAATAATTCAGATGGAGA	0.294																																					p.S78A		Atlas-SNP	.											.	CDKAL1	55	.	0			c.T232G						PASS	.						80.0	85.0	83.0					6																	20548882		2203	4300	6503	SO:0001583	missense	54901	exon4			AATAATTCAGATG	AK000349	CCDS4546.1	6p22.2	2008-02-05			ENSG00000145996	ENSG00000145996			21050	protein-coding gene	gene with protein product		611259					Standard	NM_017774		Approved	FLJ20342	uc003ndd.2	Q5VV42	OTTHUMG00000014340	ENST00000378610.1:c.232T>G	chr6.hg19:g.20548882T>G	ENSP00000367873:p.Ser78Ala	127.0	0.0	.		171.0	68.0	.	NM_017774	A8K6S0|Q6P385|Q6ZR27|Q9NXB3	Missense_Mutation	SNP	ENST00000378610.1	hg19	CCDS4546.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515717	0.85389	.	.	ENSG00000145996	ENST00000274695;ENST00000378610	T;T	0.43688	0.94;0.94	5.81	5.81	0.92471	Methylthiotransferase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	L	0.52823	1.66	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.951;0.996	T	0.39313	-0.9620	10	0.24483	T	0.36	.	16.1708	0.81812	0.0:0.0:0.0:1.0	.	78;78	Q5VV42;Q5VV42-3	CDKAL_HUMAN;.	A	78	ENSP00000274695:S78A;ENSP00000367873:S78A	ENSP00000274695:S78A	S	+	1	0	CDKAL1	20656861	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.400000	0.79949	2.225000	0.72522	0.533000	0.62120	TCA	.	.	.	none		0.294	CDKAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039986.1	NM_017774	
COL9A1	1297	hgsc.bcm.edu	37	6	71003975	71003975	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr6:71003975G>A	ENST00000357250.6	-	5	749	c.591C>T	c.(589-591)gaC>gaT	p.D197D	COL9A1_ENST00000370496.3_Silent_p.D197D	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	197	Laminin G-like.|Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TCCTGTTGCAGTCAACAAAAA	0.433																																					p.D197D		Atlas-SNP	.											.	COL9A1	228	.	0			c.C591T						PASS	.						128.0	124.0	125.0					6																	71003975		2203	4300	6503	SO:0001819	synonymous_variant	1297	exon5			GTTGCAGTCAACA		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.591C>T	chr6.hg19:g.71003975G>A		135.0	0.0	.		215.0	73.0	.	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	hg19	CCDS4971.1																																																																																			.	.	.	none		0.433	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
BACH2	60468	hgsc.bcm.edu	37	6	90660214	90660214	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr6:90660214G>A	ENST00000257749.4	-	7	2318	c.1611C>T	c.(1609-1611)ccC>ccT	p.P537P	BACH2_ENST00000343122.3_Silent_p.P537P|RP3-512E2.2_ENST00000445838.1_RNA|BACH2_ENST00000537989.1_Silent_p.P537P|RP3-512E2.2_ENST00000413986.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	537						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GGAGGCTGCAGGGTGAGCCCC	0.612																																					p.P537P		Atlas-SNP	.											.	BACH2	224	.	0			c.C1611T						PASS	.						69.0	68.0	68.0					6																	90660214		2203	4300	6503	SO:0001819	synonymous_variant	60468	exon7			GCTGCAGGGTGAG	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1611C>T	chr6.hg19:g.90660214G>A		68.0	0.0	.		102.0	40.0	.	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	ENST00000257749.4	hg19	CCDS5026.1																																																																																			.	.	.	none		0.612	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
PREP	5550	hgsc.bcm.edu	37	6	105776878	105776878	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr6:105776878T>A	ENST00000369110.3	-	9	1231	c.1039A>T	c.(1039-1041)Aac>Tac	p.N347Y		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	347					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	ACCAAGAAGTTGGACCTGACA	0.413																																					p.N347Y		Atlas-SNP	.											.	PREP	65	.	0			c.A1039T						PASS	.						71.0	73.0	73.0					6																	105776878		2203	4300	6503	SO:0001583	missense	5550	exon9			AGAAGTTGGACCT		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1039A>T	chr6.hg19:g.105776878T>A	ENSP00000358106:p.Asn347Tyr	67.0	0.0	.		91.0	35.0	.	NM_002726	Q8N6D4	Missense_Mutation	SNP	ENST00000369110.3	hg19	CCDS5053.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.627037	0.87560	.	.	ENSG00000085377	ENST00000369110	T	0.47528	0.84	5.48	5.48	0.80851	Peptidase S9A, oligopeptidase, N-terminal (1);Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.123452	0.85682	D	0.000000	T	0.60143	0.2246	M	0.83223	2.63	0.58432	D	0.999996	D	0.54047	0.964	P	0.57009	0.811	T	0.67860	-0.5561	10	0.72032	D	0.01	-30.1871	15.8535	0.78956	0.0:0.0:0.0:1.0	.	347	P48147	PPCE_HUMAN	Y	347	ENSP00000358106:N347Y	ENSP00000358106:N347Y	N	-	1	0	PREP	105883571	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.655000	0.83696	2.207000	0.71202	0.459000	0.35465	AAC	.	.	.	none		0.413	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041658.1		
SEMA3A	10371	hgsc.bcm.edu	37	7	83631283	83631283	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr7:83631283C>A	ENST00000265362.4	-	12	1754	c.1440G>T	c.(1438-1440)atG>atT	p.M480I	SEMA3A_ENST00000436949.1_Missense_Mutation_p.M480I	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	480	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GAAAAACTGTCATTTCTTCCA	0.428																																					p.M480I		Atlas-SNP	.											SEMA3A,NS,carcinoma,0,1	SEMA3A	121	.	0			c.G1440T						PASS	.						130.0	118.0	122.0					7																	83631283		2203	4300	6503	SO:0001583	missense	10371	exon12			AACTGTCATTTCT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1440G>T	chr7.hg19:g.83631283C>A	ENSP00000265362:p.Met480Ile	73.0	0.0	.		79.0	22.0	.	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665855	0.88251	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.09073	3.02;3.02	5.36	5.36	0.76844	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.09113	0.0225	N	0.10809	0.05	0.80722	D	1	P	0.42039	0.769	P	0.47162	0.54	T	0.46303	-0.9201	10	0.28530	T	0.3	.	19.4559	0.94889	0.0:1.0:0.0:0.0	.	480	Q14563	SEM3A_HUMAN	I	480	ENSP00000265362:M480I;ENSP00000415260:M480I	ENSP00000265362:M480I	M	-	3	0	SEMA3A	83469219	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.722000	0.84778	2.669000	0.90835	0.591000	0.81541	ATG	.	.	.	none		0.428	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SLC25A13	10165	hgsc.bcm.edu	37	7	95818645	95818645	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr7:95818645C>T	ENST00000265631.5	-	9	1030	c.894G>A	c.(892-894)gaG>gaA	p.E298E	SLC25A13_ENST00000416240.2_Silent_p.E298E|SLC25A13_ENST00000542654.1_Silent_p.E190E			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	298					aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GCAGAGTTCCCTCTTCCAGAG	0.458																																					p.E298E		Atlas-SNP	.											.	SLC25A13	131	.	0			c.G894A						PASS	.						93.0	91.0	91.0					7																	95818645		2203	4300	6503	SO:0001819	synonymous_variant	10165	exon9			AGTTCCCTCTTCC	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.894G>A	chr7.hg19:g.95818645C>T		48.0	0.0	.		54.0	23.0	.	NM_001160210	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Silent	SNP	ENST00000265631.5	hg19	CCDS5645.1																																																																																			.	.	.	none		0.458	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
RP1L1	94137	hgsc.bcm.edu	37	8	10466983	10466983	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr8:10466983C>A	ENST00000382483.3	-	4	4848	c.4625G>T	c.(4624-4626)cGa>cTa	p.R1542L		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1622					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCAGCGTGCTCGGAGCTCAGC	0.647																																					p.R1542L		Atlas-SNP	.											.	RP1L1	453	.	0			c.G4625T						PASS	.						22.0	26.0	25.0					8																	10466983		2119	4242	6361	SO:0001583	missense	94137	exon4			CGTGCTCGGAGCT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4625G>T	chr8.hg19:g.10466983C>A	ENSP00000371923:p.Arg1542Leu	47.0	0.0	.		62.0	19.0	.	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	9.421	1.083074	0.20309	.	.	ENSG00000183638	ENST00000382483	T	0.07327	3.2	5.32	-0.24	0.13047	.	0.320649	0.17484	U	0.172610	T	0.03959	0.0111	L	0.29908	0.895	0.09310	N	1	P	0.44309	0.832	B	0.31442	0.13	T	0.40365	-0.9567	10	0.66056	D	0.02	-2.2884	3.8382	0.08903	0.175:0.3157:0.0:0.5092	.	1542	A6NKC6	.	L	1542	ENSP00000371923:R1542L	ENSP00000371923:R1542L	R	-	2	0	RP1L1	10504393	0.988000	0.35896	0.001000	0.08648	0.017000	0.09413	2.285000	0.43487	0.252000	0.21531	0.491000	0.48974	CGA	.	.	.	none		0.647	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
CA13	377677	hgsc.bcm.edu	37	8	86180770	86180770	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr8:86180770T>G	ENST00000321764.3	+	6	885	c.583T>G	c.(583-585)Tat>Gat	p.Y195D	CA13_ENST00000517298.1_3'UTR	NM_198584.2	NP_940986.1	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	195					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|myelin sheath (GO:0043209)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)	7					Zonisamide(DB00909)	CTACTGGACATATCCTGGTTC	0.398																																					p.Y195D		Atlas-SNP	.											.	CA13	26	.	0			c.T583G						PASS	.						180.0	163.0	169.0					8																	86180770		2203	4300	6503	SO:0001583	missense	377677	exon6			TGGACATATCCTG	BC052602	CCDS6236.1	8q21	2004-05-10				ENSG00000185015		"""Carbonic anhydrases"""	14914	protein-coding gene	gene with protein product		611436				14600151	Standard	NM_198584		Approved	CAXIII, FLJ37995, MGC59868	uc003ydg.2	Q8N1Q1		ENST00000321764.3:c.583T>G	chr8.hg19:g.86180770T>G	ENSP00000318912:p.Tyr195Asp	145.0	0.0	.		166.0	64.0	.	NM_198584		Missense_Mutation	SNP	ENST00000321764.3	hg19	CCDS6236.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582688	0.86748	.	.	ENSG00000185015	ENST00000321764	D	0.83914	-1.78	5.5	5.5	0.81552	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.95401	0.8507	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97404	0.9998	10	0.87932	D	0	-19.1625	14.5856	0.68322	0.0:0.0:0.0:1.0	.	195	Q8N1Q1	CAH13_HUMAN	D	195	ENSP00000318912:Y195D	ENSP00000318912:Y195D	Y	+	1	0	CA13	86368022	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	7.311000	0.78958	2.104000	0.64026	0.383000	0.25322	TAT	.	.	.	none		0.398	CA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381066.1	NM_198584	
EFR3A	23167	hgsc.bcm.edu	37	8	132982859	132982859	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr8:132982859G>T	ENST00000254624.5	+	10	1353	c.1128G>T	c.(1126-1128)aaG>aaT	p.K376N	EFR3A_ENST00000519656.1_Missense_Mutation_p.K340N|EFR3A_ENST00000334503.4_Missense_Mutation_p.K376N	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	376						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATGATGAGAAGATTGTGCAGA	0.378																																					p.K376N		Atlas-SNP	.											.	EFR3A	96	.	0			c.G1128T						PASS	.						124.0	124.0	124.0					8																	132982859		2203	4300	6503	SO:0001583	missense	23167	exon10			TGAGAAGATTGTG	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.1128G>T	chr8.hg19:g.132982859G>T	ENSP00000254624:p.Lys376Asn	141.0	0.0	.		182.0	56.0	.	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	ENST00000254624.5	hg19	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592563	0.46214	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.67345	3.52;3.52;-0.26	5.56	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.045081	0.85682	D	0.000000	T	0.58764	0.2145	L	0.47190	1.495	0.38491	D	0.947988	B	0.28512	0.214	B	0.30782	0.12	T	0.59563	-0.7431	10	0.39692	T	0.17	-19.1717	10.108	0.42546	0.073:0.0:0.789:0.138	.	376	Q14156	EFR3A_HUMAN	N	376;376;376;340	ENSP00000254624:K376N;ENSP00000334769:K376N;ENSP00000428086:K340N	ENSP00000254624:K376N	K	+	3	2	EFR3A	133052041	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.792000	0.47837	1.342000	0.45619	0.585000	0.79938	AAG	.	.	.	none		0.378	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
KIAA0020	9933	hgsc.bcm.edu	37	9	2810352	2810352	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr9:2810352C>G	ENST00000397885.2	-	16	1921	c.1715G>C	c.(1714-1716)gGg>gCg	p.G572A		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	572						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		ACCTTCTCTCCCATTTTCTTT	0.393																																					p.G572A		Atlas-SNP	.											.	KIAA0020	56	.	0			c.G1715C						PASS	.						225.0	188.0	201.0					9																	2810352		2203	4300	6503	SO:0001583	missense	9933	exon16			TCTCTCCCATTTT	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1715G>C	chr9.hg19:g.2810352C>G	ENSP00000380982:p.Gly572Ala	65.0	0.0	.		91.0	21.0	.	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	hg19	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731430	0.30684	.	.	ENSG00000080608	ENST00000397885	T	0.50548	0.74	5.95	5.05	0.67936	CPL (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.046170	0.85682	D	0.000000	T	0.48607	0.1509	M	0.73962	2.25	0.45528	D	0.998487	B;B	0.12013	0.005;0.001	B;B	0.15870	0.014;0.006	T	0.44682	-0.9312	10	0.21014	T	0.42	-18.5072	14.8914	0.70611	0.0:0.7295:0.2705:0.0	.	432;572	B2RDG4;Q15397	.;K0020_HUMAN	A	572	ENSP00000380982:G572A	ENSP00000380982:G572A	G	-	2	0	KIAA0020	2800352	1.000000	0.71417	0.326000	0.25389	0.569000	0.35902	2.906000	0.48735	1.521000	0.48983	0.650000	0.86243	GGG	.	.	.	none		0.393	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	
PRSS3	5646	hgsc.bcm.edu	37	9	33798069	33798069	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr9:33798069T>C	ENST00000361005.5	+	3	614	c.614T>C	c.(613-615)cTg>cCg	p.L205P	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Missense_Mutation_p.L141P|PRSS3_ENST00000342836.4_Missense_Mutation_p.L162P|PRSS3_ENST00000379405.3_Missense_Mutation_p.L148P	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	205	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GGCAACACTCTGAGCTTTGGT	0.572																																					p.L205P		Atlas-SNP	.											.	PRSS3	79	.	0			c.T614C						PASS	.						130.0	111.0	117.0					9																	33798069		2203	4300	6503	SO:0001583	missense	5646	exon3			ACACTCTGAGCTT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.614T>C	chr9.hg19:g.33798069T>C	ENSP00000354280:p.Leu205Pro	129.0	0.0	.		174.0	52.0	.	NM_007343	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	hg19	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	T	10.01	1.233504	0.22626	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	3.61	-1.02	0.10135	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.210916	0.40908	D	0.000985	D	0.83248	0.5213	L	0.27053	0.805	0.58432	D	0.999996	P;P;P	0.52170	0.477;0.951;0.649	P;P;P	0.55785	0.589;0.784;0.485	T	0.76798	-0.2826	10	0.45353	T	0.12	.	2.3719	0.04332	0.3669:0.2296:0.0:0.4035	.	148;205;162	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	P	205;160;162;141;148	ENSP00000354280:L205P;ENSP00000401249:L160P;ENSP00000340889:L162P;ENSP00000401828:L141P;ENSP00000368715:L148P	ENSP00000340889:L162P	L	+	2	0	PRSS3	33788069	0.949000	0.32298	0.976000	0.42696	0.018000	0.09664	1.089000	0.30890	-0.026000	0.13895	-0.753000	0.03488	CTG	.	.	.	none		0.572	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
SEMA4D	10507	hgsc.bcm.edu	37	9	92007357	92007357	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr9:92007357A>T	ENST00000450295.1	-	8	1379	c.603T>A	c.(601-603)taT>taA	p.Y201*	SEMA4D_ENST00000420987.1_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000339861.4_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000455551.2_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000356444.2_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000422704.2_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000438547.2_Nonsense_Mutation_p.Y201*|SEMA4D_ENST00000343780.4_Nonsense_Mutation_p.Y201*			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	201	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						AAGGGATTGCATATTCTGTCC	0.488																																					p.Y201X		Atlas-SNP	.											.	SEMA4D	81	.	0			c.T603A						PASS	.						125.0	112.0	117.0					9																	92007357		2203	4300	6503	SO:0001587	stop_gained	10507	exon10			GATTGCATATTCT	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.603T>A	chr9.hg19:g.92007357A>T	ENSP00000416523:p.Tyr201*	138.0	0.0	.		139.0	40.0	.	NM_006378	B2RPM6|Q7Z5S4|Q8N8B0	Nonsense_Mutation	SNP	ENST00000450295.1	hg19	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	G	38	6.945547	0.97956	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	.	.	.	5.92	-9.64	0.00541	.	0.057514	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	23.1558	0.99980	0.8226:0.0:0.1774:0.0	.	.	.	.	X	201	.	ENSP00000344923:Y201X	Y	-	3	2	SEMA4D	91197177	0.023000	0.18921	0.008000	0.14137	0.015000	0.08874	-0.722000	0.04958	-2.623000	0.00438	-1.874000	0.00550	TAT	.	.	.	none		0.488	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
NUP214	8021	hgsc.bcm.edu	37	9	134019822	134019822	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr9:134019822T>A	ENST00000359428.5	+	12	1594	c.1450T>A	c.(1450-1452)Ttt>Att	p.F484I	RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.F484I|NUP214_ENST00000451030.1_Missense_Mutation_p.F484I|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	484	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGTGTTCTCCTTTGGTTCTTC	0.582			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.F484I	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.T1450A						PASS	.						222.0	224.0	223.0					9																	134019822		2203	4300	6503	SO:0001583	missense	8021	exon12			TTCTCCTTTGGTT	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1450T>A	chr9.hg19:g.134019822T>A	ENSP00000352400:p.Phe484Ile	413.0	0.0	.		479.0	161.0	.	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429164	0.83776	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899	T;T;T	0.79653	-1.29;-1.29;-1.29	5.79	5.79	0.91817	.	0.000000	0.42053	D	0.000772	T	0.72867	0.3514	N	0.08118	0	0.45554	D	0.998503	D;D	0.56287	0.975;0.975	P;P	0.51516	0.591;0.672	T	0.77928	-0.2404	10	0.52906	T	0.07	-18.8096	13.8602	0.63554	0.0:0.0:0.0:1.0	.	484;484	P35658-4;P35658	.;NU214_HUMAN	I	484;484;484;484;77	ENSP00000352400:F484I;ENSP00000396576:F484I;ENSP00000405014:F484I	ENSP00000352400:F484I	F	+	1	0	NUP214	133009643	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.193000	0.50997	2.201000	0.70794	0.533000	0.62120	TTT	.	.	.	none		0.582	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
PFKFB3	5209	hgsc.bcm.edu	37	10	6258717	6258717	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr10:6258717C>A	ENST00000379775.4	+	5	745	c.415C>A	c.(415-417)Cat>Aat	p.H139N	PFKFB3_ENST00000379785.1_Missense_Mutation_p.H139N|PFKFB3_ENST00000379789.4_Missense_Mutation_p.H119N|PFKFB3_ENST00000360521.2_Missense_Mutation_p.H139N|PFKFB3_ENST00000540253.1_Missense_Mutation_p.H153N|PFKFB3_ENST00000317350.4_Missense_Mutation_p.H139N|PFKFB3_ENST00000536985.1_Missense_Mutation_p.H119N|PFKFB3_ENST00000379782.3_Missense_Mutation_p.H139N	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	139	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						CATGATCCTTCATTTTGCCAA	0.463																																					p.H139N		Atlas-SNP	.											.	PFKFB3	82	.	0			c.C415A						PASS	.						215.0	210.0	211.0					10																	6258717		2203	4300	6503	SO:0001583	missense	5209	exon5			ATCCTTCATTTTG		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.415C>A	chr10.hg19:g.6258717C>A	ENSP00000369100:p.His139Asn	254.0	0.0	.		206.0	49.0	.	NM_004566	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	hg19	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	C	5.826	0.336691	0.11013	.	.	ENSG00000170525	ENST00000536985;ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.71	1.54	0.23209	6-phosphofructo-2-kinase (1);	0.496023	0.24935	N	0.034432	T	0.06554	0.0168	N	0.00408	-1.53	0.20403	N	0.999904	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.40905	-0.9538	9	0.05620	T	0.96	-18.1641	9.3897	0.38365	0.3959:0.419:0.1851:0.0	.	153;139;139;119	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	N	119;119;153;139;139;139;139;139;139	.	ENSP00000369105:H139N	H	+	1	0	PFKFB3	6298723	0.021000	0.18746	0.983000	0.44433	0.868000	0.49771	0.284000	0.18864	0.716000	0.32124	0.591000	0.81541	CAT	.	.	.	none		0.463	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1		
PFKFB3	5209	hgsc.bcm.edu	37	10	6258719	6258719	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr10:6258719T>A	ENST00000379775.4	+	5	747	c.417T>A	c.(415-417)caT>caA	p.H139Q	PFKFB3_ENST00000379785.1_Missense_Mutation_p.H139Q|PFKFB3_ENST00000379789.4_Missense_Mutation_p.H119Q|PFKFB3_ENST00000360521.2_Missense_Mutation_p.H139Q|PFKFB3_ENST00000540253.1_Missense_Mutation_p.H153Q|PFKFB3_ENST00000317350.4_Missense_Mutation_p.H139Q|PFKFB3_ENST00000536985.1_Missense_Mutation_p.H119Q|PFKFB3_ENST00000379782.3_Missense_Mutation_p.H139Q	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	139	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						TGATCCTTCATTTTGCCAAAG	0.468																																					p.H139Q		Atlas-SNP	.											.	PFKFB3	82	.	0			c.T417A						PASS	.						212.0	207.0	209.0					10																	6258719		2203	4300	6503	SO:0001583	missense	5209	exon5			CCTTCATTTTGCC		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.417T>A	chr10.hg19:g.6258719T>A	ENSP00000369100:p.His139Gln	244.0	0.0	.		201.0	47.0	.	NM_004566	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	hg19	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	T	7.097	0.573259	0.13623	.	.	ENSG00000170525	ENST00000536985;ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	5.71	0.992	0.19819	6-phosphofructo-2-kinase (1);	0.496023	0.24935	N	0.034432	T	0.13586	0.0329	N	0.01168	-0.975	0.30946	N	0.72524	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.0;0.0;0.0	T	0.24512	-1.0158	9	0.13470	T	0.59	-18.1641	10.2567	0.43401	0.0:0.3897:0.0:0.6103	.	153;139;139;119	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	Q	119;119;153;139;139;139;139;139;139	.	ENSP00000369105:H139Q	H	+	3	2	PFKFB3	6298725	0.869000	0.29996	0.999000	0.59377	0.820000	0.46376	-0.073000	0.11468	0.448000	0.26722	-0.376000	0.06991	CAT	.	.	.	none		0.468	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1		
PRPF18	8559	hgsc.bcm.edu	37	10	13653627	13653627	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr10:13653627T>A	ENST00000378572.3	+	6	683	c.523T>A	c.(523-525)Tcc>Acc	p.S175T		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	175					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GCTTGGAGAGTCCTTAGGGAA	0.423																																					p.S175T		Atlas-SNP	.											.	PRPF18	32	.	0			c.T523A						PASS	.						128.0	119.0	122.0					10																	13653627		2203	4300	6503	SO:0001583	missense	8559	exon6			GGAGAGTCCTTAG	U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.523T>A	chr10.hg19:g.13653627T>A	ENSP00000367835:p.Ser175Thr	119.0	0.0	.		105.0	39.0	.	NM_003675	Q5T9P9|Q9BUI9	Missense_Mutation	SNP	ENST00000378572.3	hg19	CCDS7100.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886622	0.33348	.	.	ENSG00000165630	ENST00000378572;ENST00000417658;ENST00000320054;ENST00000378544	.	.	.	5.59	5.59	0.84812	Prp18 (2);	0.105608	0.64402	D	0.000003	T	0.41419	0.1158	N	0.16478	0.41	0.45295	D	0.998291	B	0.06786	0.001	B	0.04013	0.001	T	0.28681	-1.0036	9	0.15499	T	0.54	-14.6828	15.7693	0.78152	0.0:0.0:0.0:1.0	.	175	Q99633	PRP18_HUMAN	T	175;169;160;169	.	ENSP00000367824:S160T	S	+	1	0	PRPF18	13693633	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.281000	0.58965	2.125000	0.65367	0.459000	0.35465	TCC	.	.	.	none		0.423	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046879.1		
CUBN	8029	hgsc.bcm.edu	37	10	16941136	16941136	+	Silent	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr10:16941136A>G	ENST00000377833.4	-	54	8522	c.8457T>C	c.(8455-8457)ccT>ccC	p.P2819P		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2819	CUB 21. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGGCCAGTGAGGGGATCTGA	0.398																																					p.P2819P		Atlas-SNP	.											.	CUBN	515	.	0			c.T8457C						PASS	.						129.0	121.0	124.0					10																	16941136		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon54			CCAGTGAGGGGAT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.8457T>C	chr10.hg19:g.16941136A>G		111.0	0.0	.		103.0	44.0	.	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.	.	none		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
NRAP	4892	hgsc.bcm.edu	37	10	115365937	115365939	+	Splice_Site	TNP	GTC	GTC	TAA			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G|T|C	G|T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr10:115365937_115365939GTC>TAA	ENST00000359988.3	-	33	4049_4051	c.3805_3807GAC>TTA	c.(3805-3807)GAC>TTA	p.D1269L	NRAP_ENST00000369358.4_Splice_Site_p.D1277L|NRAP_ENST00000360478.3_Splice_Site_p.D1234L|NRAP_ENST00000369360.3_Splice_Site_p.D1242L	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		AAGGGCTTACGTCACTCAGGTTG	0.478																																					p.D1269E|p.D1269V|p.D1269Y		Atlas-SNP	.											.	NRAP	208	.	0			c.C3807A|c.A3806T|c.G3805T						PASS	.																																			SO:0001630	splice_region_variant	4892	exon33			GCTTACGTCACTC|CTTACGTCACTCA|TTACGTCACTCAG		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3807+1GAC>TTA	chr10.hg19:g.115365937GTC>TAA		63.0	0.0	.		82.0|84.0|84.0	24.0|24.0|25.0	.	NM_001261463		Missense_Mutation	SNP	ENST00000359988.3	hg19	CCDS7579.1																																																																																			.	.	.	none		0.478	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	Missense_Mutation
MPEG1	219972	hgsc.bcm.edu	37	11	58978386	58978386	+	Silent	SNP	A	A	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:58978386A>T	ENST00000361050.3	-	1	2038	c.1953T>A	c.(1951-1953)ggT>ggA	p.G651G		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	651						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CTCCTGACAGACCACCACCAT	0.577																																					p.G651G		Atlas-SNP	.											.	MPEG1	72	.	0			c.T1953A						PASS	.						100.0	108.0	105.0					11																	58978386		2014	4161	6175	SO:0001819	synonymous_variant	219972	exon1			TGACAGACCACCA	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1953T>A	chr11.hg19:g.58978386A>T		174.0	0.0	.		180.0	58.0	.	NM_001039396	Q2M1T6|Q8TEF8	Silent	SNP	ENST00000361050.3	hg19	CCDS41650.1																																																																																			.	.	.	none		0.577	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
MACROD1	28992	hgsc.bcm.edu	37	11	63885635	63885635	+	Intron	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:63885635G>A	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Silent_p.E632E	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CCAAAGAAGAGTACGTGGTCC	0.607																																					p.E632E		Atlas-SNP	.											.	FLRT1	46	.	0			c.G1896A						PASS	.						79.0	69.0	72.0					11																	63885635		2201	4297	6498	SO:0001627	intron_variant	23769	exon2			AGAAGAGTACGTG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+33075C>T	chr11.hg19:g.63885635G>A		126.0	0.0	.		139.0	58.0	.	NM_013280	Q9UH96	Silent	SNP	ENST00000255681.6	hg19	CCDS8056.1																																																																																			.	.	.	none		0.607	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
PC	5091	hgsc.bcm.edu	37	11	66617172	66617172	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:66617172G>C	ENST00000393958.2	-	20	3150	c.3057C>G	c.(3055-3057)caC>caG	p.H1019Q	PC_ENST00000393955.2_Missense_Mutation_p.H1019Q|PC_ENST00000529047.1_Missense_Mutation_p.H139Q|PC_ENST00000393960.1_Missense_Mutation_p.H1019Q|PC_ENST00000528224.1_5'UTR	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	1019					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	AGTCCTTGAAGTGGGCAAACA	0.577																																					p.H1019Q		Atlas-SNP	.											.	PC	116	.	0			c.C3057G						PASS	.						107.0	86.0	93.0					11																	66617172		2200	4295	6495	SO:0001583	missense	5091	exon20			CTTGAAGTGGGCA	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.3057C>G	chr11.hg19:g.66617172G>C	ENSP00000377530:p.His1019Gln	81.0	0.0	.		97.0	26.0	.	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	hg19	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427583	0.25726	.	.	ENSG00000173599	ENST00000529047;ENST00000393955;ENST00000393958;ENST00000393960	D;D;D;D	0.95377	-1.52;-3.69;-3.69;-3.69	4.89	-4.28	0.03732	Carboxylase, conserved domain (1);	0.231260	0.33515	N	0.004840	T	0.79505	0.4457	N	0.00859	-1.14	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.59568	-0.7430	10	0.34782	T	0.22	-8.0574	7.3499	0.26684	0.0864:0.6092:0.163:0.1415	.	1019	P11498	PYC_HUMAN	Q	139;1019;1019;1019	ENSP00000435905:H139Q;ENSP00000377527:H1019Q;ENSP00000377530:H1019Q;ENSP00000377532:H1019Q	ENSP00000377527:H1019Q	H	-	3	2	PC	66373748	0.988000	0.35896	0.454000	0.27019	0.803000	0.45373	0.243000	0.18106	-0.607000	0.05738	0.462000	0.41574	CAC	.	.	.	none		0.577	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
DRD2	1813	hgsc.bcm.edu	37	11	113288847	113288847	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:113288847C>T	ENST00000362072.3	-	3	641	c.297G>A	c.(295-297)gaG>gaA	p.E99E	DRD2_ENST00000355319.2_Silent_p.E99E|DRD2_ENST00000346454.3_Silent_p.E99E|DRD2_ENST00000535984.1_5'UTR|DRD2_ENST00000542968.1_Silent_p.E99E|DRD2_ENST00000538967.1_Silent_p.E99E|DRD2_ENST00000544518.1_Silent_p.E98E	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	99					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TGAATTTCCACTCACCTACCA	0.532																																					p.E99E		Atlas-SNP	.											.	DRD2	98	.	0			c.G297A						PASS	.						171.0	121.0	138.0					11																	113288847		2201	4296	6497	SO:0001819	synonymous_variant	1813	exon3			TTTCCACTCACCT	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.297G>A	chr11.hg19:g.113288847C>T		65.0	0.0	.		65.0	18.0	.	NM_016574	Q9NZR3|Q9UPA9	Silent	SNP	ENST00000362072.3	hg19	CCDS8361.1																																																																																			.	.	.	none		0.532	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
IGSF9B	22997	hgsc.bcm.edu	37	11	133816079	133816079	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:133816079C>T	ENST00000321016.8	-	2	369	c.139G>A	c.(139-141)Gtg>Atg	p.V47M	IGSF9B_ENST00000533871.2_Missense_Mutation_p.V47M			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	47	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGGTGGATCACGTCGCATCGC	0.627																																					p.V47M		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G139A						PASS	.						50.0	57.0	54.0					11																	133816079		2145	4233	6378	SO:0001583	missense	22997	exon2			GGATCACGTCGCA	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.139G>A	chr11.hg19:g.133816079C>T	ENSP00000317980:p.Val47Met	38.0	0.0	.		46.0	12.0	.	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	C	32	5.124674	0.94429	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.41	5.41	0.78517	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000025	T	0.82144	0.4973	M	0.75884	2.315	0.58432	D	0.999999	D	0.89917	1.0	D	0.74023	0.982	D	0.84066	0.0377	10	0.87932	D	0	.	18.8177	0.92084	0.0:1.0:0.0:0.0	.	47	Q9UPX0	TUTLB_HUMAN	M	47;47;37;94	ENSP00000317980:V47M;ENSP00000436576:V47M;ENSP00000434026:V37M;ENSP00000435989:V94M	ENSP00000317980:V47M	V	-	1	0	IGSF9B	133321289	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.684000	0.84104	2.544000	0.85801	0.655000	0.94253	GTG	.	.	.	none		0.627	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
KLRK1	22914	hgsc.bcm.edu	37	12	10541382	10541382	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:10541382G>A	ENST00000240618.6	-	2	168	c.28C>T	c.(28-30)Cga>Tga	p.R10*	KLRK1_ENST00000540818.1_Nonsense_Mutation_p.R10*|KLRC4-KLRK1_ENST00000539300.1_3'UTR|RP11-277P12.20_ENST00000500682.1_RNA	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	10					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CAGCTGTGTCGAGACCTCCGA	0.388																																					p.R10X		Atlas-SNP	.											.	.	.	.	0			c.C28T						PASS	.						101.0	92.0	95.0					12																	10541382		2203	4300	6503	SO:0001587	stop_gained	0	exon7			TGTGTCGAGACCT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.28C>T	chr12.hg19:g.10541382G>A	ENSP00000240618:p.Arg10*	98.0	0.0	.		111.0	47.0	.	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Nonsense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.601701	0.87055	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	.	.	.	3.92	2.04	0.26737	.	1.508560	0.03947	N	0.287889	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	4.7229	0.12927	0.1127:0.0:0.657:0.2303	.	.	.	.	X	10	.	ENSP00000240618:R10X	R	-	1	2	KLRK1	10432649	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.084000	0.11268	0.589000	0.29677	0.637000	0.83480	CGA	.	.	.	none		0.388	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
LRP6	4040	hgsc.bcm.edu	37	12	12318144	12318144	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:12318144T>A	ENST00000261349.4	-	8	1707	c.1631A>T	c.(1630-1632)tAt>tTt	p.Y544F	LRP6_ENST00000543091.1_Missense_Mutation_p.Y544F	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	544	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CCAGTAAACATAGTCACCCAA	0.433																																					p.Y544F		Atlas-SNP	.											.	LRP6	170	.	0			c.A1631T						PASS	.						149.0	150.0	150.0					12																	12318144		2203	4300	6503	SO:0001583	missense	4040	exon8			TAAACATAGTCAC	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1631A>T	chr12.hg19:g.12318144T>A	ENSP00000261349:p.Tyr544Phe	195.0	0.0	.		215.0	83.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	T	9.879	1.200963	0.22121	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91295	-2.82;-2.82	4.98	3.81	0.43845	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	D	0.000032	T	0.81767	0.4892	N	0.21583	0.68	0.51767	D	0.999935	B;B	0.06786	0.001;0.001	B;B	0.10450	0.001;0.005	T	0.71820	-0.4477	10	0.11794	T	0.64	.	11.3882	0.49798	0.1355:0.0:0.0:0.8645	.	544;544	F5H7J9;O75581	.;LRP6_HUMAN	F	544	ENSP00000261349:Y544F;ENSP00000442472:Y544F	ENSP00000261349:Y544F	Y	-	2	0	LRP6	12209411	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	1.571000	0.36450	0.834000	0.34852	0.377000	0.23210	TAT	.	.	.	none		0.433	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
FAR2	55711	hgsc.bcm.edu	37	12	29469910	29469910	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:29469910T>A	ENST00000536681.3	+	9	1338	c.1092T>A	c.(1090-1092)taT>taA	p.Y364*	FAR2_ENST00000547116.1_Nonsense_Mutation_p.Y267*|FAR2_ENST00000182377.4_Nonsense_Mutation_p.Y364*|RP11-996F15.2_ENST00000553105.1_RNA	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	364					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CCATTATCTATGACTGCTATC	0.502																																					p.Y364X		Atlas-SNP	.											.	FAR2	60	.	0			c.T1092A						PASS	.						133.0	136.0	135.0					12																	29469910		2203	4300	6503	SO:0001587	stop_gained	55711	exon9			TATCTATGACTGC	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1092T>A	chr12.hg19:g.29469910T>A	ENSP00000443291:p.Tyr364*	325.0	0.0	.		358.0	142.0	.	NM_018099	F8VV73|Q9H0D5|Q9NVW8	Nonsense_Mutation	SNP	ENST00000536681.3	hg19	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	T	38	7.075542	0.98048	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	.	.	.	4.44	-3.57	0.04612	.	0.075218	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-5.8079	11.3024	0.49314	0.0:0.5138:0.0:0.4862	.	.	.	.	X	364;364;267	.	ENSP00000182377:Y364X	Y	+	3	2	FAR2	29361177	0.039000	0.19947	0.980000	0.43619	0.940000	0.58332	-0.830000	0.04410	-0.596000	0.05821	0.383000	0.25322	TAT	.	.	.	none		0.502	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
LRRK2	120892	hgsc.bcm.edu	37	12	40758851	40758851	+	Splice_Site	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:40758851A>G	ENST00000298910.7	+	49	7447	c.7389A>G	c.(7387-7389)ctA>ctG	p.L2463L		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2463					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CAGCACAGCTAGGCAAGTTTC	0.343																																					p.L2463L		Atlas-SNP	.											.	LRRK2	763	.	0			c.A7389G						PASS	.						66.0	63.0	64.0					12																	40758851		2203	4298	6501	SO:0001630	splice_region_variant	120892	exon49			ACAGCTAGGCAAG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7390+1A>G	chr12.hg19:g.40758851A>G		73.0	0.0	.		96.0	34.0	.	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	ENST00000298910.7	hg19	CCDS31774.1																																																																																			.	.	.	none		0.343	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	Silent
ANO6	196527	hgsc.bcm.edu	37	12	45803213	45803213	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:45803213G>T	ENST00000320560.8	+	16	2156	c.1954G>T	c.(1954-1956)Gac>Tac	p.D652Y	ANO6_ENST00000441606.2_Missense_Mutation_p.D634Y|ANO6_ENST00000423947.3_Missense_Mutation_p.D673Y|ANO6_ENST00000426898.2_3'UTR|ANO6_ENST00000425752.2_Missense_Mutation_p.D652Y|ANO6_ENST00000435642.1_Missense_Mutation_p.D652Y	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	652					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						ATGGGAACAGGACTACCATCT	0.353																																					p.D673Y		Atlas-SNP	.											.	ANO6	163	.	0			c.G2017T						PASS	.						124.0	124.0	124.0					12																	45803213		2203	4300	6503	SO:0001583	missense	196527	exon17			GAACAGGACTACC	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.1954G>T	chr12.hg19:g.45803213G>T	ENSP00000320087:p.Asp652Tyr	161.0	0.0	.		168.0	58.0	.	NM_001204803	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	ENST00000320560.8	hg19	CCDS31782.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754633	0.89843	.	.	ENSG00000177119	ENST00000425752;ENST00000423947;ENST00000435642;ENST00000320560;ENST00000441606	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.83991	0.5374	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.999;1.0;0.995	D	0.87659	0.2533	10	0.87932	D	0	.	19.0047	0.92846	0.0:0.0:1.0:0.0	.	634;673;652;652	E9PB30;B9EGG0;E9PCT2;Q4KMQ2	.;.;.;ANO6_HUMAN	Y	652;673;652;652;634	ENSP00000391417:D652Y;ENSP00000409126:D673Y;ENSP00000413840:D652Y;ENSP00000320087:D652Y;ENSP00000413137:D634Y	ENSP00000320087:D652Y	D	+	1	0	ANO6	44089480	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.813000	0.99286	2.652000	0.90054	0.655000	0.94253	GAC	.	.	.	none		0.353	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404822.1	XM_113743	
PTPN11	5781	hgsc.bcm.edu	37	12	112892458	112892458	+	Silent	SNP	T	T	C	rs78376169		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:112892458T>C	ENST00000351677.2	+	5	814	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	PTPN11_ENST00000392597.1_Silent_p.L206L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	206	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.L206L(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGTGGAAACATTGGGTACAGT	0.373			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.L206L		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	PTPN11,NS,carcinoma,0,2	PTPN11	623	.	1	Substitution - coding silent(1)	stomach(1)	c.T616C						PASS	.						87.0	82.0	84.0					12																	112892458		2203	4300	6503	SO:0001819	synonymous_variant	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GAAACATTGGGTA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.616T>C	chr12.hg19:g.112892458T>C		67.0	1.0	.		70.0	4.0	.	NM_080601	A8K1D9|Q96HD7	Silent	SNP	ENST00000351677.2	hg19	CCDS9163.1																																																																																			.	.	.	weak		0.373	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
ATP7B	540	hgsc.bcm.edu	37	13	52548876	52548876	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr13:52548876G>A	ENST00000242839.4	-	2	636	c.480C>T	c.(478-480)tcC>tcT	p.S160S	ATP7B_ENST00000400366.3_Silent_p.S160S|ATP7B_ENST00000344297.5_Silent_p.S160S|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000542656.1_Silent_p.S128S|ATP7B_ENST00000400370.3_Silent_p.S160S|ATP7B_ENST00000418097.2_Silent_p.S160S|ATP7B_ENST00000448424.2_Silent_p.S160S	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	160	HMA 2. {ECO:0000255|PROSITE- ProRule:PRU00280}.				cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGCCTTCAATGGAGCTGACAC	0.562									Wilson disease																												p.S160S		Atlas-SNP	.											.	ATP7B	123	.	0			c.C480T						PASS	.						47.0	49.0	48.0					13																	52548876		2045	4186	6231	SO:0001819	synonymous_variant	540	exon2	Familial Cancer Database		TTCAATGGAGCTG	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.480C>T	chr13.hg19:g.52548876G>A		71.0	0.0	.		72.0	23.0	.	NM_001243182	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Silent	SNP	ENST00000242839.4	hg19	CCDS41892.1																																																																																			.	.	.	none		0.562	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
CDC16	8881	hgsc.bcm.edu	37	13	115022697	115022697	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr13:115022697G>T	ENST00000356221.3	+	13	1350	c.1242G>T	c.(1240-1242)caG>caT	p.Q414H	CDC16_ENST00000252458.6_Intron|CDC16_ENST00000360383.3_Missense_Mutation_p.Q414H|CDC16_ENST00000252457.5_Missense_Mutation_p.Q413H|CDC16_ENST00000375308.1_Missense_Mutation_p.Q320H|CDC16_ENST00000375310.1_Missense_Mutation_p.Q320H|CDC16_ENST00000375312.3_Intron			Q13042	CDC16_HUMAN	cell division cycle 16	414					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			TTGCATTTCAGAATGGAGAGT	0.438																																					p.Q414H		Atlas-SNP	.											.	CDC16	50	.	0			c.G1242T						PASS	.						121.0	114.0	116.0					13																	115022697		2203	4300	6503	SO:0001583	missense	8881	exon13			ATTTCAGAATGGA	U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.1242G>T	chr13.hg19:g.115022697G>T	ENSP00000348554:p.Gln414His	142.0	0.0	.		166.0	53.0	.	NM_003903	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	ENST00000356221.3	hg19	CCDS9542.2	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074396	0.36566	.	.	ENSG00000130177	ENST00000360383;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.94	-2.27	0.06846	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.064378	0.64402	D	0.000003	T	0.27866	0.0686	N	0.12182	0.205	0.80722	D	1	B;B	0.23540	0.018;0.087	B;B	0.11329	0.006;0.006	T	0.07328	-1.0778	9	.	.	.	-19.2092	13.2551	0.60074	0.6016:0.0:0.3984:0.0	.	413;414	Q13042-2;Q13042	.;CDC16_HUMAN	H	414;414;320;413;320	ENSP00000353549:Q414H;ENSP00000348554:Q414H;ENSP00000364459:Q320H;ENSP00000252457:Q413H;ENSP00000364457:Q320H	.	Q	+	3	2	CDC16	114040799	1.000000	0.71417	0.983000	0.44433	0.942000	0.58702	0.794000	0.26958	-0.384000	0.07845	-0.142000	0.14014	CAG	.	.	.	none		0.438	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276737.1	NM_003903	
TINF2	26277	hgsc.bcm.edu	37	14	24709984	24709984	+	Silent	SNP	G	G	C	rs201135568		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:24709984G>C	ENST00000267415.7	-	6	1043	c.702C>G	c.(700-702)gcC>gcG	p.A234A	TINF2_ENST00000558566.1_3'UTR|TINF2_ENST00000558510.1_5'Flank|TINF2_ENST00000540705.1_Silent_p.A199A|TINF2_ENST00000538777.1_Silent_p.A20A|TINF2_ENST00000559019.1_3'UTR|TINF2_ENST00000399423.4_Silent_p.A234A	NM_001099274.1	NP_001092744.1	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	234					negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of protein ADP-ribosylation (GO:0010836)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of telomere maintenance (GO:0032206)|protein localization to chromosome (GO:0034502)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinucleolar chromocenter (GO:0010370)	telomeric DNA binding (GO:0042162)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|prostate(1)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0185)		TGCCAGGCTTGGCTTTTGGCA	0.552									Congenital Dyskeratosis;Ataxia Pancytopenia syndrome																												p.A234A		Atlas-SNP	.											.	TINF2	61	.	0			c.C702G						PASS	.						149.0	144.0	146.0					14																	24709984		1996	4158	6154	SO:0001819	synonymous_variant	26277	exon6	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita;Myelocerebellar disorder	AGGCTTGGCTTTT	AF195512	CCDS41936.1, CCDS41937.1	14q12	2008-07-29				ENSG00000092330			11824	protein-coding gene	gene with protein product		604319				10581025, 18252230	Standard	NM_012461		Approved	TIN2	uc001woa.4	Q9BSI4		ENST00000267415.7:c.702C>G	chr14.hg19:g.24709984G>C		150.0	0.0	.		143.0	35.0	.	NM_001099274	B3W5Q7|Q9H904|Q9UHC2	Silent	SNP	ENST00000267415.7	hg19	CCDS41936.1																																																																																			.	G|1.000;A|0.000	.	alt		0.552	TINF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415406.2		
HSPA2	3306	hgsc.bcm.edu	37	14	65008125	65008125	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:65008125G>A	ENST00000394709.1	+	2	634	c.558G>A	c.(556-558)ctG>ctA	p.L186L	HSPA2_ENST00000247207.6_Silent_p.L186L|RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000554883.1_3'UTR			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	186					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CCTACGGCCTGGACAAGAAGG	0.642																																					p.L186L	Pancreas(136;1211 1835 24894 31984 38227)	Atlas-SNP	.											.	HSPA2	83	.	0			c.G558A						PASS	.						67.0	75.0	72.0					14																	65008125		2203	4300	6503	SO:0001819	synonymous_variant	3306	exon1			CGGCCTGGACAAG	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.558G>A	chr14.hg19:g.65008125G>A		160.0	0.0	.		154.0	45.0	.	NM_021979	Q15508|Q53XM3|Q9UE78	Silent	SNP	ENST00000394709.1	hg19	CCDS9766.1																																																																																			.	.	.	none		0.642	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
HSPA2	3306	hgsc.bcm.edu	37	14	65008173	65008173	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:65008173C>A	ENST00000394709.1	+	2	682	c.606C>A	c.(604-606)gaC>gaA	p.D202E	HSPA2_ENST00000247207.6_Missense_Mutation_p.D202E|RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000554883.1_3'UTR			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	202					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		TCATCTTTGACCTGGGCGGTG	0.642																																					p.D202E	Pancreas(136;1211 1835 24894 31984 38227)	Atlas-SNP	.											.	HSPA2	83	.	0			c.C606A						PASS	.						98.0	106.0	103.0					14																	65008173		2203	4300	6503	SO:0001583	missense	3306	exon1			CTTTGACCTGGGC	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.606C>A	chr14.hg19:g.65008173C>A	ENSP00000378199:p.Asp202Glu	169.0	0.0	.		200.0	58.0	.	NM_021979	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	hg19	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793970	0.70452	.	.	ENSG00000126803	ENST00000394709;ENST00000247207	T;T	0.49720	0.77;0.77	5.22	5.22	0.72569	Heat shock protein 70, conserved site (1);	0.000000	0.56097	U	0.000034	D	0.87026	0.6075	H	0.99998	5.51	0.44736	D	0.997733	D	0.89917	1.0	D	0.91635	0.999	D	0.94368	0.7593	10	0.87932	D	0	-12.6764	18.774	0.91902	0.0:1.0:0.0:0.0	.	202	P54652	HSP72_HUMAN	E	202	ENSP00000378199:D202E;ENSP00000247207:D202E	ENSP00000247207:D202E	D	+	3	2	HSPA2	64077926	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.963000	0.56773	2.422000	0.82143	0.563000	0.77884	GAC	.	.	.	none		0.642	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
ADAM20	8748	hgsc.bcm.edu	37	14	70991146	70991146	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:70991146T>C	ENST00000256389.3	-	2	723	c.479A>G	c.(478-480)tAc>tGc	p.Y160C	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	110					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		ACCATGGTAGTAGCAGTCATC	0.498																																					p.Y160C		Atlas-SNP	.											.	ADAM20	59	.	0			c.A479G						PASS	.						145.0	102.0	117.0					14																	70991146		2203	4300	6503	SO:0001583	missense	8748	exon2			TGGTAGTAGCAGT	AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.479A>G	chr14.hg19:g.70991146T>C	ENSP00000256389:p.Tyr160Cys	123.0	0.0	.		161.0	71.0	.	NM_003814	Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	ENST00000256389.3	hg19	CCDS32111.1	.	.	.	.	.	.	.	.	.	.	T	10.77	1.444114	0.25987	.	.	ENSG00000134007	ENST00000256389	T	0.07444	3.19	4.14	1.61	0.23674	Peptidase M12B, propeptide (1);	0.000000	0.35555	N	0.003123	T	0.39600	0.1084	H	0.98133	4.155	0.26202	N	0.979437	D	0.89917	1.0	D	0.79108	0.992	T	0.41179	-0.9523	10	0.87932	D	0	.	9.3882	0.38356	0.4926:0.0:0.0:0.5074	.	110	O43506	ADA20_HUMAN	C	160	ENSP00000256389:Y160C	ENSP00000256389:Y160C	Y	-	2	0	ADAM20	70060899	1.000000	0.71417	0.998000	0.56505	0.115000	0.19883	1.990000	0.40717	0.202000	0.20498	-0.336000	0.08194	TAC	.	.	.	none		0.498	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395004.2		
SAMD15	161394	hgsc.bcm.edu	37	14	77844646	77844646	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:77844646G>A	ENST00000216471.4	+	1	1171	c.885G>A	c.(883-885)aaG>aaA	p.K295K	TMED8_ENST00000216468.7_5'Flank|SAMD15_ENST00000533095.2_Intron	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	295										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TGCAAAGAAAGGCAACTGAGG	0.493																																					p.K295K		Atlas-SNP	.											.	SAMD15	60	.	0			c.G885A						PASS	.						81.0	83.0	82.0					14																	77844646		2203	4300	6503	SO:0001819	synonymous_variant	161394	exon1			AAGAAAGGCAACT	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.885G>A	chr14.hg19:g.77844646G>A		126.0	0.0	.		123.0	47.0	.	NM_001010860	Q2M3P3	Silent	SNP	ENST00000216471.4	hg19	CCDS32126.1																																																																																			.	.	.	none		0.493	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
NRXN3	9369	hgsc.bcm.edu	37	14	79423648	79423648	+	Missense_Mutation	SNP	G	G	A	rs367857290		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:79423648G>A	ENST00000554719.1	+	8	1711	c.1220G>A	c.(1219-1221)cGg>cAg	p.R407Q	NRXN3_ENST00000335750.5_Missense_Mutation_p.R407Q	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	177					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.R407P(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CACACCGTTCGGGTGGTGCGG	0.473																																					p.R407Q		Atlas-SNP	.											NRXN3,NS,carcinoma,0,1	NRXN3	342	.	1	Substitution - Missense(1)	lung(1)	c.G1220A						PASS	.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	276.0	241.0	253.0		1220	3.8	1.0	14		253	0,8600		0,0,4300	no	missense	NRXN3	NM_004796.4	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	407/1062	79423648	1,13005	2203	4300	6503	SO:0001583	missense	9369	exon8			CCGTTCGGGTGGT	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1220G>A	chr14.hg19:g.79423648G>A	ENSP00000451648:p.Arg407Gln	150.0	0.0	.		172.0	65.0	.	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	hg19	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774869	0.90108	2.27E-4	0.0	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.77877	-1.13;-1.13	5.64	3.82	0.43975	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.206569	0.42821	N	0.000657	D	0.86772	0.6013	.	.	.	0.54753	D	0.999982	D;D	0.89917	1.0;0.974	D;B	0.87578	0.998;0.406	D	0.86484	0.1793	8	.	.	.	.	12.5919	0.56447	0.135:0.0:0.865:0.0	.	780;407	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	Q	780;769;407;407	ENSP00000451648:R407Q;ENSP00000338349:R407Q	.	R	+	2	0	NRXN3	78493401	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	4.901000	0.63259	0.860000	0.35481	0.650000	0.86243	CGG	.	.	.	weak		0.473	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
SYNE3	161176	hgsc.bcm.edu	37	14	95903278	95903278	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:95903278A>G	ENST00000334258.5	-	14	2431	c.2417T>C	c.(2416-2418)tTc>tCc	p.F806S	SYNE3_ENST00000554873.1_Missense_Mutation_p.F563S|SYNE3_ENST00000557275.1_Missense_Mutation_p.F801S	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	806					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GAGCTGGGAGAAATCTTCATG	0.517																																					p.F806S		Atlas-SNP	.											.	SYNE3	130	.	0			c.T2417C						PASS	.						100.0	96.0	97.0					14																	95903278		2203	4300	6503	SO:0001583	missense	161176	exon14			TGGGAGAAATCTT	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2417T>C	chr14.hg19:g.95903278A>G	ENSP00000334308:p.Phe806Ser	135.0	0.0	.		145.0	68.0	.	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	hg19	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.978684	0.34942	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.15372	3.48;2.43;3.5	5.13	-6.79	0.01715	.	1.951040	0.02897	N	0.134895	T	0.13157	0.0319	M	0.62723	1.935	0.09310	N	1	B;B	0.22211	0.066;0.04	B;B	0.17979	0.02;0.01	T	0.23226	-1.0194	10	0.23891	T	0.37	-0.2886	0.1537	0.00096	0.2263:0.2228:0.217:0.3339	.	801;806	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	S	806;563;801	ENSP00000334308:F806S;ENSP00000452154:F563S;ENSP00000450562:F801S	ENSP00000334308:F806S	F	-	2	0	C14orf49	94973031	0.011000	0.17503	0.000000	0.03702	0.134000	0.20937	0.178000	0.16820	-1.516000	0.01782	0.459000	0.35465	TTC	.	.	.	none		0.517	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
BEGAIN	57596	hgsc.bcm.edu	37	14	101012903	101012903	+	Silent	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:101012903G>A	ENST00000355173.2	-	3	182	c.111C>T	c.(109-111)caC>caT	p.H37H	BEGAIN_ENST00000443071.2_Silent_p.H37H|BEGAIN_ENST00000554747.1_5'UTR|BEGAIN_ENST00000556751.1_5'UTR	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	37						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				TCTCCAGGTAGTGGCGCGTGG	0.692																																					p.H37H	NSCLC(159;1889 2010 9965 27479 40101)	Atlas-SNP	.											.	BEGAIN	32	.	0			c.C111T						PASS	.						74.0	69.0	71.0					14																	101012903		2203	4300	6503	SO:0001819	synonymous_variant	57596	exon3			CAGGTAGTGGCGC	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.111C>T	chr14.hg19:g.101012903G>A		127.0	0.0	.		124.0	44.0	.	NM_020836	Q9NPU3|Q9P282	Silent	SNP	ENST00000355173.2	hg19	CCDS9962.1																																																																																			.	.	.	none		0.692	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836	
HERC2	8924	hgsc.bcm.edu	37	15	28431846	28431846	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr15:28431846T>A	ENST00000261609.7	-	56	8810	c.8702A>T	c.(8701-8703)gAt>gTt	p.D2901V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GATTTTACAATCGATTCCTGA	0.423																																					p.D2901V		Atlas-SNP	.											.	HERC2	501	.	0			c.A8702T						PASS	.						84.0	74.0	77.0					15																	28431846		2203	4300	6503	SO:0001583	missense	8924	exon56			TTACAATCGATTC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8702A>T	chr15.hg19:g.28431846T>A	ENSP00000261609:p.Asp2901Val	54.0	0.0	.		71.0	27.0	.	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.315805	0.81469	.	.	ENSG00000128731	ENST00000261609	T	0.70164	-0.46	5.0	5.0	0.66597	Anaphase-promoting complex, subunit 10/DOC domain (1);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.81721	0.4882	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.84597	0.0670	10	0.87932	D	0	.	15.0231	0.71647	0.0:0.0:0.0:1.0	.	2901	O95714	HERC2_HUMAN	V	2901	ENSP00000261609:D2901V	ENSP00000261609:D2901V	D	-	2	0	HERC2	26105441	1.000000	0.71417	0.496000	0.27539	0.859000	0.49053	7.997000	0.88414	2.000000	0.58554	0.528000	0.53228	GAT	.	.	.	none		0.423	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ZNF770	54989	hgsc.bcm.edu	37	15	35274327	35274327	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr15:35274327T>C	ENST00000356321.4	-	3	1653	c.1309A>G	c.(1309-1311)Aag>Gag	p.K437E		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	437					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AAGTCTTTCTTATTCACTGAA	0.348																																					p.K437E		Atlas-SNP	.											.	ZNF770	64	.	0			c.A1309G						PASS	.						82.0	84.0	83.0					15																	35274327		2201	4297	6498	SO:0001583	missense	54989	exon3			CTTTCTTATTCAC	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1309A>G	chr15.hg19:g.35274327T>C	ENSP00000348673:p.Lys437Glu	117.0	0.0	.		167.0	65.0	.	NM_014106	Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	ENST00000356321.4	hg19	CCDS10042.1	.	.	.	.	.	.	.	.	.	.	T	4.829	0.154043	0.09185	.	.	ENSG00000198146	ENST00000356321	T	0.09073	3.02	5.49	5.49	0.81192	.	0.394233	0.25414	N	0.030860	T	0.07052	0.0179	N	0.14661	0.345	0.22996	N	0.998451	B	0.23937	0.094	B	0.22386	0.039	T	0.31194	-0.9952	10	0.87932	D	0	-3.5887	15.7623	0.78096	0.0:0.0:0.0:1.0	.	437	Q6IQ21	ZN770_HUMAN	E	437	ENSP00000348673:K437E	ENSP00000348673:K437E	K	-	1	0	ZNF770	33061619	1.000000	0.71417	0.997000	0.53966	0.123000	0.20343	3.570000	0.53834	2.311000	0.77944	0.533000	0.62120	AAG	.	.	.	none		0.348	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106	
BAHD1	22893	hgsc.bcm.edu	37	15	40758294	40758294	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr15:40758294T>C	ENST00000416165.1	+	7	2379	c.2308T>C	c.(2308-2310)Ttc>Ctc	p.F770L	BAHD1_ENST00000561234.1_Missense_Mutation_p.F769L|RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000560846.1_Missense_Mutation_p.F767L	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	770	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		TGTCTATGACTTCCGCCACGG	0.632																																					p.F770L		Atlas-SNP	.											.	BAHD1	68	.	0			c.T2308C						PASS	.						98.0	101.0	100.0					15																	40758294		2203	4300	6503	SO:0001583	missense	22893	exon7			TATGACTTCCGCC	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.2308T>C	chr15.hg19:g.40758294T>C	ENSP00000396976:p.Phe770Leu	200.0	0.0	.		249.0	103.0	.	NM_014952	Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	ENST00000416165.1	hg19	CCDS10058.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.000543	0.93227	.	.	ENSG00000140320	ENST00000416165	D	0.85339	-1.97	5.6	5.6	0.85130	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	M	0.76328	2.33	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.87578	0.917;0.998;0.997	D	0.92808	0.6262	10	0.72032	D	0.01	-16.7549	15.7888	0.78332	0.0:0.0:0.0:1.0	.	767;770;769	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	L	770	ENSP00000396976:F770L	ENSP00000396976:F770L	F	+	1	0	BAHD1	38545586	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.040000	0.89188	2.144000	0.66660	0.460000	0.39030	TTC	.	.	.	none		0.632	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
MYO5C	55930	hgsc.bcm.edu	37	15	52498142	52498142	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr15:52498142G>T	ENST00000261839.7	-	37	4569	c.4408C>A	c.(4408-4410)Cca>Aca	p.P1470T	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1470	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTCTGCTGTGGACTATTATGC	0.269																																					p.P1470T		Atlas-SNP	.											.	MYO5C	162	.	0			c.C4408A						PASS	.						57.0	49.0	52.0					15																	52498142		1789	4055	5844	SO:0001583	missense	55930	exon37			GCTGTGGACTATT	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4408C>A	chr15.hg19:g.52498142G>T	ENSP00000261839:p.Pro1470Thr	47.0	0.0	.		47.0	19.0	.	NM_018728	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	hg19	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494477	0.64186	.	.	ENSG00000128833	ENST00000261839	T	0.16897	2.31	5.21	4.27	0.50696	Dilute (1);	0.061993	0.64402	D	0.000004	T	0.32010	0.0815	M	0.72118	2.19	0.80722	D	1	D	0.56035	0.974	P	0.52957	0.714	T	0.09228	-1.0684	10	0.33940	T	0.23	.	15.7715	0.78173	0.0:0.1365:0.8635:0.0	.	1470	Q9NQX4	MYO5C_HUMAN	T	1470	ENSP00000261839:P1470T	ENSP00000261839:P1470T	P	-	1	0	MYO5C	50285434	1.000000	0.71417	0.959000	0.39883	0.903000	0.53119	3.298000	0.51818	1.376000	0.46267	0.555000	0.69702	CCA	.	.	.	none		0.269	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
PML	5371	hgsc.bcm.edu	37	15	74327953	74327953	+	Intron	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr15:74327953G>A	ENST00000268058.3	+	7	1806				PML_ENST00000359928.4_Intron|PML_ENST00000435786.2_3'UTR|PML_ENST00000436891.3_3'UTR|PML_ENST00000569965.1_Intron|PML_ENST00000395135.3_Intron|PML_ENST00000395132.2_Intron|PML_ENST00000354026.6_Silent_p.R669R|PML_ENST00000268059.6_Silent_p.R717R|PML_ENST00000563500.1_3'UTR|PML_ENST00000564428.1_Intron|PML_ENST00000565898.1_Intron	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						AGCTGCAAAGGGGCATCAGCC	0.622			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.R717R		Atlas-SNP	.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	169	.	0			c.G2151A						PASS	.						64.0	63.0	64.0					15																	74327953		2198	4297	6495	SO:0001627	intron_variant	5371	exon8			GCAAAGGGGCATC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1710+1082G>A	chr15.hg19:g.74327953G>A		119.0	0.0	.		128.0	39.0	.	NM_033239	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Silent	SNP	ENST00000268058.3	hg19	CCDS10255.1																																																																																			.	.	.	none		0.622	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
AXIN1	8312	hgsc.bcm.edu	37	16	338194	338194	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:338194C>A	ENST00000262320.3	-	11	2888	c.2517G>T	c.(2515-2517)gaG>gaT	p.E839D	AXIN1_ENST00000354866.3_Missense_Mutation_p.E803D	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	839	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCTCTCGAACCTCCTCAAACA	0.587																																					p.E839D		Atlas-SNP	.											.	AXIN1	290	.	0			c.G2517T						PASS	.						233.0	174.0	194.0					16																	338194		2203	4300	6503	SO:0001583	missense	8312	exon11			TCGAACCTCCTCA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.2517G>T	chr16.hg19:g.338194C>A	ENSP00000262320:p.Glu839Asp	166.0	0.0	.		170.0	47.0	.	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	c	14.73	2.621324	0.46736	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.61274	0.12;0.12	4.62	-0.702	0.11265	DIX (3);	0.000000	0.85682	D	0.000000	T	0.73528	0.3598	M	0.89534	3.04	0.50171	D	0.999859	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	T	0.70432	-0.4873	10	0.72032	D	0.01	-11.9016	5.4595	0.16610	0.1225:0.5288:0.0:0.3487	.	803;839	O15169-2;O15169	.;AXIN1_HUMAN	D	839;803	ENSP00000262320:E839D;ENSP00000346935:E803D	ENSP00000262320:E839D	E	-	3	2	AXIN1	278195	0.998000	0.40836	0.424000	0.26647	0.122000	0.20287	0.667000	0.25112	-0.105000	0.12132	-0.224000	0.12420	GAG	.	.	.	none		0.587	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
GLYR1	84656	hgsc.bcm.edu	37	16	4864623	4864623	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:4864623G>C	ENST00000321919.9	-	11	1008	c.932C>G	c.(931-933)gCc>gGc	p.A311G	GLYR1_ENST00000436648.5_Missense_Mutation_p.A230G|GLYR1_ENST00000591451.1_Missense_Mutation_p.A305G|GLYR1_ENST00000381983.3_Missense_Mutation_p.A294G	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	311					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						TCCCAGACGGGCCCCCTCCTG	0.577																																					p.A311G		Atlas-SNP	.											.	GLYR1	49	.	0			c.C932G						PASS	.						42.0	41.0	41.0					16																	4864623		2197	4300	6497	SO:0001583	missense	84656	exon11			AGACGGGCCCCCT	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.932C>G	chr16.hg19:g.4864623G>C	ENSP00000322716:p.Ala311Gly	43.0	0.0	.		61.0	17.0	.	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	hg19	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	G	32	5.124490	0.94429	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.73789	-0.49;-0.48;-0.78	5.33	5.33	0.75918	6-phosphogluconate dehydrogenase, NADP-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.86887	0.6041	M	0.79926	2.475	0.80722	D	1	B;P;B;D	0.58620	0.262;0.512;0.173;0.983	B;P;B;D	0.79784	0.418;0.548;0.341;0.993	D	0.86708	0.1934	10	0.46703	T	0.11	-16.0047	18.1572	0.89696	0.0:0.0:1.0:0.0	.	230;305;294;311	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	G	311;294;230	ENSP00000322716:A311G;ENSP00000371413:A294G;ENSP00000390276:A230G	ENSP00000322716:A311G	A	-	2	0	GLYR1	4804624	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.422000	0.97458	2.654000	0.90174	0.561000	0.74099	GCC	.	.	.	none		0.577	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
NTAN1	123803	hgsc.bcm.edu	37	16	15133833	15133833	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:15133833C>G	ENST00000287706.3	-	8	724	c.632G>C	c.(631-633)gGa>gCa	p.G211A	PDXDC1_ENST00000535621.2_Intron	NM_001270766.1|NM_173474.3	NP_001257695.1|NP_775745.1	Q96AB6	NTAN1_HUMAN	N-terminal asparagine amidase	211					adult locomotory behavior (GO:0008344)|memory (GO:0007613)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-N-terminal asparagine amidohydrolase activity (GO:0008418)			endometrium(1)|large_intestine(4)|lung(3)	8						CACTGGTCCTCCTGCTAAAGT	0.433																																					p.G211A		Atlas-SNP	.											.	NTAN1	21	.	0			c.G632C						PASS	.						112.0	122.0	119.0					16																	15133833		2197	4300	6497	SO:0001583	missense	123803	exon8			GGTCCTCCTGCTA	AF092440	CCDS10558.1, CCDS73832.1	16p13	2008-02-05			ENSG00000157045	ENSG00000157045			29909	protein-coding gene	gene with protein product		615367				8910481	Standard	NM_173474		Approved		uc002ddd.4	Q96AB6	OTTHUMG00000129849	ENST00000287706.3:c.632G>C	chr16.hg19:g.15133833C>G	ENSP00000287706:p.Gly211Ala	277.0	0.0	.		286.0	106.0	.	NM_173474	Q7Z4Z0	Missense_Mutation	SNP	ENST00000287706.3	hg19	CCDS10558.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344058	0.82022	.	.	ENSG00000157045	ENST00000287706	T	0.29655	1.56	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	M	0.85041	2.73	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.67369	-0.5688	10	0.72032	D	0.01	-20.0269	18.5814	0.91172	0.0:1.0:0.0:0.0	.	211	Q96AB6	NTAN1_HUMAN	A	211	ENSP00000287706:G211A	ENSP00000287706:G211A	G	-	2	0	NTAN1	15041334	1.000000	0.71417	0.987000	0.45799	0.810000	0.45777	5.601000	0.67606	2.630000	0.89119	0.650000	0.86243	GGA	.	.	.	none		0.433	NTAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252089.1	NM_173474	
XPO6	23214	hgsc.bcm.edu	37	16	28181133	28181133	+	Missense_Mutation	SNP	C	C	A	rs558020059		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:28181133C>A	ENST00000304658.5	-	5	1003	c.503G>T	c.(502-504)cGg>cTg	p.R168L	XPO6_ENST00000565698.1_Missense_Mutation_p.R154L	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	168					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CTCCTCCTTCCGAGCCACACT	0.572																																					p.R168L		Atlas-SNP	.											XPO6_ENST00000304658,NS,carcinoma,0,2	XPO6	177	.	0			c.G503T						PASS	.						59.0	62.0	61.0					16																	28181133		2001	4169	6170	SO:0001583	missense	23214	exon5			TCCTTCCGAGCCA	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.503G>T	chr16.hg19:g.28181133C>A	ENSP00000302790:p.Arg168Leu	95.0	1.0	.		149.0	8.0	.	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	hg19	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	C	36	5.708014	0.96821	.	.	ENSG00000169180	ENST00000304658	T	0.54071	0.59	5.75	5.75	0.90469	Exportin-1/Importin-beta-like (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.74754	-0.3558	10	0.87932	D	0	-19.7624	17.4387	0.87559	0.0:1.0:0.0:0.0	.	168;168	B7ZM10;Q96QU8	.;XPO6_HUMAN	L	168	ENSP00000302790:R168L	ENSP00000302790:R168L	R	-	2	0	XPO6	28088634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.792000	0.85828	2.696000	0.92011	0.655000	0.94253	CGG	.	.	.	none		0.572	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
SH2B1	25970	hgsc.bcm.edu	37	16	28880661	28880661	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:28880661C>A	ENST00000322610.8	+	7	1705	c.1266C>A	c.(1264-1266)gaC>gaA	p.D422E	SH2B1_ENST00000545570.1_Missense_Mutation_p.D112E|SH2B1_ENST00000337120.5_Missense_Mutation_p.D422E|SH2B1_ENST00000395532.4_Missense_Mutation_p.D422E|SH2B1_ENST00000359285.5_Missense_Mutation_p.D422E|SH2B1_ENST00000538342.1_Missense_Mutation_p.D86E|SH2B1_ENST00000563674.1_Intron			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	422	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CCAGCCAGGACCTGCTGCTTG	0.632																																					p.D422E		Atlas-SNP	.											.	SH2B1	160	.	0			c.C1266A						PASS	.						50.0	48.0	48.0					16																	28880661		2197	4300	6497	SO:0001583	missense	25970	exon5			CCAGGACCTGCTG	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1266C>A	chr16.hg19:g.28880661C>A	ENSP00000321221:p.Asp422Glu	96.0	0.0	.		96.0	35.0	.	NM_001145796	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	hg19	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420802	0.25639	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	T;T;T;T;T;T	0.42131	0.98;1.71;1.01;1.6;1.0;1.0	5.17	-9.53	0.00575	.	0.393219	0.23983	N	0.042660	T	0.11836	0.0288	N	0.03608	-0.345	0.22112	N	0.999357	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0	B;B;B;B;B	0.06405	0.0;0.001;0.001;0.002;0.001	T	0.09207	-1.0685	10	0.27082	T	0.32	-14.1712	6.2599	0.20893	0.0853:0.4877:0.1844:0.2426	.	86;112;422;422;422	B4DLN5;F5GXU7;Q9NRF2-2;Q9NRF2-3;Q9NRF2	.;.;.;.;SH2B1_HUMAN	E	422;112;422;86;422;422	ENSP00000321221:D422E;ENSP00000440354:D112E;ENSP00000352232:D422E;ENSP00000438784:D86E;ENSP00000378903:D422E;ENSP00000337163:D422E	ENSP00000321221:D422E	D	+	3	2	SH2B1	28788162	0.011000	0.17503	0.821000	0.32701	0.889000	0.51656	-2.120000	0.01323	-1.453000	0.01928	-0.373000	0.07131	GAC	.	.	.	none		0.632	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
RABEP2	79874	hgsc.bcm.edu	37	16	28925762	28925762	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:28925762T>A	ENST00000358201.4	-	5	1277	c.689A>T	c.(688-690)gAc>gTc	p.D230V	RABEP2_ENST00000561803.1_5'Flank|RABEP2_ENST00000357573.6_Missense_Mutation_p.D230V|RABEP2_ENST00000544477.1_Missense_Mutation_p.D159V	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	230					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						GGAGGCGCTGTCATCGCAGTT	0.682																																					p.D230V	Pancreas(66;639 1284 10093 31061 49099)	Atlas-SNP	.											.	RABEP2	48	.	0			c.A689T						PASS	.						24.0	30.0	28.0					16																	28925762		2041	4205	6246	SO:0001583	missense	79874	exon5			GCGCTGTCATCGC	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.689A>T	chr16.hg19:g.28925762T>A	ENSP00000350934:p.Asp230Val	46.0	0.0	.		48.0	11.0	.	NM_024816		Missense_Mutation	SNP	ENST00000358201.4	hg19	CCDS42140.1	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867523	0.72065	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.70516	-0.33;-0.49;-0.27	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.74906	0.3778	L	0.29908	0.895	0.53005	D	0.999965	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;D;D	0.87578	0.996;0.998;0.994;0.996	T	0.77653	-0.2507	10	0.87932	D	0	-35.9958	11.3244	0.49440	0.0:0.0:0.0:1.0	.	159;230;230;230	B4DHR0;Q9H5N1-2;Q49AT6;Q9H5N1	.;.;.;RABE2_HUMAN	V	230;230;159	ENSP00000350934:D230V;ENSP00000350186:D230V;ENSP00000442798:D159V	ENSP00000350186:D230V	D	-	2	0	RABEP2	28833263	1.000000	0.71417	0.997000	0.53966	0.848000	0.48234	5.481000	0.66826	1.933000	0.56026	0.379000	0.24179	GAC	.	.	.	none		0.682	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816	
RNF40	9810	hgsc.bcm.edu	37	16	30775599	30775599	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:30775599T>C	ENST00000324685.6	+	5	977	c.542T>C	c.(541-543)cTg>cCg	p.L181P	C16orf93_ENST00000545825.1_5'Flank|C16orf93_ENST00000543610.1_5'Flank|RNF40_ENST00000563683.1_Missense_Mutation_p.L181P|C16orf93_ENST00000541260.1_5'Flank|RNF40_ENST00000357890.5_Missense_Mutation_p.L181P|RNF40_ENST00000402121.3_Intron	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	181					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GAGCTGGAGCTGCAAGGCCGA	0.632																																					p.L181P		Atlas-SNP	.											.	RNF40	83	.	0			c.T542C						PASS	.						69.0	56.0	60.0					16																	30775599		2197	4300	6497	SO:0001583	missense	9810	exon5			TGGAGCTGCAAGG	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.542T>C	chr16.hg19:g.30775599T>C	ENSP00000325677:p.Leu181Pro	20.0	0.0	.		36.0	11.0	.	NM_014771	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	hg19	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423101	0.62733	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	T;T	0.60920	0.76;0.15	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000001	T	0.78349	0.4269	M	0.82323	2.585	0.80722	D	1	D;B;B	0.76494	0.999;0.09;0.024	D;B;B	0.85130	0.997;0.06;0.038	T	0.81540	-0.0886	10	0.87932	D	0	-13.9353	15.6114	0.76721	0.0:0.0:0.0:1.0	.	181;181;181	O75150-4;A8K6K1;O75150	.;.;BRE1B_HUMAN	P	181;181;30	ENSP00000325677:L181P;ENSP00000350563:L181P	ENSP00000325677:L181P	L	+	2	0	RNF40	30683100	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	6.959000	0.76031	2.326000	0.78906	0.533000	0.62120	CTG	.	.	.	none		0.632	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771	
ITGAM	3684	hgsc.bcm.edu	37	16	31340556	31340556	+	Missense_Mutation	SNP	G	G	T	rs199790913		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:31340556G>T	ENST00000287497.8	+	24	2875	c.2800G>T	c.(2800-2802)Gtc>Ttc	p.V934F	ITGAM_ENST00000544665.3_Missense_Mutation_p.V935F			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	934					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CAGCCATGGGGTCTCCACTAA	0.542																																					p.V935F		Atlas-SNP	.											.	ITGAM	137	.	0			c.G2803T						PASS	.	G	PHE/VAL,PHE/VAL	0,3888		0,0,1944	71.0	70.0	70.0		2803,2800	-6.6	0.0	16		70	1,8303		0,1,4151	yes	missense,missense	ITGAM	NM_001145808.1,NM_000632.3	50,50	0,1,6095	TT,TG,GG		0.012,0.0,0.0082	benign,benign	935/1154,934/1153	31340556	1,12191	1944	4152	6096	SO:0001583	missense	3684	exon24			CATGGGGTCTCCA	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2800G>T	chr16.hg19:g.31340556G>T	ENSP00000287497:p.Val934Phe	31.0	0.0	.		28.0	10.0	.	NM_001145808	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	hg19	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464821	0.43839	0.0	1.2E-4	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.44083	0.93;0.93	4.87	-6.59	0.01830	Integrin alpha-2 (1);	.	.	.	.	T	0.31513	0.0799	L	0.44542	1.39	0.09310	N	1	B;B	0.34181	0.44;0.44	B;B	0.41619	0.361;0.361	T	0.41574	-0.9501	9	0.59425	D	0.04	.	1.9836	0.03432	0.3427:0.3574:0.1793:0.1206	.	934;934	Q4VAK1;P11215	.;ITAM_HUMAN	F	935;934	ENSP00000441691:V935F;ENSP00000287497:V934F	ENSP00000287497:V934F	V	+	1	0	ITGAM	31248057	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.727000	0.04931	-1.560000	0.01686	-0.903000	0.02851	GTC	.	.	.	weak		0.542	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
PHKB	5257	hgsc.bcm.edu	37	16	47684490	47684490	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr16:47684490G>T	ENST00000323584.5	+	19	1857	c.1833G>T	c.(1831-1833)atG>atT	p.M611I	PHKB_ENST00000299167.8_Missense_Mutation_p.M611I|PHKB_ENST00000566044.1_Missense_Mutation_p.M604I|PHKB_ENST00000455779.1_Missense_Mutation_p.M604I	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	611					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				ATTGGAAAATGCATGGACGTC	0.408																																					p.M611I		Atlas-SNP	.											.	PHKB	298	.	0			c.G1833T						PASS	.						137.0	120.0	126.0					16																	47684490		2201	4300	6501	SO:0001583	missense	5257	exon19			GAAAATGCATGGA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1833G>T	chr16.hg19:g.47684490G>T	ENSP00000313504:p.Met611Ile	140.0	0.0	.		120.0	40.0	.	NM_000293	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004653	0.74932	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.90900	-2.75;-2.75	5.86	5.86	0.93980	Glycoside hydrolase 15-related (1);	0.036486	0.85682	D	0.000000	D	0.91432	0.7296	M	0.73598	2.24	0.80722	D	1	B;B	0.26902	0.036;0.163	B;B	0.29862	0.098;0.108	D	0.88208	0.2888	10	0.44086	T	0.13	-27.2635	20.1813	0.98205	0.0:0.0:1.0:0.0	.	611;604	Q93100;Q93100-4	KPBB_HUMAN;.	I	604;604;611	ENSP00000414345:M604I;ENSP00000313504:M611I	ENSP00000299167:M604I	M	+	3	0	PHKB	46241991	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.172000	0.94808	2.777000	0.95525	0.591000	0.81541	ATG	.	.	.	none		0.408	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
HELZ	9931	hgsc.bcm.edu	37	17	65134124	65134125	+	Missense_Mutation	DNP	TG	TG	GA			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr17:65134124_65134125TG>GA	ENST00000358691.5	-	22	3041_3042	c.2875_2876CA>TC	c.(2875-2877)CAa>TCa	p.Q959S	HELZ_ENST00000580168.1_Missense_Mutation_p.Q960S	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	959						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCTAAACACTTGATCAGCATAT	0.401																																					p.Q959P|p.Q959X		Atlas-SNP	.											.	HELZ	160	.	0			c.A2876C|c.C2875T						PASS	.																																			SO:0001583	missense	9931	exon22			AACACTTGATCAG|ACACTTGATCAGC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.2875_2876delinsGA	chr17.hg19:g.65134124_65134125delinsGA	ENSP00000351524:p.Gln959Ser	174.0|173.0	0.0	.		203.0|197.0	74.0	.	NM_014877	I6L9H4	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1																																																																																			.	.	.	none		0.401	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
COG1	9382	hgsc.bcm.edu	37	17	71197359	71197359	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr17:71197359A>G	ENST00000299886.4	+	7	1473	c.1393A>G	c.(1393-1395)Atc>Gtc	p.I465V		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	465					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			AAATAAGCACATCCACTTTGA	0.522																																					p.I465V		Atlas-SNP	.											.	COG1	46	.	0			c.A1393G						PASS	.						161.0	147.0	152.0					17																	71197359		2203	4300	6503	SO:0001583	missense	9382	exon7			AAGCACATCCACT		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1393A>G	chr17.hg19:g.71197359A>G	ENSP00000299886:p.Ile465Val	187.0	0.0	.		195.0	69.0	.	NM_018714	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	hg19	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	A	6.539	0.467704	0.12402	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.19938	2.11;2.11	5.28	-4.74	0.03249	.	0.662686	0.16490	N	0.212142	T	0.08714	0.0216	N	0.17674	0.51	0.09310	N	0.999994	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.40924	-0.9537	10	0.07990	T	0.79	-9.3358	8.8132	0.34981	0.3346:0.2123:0.4531:0.0	.	465;465;465	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	V	465	ENSP00000400111:I465V;ENSP00000299886:I465V	ENSP00000299886:I465V	I	+	1	0	COG1	68708954	0.000000	0.05858	0.363000	0.25875	0.372000	0.29890	-0.711000	0.05019	-0.776000	0.04578	-0.250000	0.11733	ATC	.	.	.	none		0.522	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
MTCL1	23255	hgsc.bcm.edu	37	18	8813135	8813135	+	Silent	SNP	C	C	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr18:8813135C>T	ENST00000306329.11	+	10	3720	c.3720C>T	c.(3718-3720)aaC>aaT	p.N1240N	SOGA2_ENST00000306285.7_Silent_p.N274N|SOGA2_ENST00000359865.3_Silent_p.N921N|SOGA2_ENST00000400050.3_Silent_p.N880N|SOGA2_ENST00000517570.1_Silent_p.N880N|SOGA2_ENST00000518815.1_Silent_p.N274N																							GCGAGAAGAACTGGAACCGGG	0.572																																					p.N921N		Atlas-SNP	.											.	.	.	.	0			c.C2763T						PASS	.						45.0	44.0	44.0					18																	8813135		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon12			GAAGAACTGGAAC																												ENST00000306329.11:c.3720C>T	chr18.hg19:g.8813135C>T		36.0	0.0	.		26.0	14.0	.	NM_015210		Silent	SNP	ENST00000306329.11	hg19																																																																																				.	.	.	none		0.572	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
ZNF599	148103	hgsc.bcm.edu	37	19	35250173	35250173	+	Missense_Mutation	SNP	T	T	A	rs375598988		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr19:35250173T>A	ENST00000329285.8	-	4	1906	c.1533A>T	c.(1531-1533)gaA>gaT	p.E511D		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CCTTTCCACATTCTCTACAAA	0.418																																					p.E511D		Atlas-SNP	.											.	ZNF599	72	.	0			c.A1533T						PASS	.						116.0	117.0	116.0					19																	35250173		2203	4300	6503	SO:0001583	missense	148103	exon4			TCCACATTCTCTA	AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.1533A>T	chr19.hg19:g.35250173T>A	ENSP00000333802:p.Glu511Asp	136.0	0.0	.		173.0	71.0	.	NM_001007248	Q569K0|Q5PRG1	Missense_Mutation	SNP	ENST00000329285.8	hg19	CCDS32991.1	.	.	.	.	.	.	.	.	.	.	T	4.110	0.018610	0.07959	.	.	ENSG00000153896	ENST00000392231;ENST00000329285;ENST00000392229	T	0.07444	3.19	2.52	1.45	0.22620	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07143	0.0181	L	0.50993	1.605	0.58432	D	0.999999	B	0.06786	0.001	B	0.11329	0.006	T	0.24905	-1.0147	9	0.45353	T	0.12	.	2.0678	0.03606	0.2607:0.1492:0.0:0.5901	.	511	Q96NL3	ZN599_HUMAN	D	510;511;285	ENSP00000333802:E511D	ENSP00000333802:E511D	E	-	3	2	ZNF599	39942013	0.000000	0.05858	0.906000	0.35671	0.133000	0.20885	-1.206000	0.03011	0.357000	0.24183	0.482000	0.46254	GAA	.	.	.	alt		0.418	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460648.2	XM_086046	
ZNF599	148103	hgsc.bcm.edu	37	19	35250175	35250175	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr19:35250175C>A	ENST00000329285.8	-	4	1904	c.1531G>T	c.(1531-1533)Gaa>Taa	p.E511*		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTCCACATTCTCTACAAACA	0.418																																					p.E511X		Atlas-SNP	.											.	ZNF599	72	.	0			c.G1531T						PASS	.						115.0	117.0	116.0					19																	35250175		2203	4300	6503	SO:0001587	stop_gained	148103	exon4			CACATTCTCTACA	AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.1531G>T	chr19.hg19:g.35250175C>A	ENSP00000333802:p.Glu511*	142.0	0.0	.		176.0	71.0	.	NM_001007248	Q569K0|Q5PRG1	Nonsense_Mutation	SNP	ENST00000329285.8	hg19	CCDS32991.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544924	0.86022	.	.	ENSG00000153896	ENST00000392231;ENST00000329285;ENST00000392229	.	.	.	2.52	2.52	0.30459	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999974	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	11.1742	0.48590	0.0:1.0:0.0:0.0	.	.	.	.	X	510;511;285	.	ENSP00000333802:E511X	E	-	1	0	ZNF599	39942015	0.000000	0.05858	0.726000	0.30738	0.087000	0.18053	0.077000	0.14738	1.711000	0.51337	0.591000	0.81541	GAA	.	.	.	none		0.418	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460648.2	XM_086046	
SALL4	57167	hgsc.bcm.edu	37	20	50407897	50407897	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr20:50407897G>C	ENST00000217086.4	-	2	1236	c.1125C>G	c.(1123-1125)gaC>gaG	p.D375E	SALL4_ENST00000371539.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Missense_Mutation_p.D375E	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	375					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GGGCCGCCTCGTCTTTGGGTT	0.547																																					p.D375E		Atlas-SNP	.											.	SALL4	168	.	0			c.C1125G						PASS	.						78.0	76.0	77.0					20																	50407897		2203	4300	6503	SO:0001583	missense	57167	exon2			CGCCTCGTCTTTG	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1125C>G	chr20.hg19:g.50407897G>C	ENSP00000217086:p.Asp375Glu	134.0	0.0	.		128.0	45.0	.	NM_020436	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	hg19	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	G	4.854	0.158821	0.09236	.	.	ENSG00000101115	ENST00000217086;ENST00000395997	T;T	0.08807	3.05;3.34	5.29	-5.33	0.02713	.	0.000000	0.47852	D	0.000204	T	0.08044	0.0201	L	0.29908	0.895	0.80722	D	1	B;D	0.69078	0.028;0.997	B;D	0.76575	0.006;0.988	T	0.49781	-0.8903	10	0.02654	T	1	-53.0902	4.1442	0.10209	0.5133:0.168:0.2268:0.0919	.	375;375	A2A2D8;Q9UJQ4	.;SALL4_HUMAN	E	375	ENSP00000217086:D375E;ENSP00000379319:D375E	ENSP00000217086:D375E	D	-	3	2	SALL4	49841304	0.000000	0.05858	0.608000	0.28969	0.091000	0.18340	-1.867000	0.01646	-0.896000	0.03915	-1.581000	0.00855	GAC	.	.	.	none		0.547	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
RGL4	266747	hgsc.bcm.edu	37	22	24034222	24034222	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr22:24034222G>A	ENST00000290691.5	+	1	1175	c.5G>A	c.(4-6)aGg>aAg	p.R2K	AP000347.2_ENST00000417194.1_RNA|KB-1572G7.2_ENST00000421064.1_RNA|GUSBP11_ENST00000455485.1_RNA|RGL4_ENST00000401461.1_Intron	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4	2					small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						GCTTTGATGAGGAAGCTGCTC	0.607																																					p.R2K		Atlas-SNP	.											.	RGL4	29	.	0			c.G5A						PASS	.						59.0	58.0	58.0					22																	24034222		2203	4300	6503	SO:0001583	missense	266747	exon1			TGATGAGGAAGCT		CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.5G>A	chr22.hg19:g.24034222G>A	ENSP00000290691:p.Arg2Lys	109.0	0.0	.		88.0	5.0	.	NM_153615	Q495L8	Missense_Mutation	SNP	ENST00000290691.5	hg19	CCDS13811.1	.	.	.	.	.	.	.	.	.	.	g	8.750	0.921142	0.17982	.	.	ENSG00000159496	ENST00000290691;ENST00000382833;ENST00000423392	T;T	0.32023	1.47;1.47	1.77	-2.54	0.06307	.	7.772780	0.01150	U	0.006397	T	0.18215	0.0437	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.0	T	0.27536	-1.0071	10	0.87932	D	0	.	4.1084	0.10047	0.1754:0.4809:0.3436:0.0	.	2;2	E9PH87;Q8IZJ4	.;RGDSR_HUMAN	K	2	ENSP00000290691:R2K;ENSP00000402142:R2K	ENSP00000290691:R2K	R	+	2	0	RGL4	22364222	0.139000	0.22563	0.000000	0.03702	0.001000	0.01503	-0.102000	0.10956	-0.558000	0.06118	-0.386000	0.06593	AGG	.	.	.	none		0.607	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319711.1	NM_153615	
MICALL1	85377	hgsc.bcm.edu	37	22	38328888	38328888	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr22:38328888A>G	ENST00000215957.6	+	12	2353	c.2227A>G	c.(2227-2229)Atc>Gtc	p.I743V	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	743	Necessary and sufficient to associate with tubular recycling endosome membranes, mediate phosphatidic acid- binding and membrane tubulation.|RAB-binding domain (RBD); mediates the interaction with RAB13 and RAB35 and intramolecular interaction with the CH domain.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					GTCCGAGCTCATCTATGTGTG	0.582																																					p.I743V		Atlas-SNP	.											.	MICALL1	53	.	0			c.A2227G						PASS	.						68.0	63.0	65.0					22																	38328888		2203	4300	6503	SO:0001583	missense	85377	exon12			GAGCTCATCTATG	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.2227A>G	chr22.hg19:g.38328888A>G	ENSP00000215957:p.Ile743Val	67.0	0.0	.		77.0	31.0	.	NM_033386	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Missense_Mutation	SNP	ENST00000215957.6	hg19	CCDS13961.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.26|13.26	2.184944|2.184944	0.38609|0.38609	.|.	.|.	ENSG00000100139|ENSG00000100139	ENST00000454685|ENST00000215957;ENST00000402631;ENST00000424008	.|T;T;T	.|0.39406	.|1.08;1.08;1.08	5.47|5.47	4.37|4.37	0.52481|0.52481	.|Domain of unknown function DUF3585 (1);	.|0.102897	.|0.43919	.|D	.|0.000508	T|T	0.16854|0.16854	0.0405|0.0405	N|N	0.02960|0.02960	-0.455|-0.455	0.40194|0.40194	D|D	0.97743|0.97743	.|B	.|0.34329	.|0.449	.|B	.|0.34873	.|0.191	T|T	0.09796|0.09796	-1.0658|-1.0658	5|10	.|0.19147	.|T	.|0.46	.|.	6.8248|6.8248	0.23876|0.23876	0.7709:0.1531:0.076:0.0|0.7709:0.1531:0.076:0.0	.|.	.|743	.|Q8N3F8	.|MILK1_HUMAN	R|V	318|743;170;57	.|ENSP00000215957:I743V;ENSP00000384608:I170V;ENSP00000416766:I57V	.|ENSP00000215957:I743V	H|I	+|+	2|1	0|0	MICALL1|MICALL1	36658834|36658834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.031000|5.031000	0.64134|0.64134	2.070000|2.070000	0.61991|0.61991	0.482000|0.482000	0.46254|0.46254	CAT|ATC	.	.	.	none		0.582	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386	
MKL1	57591	hgsc.bcm.edu	37	22	40816901	40816901	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr22:40816901C>G	ENST00000355630.3	-	10	1421	c.831G>C	c.(829-831)caG>caC	p.Q277H	MKL1_ENST00000396617.3_Missense_Mutation_p.Q277H|MKL1_ENST00000407029.1_Missense_Mutation_p.Q277H|MKL1_ENST00000402042.1_Missense_Mutation_p.Q227H	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	277	Gln-rich.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCTGCTGCTGCTGGTTGAGGA	0.657			T	RBM15	acute megakaryocytic leukemia																																p.Q277H		Atlas-SNP	.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1	69	.	0			c.G831C						PASS	.						62.0	63.0	62.0					22																	40816901		2203	4300	6503	SO:0001583	missense	57591	exon10			CTGCTGCTGGTTG	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.831G>C	chr22.hg19:g.40816901C>G	ENSP00000347847:p.Gln277His	59.0	0.0	.		72.0	4.0	.	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	hg19	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766193	0.69878	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.61859	0.16;0.11;0.07;0.16	5.26	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.73353	0.3576	M	0.77616	2.38	0.48696	D	0.999692	P;D;P	0.67145	0.787;0.996;0.787	B;D;B	0.75484	0.294;0.986;0.294	T	0.75385	-0.3336	10	0.66056	D	0.02	-15.2355	9.9937	0.41887	0.0:0.8449:0.0:0.1551	.	227;277;277	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	H	277;277;227;277	ENSP00000347847:Q277H;ENSP00000379861:Q277H;ENSP00000385584:Q227H;ENSP00000385835:Q277H	ENSP00000347847:Q277H	Q	-	3	2	MKL1	39146847	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.270000	0.51600	1.210000	0.43336	0.462000	0.41574	CAG	.	.	.	none		0.657	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
PLS3	5358	hgsc.bcm.edu	37	X	114883786	114883786	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chrX:114883786G>C	ENST00000420625.2	+	16	1932	c.1798G>C	c.(1798-1800)Gtg>Ctg	p.V600L	PLS3_ENST00000537301.1_Missense_Mutation_p.V587L|PLS3_ENST00000543070.1_Missense_Mutation_p.V194L|PLS3_ENST00000355899.3_Missense_Mutation_p.V600L|PLS3_ENST00000289290.3_Missense_Mutation_p.V564L|PLS3_ENST00000539310.1_Missense_Mutation_p.V555L	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	600	Actin-binding 2.|CH 4. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						CGGAGCCAGAGTGTATGCTCT	0.433																																					p.V600L	Colon(160;1047 1864 8490 12969 29601)	Atlas-SNP	.											.	PLS3	60	.	0			c.G1798C						PASS	.						161.0	136.0	145.0					X																	114883786		2203	4300	6503	SO:0001583	missense	5358	exon16			GCCAGAGTGTATG	L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.1798G>C	chrX.hg19:g.114883786G>C	ENSP00000398945:p.Val600Leu	156.0	0.0	.		183.0	72.0	.	NM_005032	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	ENST00000420625.2	hg19	CCDS14568.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840800	0.32513	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310;ENST00000543070	D;D;D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58;-3.58;-3.58	5.59	5.59	0.84812	Calponin homology domain (5);	0.053518	0.85682	D	0.000000	D	0.95367	0.8496	M	0.81942	2.565	0.80722	D	1	B;B;B	0.21606	0.02;0.058;0.009	B;B;B	0.39771	0.309;0.306;0.215	D	0.93807	0.7106	10	0.87932	D	0	-7.9383	10.9343	0.47237	0.0886:0.0:0.9114:0.0	.	573;587;600	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	L	600;587;564;600;555;194	ENSP00000348163:V600L;ENSP00000445105:V587L;ENSP00000289290:V564L;ENSP00000398945:V600L;ENSP00000445339:V555L;ENSP00000439260:V194L	ENSP00000289290:V564L	V	+	1	0	PLS3	114790042	1.000000	0.71417	0.983000	0.44433	0.191000	0.23601	7.881000	0.87252	2.494000	0.84150	0.594000	0.82650	GTG	.	.	.	none		0.433	PLS3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057976.2		
WDR44	54521	hgsc.bcm.edu	37	X	117526750	117526750	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chrX:117526750T>G	ENST00000254029.3	+	4	737	c.342T>G	c.(340-342)gaT>gaG	p.D114E	WDR44_ENST00000493448.1_3'UTR|WDR44_ENST00000371825.3_Missense_Mutation_p.D114E|WDR44_ENST00000371822.5_Missense_Mutation_p.D89E	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	114	Binding activity.					endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						TAGCCATAGATCAAGTACTAC	0.403																																					p.D114E		Atlas-SNP	.											.	WDR44	188	.	0			c.T342G						PASS	.						88.0	83.0	85.0					X																	117526750		2203	4300	6503	SO:0001583	missense	54521	exon4			CATAGATCAAGTA	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.342T>G	chrX.hg19:g.117526750T>G	ENSP00000254029:p.Asp114Glu	159.0	0.0	.		190.0	78.0	.	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	hg19	CCDS14572.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.058|0.058	-1.232190|-1.232190	0.01505|0.01505	.|.	.|.	ENSG00000131725|ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825|ENST00000371848	T;T;T|.	0.71579|.	-0.58;0.02;0.15|.	5.68|5.68	0.195|0.195	0.15151|0.15151	.|.	0.637812|.	0.17319|.	N|.	0.178592|.	T|T	0.09949|0.09949	0.0244|0.0244	N|N	0.04508|0.04508	-0.205|-0.205	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.0|.	T|T	0.26326|0.26326	-1.0106|-1.0106	10|5	0.08179|.	T|.	0.78|.	-1.0257|-1.0257	1.5608|1.5608	0.02594|0.02594	0.3214:0.0908:0.3459:0.2419|0.3214:0.0908:0.3459:0.2419	.|.	89;114;114|.	F8W913;Q5JSH3-2;Q5JSH3|.	.;.;WDR44_HUMAN|.	E|A	89;114;114|14	ENSP00000360887:D89E;ENSP00000254029:D114E;ENSP00000360890:D114E|.	ENSP00000254029:D114E|.	D|S	+|+	3|1	2|0	WDR44|WDR44	117410778|117410778	0.397000|0.397000	0.25270|0.25270	0.074000|0.074000	0.20217|0.20217	0.110000|0.110000	0.19582|0.19582	0.688000|0.688000	0.25422|0.25422	-0.017000|-0.017000	0.14103|0.14103	0.486000|0.486000	0.48141|0.48141	GAT|TCA	.	.	.	none		0.403	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
THOC2	57187	hgsc.bcm.edu	37	X	122801090	122801090	+	Silent	SNP	A	A	G			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chrX:122801090A>G	ENST00000245838.8	-	11	1088	c.1057T>C	c.(1057-1059)Tta>Cta	p.L353L	THOC2_ENST00000355725.4_Silent_p.L353L|THOC2_ENST00000491737.1_Silent_p.L238L	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	353					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						CCAATCTTTAATAAGGCTTCC	0.378																																					p.L353L		Atlas-SNP	.											.	THOC2	310	.	0			c.T1057C						PASS	.						138.0	121.0	127.0					X																	122801090		1869	4097	5966	SO:0001819	synonymous_variant	57187	exon11			TCTTTAATAAGGC	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1057T>C	chrX.hg19:g.122801090A>G		155.0	0.0	.		171.0	64.0	.	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Silent	SNP	ENST00000245838.8	hg19	CCDS43988.1																																																																																			.	.	.	none		0.378	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
ATP2B3	492	hgsc.bcm.edu	37	X	152826336	152826336	+	Silent	SNP	C	C	T	rs181539158		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chrX:152826336C>T	ENST00000349466.2	+	18	3368	c.3042C>T	c.(3040-3042)ttC>ttT	p.F1014F	ATP2B3_ENST00000393842.1_Silent_p.F1000F|ATP2B3_ENST00000263519.4_Silent_p.F1014F|ATP2B3_ENST00000359149.3_Silent_p.F1014F|ATP2B3_ENST00000370186.1_Silent_p.F1000F|ATP2B3_ENST00000370181.2_Silent_p.F1000F			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1014					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.F1014F(5)|p.F1014L(3)|p.F1000F(2)|p.F1000L(1)		NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGGCACTTTCGGGATTCAGG	0.572													C|||	1	0.000264901	0.0008	0.0	3775	,	,		13946	0.0		0.0	False		,,,				2504	0.0				p.F1014F		Atlas-SNP	.											.	ATP2B3	552	.	11	Substitution - coding silent(7)|Substitution - Missense(4)	lung(4)|breast(4)|large_intestine(3)	c.C3042T						PASS	.						194.0	141.0	159.0					X																	152826336		2203	4300	6503	SO:0001819	synonymous_variant	492	exon17			CACTTTCGGGATT	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3042C>T	chrX.hg19:g.152826336C>T		114.0	0.0	.		106.0	50.0	.	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	hg19	CCDS35440.1																																																																																			.	C|1.000;A|0.000	.	alt		0.572	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
F12	2161	hgsc.bcm.edu	37	5	176829362	176829363	+	Frame_Shift_Del	DEL	GC	GC	-	rs375101670		TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr5:176829362_176829363delGC	ENST00000253496.3	-	14	1826_1827	c.1778_1779delGC	c.(1777-1779)cgcfs	p.R593fs	F12_ENST00000514943.1_5'Flank|PFN3_ENST00000358571.2_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	593	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CTGGCTTGTTGCGGTCACCACA	0.619									Hereditary Angioedema																												p.593_594del		Atlas-INDEL	.											.	F12	35	.	0			c.1779_1780del						PASS	.																																			SO:0001589	frameshift_variant	2161	exon14	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	.	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1778_1779delGC	chr5.hg19:g.176829362_176829363delGC	ENSP00000253496:p.Arg593fs	41.0	0.0	0		44.0	13.0	0.295455	NM_000505	P78339	Frame_Shift_Del	DEL	ENST00000253496.3	hg19	CCDS34302.1																																																																																			.	.	.	none		0.619	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
CHL1	10752	hgsc.bcm.edu	37	3	407694	407695	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:407694_407695insT	ENST00000256509.2	+	15	2289_2290	c.1647_1648insT	c.(1648-1650)ttafs	p.L550fs	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Frame_Shift_Ins_p.L534fs|CHL1-AS1_ENST00000608098.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		ATATGCTTGAATTACATTGTGA	0.361																																					p.E549fs		Atlas-INDEL	.											.	CHL1	242	.	0			c.1647_1648insT						PASS	.																																			SO:0001589	frameshift_variant	10752	exon13			.	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1649dupT	chr3.hg19:g.407696_407696dupT	ENSP00000256509:p.Leu550fs	71.0	0.0	0		87.0	36.0	0.413793	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Frame_Shift_Ins	INS	ENST00000256509.2	hg19	CCDS2556.1																																																																																			.	.	.	none		0.361	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
MTCL1	23255	hgsc.bcm.edu	37	18	8813134	8813135	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr18:8813134_8813135insT	ENST00000306329.11	+	10	3719_3720	c.3719_3720insT	c.(3718-3723)aactggfs	p.W1241fs	SOGA2_ENST00000306285.7_Frame_Shift_Ins_p.W275fs|SOGA2_ENST00000359865.3_Frame_Shift_Ins_p.W922fs|SOGA2_ENST00000400050.3_Frame_Shift_Ins_p.W881fs|SOGA2_ENST00000517570.1_Frame_Shift_Ins_p.W881fs|SOGA2_ENST00000518815.1_Frame_Shift_Ins_p.W275fs																							AGCGAGAAGAACTGGAACCGGG	0.574																																					p.N921fs		Atlas-INDEL	.											.	.	.	.	0			c.2762_2763insT						PASS	.																																			SO:0001589	frameshift_variant	23255	exon12			.																												Exception_encountered	chr18.hg19:g.8813134_8813135insT	ENSP00000305027:p.Trp1241fs	37.0	0.0	0		26.0	14.0	0.538462	NM_015210		Frame_Shift_Ins	INS	ENST00000306329.11	hg19																																																																																				.	.	.	none		0.574	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
SKAP1	8631	hgsc.bcm.edu	37	17	46423341	46423341	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr17:46423341delT	ENST00000336915.6	-	4	275	c.206delA	c.(205-207)gatfs	p.D70fs	SKAP1_ENST00000584924.1_Frame_Shift_Del_p.D70fs	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	70					positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						GTGATTATCATCAGAGCTGTC	0.438																																					p.D69fs		Atlas-INDEL	.											.	SKAP1	41	.	0			c.207delT						PASS	.						80.0	70.0	73.0					17																	46423341		2203	4300	6503	SO:0001589	frameshift_variant	8631	exon4			.	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.206delA	chr17.hg19:g.46423341delT	ENSP00000338171:p.Asp70fs	55.0	0.0	0		67.0	30.0	0.447761	NM_001075099	D3DTV1|O15268	Frame_Shift_Del	DEL	ENST00000336915.6	hg19	CCDS32674.1																																																																																			.	.	.	none		0.438	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	
ARMCX1	51309	hgsc.bcm.edu	37	X	100808732	100808733	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chrX:100808732_100808733insT	ENST00000372829.3	+	4	1190_1191	c.819_820insT	c.(820-822)ttgfs	p.L274fs		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	274						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CCCTTAATAACTTGAGTGTGAA	0.426																																					p.N273fs		Atlas-INDEL	.											.	ARMCX1	67	.	0			c.819_820insT						PASS	.																																			SO:0001589	frameshift_variant	51309	exon4			.	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.821dupT	chrX.hg19:g.100808734_100808734dupT	ENSP00000361917:p.Leu274fs	96.0	0.0	0		103.0	44.0	0.427184	NM_016608	Q53HK2|Q9H2Q0	Frame_Shift_Ins	INS	ENST00000372829.3	hg19	CCDS14487.1																																																																																			.	.	.	none		0.426	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
AHNAK2	113146	hgsc.bcm.edu	37	14	105408067	105408067	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr14:105408067delT	ENST00000333244.5	-	7	13840	c.13721delA	c.(13720-13722)gacfs	p.D4574fs	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4574						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTTTCAGGTCCAGCTTGGG	0.627																																					p.D4574fs		Atlas-INDEL	.											.	AHNAK2	719	.	0			c.13722delC						PASS	.						124.0	134.0	131.0					14																	105408067		1916	4122	6038	SO:0001589	frameshift_variant	113146	exon7			.	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.13721delA	chr14.hg19:g.105408067delT	ENSP00000353114:p.Asp4574fs	307.0	0.0	0		302.0	94.0	0.311258	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Frame_Shift_Del	DEL	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.	.	none		0.627	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
FUT4	2526	hgsc.bcm.edu	37	11	94278647	94278649	+	In_Frame_Del	DEL	TTT	TTT	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	TTT	TTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr11:94278647_94278649delTTT	ENST00000358752.2	+	1	1631_1633	c.1348_1350delTTT	c.(1348-1350)tttdel	p.F450del	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	450					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTACGAGCGCTTTGTGCCCCGCG	0.655																																					p.449_450del		Atlas-INDEL	.											.	FUT4	17	.	0			c.1347_1349del						PASS	.																																			SO:0001651	inframe_deletion	2526	exon1			.		CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.1348_1350delTTT	chr11.hg19:g.94278647_94278649delTTT	ENSP00000351602:p.Phe450del	58.0	0.0	0		73.0	25.0	0.342466	NM_002033	B2RMS0	In_Frame_Del	DEL	ENST00000358752.2	hg19	CCDS8301.1																																																																																			.	.	.	none		0.655	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396327.2	NM_002033	
ZBTB20	26137	hgsc.bcm.edu	37	3	114057877	114057878	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:114057877_114057878delAT	ENST00000474710.1	-	5	2378_2379	c.2200_2201delAT	c.(2200-2202)atgfs	p.M734fs	ZBTB20_ENST00000393785.2_Frame_Shift_Del_p.M661fs|ZBTB20_ENST00000357258.3_Frame_Shift_Del_p.M661fs|ZBTB20_ENST00000464560.1_Frame_Shift_Del_p.M661fs|ZBTB20_ENST00000462705.1_Frame_Shift_Del_p.M661fs|ZBTB20_ENST00000481632.1_Frame_Shift_Del_p.M661fs|ZBTB20_ENST00000471418.1_Frame_Shift_Del_p.M661fs	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	734						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ATGCATCCTCATGTGGTCGTTG	0.48																																					p.734_734del	NSCLC(69;748 1344 9802 11203 30933)	Atlas-INDEL	.											.	ZBTB20	157	.	0			c.2201_2202del						PASS	.																																			SO:0001589	frameshift_variant	26137	exon5			.	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2200_2201delAT	chr3.hg19:g.114057877_114057878delAT	ENSP00000419153:p.Met734fs	124.0	0.0	0		141.0	56.0	0.397163	NM_001164342	Q63HP6|Q8N6R5|Q9Y410	Frame_Shift_Del	DEL	ENST00000474710.1	hg19	CCDS54626.1																																																																																			.	.	.	none		0.480	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
CLEC1B	51266	hgsc.bcm.edu	37	12	10145838	10145838	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr12:10145838delA	ENST00000298527.6	-	6	773	c.594delT	c.(592-594)tttfs	p.F198fs	CLEC1B_ENST00000348658.4_Frame_Shift_Del_p.F165fs|CLEC1B_ENST00000428126.2_Frame_Shift_Del_p.F165fs	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	198	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						TCCCATTATGAAAATAAGCAC	0.373																																					p.H199fs		Atlas-INDEL	.											.	CLEC1B	39	.	0			c.595delC						PASS	.						136.0	123.0	127.0					12																	10145838		1852	4085	5937	SO:0001589	frameshift_variant	51266	exon6			.	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.594delT	chr12.hg19:g.10145838delA	ENSP00000298527:p.Phe198fs	127.0	0.0	0		191.0	72.0	0.376963	NM_016509	Q6UWX7|Q8NHR6	Frame_Shift_Del	DEL	ENST00000298527.6	hg19	CCDS41752.1																																																																																			.	.	.	none		0.373	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509	
PBX1	5087	hgsc.bcm.edu	37	1	164781319	164781320	+	Frame_Shift_Ins	INS	-	-	GTATA			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:164781319_164781320insGTATA	ENST00000420696.2	+	6	1118_1119	c.930_931insGTATA	c.(931-933)gtcfs	p.-311fs	PBX1_ENST00000367897.1_Frame_Shift_Ins_p.-311fs|PBX1_ENST00000540246.1_Frame_Shift_Ins_p.-206fs|PBX1_ENST00000560641.1_Frame_Shift_Ins_p.-206fs|PBX1_ENST00000401534.1_Frame_Shift_Ins_p.-311fs|PBX1_ENST00000559240.1_Intron|PBX1_ENST00000540236.1_Frame_Shift_Ins_p.-311fs	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCAAAACAGCTGTCACTGCTAC	0.455			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.A310fs		Atlas-INDEL	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.930_931insGTATA						PASS	.																																			SO:0001589	frameshift_variant	5087	exon6			.	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	Exception_encountered	chr1.hg19:g.164781319_164781320insGTATA	ENSP00000405890:p.Val311fs	83.0	0.0	0		100.0	23.0	0.23	NM_001204963	B4DSC1|F5H4U9|Q5T488	Frame_Shift_Ins	INS	ENST00000420696.2	hg19	CCDS1246.1																																																																																			.	.	.	none		0.455	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
LRTM1	57408	hgsc.bcm.edu	37	3	54952818	54952823	+	In_Frame_Del	DEL	CAGGAA	CAGGAA	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	CAGGAA	CAGGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr3:54952818_54952823delCAGGAA	ENST00000273286.5	-	3	863_868	c.701_706delTTCCTG	c.(700-708)cttcctgct>cct	p.234_236LPA>P	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron|LRTM1_ENST00000493075.1_In_Frame_Del_p.158_160LPA>P	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	234	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		GGATCAGGAGCAGGAAGAGGGCAGGG	0.597																																					p.234_236del		Atlas-INDEL	.											.	LRTM1	52	.	0			c.702_707del						PASS	.																																			SO:0001651	inframe_deletion	57408	exon3			.	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.701_706delTTCCTG	chr3.hg19:g.54952818_54952823delCAGGAA	ENSP00000273286:p.Leu234_Ala236delinsPro	38.0	0.0	0		43.0	14.0	0.325581	NM_020678	Q8IUU2	In_Frame_Del	DEL	ENST00000273286.5	hg19	CCDS2876.1																																																																																			.	.	.	none		0.597	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
STIL	6491	hgsc.bcm.edu	37	1	47717027	47717027	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:47717027delT	ENST00000360380.3	-	18	4008	c.3645delA	c.(3643-3645)ccafs	p.P1215fs	STIL_ENST00000243182.6_Frame_Shift_Del_p.P1215fs|STIL_ENST00000371877.3_Frame_Shift_Del_p.P1216fs|STIL_ENST00000396221.2_Frame_Shift_Del_p.P1198fs|STIL_ENST00000337817.5_Frame_Shift_Del_p.P1215fs	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1215					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CTAAGAAAGCTGGCTTTTCAG	0.423																																					p.A1217fs		Atlas-INDEL	.											.	STIL	91	.	0			c.3649delG						PASS	.						120.0	121.0	121.0					1																	47717027		2203	4300	6503	SO:0001589	frameshift_variant	6491	exon17			.	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3645delA	chr1.hg19:g.47717027delT	ENSP00000353544:p.Pro1215fs	117.0	0.0	0		175.0	71.0	0.405714	NM_001048166	Q5T0C5|Q68CN9	Frame_Shift_Del	DEL	ENST00000360380.3	hg19	CCDS548.1																																																																																			.	.	.	none		0.423	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
PRPF38A	84950	hgsc.bcm.edu	37	1	52881045	52881046	+	In_Frame_Ins	INS	-	-	AGT			TCGA-GL-7773-01A-11D-2136-08	TCGA-GL-7773-10A-01D-2136-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	10a0f4f1-391f-4eff-9dc9-023a2993549c	06b70c78-6523-4956-a2b4-dd78e80cad60	g.chr1:52881045_52881046insAGT	ENST00000257181.9	+	9	1069_1070	c.883_884insAGT	c.(883-885)aag>aAGTag	p.295_296ins*	PRPF38A_ENST00000474048.1_3'UTR	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	295					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						GAGCCACTCAAAGTCTCCCGAA	0.401																																					p.K295delinsKX		Atlas-INDEL	.											.	PRPF38A	36	.	0			c.883_884insAGT						PASS	.																																			SO:0001652	inframe_insertion	84950	exon9			.	AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.884_886dupAGT	chr1.hg19:g.52881046_52881048dupAGT	ENSP00000257181:p.Ser296*	53.0	0.0	0		51.0	19.0	0.372549	NM_032864	Q96JW1|Q9BVZ8	In_Frame_Ins	INS	ENST00000257181.9	hg19	CCDS567.1																																																																																			.	.	.	none		0.401	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022459.2	NM_032864	
