#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CC2D1B	200014	hgsc.bcm.edu	37	1	52820569	52820569	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:52820569C>A	ENST00000371586.2	-	22	2438	c.2300G>T	c.(2299-2301)cGg>cTg	p.R767L	CC2D1B_ENST00000438831.1_Missense_Mutation_p.R142L|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.R761L|RP11-155O18.6_ENST00000606527.1_RNA	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	767	C2.					nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						CTTGAAGCCCCGGTGGTTTCG	0.532																																					p.R767L		Atlas-SNP	.											CC2D1B,NS,carcinoma,0,1	CC2D1B	73	.	0			c.G2300T						PASS	.						135.0	130.0	131.0					1																	52820569		2203	4300	6503	SO:0001583	missense	200014	exon22			AAGCCCCGGTGGT	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.2300G>T	chr1.hg19:g.52820569C>A	ENSP00000360642:p.Arg767Leu	124.0	0.0	.		74.0	3.0	.	NM_032449	Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	hg19	CCDS30714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.756100|5.756100	0.96898|0.96898	.|.	.|.	ENSG00000154222|ENSG00000154222	ENST00000438021;ENST00000450942|ENST00000371586;ENST00000284376;ENST00000371573;ENST00000438831	.|T;T;T	.|0.27256	.|1.68;1.68;1.68	5.65|5.65	5.65|5.65	0.86999|0.86999	.|C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58892|0.58892	0.2154|0.2154	M|M	0.84846|0.84846	2.72|2.72	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.999	T|T	0.62421|0.62421	-0.6858|-0.6858	5|10	.|0.87932	.|D	.|0	-19.4104|-19.4104	19.9142|19.9142	0.97043|0.97043	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|547;761;767	.|Q5T0G1;Q5T0F9-2;Q5T0F9	.|.;.;C2D1B_HUMAN	W|L	548;681|767;761;675;142	.|ENSP00000360642:R767L;ENSP00000284376:R761L;ENSP00000406300:R142L	.|ENSP00000284376:R761L	G|R	-|-	1|2	0|0	CC2D1B|CC2D1B	52593157|52593157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.249000|7.249000	0.78278|0.78278	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GGG|CGG	.	.	.	none		0.532	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449	
EVI5	7813	hgsc.bcm.edu	37	1	93160869	93160869	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:93160869C>G	ENST00000370331.1	-	7	1048	c.1039G>C	c.(1039-1041)Gag>Cag	p.E347Q	EVI5_ENST00000540033.1_Missense_Mutation_p.E347Q|EVI5_ENST00000543509.1_Missense_Mutation_p.E347Q	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	347	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		TAGCTTACCTCAGACATAAAG	0.423																																					p.E347Q		Atlas-SNP	.											.	EVI5	94	.	0			c.G1039C						PASS	.						107.0	109.0	108.0					1																	93160869		2203	4300	6503	SO:0001583	missense	7813	exon7			TTACCTCAGACAT	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1039G>C	chr1.hg19:g.93160869C>G	ENSP00000359356:p.Glu347Gln	135.0	0.0	.		66.0	7.0	.	NM_005665	A6NKX8|B9A6J0|Q9H1Y9	Missense_Mutation	SNP	ENST00000370331.1	hg19	CCDS30774.1	.	.	.	.	.	.	.	.	.	.	C	31	5.084339	0.94100	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509	T;T;T	0.14766	2.48;2.48;2.48	5.94	5.94	0.96194	Rab-GAP/TBC domain (4);	0.045268	0.85682	D	0.000000	T	0.34424	0.0897	M	0.83223	2.63	0.80722	D	1	D;D	0.60575	0.986;0.988	P;P	0.62560	0.844;0.904	T	0.13282	-1.0515	10	0.87932	D	0	-17.0097	20.3552	0.98837	0.0:1.0:0.0:0.0	.	347;347	F5H4R0;O60447	.;EVI5_HUMAN	Q	347	ENSP00000359356:E347Q;ENSP00000440826:E347Q;ENSP00000445019:E347Q	ENSP00000359356:E347Q	E	-	1	0	EVI5	92933457	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.760000	0.85248	2.812000	0.96745	0.557000	0.71058	GAG	.	.	.	none		0.423	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030047.1	NM_005665	
OR6Y1	391112	hgsc.bcm.edu	37	1	158517503	158517503	+	Silent	SNP	A	A	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:158517503A>T	ENST00000302617.3	-	1	392	c.393T>A	c.(391-393)atT>atA	p.I131I		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GTGGATTACAAATGGCTACAT	0.473																																					p.I131I		Atlas-SNP	.											.	OR6Y1	73	.	0			c.T393A						PASS	.						100.0	85.0	90.0					1																	158517503		2202	4300	6502	SO:0001819	synonymous_variant	391112	exon1			ATTACAAATGGCT	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.393T>A	chr1.hg19:g.158517503A>T		100.0	0.0	.		104.0	8.0	.	NM_001005189	Q6IFS0	Silent	SNP	ENST00000302617.3	hg19	CCDS30899.1																																																																																			.	.	.	none		0.473	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
NUAK2	81788	hgsc.bcm.edu	37	1	205274389	205274389	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:205274389T>C	ENST00000367157.3	-	6	887	c.761A>G	c.(760-762)gAc>gGc	p.D254G		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GATCTTATGGTCATGCCCATC	0.572																																					p.D254G		Atlas-SNP	.											.	NUAK2	107	.	0			c.A761G						PASS	.						98.0	83.0	88.0					1																	205274389		2203	4300	6503	SO:0001583	missense	81788	exon6			TTATGGTCATGCC	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.761A>G	chr1.hg19:g.205274389T>C	ENSP00000356125:p.Asp254Gly	87.0	0.0	.		69.0	17.0	.	NM_030952		Missense_Mutation	SNP	ENST00000367157.3	hg19	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.895395	0.91962	.	.	ENSG00000163545	ENST00000367157	T	0.26373	1.74	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000245	T	0.38983	0.1061	L	0.41124	1.26	0.80722	D	1	D	0.63046	0.992	P	0.59056	0.851	T	0.13710	-1.0499	10	0.62326	D	0.03	.	15.683	0.77388	0.0:0.0:0.0:1.0	.	254	Q9H093	NUAK2_HUMAN	G	254	ENSP00000356125:D254G	ENSP00000356125:D254G	D	-	2	0	NUAK2	203541012	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	8.040000	0.89188	2.188000	0.69820	0.459000	0.35465	GAC	.	.	.	none		0.572	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
SDE2	163859	hgsc.bcm.edu	37	1	226180666	226180666	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:226180666A>C	ENST00000272091.7	-	3	294	c.276T>G	c.(274-276)atT>atG	p.I92M		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	92																	TTGTCTTCTCAATCTGAGCAC	0.428																																					p.I92M		Atlas-SNP	.											.	.	.	.	0			c.T276G						PASS	.						85.0	76.0	79.0					1																	226180666		1868	4101	5969	SO:0001583	missense	163859	exon3			CTTCTCAATCTGA	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.276T>G	chr1.hg19:g.226180666A>C	ENSP00000272091:p.Ile92Met	89.0	0.0	.		69.0	25.0	.	NM_152608	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	hg19	CCDS41473.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.5|20.5	3.994098|3.994098	0.74703|0.74703	.|.	.|.	ENSG00000143751|ENSG00000143751	ENST00000272091;ENST00000366818|ENST00000366817	T|T	0.42131|0.49139	0.98|0.79	5.86|5.86	2.21|2.21	0.28008|0.28008	.|.	0.046995|.	0.85682|.	D|.	0.000000|.	T|T	0.41488|0.41488	0.1161|0.1161	L|L	0.41356|0.41356	1.27|1.27	0.29942|0.29942	N|N	0.82101|0.82101	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.91635|.	0.999;0.978|.	T|T	0.45071|0.45071	-0.9286|-0.9286	10|7	0.15066|0.87932	T|D	0.55|0	-11.6814|-11.6814	4.9973|4.9973	0.14245|0.14245	0.6408:0.0:0.1288:0.2305|0.6408:0.0:0.1288:0.2305	.|.	80;92|.	Q6IQ49-2;Q6IQ49|.	.;CA055_HUMAN|.	M|W	92;80|41	ENSP00000272091:I92M|ENSP00000355782:L41W	ENSP00000272091:I92M|ENSP00000355782:L41W	I|L	-|-	3|2	3|0	C1orf55|C1orf55	224247289|224247289	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.520000|1.520000	0.35899|0.35899	0.119000|0.119000	0.18210|0.18210	0.529000|0.529000	0.55759|0.55759	ATT|TTG	.	.	.	none		0.428	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1	NM_152608	
FH	2271	hgsc.bcm.edu	37	1	241663812	241663812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr1:241663812G>A	ENST00000366560.3	-	9	1353	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*		NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase	439					cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		GTATTGGCCTGGATTCCCACC	0.413			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												p.Q439X	Melanoma(148;1573 2486 7381 46575)	Atlas-SNP	.	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	FH	64	.	0			c.C1315T						PASS	.						149.0	143.0	145.0					1																	241663812		2203	4298	6501	SO:0001587	stop_gained	2271	exon9	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	TGGCCTGGATTCC	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1315C>T	chr1.hg19:g.241663812G>A	ENSP00000355518:p.Gln439*	195.0	0.0	.		218.0	91.0	.	NM_000143	B1ANK7	Nonsense_Mutation	SNP	ENST00000366560.3	hg19	CCDS1617.1	.	.	.	.	.	.	.	.	.	.	G	36	5.942978	0.97128	.	.	ENSG00000091483	ENST00000366560	.	.	.	5.71	5.71	0.89125	.	0.221640	0.47093	D	0.000245	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-13.6944	17.3485	0.87316	0.0:0.0:1.0:0.0	.	.	.	.	X	439	.	ENSP00000355518:Q439X	Q	-	1	0	FH	239730435	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.437000	0.52863	2.697000	0.92050	0.655000	0.94253	CAG	.	.	.	none		0.413	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	
SCN2A	6326	hgsc.bcm.edu	37	2	166201262	166201262	+	Silent	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:166201262C>G	ENST00000375437.2	+	16	3050	c.2760C>G	c.(2758-2760)ctC>ctG	p.L920L	SCN2A_ENST00000283256.6_Silent_p.L920L|SCN2A_ENST00000357398.3_Silent_p.L920L|SCN2A_ENST00000375427.2_Silent_p.L920L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	920					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTGTGAACTCCCACGCTGGC	0.488																																					p.L920L		Atlas-SNP	.											.	SCN2A	589	.	0			c.C2760G						PASS	.						231.0	208.0	216.0					2																	166201262		2203	4300	6503	SO:0001819	synonymous_variant	6326	exon15			TGAACTCCCACGC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2760C>G	chr2.hg19:g.166201262C>G		199.0	0.0	.		182.0	26.0	.	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	hg19	CCDS33314.1																																																																																			.	.	.	none		0.488	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
XIRP2	129446	hgsc.bcm.edu	37	2	168105759	168105759	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:168105759G>A	ENST00000409195.1	+	9	7946	c.7857G>A	c.(7855-7857)cgG>cgA	p.R2619R	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Silent_p.R2619R|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Silent_p.R2397R|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2444					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTAATGCTCGGATACTAGGAG	0.458																																					p.R2619R		Atlas-SNP	.											.	XIRP2	914	.	0			c.G7857A						PASS	.						88.0	85.0	86.0					2																	168105759		1909	4120	6029	SO:0001819	synonymous_variant	129446	exon9			TGCTCGGATACTA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7857G>A	chr2.hg19:g.168105759G>A		134.0	0.0	.		147.0	41.0	.	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	hg19	CCDS42769.1																																																																																			.	.	.	none		0.458	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
SESTD1	91404	hgsc.bcm.edu	37	2	179986590	179986590	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:179986590G>A	ENST00000428443.3	-	13	1665	c.1349C>T	c.(1348-1350)tCc>tTc	p.S450F		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	450							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATAGGCCCAGGATGCCTGATT	0.393																																					p.S450F		Atlas-SNP	.											.	SESTD1	66	.	0			c.C1349T						PASS	.						109.0	106.0	107.0					2																	179986590		2203	4300	6503	SO:0001583	missense	91404	exon13			GCCCAGGATGCCT	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1349C>T	chr2.hg19:g.179986590G>A	ENSP00000415332:p.Ser450Phe	76.0	0.0	.		84.0	26.0	.	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	hg19	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547863	0.86022	.	.	ENSG00000187231	ENST00000428443	T	0.06371	3.31	5.18	5.18	0.71444	.	0.102206	0.64402	D	0.000001	T	0.06280	0.0162	N	0.24115	0.695	0.80722	D	1	P	0.50943	0.94	B	0.41571	0.36	T	0.50268	-0.8848	9	.	.	.	-0.0059	18.0499	0.89344	0.0:0.0:1.0:0.0	.	450	Q86VW0	SESD1_HUMAN	F	450	ENSP00000415332:S450F	.	S	-	2	0	SESTD1	179694835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.023000	0.93683	2.584000	0.87258	0.467000	0.42956	TCC	.	.	.	none		0.393	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
ABCB6	10058	hgsc.bcm.edu	37	2	220074990	220074990	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:220074990G>A	ENST00000265316.3	-	18	2698	c.2382C>T	c.(2380-2382)atC>atT	p.I794I	ABCB6_ENST00000439002.2_Silent_p.I748I	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	794	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGATGACGAGGATCTGGTCAG	0.562																																					p.I794I		Atlas-SNP	.											.	ABCB6	76	.	0			c.C2382T						PASS	.						102.0	97.0	99.0					2																	220074990		2203	4300	6503	SO:0001819	synonymous_variant	10058	exon18			GACGAGGATCTGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.2382C>T	chr2.hg19:g.220074990G>A		129.0	0.0	.		126.0	8.0	.	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Silent	SNP	ENST00000265316.3	hg19	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	G	9.909	1.208939	0.22205	.	.	ENSG00000115657	ENST00000295750	.	.	.	4.83	0.378	0.16204	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49579	-0.8925	4	.	.	.	-23.7644	9.3287	0.38008	0.3743:0.0:0.6257:0.0	.	.	.	.	F	642	.	.	S	-	2	0	ABCB6	219783234	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	0.893000	0.28336	0.171000	0.19730	-0.145000	0.13849	TCC	.	.	.	none		0.562	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
CNOT10	25904	hgsc.bcm.edu	37	3	32766999	32766999	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr3:32766999G>A	ENST00000328834.5	+	9	1236	c.920G>A	c.(919-921)aGc>aAc	p.S307N	CNOT10_ENST00000454516.2_Missense_Mutation_p.S367N|CNOT10_ENST00000538368.1_Missense_Mutation_p.S79N|CNOT10_ENST00000463697.1_3'UTR|CNOT10_ENST00000331889.6_Missense_Mutation_p.S307N	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	307					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						TTTGCCATGAGCAAGCACAAT	0.393																																					p.S367N		Atlas-SNP	.											.	CNOT10	57	.	0			c.G1100A						PASS	.						148.0	145.0	146.0					3																	32766999		2203	4300	6503	SO:0001583	missense	25904	exon9			CCATGAGCAAGCA	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.920G>A	chr3.hg19:g.32766999G>A	ENSP00000330060:p.Ser307Asn	177.0	0.0	.		133.0	8.0	.	NM_001256742	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	hg19	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689299	0.68271	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000540405;ENST00000538368;ENST00000454516	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.52	5.52	0.82312	Tetratricopeptide-like helical (1);	0.043732	0.85682	D	0.000000	T	0.39279	0.1072	N	0.03608	-0.345	0.47037	D	0.999297	B;B;B;B	0.17465	0.022;0.011;0.019;0.014	B;B;B;B	0.19946	0.027;0.012;0.019;0.02	T	0.23013	-1.0200	10	0.39692	T	0.17	-16.0206	19.4425	0.94827	0.0:0.0:1.0:0.0	.	367;307;306;307	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	N	307;307;207;79;367	ENSP00000329376:S307N;ENSP00000330060:S307N;ENSP00000442552:S79N;ENSP00000399862:S367N	ENSP00000330060:S307N	S	+	2	0	CNOT10	32742003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.348000	0.97062	2.594000	0.87642	0.655000	0.94253	AGC	.	.	.	none		0.393	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
TAS2R1	50834	hgsc.bcm.edu	37	5	9629374	9629374	+	Silent	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:9629374G>A	ENST00000382492.2	-	1	1089	c.771C>T	c.(769-771)ttC>ttT	p.F257F	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	257					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						ACAGAAAGATGAACCTTCTGA	0.378																																					p.F257F		Atlas-SNP	.											.	TAS2R1	84	.	0			c.C771T						PASS	.						97.0	101.0	100.0					5																	9629374		2203	4300	6503	SO:0001819	synonymous_variant	50834	exon1			AAAGATGAACCTT	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.771C>T	chr5.hg19:g.9629374G>A		103.0	0.0	.		85.0	7.0	.	NM_019599	Q646G8	Silent	SNP	ENST00000382492.2	hg19	CCDS3876.1																																																																																			.	.	.	none		0.378	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
SHROOM1	134549	hgsc.bcm.edu	37	5	132161119	132161119	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr5:132161119C>T	ENST00000378679.3	-	4	1518	c.714G>A	c.(712-714)ccG>ccA	p.P238P	SHROOM1_ENST00000319854.3_Silent_p.P238P|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000378676.1_Silent_p.P238P	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	238					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ATTCCCGCGCCGGCCCACCGC	0.682																																					p.P238P		Atlas-SNP	.											.	SHROOM1	35	.	0			c.G714A						PASS	.																																			SO:0001819	synonymous_variant	134549	exon1			CCGCGCCGGCCCA	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.714G>A	chr5.hg19:g.132161119C>T		25.0	0.0	.		11.0	8.0	.	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	ENST00000378679.3	hg19	CCDS54902.1																																																																																			.	.	.	none		0.682	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
MTHFD1L	25902	hgsc.bcm.edu	37	6	151358132	151358132	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr6:151358132A>G	ENST00000367321.3	+	26	3000	c.2726A>G	c.(2725-2727)aAg>aGg	p.K909R	AL133260.1_ENST00000408542.1_RNA	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	909	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		TGCATGGCAAAGACCCACCTT	0.463																																					p.K910R		Atlas-SNP	.											.	MTHFD1L	75	.	0			c.A2729G						PASS	.						85.0	79.0	81.0					6																	151358132		2203	4300	6503	SO:0001583	missense	25902	exon26			TGGCAAAGACCCA	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.2726A>G	chr6.hg19:g.151358132A>G	ENSP00000356290:p.Lys909Arg	116.0	0.0	.		87.0	6.0	.	NM_001242767	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	hg19	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951688	0.92660	.	.	ENSG00000120254	ENST00000367321;ENST00000453602;ENST00000450635	T;T;T	0.39787	1.06;1.06;1.06	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73297	0.3569	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;D;D	0.91635	0.999;0.914;0.999	D	0.84465	0.0596	10	0.72032	D	0.01	.	15.1893	0.73032	1.0:0.0:0.0:0.0	.	910;664;909	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	R	909;34;8	ENSP00000356290:K909R;ENSP00000391022:K34R;ENSP00000399804:K8R	ENSP00000356290:K909R	K	+	2	0	MTHFD1L	151399825	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	1.974000	0.57490	0.533000	0.62120	AAG	.	.	.	none		0.463	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
NOBOX	135935	hgsc.bcm.edu	37	7	144098145	144098145	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr7:144098145G>T	ENST00000467773.1	-	4	837	c.838C>A	c.(838-840)Cgc>Agc	p.R280S	NOBOX_ENST00000223140.5_Missense_Mutation_p.R195S|NOBOX_ENST00000483238.1_Missense_Mutation_p.R280S	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	280					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R280G(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TTACCTGAGCGGTATAGGGTT	0.542																																					p.R280S		Atlas-SNP	.											NOBOX_ENST00000467773,NS,carcinoma,0,2	NOBOX	130	.	2	Substitution - Missense(2)	kidney(2)	c.C838A						PASS	.						76.0	72.0	73.0					7																	144098145		1844	4092	5936	SO:0001583	missense	135935	exon4			CTGAGCGGTATAG			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.838C>A	chr7.hg19:g.144098145G>T	ENSP00000419457:p.Arg280Ser	59.0	1.0	.		27.0	2.0	.	NM_001080413	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	hg19		.	.	.	.	.	.	.	.	.	.	G	14.32	2.499271	0.44455	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.94828	-3.53;-3.53;-3.53	5.15	5.15	0.70609	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.135341	0.49305	D	0.000145	T	0.79776	0.4504	N	0.00007	-3.155	0.36532	D	0.870806	P	0.50819	0.939	P	0.56865	0.808	D	0.84935	0.0862	10	0.15066	T	0.55	-31.9255	13.9985	0.64419	0.0:0.0:1.0:0.0	.	280	O60393	NOBOX_HUMAN	S	280;280;195;69	ENSP00000419565:R280S;ENSP00000419457:R280S;ENSP00000223140:R195S	ENSP00000223140:R195S	R	-	1	0	NOBOX	143729078	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.884000	0.48562	2.671000	0.90904	0.650000	0.86243	CGC	.	.	.	none		0.542	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420	
CCDC183	84960	hgsc.bcm.edu	37	9	139694856	139694856	+	Missense_Mutation	SNP	G	G	A	rs544497218	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr9:139694856G>A	ENST00000338005.6	+	5	489	c.454G>A	c.(454-456)Gag>Aag	p.E152K	RP11-216L13.18_ENST00000471502.1_RNA|RP11-216L13.19_ENST00000415992.1_RNA|KIAA1984_ENST00000371682.3_3'UTR|RP11-216L13.17_ENST00000456614.2_Missense_Mutation_p.E182K	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		152										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		CCGCCAGCTGGAGAACAACAT	0.602													G|||	3	0.000599042	0.0	0.0	5008	,	,		10479	0.0		0.0	False		,,,				2504	0.0031				p.E152K		Atlas-SNP	.											.	KIAA1984	39	.	0			c.G454A						PASS	.																																			SO:0001583	missense	84960	exon5			CAGCTGGAGAACA																												ENST00000338005.6:c.454G>A	chr9.hg19:g.139694856G>A	ENSP00000338013:p.Glu152Lys	20.0	0.0	.		17.0	6.0	.	NM_001039374	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	ENST00000338005.6	hg19	CCDS43906.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059818	0.93846	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.31510	1.49	4.19	4.19	0.49359	.	0.000000	0.41823	U	0.000810	T	0.50086	0.1595	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.49360	-0.8948	10	0.48119	T	0.1	-24.9723	12.0196	0.53336	0.0:0.0:1.0:0.0	.	152	Q5T5S1	K1984_HUMAN	K	152	ENSP00000338013:E152K	ENSP00000338013:E152K	E	+	1	0	KIAA1984	138814677	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	3.494000	0.53273	1.873000	0.54277	0.305000	0.20034	GAG	.	.	.	none		0.602	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354899.1		
GLB1L2	89944	hgsc.bcm.edu	37	11	134241359	134241359	+	Silent	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:134241359A>G	ENST00000535456.2	+	14	1589	c.1401A>G	c.(1399-1401)acA>acG	p.T467T	GLB1L2_ENST00000389881.3_Silent_p.T467T|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Silent_p.T467T	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	467					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		ACTACAAGACAACGAAGATTG	0.542																																					p.T467T		Atlas-SNP	.											.	GLB1L2	79	.	0			c.A1401G						PASS	.						161.0	159.0	160.0					11																	134241359		2201	4297	6498	SO:0001819	synonymous_variant	89944	exon14			CAAGACAACGAAG		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1401A>G	chr11.hg19:g.134241359A>G		216.0	0.0	.		210.0	79.0	.	NM_138342	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Silent	SNP	ENST00000535456.2	hg19	CCDS31724.1	.	.	.	.	.	.	.	.	.	.	A	4.458	0.084834	0.08583	.	.	ENSG00000149328	ENST00000525089	.	.	.	4.72	-9.38	0.00623	.	.	.	.	.	T	0.13457	0.0326	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17961	-1.0352	4	.	.	.	-3.4454	0.6104	0.00760	0.3795:0.1978:0.2259:0.1968	.	.	.	.	D	406	.	.	N	+	1	0	GLB1L2	133746569	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-3.622000	0.00412	-1.622000	0.01560	-1.291000	0.01355	AAC	.	.	.	none		0.542	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
ULK1	8408	hgsc.bcm.edu	37	12	132395297	132395297	+	Silent	SNP	C	C	T	rs571147302		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr12:132395297C>T	ENST00000321867.4	+	12	1251	c.900C>T	c.(898-900)tcC>tcT	p.S300S		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	300	Interaction with GABARAP and GABARAPL2.|Poly-Ser.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCTCGGGGTCCGGCAGCAGCT	0.662													T|||	1	0.000199681	0.0008	0.0	5008	,	,		14232	0.0		0.0	False		,,,				2504	0.0				p.S300S		Atlas-SNP	.											.	ULK1	92	.	0			c.C900T						PASS	.						76.0	67.0	70.0					12																	132395297		2203	4299	6502	SO:0001819	synonymous_variant	8408	exon12			GGGGTCCGGCAGC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.900C>T	chr12.hg19:g.132395297C>T		95.0	0.0	.		81.0	31.0	.	NM_003565	Q9UQ28	Silent	SNP	ENST00000321867.4	hg19	CCDS9274.1																																																																																			.	.	.	none		0.662	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
SNURF	8926	hgsc.bcm.edu	37	15	25207297	25207297	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:25207297C>T	ENST00000577949.1	+	2	114	c.51C>T	c.(49-51)caC>caT	p.H17H	SNURF_ENST00000338094.6_Silent_p.H17H|SNRPN_ENST00000554227.2_5'UTR|SNURF_ENST00000551312.2_Silent_p.H17H|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000400100.1_5'UTR|SNURF_ENST00000338327.4_Silent_p.H17H|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNRPN_ENST00000346403.6_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	17						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		CAGAACAGCACGTACCAGAGG	0.448																																					p.H17H		Atlas-SNP	.											.	SNURF	17	.	0			c.C51T						PASS	.						154.0	124.0	134.0					15																	25207297		2203	4300	6503	SO:0001819	synonymous_variant	8926	exon2			ACAGCACGTACCA		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.51C>T	chr15.hg19:g.25207297C>T		129.0	0.0	.		74.0	5.0	.	NM_005678	A6NCW2	Silent	SNP	ENST00000577949.1	hg19	CCDS10016.1																																																																																			.	.	.	none		0.448	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446300.1	NM_005678	
UACA	55075	hgsc.bcm.edu	37	15	70987423	70987423	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:70987423C>T	ENST00000322954.6	-	3	419	c.234G>A	c.(232-234)aaG>aaA	p.K78K	UACA_ENST00000560441.1_Silent_p.K65K|UACA_ENST00000539319.1_Silent_p.K78K|UACA_ENST00000379983.2_Silent_p.K65K	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	78					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						CAAGATTCCCCTTTGAGGTCA	0.353																																					p.K78K		Atlas-SNP	.											.	UACA	235	.	0			c.G234A						PASS	.						91.0	83.0	86.0					15																	70987423		2199	4297	6496	SO:0001819	synonymous_variant	55075	exon3			ATTCCCCTTTGAG	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.234G>A	chr15.hg19:g.70987423C>T		44.0	0.0	.		27.0	18.0	.	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	ENST00000322954.6	hg19	CCDS10235.1																																																																																			.	.	.	none		0.353	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
KIAA0753	9851	hgsc.bcm.edu	37	17	6531560	6531560	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:6531560G>A	ENST00000361413.3	-	3	953	c.595C>T	c.(595-597)Cag>Tag	p.Q199*	KIAA0753_ENST00000542606.1_5'UTR|KIAA0753_ENST00000572370.1_5'UTR	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	199						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GGATGAGGCTGAAGTCCCGGA	0.483																																					p.Q199X		Atlas-SNP	.											.	KIAA0753	63	.	0			c.C595T						PASS	.						129.0	131.0	131.0					17																	6531560		2023	4175	6198	SO:0001587	stop_gained	9851	exon3			GAGGCTGAAGTCC		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.595C>T	chr17.hg19:g.6531560G>A	ENSP00000355250:p.Gln199*	179.0	0.0	.		157.0	9.0	.	NM_014804	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Nonsense_Mutation	SNP	ENST00000361413.3	hg19	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	G	32	5.129961	0.94473	.	.	ENSG00000198920	ENST00000361413	.	.	.	5.34	-0.77	0.11005	.	0.864801	0.09963	N	0.733125	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-2.5116	10.7147	0.46005	0.0:0.5544:0.3039:0.1417	.	.	.	.	X	199	.	ENSP00000355250:Q199X	Q	-	1	0	KIAA0753	6472284	0.004000	0.15560	0.007000	0.13788	0.294000	0.27393	0.211000	0.17474	0.282000	0.22254	0.655000	0.94253	CAG	.	.	.	none		0.483	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
TRPV2	51393	hgsc.bcm.edu	37	17	16340169	16340169	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:16340169A>G	ENST00000338560.7	+	15	2660	c.2261A>G	c.(2260-2262)aAc>aGc	p.N754S	C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000487066.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|TRPV2_ENST00000577397.1_Missense_Mutation_p.N324S|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	754					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCTGAGGAAAACTATGTGCCC	0.562																																					p.N754S		Atlas-SNP	.											.	TRPV2	74	.	0			c.A2261G						PASS	.						154.0	134.0	141.0					17																	16340169		2203	4300	6503	SO:0001583	missense	51393	exon15			AGGAAAACTATGT	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.2261A>G	chr17.hg19:g.16340169A>G	ENSP00000342222:p.Asn754Ser	156.0	0.0	.		145.0	58.0	.	NM_016113	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	hg19	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	A	5.819	0.335390	0.11013	.	.	ENSG00000187688	ENST00000338560	D	0.87334	-2.24	3.83	3.83	0.44106	.	0.576086	0.16403	N	0.215935	T	0.72740	0.3498	N	0.08118	0	0.19775	N	0.999956	B	0.09022	0.002	B	0.09377	0.004	T	0.61093	-0.7132	10	0.34782	T	0.22	-56.024	9.2873	0.37764	1.0:0.0:0.0:0.0	.	754	Q9Y5S1	TRPV2_HUMAN	S	754	ENSP00000342222:N754S	ENSP00000342222:N754S	N	+	2	0	TRPV2	16280894	0.920000	0.31207	0.964000	0.40570	0.094000	0.18550	2.141000	0.42168	1.972000	0.57404	0.459000	0.35465	AAC	.	.	.	none		0.562	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
SYT4	6860	hgsc.bcm.edu	37	18	40853736	40853736	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr18:40853736C>G	ENST00000255224.3	-	2	1026	c.658G>C	c.(658-660)Gat>Cat	p.D220H	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.D202H	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	220	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						AAGGTCTCATCAAAAGCTGGA	0.403																																					p.D220H	NSCLC(85;81 1419 2855 22820 35912)	Atlas-SNP	.											.	SYT4	162	.	0			c.G658C						PASS	.						111.0	108.0	109.0					18																	40853736		2203	4300	6503	SO:0001583	missense	6860	exon2			TCTCATCAAAAGC	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.658G>C	chr18.hg19:g.40853736C>G	ENSP00000255224:p.Asp220His	147.0	0.0	.		68.0	30.0	.	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	hg19	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.319387	0.81469	.	.	ENSG00000132872	ENST00000255224;ENST00000442661	T	0.09163	3.01	5.87	5.87	0.94306	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.043597	0.85682	D	0.000000	T	0.33265	0.0857	M	0.64260	1.97	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.69142	0.962;0.962	T	0.00357	-1.1792	10	0.87932	D	0	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	202;220	B4DEU3;Q9H2B2	.;SYT4_HUMAN	H	220;25	ENSP00000255224:D220H	ENSP00000255224:D220H	D	-	1	0	SYT4	39107734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.729000	0.84864	2.941000	0.99782	0.655000	0.94253	GAT	.	.	.	none		0.403	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
SERPINB10	5273	hgsc.bcm.edu	37	18	61585305	61585305	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr18:61585305T>A	ENST00000238508.3	+	4	400	c.341T>A	c.(340-342)aTa>aAa	p.I114K		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	114					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GCCAATGCGATATATGGAGAG	0.363																																					p.I114K		Atlas-SNP	.											.	SERPINB10	53	.	0			c.T341A						PASS	.						103.0	94.0	97.0					18																	61585305		2203	4300	6503	SO:0001583	missense	5273	exon3			ATGCGATATATGG	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.341T>A	chr18.hg19:g.61585305T>A	ENSP00000238508:p.Ile114Lys	83.0	0.0	.		44.0	6.0	.	NM_005024	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	hg19	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	T	9.136	1.012671	0.19277	.	.	ENSG00000242550	ENST00000238508	D	0.84370	-1.84	5.83	3.43	0.39272	Serpin domain (3);	0.694589	0.14087	N	0.342276	D	0.88555	0.6468	H	0.94771	3.58	0.09310	N	1	B	0.27316	0.175	B	0.28465	0.09	T	0.83166	-0.0096	10	0.87932	D	0	.	9.1438	0.36919	0.0:0.1534:0.0:0.8466	.	114	P48595	SPB10_HUMAN	K	114	ENSP00000238508:I114K	ENSP00000238508:I114K	I	+	2	0	SERPINB10	59736285	0.002000	0.14202	0.004000	0.12327	0.109000	0.19521	1.191000	0.32138	1.037000	0.40024	-0.274000	0.10170	ATA	.	.	.	none		0.363	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
KXD1	79036	hgsc.bcm.edu	37	19	18679377	18679377	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr19:18679377A>T	ENST00000602094.1	+	5	1927	c.467A>T	c.(466-468)cAg>cTg	p.Q156L	KXD1_ENST00000539106.1_Missense_Mutation_p.Q156L|KXD1_ENST00000595073.1_Missense_Mutation_p.Q156L|AC005253.4_ENST00000593791.1_RNA|KXD1_ENST00000540691.1_Missense_Mutation_p.Q156L|KXD1_ENST00000222307.4_Missense_Mutation_p.Q156L|KXD1_ENST00000601630.1_Missense_Mutation_p.Q175L|KXD1_ENST00000599319.1_Missense_Mutation_p.Q156L			Q9BQD3	KXDL1_HUMAN	KxDL motif containing 1	156					vesicle-mediated transport (GO:0016192)	BLOC-1 complex (GO:0031083)											TCCCATGTCCAGCCTGGCTCC	0.657																																					p.Q156L		Atlas-SNP	.											C19orf50,caecum,carcinoma,0,1	.	.	.	0			c.A467T						PASS	.						96.0	89.0	92.0					19																	18679377		2203	4300	6503	SO:0001583	missense	79036	exon6			ATGTCCAGCCTGG	AK098346	CCDS12381.1	19p13.11	2011-11-24	2011-11-24	2011-11-24	ENSG00000105700	ENSG00000105700			28420	protein-coding gene	gene with protein product		615178	"""chromosome 19 open reading frame 50"""	C19orf50		21159114	Standard	NM_001171948		Approved	FLJ25480, MGC2749, KXDL	uc002njo.3	Q9BQD3		ENST00000602094.1:c.467A>T	chr19.hg19:g.18679377A>T	ENSP00000472836:p.Gln156Leu	151.0	0.0	.		141.0	9.0	.	NM_001171948	O76098	Missense_Mutation	SNP	ENST00000602094.1	hg19	CCDS12381.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064988	0.36470	.	.	ENSG00000105700	ENST00000540691;ENST00000539106;ENST00000222307	T;T;T	0.45276	0.9;0.9;0.9	4.59	-4.19	0.03835	.	0.517276	0.21501	N	0.073525	T	0.21590	0.0520	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.05699	-1.0869	10	0.59425	D	0.04	-5.0797	6.0241	0.19646	0.4521:0.2352:0.3127:0.0	.	156	Q9BQD3	CS050_HUMAN	L	156	ENSP00000443549:Q156L;ENSP00000438903:Q156L;ENSP00000222307:Q156L	ENSP00000222307:Q156L	Q	+	2	0	C19orf50	18540377	0.002000	0.14202	0.000000	0.03702	0.040000	0.13550	0.014000	0.13333	-0.954000	0.03640	-0.345000	0.07892	CAG	.	.	.	none		0.657	KXD1-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465107.1	NM_024069	
LSS	4047	hgsc.bcm.edu	37	21	47615617	47615617	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr21:47615617G>A	ENST00000397728.3	-	19	1868	c.1790C>T	c.(1789-1791)gCc>gTc	p.A597V	LSS_ENST00000356396.4_Missense_Mutation_p.A597V|LSS_ENST00000522411.1_Missense_Mutation_p.A586V|LSS_ENST00000457828.2_Missense_Mutation_p.A517V|AP001468.1_ENST00000594486.1_5'Flank	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	597					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)	p.A597V(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					CCCCATACAGGCGAAGGCCTC	0.582																																					p.A597V	Pancreas(114;955 2313 34923 50507)	Atlas-SNP	.											LSS,trunk,malignant_melanoma,0,1	LSS	50	.	1	Substitution - Missense(1)	skin(1)	c.C1790T						PASS	.						127.0	109.0	115.0					21																	47615617		2203	4300	6503	SO:0001583	missense	4047	exon19			ATACAGGCGAAGG	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1790C>T	chr21.hg19:g.47615617G>A	ENSP00000380837:p.Ala597Val	118.0	0.0	.		67.0	51.0	.	NM_001001438	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	hg19	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738473	0.69304	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	5.61	5.61	0.85477	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.098347	0.64402	D	0.000001	T	0.31670	0.0804	L	0.39692	1.235	0.80722	D	1	D;D	0.62365	0.979;0.991	B;P	0.49922	0.393;0.626	T	0.01205	-1.1419	10	0.19590	T	0.45	.	19.224	0.93810	0.0:0.0:1.0:0.0	.	586;597	E9PEI9;P48449	.;ERG7_HUMAN	V	597;517;597;586	ENSP00000348762:A597V;ENSP00000409191:A517V;ENSP00000380837:A597V;ENSP00000429133:A586V	ENSP00000348762:A597V	A	-	2	0	LSS	46440045	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	9.232000	0.95325	2.633000	0.89246	0.655000	0.94253	GCC	.	.	.	none		0.582	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
APOL3	80833	hgsc.bcm.edu	37	22	36556768	36556768	+	Missense_Mutation	SNP	G	G	T	rs11089781	byFrequency	TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:36556768G>T	ENST00000349314.2	-	1	209	c.172C>A	c.(172-174)Cag>Aag	p.Q58K	APOL3_ENST00000361710.2_5'UTR|APOL3_ENST00000424878.2_5'UTR|APOL3_ENST00000397293.2_5'UTR|APOL3_ENST00000397287.2_5'UTR	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	58					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						GTTCTGAGCTGTGTGGATCCC	0.512																																					p.Q58K		Atlas-SNP	.											.	APOL3	60	.	0			c.C172A						PASS	.						149.0	122.0	131.0					22																	36556768		2203	4300	6503	SO:0001583	missense	80833	exon1			TGAGCTGTGTGGA	AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.172C>A	chr22.hg19:g.36556768G>T	ENSP00000344577:p.Gln58Lys	144.0	0.0	.		75.0	11.0	.	NM_145640	B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	ENST00000349314.2	hg19	CCDS13922.1	.	.	.	.	.	.	.	.	.	.	G	5.735	0.320098	0.10845	.	.	ENSG00000128284	ENST00000349314;ENST00000531095	T;T	0.60672	3.74;0.17	2.76	1.71	0.24356	.	680.984000	0.00751	U	0.001072	T	0.34890	0.0913	N	0.08118	0	0.23879	N	0.99658	P	0.43477	0.808	B	0.33799	0.17	T	0.40040	-0.9584	10	0.51188	T	0.08	.	6.0512	0.19787	0.1475:0.0:0.8525:0.0	.	58	O95236	APOL3_HUMAN	K	58;22	ENSP00000344577:Q58K;ENSP00000432271:Q22K	ENSP00000344577:Q58K	Q	-	1	0	APOL3	34886714	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	-0.640000	0.05440	0.726000	0.32339	0.603000	0.83216	CAG	.	G|0.932;A|0.068	.	alt		0.512	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319268.1	NM_145641	
ATP2B3	492	hgsc.bcm.edu	37	X	152823737	152823737	+	Silent	SNP	C	C	T			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chrX:152823737C>T	ENST00000349466.2	+	16	2927	c.2601C>T	c.(2599-2601)gcC>gcT	p.A867A	ATP2B3_ENST00000460549.1_3'UTR|ATP2B3_ENST00000393842.1_Silent_p.A853A|ATP2B3_ENST00000359149.3_Silent_p.A867A|ATP2B3_ENST00000263519.4_Silent_p.A867A|ATP2B3_ENST00000370186.1_Silent_p.A853A|ATP2B3_ENST00000370181.2_Silent_p.A853A			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	867					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGATCGTGGCCTTCACAGGTG	0.582																																					p.A867A		Atlas-SNP	.											.	ATP2B3	552	.	0			c.C2601T						PASS	.						181.0	128.0	146.0					X																	152823737		2203	4300	6503	SO:0001819	synonymous_variant	492	exon15			CGTGGCCTTCACA	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.2601C>T	chrX.hg19:g.152823737C>T		208.0	0.0	.		133.0	8.0	.	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	hg19	CCDS35440.1																																																																																			.	.	.	none		0.582	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
B2M	567	hgsc.bcm.edu	37	15	45003781	45003782	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr15:45003781_45003782delCT	ENST00000558401.1	+	1	107_108	c.37_38delCT	c.(37-39)ctcfs	p.L13fs	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Frame_Shift_Del_p.L13fs|B2M_ENST00000544417.1_Frame_Shift_Del_p.L13fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	13					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.A11fs*42(1)|p.L13F(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GCTCGCGCTACTCTCTCTTTCT	0.614																																					p.12_13del		Atlas-INDEL	.											.	B2M	99	.	6	Deletion - Frameshift(5)|Substitution - Missense(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|skin(1)	c.36_37del						PASS	.																																			SO:0001589	frameshift_variant	567	exon1			.	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.37_38delCT	chr15.hg19:g.45003787_45003788delCT	ENSP00000452780:p.Leu13fs	104.0	0.0	0		58.0	10.0	0.172414	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	hg19	CCDS10113.1																																																																																			.	.	.	none		0.614	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
TAF1B	9014	hgsc.bcm.edu	37	2	10059757	10059763	+	Frame_Shift_Del	DEL	GCACACT	GCACACT	-	rs59159809		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	GCACACT	GCACACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr2:10059757_10059763delGCACACT	ENST00000263663.5	+	14	1561_1567	c.1373_1379delGCACACT	c.(1372-1380)agcacactgfs	p.STL458fs	TAF1B_ENST00000396242.3_Frame_Shift_Del_p.STL203fs	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	458					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAACAATTTAGCACACTGGTCGAGTCA	0.391																																					p.458_460del		Atlas-INDEL	.											.	TAF1B	62	.	0			c.1372_1378del						PASS	.																																			SO:0001589	frameshift_variant	9014	exon14			.	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1373_1379delGCACACT	chr2.hg19:g.10059757_10059763delGCACACT	ENSP00000263663:p.Ser458fs	123.0	0.0	0		101.0	17.0	0.168317	NM_005680	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Del	DEL	ENST00000263663.5	hg19	CCDS33143.1																																																																																			.	.	.	none		0.391	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
TCFL5	10732	hgsc.bcm.edu	37	20	61490803	61490806	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	AGAA	AGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr20:61490803_61490806delAGAA	ENST00000335351.3	-	3	996_999	c.904_907delTTCT	c.(904-909)ttctgtfs	p.FC302fs	TCFL5_ENST00000217162.5_Frame_Shift_Del_p.FC254fs	NM_006602.2	NP_006593.2	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 (basic helix-loop-helix)	302					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|urinary_tract(1)	9	Breast(26;5.68e-08)					TGCTGATAACAGAAAGAAAATGCT	0.387																																					p.302_303del		Atlas-INDEL	.											.	TCFL5	43	.	0			c.905_908del						PASS	.																																			SO:0001589	frameshift_variant	10732	exon3			.	AB012124	CCDS13506.1	20q13.33	2013-09-19			ENSG00000101190	ENSG00000101190		"""Basic helix-loop-helix proteins"""	11646	protein-coding gene	gene with protein product	"""HPV-16 E2 binding protein 1"""	604745				9763657	Standard	XM_005260185		Approved	Figlb, E2BP-1, CHA, bHLHe82	uc002ydp.3	Q9UL49	OTTHUMG00000032939	ENST00000335351.3:c.904_907delTTCT	chr20.hg19:g.61490807_61490810delAGAA	ENSP00000334294:p.Phe302fs	228.0	0.0	0		210.0	74.0	0.352381	NM_006602	O94771|Q9BYW0	Frame_Shift_Del	DEL	ENST00000335351.3	hg19	CCDS13506.1																																																																																			.	.	.	none		0.387	TCFL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080079.2	NM_006602	
NF2	4771	hgsc.bcm.edu	37	22	30061052	30061052	+	Splice_Site	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:30061052delT	ENST00000338641.4	+	9	1325	c.884delT	c.(883-885)ctg>cg	p.L295fs	NF2_ENST00000403435.1_Splice_Site_p.L295fs|NF2_ENST00000397789.3_Splice_Site_p.L295fs|NF2_ENST00000361166.4_Splice_Site_p.L295fs|NF2_ENST00000334961.7_Splice_Site_p.L212fs|NF2_ENST00000413209.2_Intron|NF2_ENST00000361676.4_Splice_Site_p.L253fs|NF2_ENST00000353887.4_Splice_Site_p.L212fs|NF2_ENST00000361452.4_Splice_Site_p.L254fs|NF2_ENST00000403999.3_Splice_Site_p.L295fs|NF2_ENST00000347330.5_Splice_Site_p.L136fs	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	295	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.F271_L295del(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						GTTAATAAGCTGGTAAGTTGA	0.333			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.L295X		Atlas-INDEL	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	4	Unknown(3)|Deletion - In frame(1)	central_nervous_system(2)|large_intestine(1)|stomach(1)	c.883delC	GRCh37	CD070492	NF2	D		PASS	.						111.0	103.0	106.0					22																	30061052		2202	4300	6502	SO:0001630	splice_region_variant	4771	exon9	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	.	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.885+1T>-	chr22.hg19:g.30061052delT		28.0	0.0	0		24.0	18.0	0.75	NM_181832	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Frame_Shift_Del	DEL	ENST00000338641.4	hg19	CCDS13861.1																																																																																			.	.	.	none		0.333	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Frame_Shift_Del
STARD3	10948	hgsc.bcm.edu	37	17	37809843	37809854	+	In_Frame_Del	DEL	CCTCCCTGGGCT	CCTCCCTGGGCT	-	rs371019835		TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	CCTCCCTGGGCT	CCTCCCTGGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr17:37809843_37809854delCCTCCCTGGGCT	ENST00000336308.5	+	2	277_288	c.59_70delCCTCCCTGGGCT	c.(58-72)gcctccctgggctcc>gcc	p.SLGS21del	STARD3_ENST00000544210.2_In_Frame_Del_p.SLGS21del|STARD3_ENST00000578232.1_Intron|STARD3_ENST00000394250.4_In_Frame_Del_p.SLGS21del|STARD3_ENST00000580611.1_In_Frame_Del_p.SLGS21del	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	21					cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCTGCCGTGGCCTCCCTGGGCTCCTCACTGTC	0.684											OREG0024381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.20_23del		Atlas-INDEL	.											.	STARD3	33	.	0			c.58_69del						PASS	.																																			SO:0001651	inframe_deletion	10948	exon2			.		CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.59_70delCCTCCCTGGGCT	chr17.hg19:g.37809843_37809854delCCTCCCTGGGCT	ENSP00000337446:p.Ser21_Ser24del	76.0	0.0	0	873	60.0	20.0	0.333333	NM_006804	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	In_Frame_Del	DEL	ENST00000336308.5	hg19	CCDS11341.1																																																																																			.	.	.	none		0.684	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256933.1		
CACNG2	10369	hgsc.bcm.edu	37	22	37098492	37098492	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr22:37098492delT	ENST00000300105.6	-	1	1111	c.130delA	c.(130-132)agtfs	p.S44fs	RP1-293L6.1_ENST00000430281.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	44					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						TCACTGACACTTTTGGTCTTG	0.488																																					p.S44fs		Atlas-INDEL	.											.	CACNG2	43	.	0			c.131delG						PASS	.						266.0	225.0	239.0					22																	37098492		2203	4300	6503	SO:0001589	frameshift_variant	10369	exon1			.	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.130delA	chr22.hg19:g.37098492delT	ENSP00000300105:p.Ser44fs	266.0	0.0	0		174.0	120.0	0.689655	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Frame_Shift_Del	DEL	ENST00000300105.6	hg19	CCDS13931.1																																																																																			.	.	.	none		0.488	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
PUS3	83480	hgsc.bcm.edu	37	11	125766029	125766029	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-7966-01A-11D-2201-08	TCGA-GL-7966-10A-01D-2201-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	458fa5d9-d07d-4869-8e72-52b7318d7810	b720a727-863a-4225-99b2-bb5cd03e11bd	g.chr11:125766029delT	ENST00000530811.1	-	1	196	c.151delA	c.(151-153)actfs	p.T51fs	HYLS1_ENST00000356438.3_Intron|HYLS1_ENST00000425380.2_Intron|PUS3_ENST00000227474.3_Frame_Shift_Del_p.T51fs|HYLS1_ENST00000526028.1_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	51					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		GCACGCTTAGTTTTTCCAGCT	0.448																																					p.T51fs		Atlas-INDEL	.											.	PUS3	33	.	0			c.152delC						PASS	.						230.0	226.0	227.0					11																	125766029		2201	4299	6500	SO:0001589	frameshift_variant	83480	exon2			.	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.151delA	chr11.hg19:g.125766029delT	ENSP00000432386:p.Thr51fs	255.0	0.0	0		244.0	18.0	0.0737705	NM_031307	B2RAM0|Q96D17|Q96J23|Q96NB4	Frame_Shift_Del	DEL	ENST00000530811.1	hg19	CCDS8466.1																																																																																			.	.	.	none		0.448	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386783.1	NM_031307	
