#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTC4	7268	hgsc.bcm.edu	37	1	55183223	55183223	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr1:55183223G>C	ENST00000371281.3	+	3	375	c.288G>C	c.(286-288)aaG>aaC	p.K96N	MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.R1332T|TTC4_ENST00000371284.5_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	96										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						AAGACTACAAGAAAGCTGTAA	0.368																																					p.K96N		Atlas-SNP	.											.	TTC4	21	.	0			c.G288C						PASS	.						64.0	63.0	64.0					1																	55183223		2203	4300	6503	SO:0001583	missense	7268	exon3			CTACAAGAAAGCT		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.288G>C	chr1.hg19:g.55183223G>C	ENSP00000360329:p.Lys96Asn	176.0	0.0	.		156.0	55.0	.	NM_004623	Q53Y95|Q5TA96|Q9H3I2	Missense_Mutation	SNP	ENST00000371281.3	hg19	CCDS596.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424330	0.43020	.	.	ENSG00000243725	ENST00000371281;ENST00000371284	T	0.61040	0.14	3.97	1.82	0.25136	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	T	0.42877	0.1222	L	0.38838	1.175	0.46185	D	0.998919	B;P	0.34977	0.058;0.478	B;B	0.34824	0.056;0.19	T	0.19549	-1.0302	9	0.45353	T	0.12	-17.6511	6.6318	0.22861	0.303:0.0:0.697:0.0	.	96;107	O95801;Q5TA95	TTC4_HUMAN;.	N	96;107	ENSP00000360329:K96N	ENSP00000360329:K96N	K	+	3	2	TTC4	54955811	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.484000	0.45242	0.311000	0.23014	0.563000	0.77884	AAG	.	.	.	none		0.368	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623	
ASH1L	55870	hgsc.bcm.edu	37	1	155313421	155313421	+	Silent	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr1:155313421G>A	ENST00000368346.3	-	23	8748	c.8109C>T	c.(8107-8109)cgC>cgT	p.R2703R	ASH1L_ENST00000392403.3_Silent_p.R2698R|MIR555_ENST00000384987.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2703	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCTTCTCAATGCGAAAGATGT	0.493																																					p.R2698R		Atlas-SNP	.											.	ASH1L	279	.	0			c.C8094T						PASS	.						114.0	109.0	110.0					1																	155313421		2203	4300	6503	SO:0001819	synonymous_variant	55870	exon23			CTCAATGCGAAAG	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8109C>T	chr1.hg19:g.155313421G>A		186.0	0.0	.		177.0	64.0	.	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	hg19																																																																																				.	.	.	none		0.493	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
LMNA	4000	hgsc.bcm.edu	37	1	156107474	156107474	+	Silent	SNP	A	A	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr1:156107474A>C	ENST00000368300.4	+	10	1850	c.1638A>C	c.(1636-1638)tcA>tcC	p.S546S	LMNA_ENST00000347559.2_Intron|LMNA_ENST00000392353.3_Silent_p.S465S|LMNA_ENST00000448611.2_Silent_p.S434S|LMNA_ENST00000368301.2_Silent_p.S546S|LMNA_ENST00000361308.4_Silent_p.S546S|LMNA_ENST00000368297.1_Silent_p.S465S|LMNA_ENST00000368299.3_Silent_p.S546S|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Silent_p.S447S	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	546	Tail.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TGGTGCGCTCAGTGACTGTGG	0.622									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.S546S		Atlas-SNP	.											.	LMNA	31	.	0			c.A1638C						PASS	.						64.0	45.0	51.0					1																	156107474		2174	4254	6428	SO:0001819	synonymous_variant	4000	exon10	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GCGCTCAGTGACT	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1638A>C	chr1.hg19:g.156107474A>C		74.0	0.0	.		77.0	29.0	.	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	hg19	CCDS1129.1																																																																																			.	.	.	none		0.622	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
AXDND1	126859	hgsc.bcm.edu	37	1	179339155	179339155	+	Missense_Mutation	SNP	C	C	G	rs577148644		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr1:179339155C>G	ENST00000367618.3	+	4	703	c.316C>G	c.(316-318)Cga>Gga	p.R106G	AXDND1_ENST00000457238.2_Missense_Mutation_p.R106G|AXDND1_ENST00000461179.2_3'UTR	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	106										NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						TCACCCTGTTCGAAGGAATAA	0.438																																					p.R106G		Atlas-SNP	.											.	AXDND1	142	.	0			c.C316G						PASS	.						80.0	72.0	75.0					1																	179339155		2203	4300	6503	SO:0001583	missense	126859	exon4			CCTGTTCGAAGGA	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.316C>G	chr1.hg19:g.179339155C>G	ENSP00000356590:p.Arg106Gly	104.0	0.0	.		106.0	44.0	.	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720207	0.30503	.	.	ENSG00000162779	ENST00000509175;ENST00000367618;ENST00000360322;ENST00000507383;ENST00000457238;ENST00000508285;ENST00000511889;ENST00000434088	T;T;T	0.52057	1.9;0.68;2.02	5.39	3.47	0.39725	.	0.176693	0.38605	N	0.001628	T	0.45256	0.1333	L	0.41710	1.295	0.19775	N	0.99996	D;D	0.53619	0.961;0.961	P;P	0.51453	0.67;0.67	T	0.34279	-0.9835	10	0.87932	D	0	0.9492	6.752	0.23491	0.1744:0.7348:0.0:0.0909	.	64;106	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	G	64;106;64;64;106;106;64;40	ENSP00000356590:R106G;ENSP00000416712:R106G;ENSP00000391716:R40G	ENSP00000353471:R64G	R	+	1	2	AXDND1	177605778	0.879000	0.30193	0.432000	0.26747	0.923000	0.55619	1.441000	0.35035	0.605000	0.29947	0.453000	0.30009	CGA	.	.	.	none		0.438	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
CAPN13	92291	hgsc.bcm.edu	37	2	30987162	30987162	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:30987162A>G	ENST00000295055.8	-	6	711	c.535T>C	c.(535-537)Tcc>Ccc	p.S179P	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Missense_Mutation_p.S179P	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	179	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TCGGAATAGGATCCGAGCAGC	0.577																																					p.S179P		Atlas-SNP	.											.	CAPN13	70	.	0			c.T535C						PASS	.						50.0	51.0	51.0					2																	30987162		2104	4217	6321	SO:0001583	missense	92291	exon6			AATAGGATCCGAG		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.535T>C	chr2.hg19:g.30987162A>G	ENSP00000295055:p.Ser179Pro	102.0	0.0	.		136.0	55.0	.	NM_144575	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	hg19	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618329	0.66787	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.89552	-2.53;-2.53	5.22	5.22	0.72569	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	D	0.96439	0.8838	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97655	1.0157	10	0.72032	D	0.01	.	14.0703	0.64856	1.0:0.0:0.0:0.0	.	179	Q6MZZ7	CAN13_HUMAN	P	179	ENSP00000295055:S179P;ENSP00000431298:S179P	ENSP00000295055:S179P	S	-	1	0	CAPN13	30840666	1.000000	0.71417	0.951000	0.38953	0.450000	0.32258	4.956000	0.63645	1.970000	0.57323	0.379000	0.24179	TCC	.	.	.	none		0.577	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
XPO1	7514	hgsc.bcm.edu	37	2	61705989	61705989	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:61705989T>C	ENST00000401558.2	-	25	3909	c.3182A>G	c.(3181-3183)aAt>aGt	p.N1061S	RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.N1061S|XPO1_ENST00000404992.2_Missense_Mutation_p.N1061S|RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	1061					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			CTCATGTGGATTAAAGATGCC	0.393			Mis		CLL																																p.N1061S		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.A3182G						PASS	.						137.0	137.0	137.0					2																	61705989		2203	4300	6503	SO:0001583	missense	7514	exon25			TGTGGATTAAAGA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.3182A>G	chr2.hg19:g.61705989T>C	ENSP00000384863:p.Asn1061Ser	68.0	0.0	.		42.0	20.0	.	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	hg19	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.120462	0.77323	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.78007	0.4216	M	0.79258	2.445	0.58432	D	0.999996	D;D	0.76494	0.994;0.999	P;D	0.69307	0.888;0.963	T	0.76534	-0.2924	9	0.28530	T	0.3	-21.4772	15.9952	0.80234	0.0:0.0:0.0:1.0	.	708;1061	B3KWD0;O14980	.;XPO1_HUMAN	S	1061	.	ENSP00000384863:N1061S	N	-	2	0	XPO1	61559493	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.005000	0.88553	2.172000	0.68678	0.533000	0.62120	AAT	.	.	.	none		0.393	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
FAM161A	84140	hgsc.bcm.edu	37	2	62067237	62067237	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:62067237T>C	ENST00000405894.3	-	3	1003	c.902A>G	c.(901-903)aAg>aGg	p.K301R	FAM161A_ENST00000404929.1_Missense_Mutation_p.K301R	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	301					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TTCTTTTTGCTTGACTAAATC	0.418																																					p.K301R		Atlas-SNP	.											.	FAM161A	200	.	0			c.A902G						PASS	.						166.0	149.0	154.0					2																	62067237		1847	4095	5942	SO:0001583	missense	84140	exon3			TTTTGCTTGACTA		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.902A>G	chr2.hg19:g.62067237T>C	ENSP00000385893:p.Lys301Arg	67.0	0.0	.		46.0	21.0	.	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	hg19	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322375	0.41096	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.22336	1.96;1.96	5.41	4.26	0.50523	.	0.176973	0.44902	D	0.000408	T	0.22205	0.0535	L	0.52573	1.65	0.29380	N	0.863369	B;B	0.30563	0.285;0.074	B;B	0.34931	0.192;0.064	T	0.10314	-1.0635	10	0.44086	T	0.13	-18.3941	10.8689	0.46872	0.0:0.0746:0.0:0.9254	.	301;301	Q3B820;Q3B820-3	F161A_HUMAN;.	R	301	ENSP00000385158:K301R;ENSP00000385893:K301R	ENSP00000385158:K301R	K	-	2	0	FAM161A	61920741	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	2.205000	0.42770	0.884000	0.36064	0.533000	0.62120	AAG	.	.	.	none		0.418	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
RTKN	6242	hgsc.bcm.edu	37	2	74656034	74656034	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:74656034A>G	ENST00000233330.6	-	7	958	c.641T>C	c.(640-642)cTc>cCc	p.L214P	RTKN_ENST00000272430.5_Missense_Mutation_p.L264P|RTKN_ENST00000305557.5_Missense_Mutation_p.L251P	NM_001015056.1	NP_001015056.1			rhotekin											endometrium(3)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	16						TGCCAGGGTGAGTGTGGTGTG	0.552																																					p.L264P		Atlas-SNP	.											.	RTKN	80	.	0			c.T791C						PASS	.						192.0	128.0	150.0					2																	74656034		2203	4300	6503	SO:0001583	missense	6242	exon7			AGGGTGAGTGTGG	AF049227	CCDS1941.1, CCDS33226.1, CCDS42699.1	2p13.1	2013-01-10			ENSG00000114993	ENSG00000114993		"""Pleckstrin homology (PH) domain containing"""	10466	protein-coding gene	gene with protein product		602288				9073523, 10940294	Standard	XM_005264478		Approved	B5	uc002sle.3	Q9BST9	OTTHUMG00000129955	ENST00000233330.6:c.641T>C	chr2.hg19:g.74656034A>G	ENSP00000233330:p.Leu214Pro	249.0	0.0	.		232.0	68.0	.	NM_001015055		Missense_Mutation	SNP	ENST00000233330.6	hg19	CCDS42699.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.545730	0.86022	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	T;T;T	0.65178	-0.14;-0.14;-0.14	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81055	-0.1106	10	0.87932	D	0	.	13.6415	0.62253	1.0:0.0:0.0:0.0	.	264;251	Q9BST9;Q9BST9-2	RTKN_HUMAN;.	P	251;264;214	ENSP00000305298:L251P;ENSP00000272430:L264P;ENSP00000233330:L214P	ENSP00000233330:L214P	L	-	2	0	RTKN	74509542	1.000000	0.71417	0.991000	0.47740	0.971000	0.66376	8.673000	0.91186	2.128000	0.65567	0.459000	0.35465	CTC	.	.	.	none		0.552	RTKN-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328236.3	NM_001015055	
DNAH6	1768	hgsc.bcm.edu	37	2	84846836	84846836	+	Silent	SNP	T	T	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:84846836T>G	ENST00000237449.6	+	23	3608	c.3600T>G	c.(3598-3600)ctT>ctG	p.L1200L	DNAH6_ENST00000398278.2_Silent_p.L1200L|DNAH6_ENST00000389394.3_Silent_p.L1200L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1200	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ATGATGAACTTCTGGAGATTT	0.383																																					p.L1200L		Atlas-SNP	.											.	DNAH6	194	.	0			c.T3600G						PASS	.						138.0	114.0	121.0					2																	84846836		692	1591	2283	SO:0001819	synonymous_variant	1768	exon24			TGAACTTCTGGAG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3600T>G	chr2.hg19:g.84846836T>G		67.0	0.0	.		54.0	23.0	.	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.	.	none		0.383	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
NEB	4703	hgsc.bcm.edu	37	2	152390040	152390040	+	Intron	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:152390040G>T	ENST00000172853.10	-	115	16462				NEB_ENST00000397345.3_Silent_p.A7111A|NEB_ENST00000604864.1_Intron|NEB_ENST00000427231.2_Intron|NEB_ENST00000603639.1_Silent_p.A7111A|NEB_ENST00000409198.1_Intron			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GAAACATCTTGGCACTAGATT	0.413																																					p.A7146A		Atlas-SNP	.											.	NEB	1697	.	0			c.C21438A						PASS	.						182.0	146.0	157.0					2																	152390040		692	1591	2283	SO:0001627	intron_variant	4703	exon144			CATCTTGGCACTA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.16314+688C>A	chr2.hg19:g.152390040G>T		76.0	0.0	.		56.0	4.0	.	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	hg19																																																																																				.	.	.	none		0.413	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
AGPS	8540	hgsc.bcm.edu	37	2	178257747	178257747	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:178257747C>T	ENST00000264167.4	+	1	376	c.230C>T	c.(229-231)gCg>gTg	p.A77V	NFE2L2_ENST00000464747.1_5'Flank|AGPS_ENST00000409888.1_Missense_Mutation_p.A77V|AC074286.1_ENST00000397057.2_RNA	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	77					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			ACTCCCGCCGCGCAGGAGTCG	0.692																																					p.A77V		Atlas-SNP	.											.	AGPS	56	.	0			c.C230T						PASS	.						2.0	2.0	2.0					2																	178257747		1370	2704	4074	SO:0001583	missense	8540	exon1			CCGCCGCGCAGGA	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.230C>T	chr2.hg19:g.178257747C>T	ENSP00000264167:p.Ala77Val	51.0	0.0	.		53.0	31.0	.	NM_003659	A5D8U9|Q2TU35	Missense_Mutation	SNP	ENST00000264167.4	hg19	CCDS2275.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589519	0.66105	.	.	ENSG00000018510	ENST00000264167;ENST00000409888	D	0.97328	-4.34	4.57	3.7	0.42460	.	0.000000	0.45126	D	0.000391	D	0.91543	0.7329	L	0.38531	1.155	0.23751	N	0.996949	P	0.38745	0.645	B	0.22386	0.039	D	0.84254	0.0479	10	0.29301	T	0.29	.	9.702	0.40192	0.0:0.902:0.0:0.098	.	77	O00116	ADAS_HUMAN	V	77	ENSP00000264167:A77V	ENSP00000264167:A77V	A	+	2	0	AGPS	177965993	0.089000	0.21612	0.781000	0.31783	0.978000	0.69477	0.687000	0.25407	1.138000	0.42230	0.655000	0.94253	GCG	.	.	.	none		0.692	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
TTN	7273	hgsc.bcm.edu	37	2	179598544	179598545	+	Missense_Mutation	DNP	AC	AC	CA			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:179598544_179598545AC>CA	ENST00000591111.1	-	51	14844_14845	c.14620_14621GT>TG	c.(14620-14622)GTg>TGg	p.V4874W	TTN_ENST00000342992.6_Missense_Mutation_p.V3947W|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V5191W			Q8WZ42	TITIN_HUMAN	titin	12256	Ig-like 29.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGACCCTCTCACAGCAGCTTGC	0.426																																					p.V5191G|p.V5191L		Atlas-SNP	.											.	TTN	18412	.	0			c.T15572G|c.G15571T						PASS	.																																			SO:0001583	missense	7273	exon53			CCTCTCACAGCAG|CTCTCACAGCAGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.14620_14621delinsCA	chr2.hg19:g.179598544_179598545delinsCA	ENSP00000465570:p.Val4874Trp	154.0|156.0	0.0	.		151.0	66.0|65.0	.	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19																																																																																				.	.	.	none		0.426	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FSIP2	401024	hgsc.bcm.edu	37	2	186672719	186672719	+	Missense_Mutation	SNP	T	T	C	rs377239551		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:186672719T>C	ENST00000424728.1	+	17	18686	c.18686T>C	c.(18685-18687)aTt>aCt	p.I6229T	FSIP2_ENST00000343098.5_Missense_Mutation_p.I6318T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6229										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAAAGTAAGATTAAACTTGTA	0.308																																					p.I6318T		Atlas-SNP	.											.	FSIP2	251	.	0			c.T18953C						PASS	.	T	THR/ILE	0,3640		0,0,1820	32.0	29.0	30.0		18953	5.1	1.0	2		30	1,8109		0,1,4054	no	missense	FSIP2	NM_173651.2	89	0,1,5874	CC,CT,TT		0.0123,0.0,0.0085	probably-damaging	6318/6997	186672719	1,11749	1820	4055	5875	SO:0001583	missense	401024	exon17			GTAAGATTAAACT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18686T>C	chr2.hg19:g.186672719T>C	ENSP00000401306:p.Ile6229Thr	111.0	0.0	.		152.0	14.0	.	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.95	2.984130	0.53827	0.0	1.23E-4	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.60797	0.16;0.16	5.07	5.07	0.68467	.	0.235594	0.29737	N	0.011328	T	0.61825	0.2378	L	0.52011	1.625	0.34264	D	0.680189	.	.	.	.	.	.	T	0.74544	-0.3630	8	0.72032	D	0.01	.	11.132	0.48351	0.0:0.0:0.0:1.0	.	.	.	.	T	6318;6229	ENSP00000344403:I6318T;ENSP00000401306:I6229T	ENSP00000344403:I6318T	I	+	2	0	FSIP2	186380964	1.000000	0.71417	0.983000	0.44433	0.928000	0.56348	3.872000	0.56085	2.130000	0.65690	0.397000	0.26171	ATT	.	.	.	weak		0.308	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
SF3B1	23451	hgsc.bcm.edu	37	2	198265131	198265131	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr2:198265131T>C	ENST00000335508.6	-	19	2837	c.2746A>G	c.(2746-2748)Aca>Gca	p.T916A	SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	916					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTAACCACTGTGCCAAAGCCG	0.358			Mis		myelodysplastic syndrome																																p.T916A		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.A2746G						PASS	.						97.0	95.0	95.0					2																	198265131		2203	4300	6503	SO:0001583	missense	23451	exon19			CCACTGTGCCAAA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2746A>G	chr2.hg19:g.198265131T>C	ENSP00000335321:p.Thr916Ala	178.0	0.0	.		176.0	77.0	.	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.851230	0.51270	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	L	0.48174	1.505	0.80722	D	1	B	0.14012	0.009	B	0.21360	0.034	T	0.51903	-0.8646	9	0.29301	T	0.29	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	916	O75533	SF3B1_HUMAN	A	916	.	ENSP00000335321:T916A	T	-	1	0	SF3B1	197973376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.910000	0.87451	2.371000	0.80710	0.533000	0.62120	ACA	.	.	.	none		0.358	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SCN11A	11280	hgsc.bcm.edu	37	3	38966961	38966961	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr3:38966961C>G	ENST00000302328.3	-	5	855	c.657G>C	c.(655-657)ttG>ttC	p.L219F	SCN11A_ENST00000444237.2_Missense_Mutation_p.L219F|SCN11A_ENST00000450244.1_Missense_Mutation_p.L219F|SCN11A_ENST00000456224.3_Missense_Mutation_p.L219F	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	219					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TACGCAGGGGCAATAGTTTGA	0.463																																					p.L219F		Atlas-SNP	.											.	SCN11A	296	.	0			c.G657C						PASS	.						162.0	136.0	145.0					3																	38966961		2203	4300	6503	SO:0001583	missense	11280	exon5			CAGGGGCAATAGT	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.657G>C	chr3.hg19:g.38966961C>G	ENSP00000307599:p.Leu219Phe	132.0	0.0	.		141.0	53.0	.	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	hg19	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808991	0.50421	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37	4.79	-4.0	0.04057	Ion transport (1);	0.225617	0.39210	N	0.001423	D	0.94515	0.8234	L	0.55481	1.735	0.09310	N	1	P	0.50819	0.939	P	0.49192	0.602	D	0.89878	0.4028	10	0.87932	D	0	.	5.7293	0.18030	0.0:0.2152:0.3973:0.3874	.	219	Q9UI33	SCNBA_HUMAN	F	219	ENSP00000307599:L219F;ENSP00000400945:L219F;ENSP00000416757:L219F;ENSP00000408028:L219F	ENSP00000307599:L219F	L	-	3	2	SCN11A	38941965	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	-1.047000	0.03521	-0.513000	0.06496	0.467000	0.42956	TTG	.	.	.	none		0.463	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
PLXNB1	5364	hgsc.bcm.edu	37	3	48465285	48465285	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr3:48465285C>T	ENST00000358536.4	-	3	1005	c.736G>A	c.(736-738)Gcc>Acc	p.A246T	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Missense_Mutation_p.A246T|PLXNB1_ENST00000456774.1_Missense_Mutation_p.A246T|PLXNB1_ENST00000296440.6_Missense_Mutation_p.A246T	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	246	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GATACATAGGCACGAAAAGCT	0.607																																					p.A246T		Atlas-SNP	.											.	PLXNB1	150	.	0			c.G736A						PASS	.						62.0	58.0	59.0					3																	48465285		2202	4300	6502	SO:0001583	missense	5364	exon3			CATAGGCACGAAA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.736G>A	chr3.hg19:g.48465285C>T	ENSP00000351338:p.Ala246Thr	218.0	0.0	.		188.0	81.0	.	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	hg19	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.836487	0.00579	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.02944	4.1;4.1;4.1;4.1	4.41	2.58	0.30949	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.176749	0.38436	N	0.001699	T	0.00666	0.0022	N	0.00201	-1.865	0.80722	D	1	B;B	0.12013	0.001;0.005	B;B	0.10450	0.005;0.004	T	0.41324	-0.9515	10	0.07325	T	0.83	.	4.5893	0.12299	0.0:0.2937:0.3661:0.3403	.	246;246	O43157;O43157-2	PLXB1_HUMAN;.	T	246	ENSP00000296440:A246T;ENSP00000351242:A246T;ENSP00000351338:A246T;ENSP00000414199:A246T	ENSP00000296440:A246T	A	-	1	0	PLXNB1	48440289	0.995000	0.38212	0.188000	0.23233	0.006000	0.05464	2.590000	0.46154	0.308000	0.22923	-0.229000	0.12294	GCC	.	.	.	none		0.607	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
NISCH	11188	hgsc.bcm.edu	37	3	52505969	52505969	+	Silent	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr3:52505969C>T	ENST00000479054.1	+	6	621	c.549C>T	c.(547-549)ttC>ttT	p.F183F	NISCH_ENST00000420808.2_Silent_p.F183F|NISCH_ENST00000345716.4_Silent_p.F183F|NISCH_ENST00000488380.1_Silent_p.F183F			Q9Y2I1	NISCH_HUMAN	nischarin	183	Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TCCTGGACTTCACCTGTCGCC	0.632											OREG0015615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F183F		Atlas-SNP	.											.	NISCH	97	.	0			c.C549T						PASS	.						59.0	60.0	60.0					3																	52505969		2203	4300	6503	SO:0001819	synonymous_variant	11188	exon5			GGACTTCACCTGT	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.549C>T	chr3.hg19:g.52505969C>T		323.0	0.0	.	985	284.0	18.0	.	NM_001276293	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	ENST00000479054.1	hg19	CCDS33767.1																																																																																			.	.	.	none		0.632	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
SKIL	6498	hgsc.bcm.edu	37	3	170078913	170078913	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr3:170078913A>T	ENST00000458537.3	+	1	1503	c.794A>T	c.(793-795)gAg>gTg	p.E265V	SKIL_ENST00000259119.4_Missense_Mutation_p.E265V|SKIL_ENST00000413427.2_Missense_Mutation_p.E265V|SKIL_ENST00000426052.2_Missense_Mutation_p.E245V	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	265					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TTTGAAGTGGAGCATGAATGC	0.453																																					p.E265V		Atlas-SNP	.											.	SKIL	67	.	0			c.A794T						PASS	.						147.0	129.0	135.0					3																	170078913		2203	4300	6503	SO:0001583	missense	6498	exon1			AAGTGGAGCATGA	X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.794A>T	chr3.hg19:g.170078913A>T	ENSP00000415243:p.Glu265Val	187.0	0.0	.		190.0	66.0	.	NM_001248008	A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	ENST00000458537.3	hg19	CCDS33890.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.312956	0.60414	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.91464	-2.85;-2.85;-2.83;-2.85	5.51	5.51	0.81932	SAND domain-like (2);c-SKI Smad4-binding (1);	0.221987	0.48286	D	0.000184	D	0.92038	0.7477	L	0.33485	1.01	0.52099	D	0.999943	D;D	0.89917	0.998;1.0	D;D	0.97110	0.969;1.0	D	0.90522	0.4489	10	0.25751	T	0.34	-22.9066	15.6712	0.77279	1.0:0.0:0.0:0.0	.	265;265	P12757-3;P12757	.;SKIL_HUMAN	V	265;245;265;265	ENSP00000259119:E265V;ENSP00000406520:E245V;ENSP00000400193:E265V;ENSP00000415243:E265V	ENSP00000259119:E265V	E	+	2	0	SKIL	171561607	1.000000	0.71417	1.000000	0.80357	0.454000	0.32378	8.962000	0.93254	2.111000	0.64477	0.524000	0.50904	GAG	.	.	.	none		0.453	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352351.4	NM_005414	
RUFY3	22902	hgsc.bcm.edu	37	4	71629308	71629308	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr4:71629308G>A	ENST00000226328.4	+	3	955	c.392G>A	c.(391-393)gGg>gAg	p.G131E	RUFY3_ENST00000536664.1_Missense_Mutation_p.G115E|RUFY3_ENST00000381006.3_Missense_Mutation_p.G131E|RUFY3_ENST00000417478.2_Missense_Mutation_p.G191E|RUFY3_ENST00000502653.1_Missense_Mutation_p.G78E	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	131	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TCCTTCTGGGGGCCTCTAGAA	0.368																																					p.G191E		Atlas-SNP	.											.	RUFY3	61	.	0			c.G572A						PASS	.						37.0	41.0	40.0					4																	71629308		2195	4298	6493	SO:0001583	missense	22902	exon3			TCTGGGGGCCTCT	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.392G>A	chr4.hg19:g.71629308G>A	ENSP00000226328:p.Gly131Glu	184.0	0.0	.		104.0	50.0	.	NM_001130709	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	hg19	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907015	0.92107	.	.	ENSG00000018189	ENST00000503876;ENST00000417478;ENST00000381006;ENST00000226328;ENST00000536664;ENST00000513597;ENST00000502653	T;T;T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75;2.75;2.75	5.13	5.13	0.70059	RUN (2);	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	M	0.64997	1.995	0.80722	D	1	D;P;B;P	0.59767	0.986;0.498;0.397;0.956	D;P;P;D	0.76071	0.987;0.744;0.679;0.95	T	0.02093	-1.1215	10	0.72032	D	0.01	-9.749	18.944	0.92615	0.0:0.0:1.0:0.0	.	115;131;131;191	B4DKC2;Q7L099-3;Q7L099;Q7L099-2	.;.;RUFY3_HUMAN;.	E	67;191;131;131;115;67;78	ENSP00000426734:G67E;ENSP00000399771:G191E;ENSP00000370394:G131E;ENSP00000226328:G131E;ENSP00000443652:G115E;ENSP00000425574:G67E;ENSP00000425400:G78E	ENSP00000226328:G131E	G	+	2	0	RUFY3	71848172	1.000000	0.71417	0.979000	0.43373	0.957000	0.61999	9.744000	0.98853	2.569000	0.86673	0.591000	0.81541	GGG	.	.	.	none		0.368	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
NSUN2	54888	hgsc.bcm.edu	37	5	6600168	6600168	+	Silent	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr5:6600168G>A	ENST00000264670.6	-	19	2486	c.2175C>T	c.(2173-2175)acC>acT	p.T725T	NSUN2_ENST00000506139.1_Silent_p.T690T|NSUN2_ENST00000539938.1_Silent_p.T489T	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	725					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CTGGCTGTCCGGTGCTGGCTG	0.537																																					p.T725T		Atlas-SNP	.											.	NSUN2	82	.	0			c.C2175T						PASS	.						182.0	148.0	160.0					5																	6600168		2203	4300	6503	SO:0001819	synonymous_variant	54888	exon19			CTGTCCGGTGCTG	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.2175C>T	chr5.hg19:g.6600168G>A		125.0	0.0	.		146.0	64.0	.	NM_017755	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	hg19	CCDS3869.1																																																																																			.	.	.	none		0.537	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
FASTKD3	79072	hgsc.bcm.edu	37	5	7867451	7867451	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr5:7867451T>C	ENST00000264669.5	-	2	882	c.746A>G	c.(745-747)gAa>gGa	p.E249G	MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000264668.2_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	249					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGTAAATGTTTCCAATTTTTC	0.368																																					p.E249G		Atlas-SNP	.											.	FASTKD3	88	.	0			c.A746G						PASS	.						80.0	85.0	83.0					5																	7867451		2203	4300	6503	SO:0001583	missense	79072	exon2			AATGTTTCCAATT	AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.746A>G	chr5.hg19:g.7867451T>C	ENSP00000264669:p.Glu249Gly	31.0	0.0	.		32.0	11.0	.	NM_024091	Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	hg19	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.275390	0.59649	.	.	ENSG00000124279	ENST00000264669	T	0.29142	1.58	4.85	3.65	0.41850	.	0.369914	0.32055	N	0.006643	T	0.31327	0.0793	M	0.72118	2.19	0.23421	N	0.997719	P	0.40144	0.704	B	0.36719	0.231	T	0.14531	-1.0469	10	0.38643	T	0.18	-20.1472	11.6008	0.51001	0.0:0.0:0.1494:0.8506	.	249	Q14CZ7	FAKD3_HUMAN	G	249	ENSP00000264669:E249G	ENSP00000264669:E249G	E	-	2	0	FASTKD3	7920451	0.203000	0.23435	0.094000	0.20943	0.730000	0.41778	2.603000	0.46266	0.835000	0.34877	0.528000	0.53228	GAA	.	.	.	none		0.368	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60840060	60840060	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr5:60840060G>T	ENST00000252744.5	+	14	3564	c.3564G>T	c.(3562-3564)caG>caT	p.Q1188H		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	1188					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						GACACATTCAGTTTACACAGT	0.423																																					p.Q1188H		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.G3564T						PASS	.						106.0	92.0	96.0					5																	60840060		692	1591	2283	SO:0001583	missense	57688	exon14			CATTCAGTTTACA	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.3564G>T	chr5.hg19:g.60840060G>T	ENSP00000252744:p.Gln1188His	136.0	0.0	.		138.0	50.0	.	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	-	14.72	2.620938	0.46736	.	.	ENSG00000130449	ENST00000252744	T	0.55930	0.49	4.46	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.71324	0.3326	M	0.71581	2.175	0.58432	D	0.999998	D	0.89917	1.0	D	0.77557	0.99	T	0.74396	-0.3679	10	0.54805	T	0.06	-8.3871	16.9712	0.86300	0.0:0.0:1.0:0.0	.	1188	Q9HCJ5	ZSWM6_HUMAN	H	1188	ENSP00000252744:Q1188H	ENSP00000252744:Q1188H	Q	+	3	2	ZSWIM6	60875817	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.204000	0.95041	2.350000	0.79820	0.544000	0.68410	CAG	.	.	.	none		0.423	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
DXO	1797	hgsc.bcm.edu	37	6	31938842	31938842	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr6:31938842C>T	ENST00000375349.3	-	3	850	c.439G>A	c.(439-441)Gag>Aag	p.E147K	DXO_ENST00000478221.1_5'UTR|DXO_ENST00000375356.3_Missense_Mutation_p.E147K|STK19_ENST00000375331.2_5'Flank|DXO_ENST00000337523.5_Missense_Mutation_p.E147K|STK19_ENST00000375333.2_5'Flank			O77932	DXO_HUMAN	decapping exoribonuclease	147					metabolic process (GO:0008152)|mRNA catabolic process (GO:0006402)|nuclear mRNA surveillance (GO:0071028)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA destabilization (GO:0050779)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|magnesium ion binding (GO:0000287)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA pyrophosphohydrolase activity (GO:0034353)										TGCCAGCCCTCCTGCCGCTCA	0.642																																					p.E147K		Atlas-SNP	.											.	DOM3Z	20	.	0			c.G439A						PASS	.						81.0	91.0	88.0					6																	31938842		1508	2708	4216	SO:0001583	missense	1797	exon3			AGCCCTCCTGCCG	AF059252	CCDS4732.1	6p21.3	2013-09-11	2013-09-11	2013-09-11	ENSG00000204348	ENSG00000204348			2992	protein-coding gene	gene with protein product		605996	"""DOM-3 (C. elegans) homolog Z"", ""dom-3 homolog Z (C. elegans)"""	DOM3Z		9799600, 23523372	Standard	NM_005510		Approved		uc003nyp.1	O77932	OTTHUMG00000031272	ENST00000375349.3:c.439G>A	chr6.hg19:g.31938842C>T	ENSP00000364498:p.Glu147Lys	90.0	0.0	.		88.0	34.0	.	NM_005510	A2CER3|B0UZ80|O15004|O78127|O78128|Q5ST60|Q6IPZ2|Q9NPK4	Missense_Mutation	SNP	ENST00000375349.3	hg19	CCDS4732.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568158	0.86439	.	.	ENSG00000204348	ENST00000337523;ENST00000375349;ENST00000375356	T;T;T	0.19532	2.14;2.14;2.14	4.91	4.03	0.46877	.	0.054459	0.64402	D	0.000001	T	0.24547	0.0595	L	0.53249	1.67	0.49483	D	0.999795	P;D	0.76494	0.951;0.999	P;P	0.62298	0.487;0.9	T	0.01591	-1.1317	10	0.29301	T	0.29	-10.6299	14.2192	0.65815	0.0:0.849:0.151:0.0	.	147;147	F8WC68;O77932	.;DOM3Z_HUMAN	K	147	ENSP00000337759:E147K;ENSP00000364498:E147K;ENSP00000364505:E147K	ENSP00000337759:E147K	E	-	1	0	DOM3Z	32046821	1.000000	0.71417	0.983000	0.44433	0.793000	0.44817	7.160000	0.77495	1.266000	0.44231	-0.305000	0.09177	GAG	.	.	.	none		0.642	DXO-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076592.3		
PGK2	5232	hgsc.bcm.edu	37	6	49753793	49753793	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr6:49753793C>G	ENST00000304801.3	-	1	1260	c.1108G>C	c.(1108-1110)Gtt>Ctt	p.V370L		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	370					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CCCCCTATAACAGTGATGCAG	0.498																																					p.V370L		Atlas-SNP	.											.	PGK2	87	.	0			c.G1108C						PASS	.						155.0	152.0	153.0					6																	49753793		2203	4300	6503	SO:0001583	missense	5232	exon1			CTATAACAGTGAT	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1108G>C	chr6.hg19:g.49753793C>G	ENSP00000305995:p.Val370Leu	195.0	0.0	.		189.0	53.0	.	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	hg19	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243598	0.39697	.	.	ENSG00000170950	ENST00000304801	D	0.93712	-3.27	4.81	2.39	0.29439	Phosphoglycerate kinase, C-terminal (1);	0.100392	0.64402	D	0.000003	D	0.84347	0.5452	L	0.56199	1.76	0.22719	N	0.998819	B	0.14805	0.011	B	0.28553	0.091	T	0.79105	-0.1940	10	0.87932	D	0	-12.902	7.2513	0.26150	0.0:0.2024:0.0:0.7976	.	370	P07205	PGK2_HUMAN	L	370	ENSP00000305995:V370L	ENSP00000305995:V370L	V	-	1	0	PGK2	49861752	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	3.605000	0.54088	0.407000	0.25591	-0.295000	0.09555	GTT	.	.	.	none		0.498	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
GIGYF1	64599	hgsc.bcm.edu	37	7	100279805	100279805	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr7:100279805C>T	ENST00000275732.5	-	22	4024	c.2815G>A	c.(2815-2817)Gat>Aat	p.D939N	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	939					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CGGATATAATCGTGGACATCA	0.597																																					p.D939N		Atlas-SNP	.											.	GIGYF1	113	.	0			c.G2815A						PASS	.						74.0	79.0	77.0					7																	100279805		2203	4300	6503	SO:0001583	missense	64599	exon22			TATAATCGTGGAC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.2815G>A	chr7.hg19:g.100279805C>T	ENSP00000275732:p.Asp939Asn	50.0	0.0	.		81.0	5.0	.	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	hg19	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	17.25	3.341351	0.60963	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	D	0.84223	-1.82	5.14	5.14	0.70334	.	0.053328	0.64402	D	0.000001	T	0.78748	0.4332	L	0.59912	1.85	0.51482	D	0.999924	P	0.47409	0.895	B	0.25506	0.061	D	0.83414	0.0029	10	0.59425	D	0.04	-21.0708	16.146	0.81569	0.0:1.0:0.0:0.0	.	939	O75420	PERQ1_HUMAN	N	658;939	ENSP00000275732:D939N	ENSP00000275732:D939N	D	-	1	0	GIGYF1	100117741	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.780000	0.62382	2.672000	0.90937	0.555000	0.69702	GAT	.	.	.	none		0.597	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
FOXP2	93986	hgsc.bcm.edu	37	7	114302186	114302186	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr7:114302186G>A	ENST00000393494.2	+	14	1993	c.1714G>A	c.(1714-1716)Gta>Ata	p.V572I	FOXP2_ENST00000393498.2_Missense_Mutation_p.V551I|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000408937.3_Missense_Mutation_p.V597I|FOXP2_ENST00000350908.4_Missense_Mutation_p.V572I|FOXP2_ENST00000393489.3_Missense_Mutation_p.V480I|FOXP2_ENST00000403559.4_Missense_Mutation_p.V589I|FOXP2_ENST00000393491.3_Missense_Mutation_p.V387I			O15409	FOXP2_HUMAN	forkhead box P2	572					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TAAAGGAGCAGTATGGACTGT	0.393																																					p.V597I		Atlas-SNP	.											.	FOXP2	133	.	0			c.G1789A						PASS	.						139.0	129.0	133.0					7																	114302186		2203	4300	6503	SO:0001583	missense	93986	exon15			GGAGCAGTATGGA	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1714G>A	chr7.hg19:g.114302186G>A	ENSP00000377132:p.Val572Ile	157.0	0.0	.		245.0	53.0	.	NM_148898	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	hg19	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967741	0.74131	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71;-3.71;-3.71	5.65	5.65	0.86999	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.97692	0.9243	M	0.76838	2.35	0.80722	D	1	P;P;D;P;P	0.67145	0.92;0.92;0.996;0.92;0.902	D;D;D;D;D	0.70227	0.935;0.956;0.968;0.935;0.927	D	0.97929	1.0319	10	0.87932	D	0	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	571;589;387;572;597	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	I	572;597;589;572;549;480;387	ENSP00000377132:V572I;ENSP00000386200:V597I;ENSP00000385069:V589I;ENSP00000265436:V572I;ENSP00000377129:V480I;ENSP00000377130:V387I	ENSP00000265436:V572I	V	+	1	0	FOXP2	114089422	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.813000	0.99286	2.824000	0.97209	0.655000	0.94253	GTA	.	.	.	none		0.393	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
MET	4233	hgsc.bcm.edu	37	7	116415114	116415115	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr7:116415114_116415115GT>AG	ENST00000318493.6	+	15	3449_3450	c.3262_3263GT>AG	c.(3262-3264)GTg>AGg	p.V1088R	MET_ENST00000397752.3_Missense_Mutation_p.V1070R|MET_ENST00000539704.1_5'Flank			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V1088E(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GCAGCATGTAGTGATTGGGCCC	0.431			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.V1088M|p.V1088G		Atlas-SNP	.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.|MET,NS,carcinoma,0,1	MET	412	.	1	Substitution - Missense(1)	kidney(1)	c.G3262A|c.T3263G						PASS	.																																			SO:0001583	missense	4233	exon15	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	CATGTAGTGATTG|ATGTAGTGATTGG	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	Exception_encountered	chr7.hg19:g.116415114_116415115delinsAG	ENSP00000317272:p.Val1088Arg	133.0|132.0	0.0	.		205.0|202.0	127.0|125.0	.	NM_001127500	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	hg19	CCDS47689.1																																																																																			.	.	.	none		0.431	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
AASS	10157	hgsc.bcm.edu	37	7	121717970	121717971	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr7:121717970_121717971CA>AG	ENST00000393376.1	-	22	2678_2679	c.2583_2584TG>CT	c.(2581-2586)taTGgg>taCTgg	p.G862W	AASS_ENST00000473553.1_5'UTR|AASS_ENST00000417368.2_Missense_Mutation_p.G862W			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	862	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TTGATGTCCCCATAAGCCACAA	0.436																																					p.G862W|p.Y861Y		Atlas-SNP	.											.	AASS	123	.	0			c.G2584T|c.T2583C						PASS	.																																			SO:0001583	missense	10157	exon23			TGTCCCCATAAGC|GTCCCCATAAGCC	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2583_2584delinsAG	chr7.hg19:g.121717970_121717971delinsAG	ENSP00000377040:p.Gly862Trp	143.0|145.0	0.0	.		222.0	21.0	.	NM_005763	O95462	Missense_Mutation|Silent	SNP	ENST00000393376.1	hg19	CCDS5783.1																																																																																			.	.	.	none		0.436	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
KIAA1549	57670	hgsc.bcm.edu	37	7	138566237	138566237	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr7:138566237G>T	ENST00000422774.1	-	11	4174	c.4126C>A	c.(4126-4128)Cca>Aca	p.P1376T	KIAA1549_ENST00000242365.4_Missense_Mutation_p.P1326T|KIAA1549_ENST00000440172.1_Missense_Mutation_p.P1376T			Q9HCM3	K1549_HUMAN	KIAA1549	1376						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CCTGGCAGTGGCGCTGGCTCA	0.512			O	BRAF	pilocytic astrocytoma																																p.P1376T	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.C4126A						PASS	.						115.0	121.0	119.0					7																	138566237		2083	4214	6297	SO:0001583	missense	57670	exon11			GCAGTGGCGCTGG		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.4126C>A	chr7.hg19:g.138566237G>T	ENSP00000416040:p.Pro1376Thr	196.0	0.0	.		259.0	71.0	.	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	hg19	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101871	0.76983	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.25912	1.77;1.77;1.79	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.51227	0.1662	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	T	0.38067	-0.9678	10	0.41790	T	0.15	.	18.5236	0.90963	0.0:0.0:1.0:0.0	.	1376;160;1376;160	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	T	1376;1326;1376	ENSP00000406661:P1376T;ENSP00000242365:P1326T;ENSP00000416040:P1376T	ENSP00000242365:P1326T	P	-	1	0	KIAA1549	138216777	1.000000	0.71417	0.686000	0.30086	0.849000	0.48306	7.124000	0.77185	2.716000	0.92895	0.655000	0.94253	CCA	.	.	.	none		0.512	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
ANK1	286	hgsc.bcm.edu	37	8	41547822	41547822	+	Silent	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr8:41547822G>A	ENST00000347528.4	-	33	4110	c.4027C>T	c.(4027-4029)Ctg>Ttg	p.L1343L	ANK1_ENST00000265709.8_Silent_p.L1384L|ANK1_ENST00000289734.7_Silent_p.L1343L|ANK1_ENST00000396942.1_Silent_p.L1343L|ANK1_ENST00000396945.1_Silent_p.L1343L|ANK1_ENST00000352337.4_Silent_p.L1343L|ANK1_ENST00000379758.2_Silent_p.L1343L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1343	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCCTTGCGCAGAAACGACAGG	0.597																																					p.L1384L		Atlas-SNP	.											.	ANK1	497	.	0			c.C4150T						PASS	.						133.0	112.0	119.0					8																	41547822		2203	4300	6503	SO:0001819	synonymous_variant	286	exon34			TGCGCAGAAACGA	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4027C>T	chr8.hg19:g.41547822G>A		146.0	0.0	.		136.0	57.0	.	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	hg19	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	8.890	0.953747	0.18431	.	.	ENSG00000029534	ENST00000520299	.	.	.	5.08	4.2	0.49525	.	.	.	.	.	T	0.55210	0.1906	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52734	-0.8536	4	.	.	.	.	6.0089	0.19562	0.1621:0.0:0.6843:0.1536	.	.	.	.	F	664	.	.	S	-	2	0	ANK1	41666979	1.000000	0.71417	0.884000	0.34674	0.838000	0.47535	1.678000	0.37586	1.352000	0.45808	0.563000	0.77884	TCT	.	.	.	none		0.597	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ZBTB10	65986	hgsc.bcm.edu	37	8	81412103	81412103	+	Silent	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr8:81412103T>C	ENST00000430430.1	+	3	2126	c.1347T>C	c.(1345-1347)agT>agC	p.S449S	ZBTB10_ENST00000455036.3_Silent_p.S449S|ZBTB10_ENST00000426744.2_Silent_p.S449S|ZBTB10_ENST00000379091.4_Silent_p.S157S	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TTCAAATGAGTGAAGTTGTTC	0.373																																					p.S449S		Atlas-SNP	.											.	ZBTB10	51	.	0			c.T1347C						PASS	.						88.0	81.0	83.0					8																	81412103		1826	4092	5918	SO:0001819	synonymous_variant	65986	exon2			AATGAGTGAAGTT	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1347T>C	chr8.hg19:g.81412103T>C		83.0	0.0	.		67.0	21.0	.	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Silent	SNP	ENST00000430430.1	hg19	CCDS47880.1																																																																																			.	.	.	none		0.373	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
JAK2	3717	hgsc.bcm.edu	37	9	5078361	5078361	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr9:5078361G>T	ENST00000381652.3	+	16	2542	c.2048G>T	c.(2047-2049)aGa>aTa	p.R683I	JAK2_ENST00000539801.1_Missense_Mutation_p.R683I|JAK2_ENST00000544510.1_Missense_Mutation_p.R534I|AL161450.1_ENST00000601793.1_Intron	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	683	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)	p.R683T(2)|p.I682_R683insTG(1)|p.R683K(1)|p.I682_D686>(1)	BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTGCTTATCAGAGAAGAAGAC	0.363		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.R683I		Atlas-SNP	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	JAK2,colon,carcinoma,-1,3	JAK2	35466	.	5	Substitution - Missense(3)|Insertion - In frame(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)	c.G2048T						PASS	.						149.0	163.0	158.0					9																	5078361		2203	4300	6503	SO:0001583	missense	3717	exon16	Familial Cancer Database		TTATCAGAGAAGA		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.2048G>T	chr9.hg19:g.5078361G>T	ENSP00000371067:p.Arg683Ile	66.0	1.0	.		71.0	25.0	.	NM_004972	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	hg19	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	G	32	5.158488	0.94686	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	D;D;D	0.83163	-1.69;-1.69;-1.69	5.55	5.55	0.83447	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92381	0.7582	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92930	0.6363	10	0.87932	D	0	-24.9121	19.4912	0.95050	0.0:0.0:1.0:0.0	.	683	O60674	JAK2_HUMAN	I	683;683;534	ENSP00000440387:R683I;ENSP00000371067:R683I;ENSP00000443103:R534I	ENSP00000371067:R683I	R	+	2	0	JAK2	5068361	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.371000	0.97162	2.771000	0.95319	0.561000	0.74099	AGA	.	.	.	none		0.363	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
DDX58	23586	hgsc.bcm.edu	37	9	32459420	32459420	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr9:32459420G>T	ENST00000379883.2	-	17	2587	c.2430C>A	c.(2428-2430)tgC>tgA	p.C810*	DDX58_ENST00000379882.1_Nonsense_Mutation_p.C765*|DDX58_ENST00000542096.1_Nonsense_Mutation_p.C739*|DDX58_ENST00000379868.1_Nonsense_Mutation_p.C607*	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	810	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TGCACTTTCTGCAGAGCAGTT	0.388																																					p.C810X		Atlas-SNP	.											.	DDX58	82	.	0			c.C2430A						PASS	.						184.0	166.0	172.0					9																	32459420		2203	4300	6503	SO:0001587	stop_gained	23586	exon17			CTTTCTGCAGAGC	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2430C>A	chr9.hg19:g.32459420G>T	ENSP00000369213:p.Cys810*	57.0	0.0	.		47.0	4.0	.	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Nonsense_Mutation	SNP	ENST00000379883.2	hg19	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	G	38	7.254024	0.98168	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	.	.	.	4.79	-0.4	0.12411	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0038	9.3509	0.38138	0.719:0.0:0.281:0.0	.	.	.	.	X	765;810;607;739	.	ENSP00000369197:C607X	C	-	3	2	DDX58	32449420	0.540000	0.26410	0.928000	0.36995	0.005000	0.04900	0.443000	0.21644	0.069000	0.16605	0.655000	0.94253	TGC	.	.	.	none		0.388	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
VPS13A	23230	hgsc.bcm.edu	37	9	79820297	79820297	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr9:79820297A>G	ENST00000360280.3	+	4	516	c.256A>G	c.(256-258)Att>Gtt	p.I86V	VPS13A_ENST00000376636.3_Missense_Mutation_p.I86V|VPS13A_ENST00000357409.5_Missense_Mutation_p.I86V|VPS13A_ENST00000376634.4_Missense_Mutation_p.I86V	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	86					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATTGGAAGAAATTTATTTACT	0.229																																					p.I86V		Atlas-SNP	.											.	VPS13A	735	.	0			c.A256G						PASS	.						38.0	44.0	42.0					9																	79820297		2194	4279	6473	SO:0001583	missense	23230	exon4			GAAGAAATTTATT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.256A>G	chr9.hg19:g.79820297A>G	ENSP00000353422:p.Ile86Val	59.0	0.0	.		55.0	34.0	.	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	hg19	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	A	8.130	0.782854	0.16189	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.62	4.48	0.54585	.	0.063343	0.64402	D	0.000008	T	0.55593	0.1930	N	0.04880	-0.145	0.80722	D	1	B;B;B;B	0.24882	0.012;0.113;0.046;0.046	B;B;B;B	0.25614	0.018;0.062;0.027;0.027	T	0.51980	-0.8636	10	0.02654	T	1	.	7.951	0.30014	0.7743:0.0:0.2257:0.0	.	86;86;86;86	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	V	86	ENSP00000365821:I86V;ENSP00000365823:I86V;ENSP00000353422:I86V;ENSP00000349985:I86V	ENSP00000349985:I86V	I	+	1	0	VPS13A	79010117	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.485000	0.60279	0.952000	0.37798	0.477000	0.44152	ATT	.	.	.	none		0.229	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
CTSV	1515	hgsc.bcm.edu	37	9	99799669	99799669	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr9:99799669T>G	ENST00000259470.5	-	4	510	c.261A>C	c.(259-261)gaA>gaC	p.E87D	CTSV_ENST00000479932.1_5'UTR|CTSV_ENST00000538255.1_Missense_Mutation_p.E87D	NM_001333.3	NP_001324.2	O60911	CATL2_HUMAN	cathepsin V	87					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic cell death (GO:0048102)|catagen (GO:0042637)|cellular response to starvation (GO:0009267)|decidualization (GO:0046697)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|multicellular organismal aging (GO:0010259)|negative regulation of keratinocyte proliferation (GO:0010839)|nerve development (GO:0021675)|protein autoprocessing (GO:0016540)|regulation of actin cytoskeleton reorganization (GO:2000249)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to gonadotropin (GO:0034698)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	aminopeptidase activity (GO:0004177)|cysteine-type carboxypeptidase activity (GO:0016807)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptide binding (GO:0042277)										TCTGCCTGAATTCTTCATTGG	0.418																																					p.E87D		Atlas-SNP	.											.	CTSL2	40	.	0			c.A261C						PASS	.						100.0	100.0	100.0					9																	99799669		2203	4300	6503	SO:0001583	missense	1515	exon4			CCTGAATTCTTCA	Y14734	CCDS6723.1	9q22.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000136943	ENSG00000136943		"""Cathepsins"""	2538	protein-coding gene	gene with protein product		603308	"""cathepsin L2"""	CTSL2		9563472, 10029531	Standard	NM_001201575		Approved	CTSU	uc004awt.3	O60911	OTTHUMG00000020314	ENST00000259470.5:c.261A>C	chr9.hg19:g.99799669T>G	ENSP00000259470:p.Glu87Asp	108.0	0.0	.		114.0	55.0	.	NM_001201575	O60233|Q2TB86|Q5T1U0	Missense_Mutation	SNP	ENST00000259470.5	hg19	CCDS6723.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.776996	0.70107	.	.	ENSG00000136943	ENST00000259470;ENST00000538255	D;D	0.94092	-3.35;-3.35	3.81	2.68	0.31781	Proteinase inhibitor I29, cathepsin propeptide (2);	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	H	0.97365	3.99	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96055	0.9034	9	.	.	.	.	7.4637	0.27310	0.0:0.1067:0.0:0.8933	.	87;87	B2R717;O60911	.;CATL2_HUMAN	D	87	ENSP00000259470:E87D;ENSP00000445052:E87D	.	E	-	3	2	CTSL2	98839490	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	0.938000	0.28965	0.848000	0.35191	0.459000	0.35465	GAA	.	.	.	none		0.418	CTSV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053301.2	NM_001333	
JMJD1C	221037	hgsc.bcm.edu	37	10	64968540	64968540	+	Silent	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr10:64968540A>G	ENST00000399262.2	-	10	3107	c.2889T>C	c.(2887-2889)ttT>ttC	p.F963F	JMJD1C_ENST00000399251.1_Silent_p.F744F|JMJD1C_ENST00000542921.1_Silent_p.F781F|JMJD1C_ENST00000402544.1_Silent_p.F744F	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	963					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATGGTTCCATAAAAGCTTTTC	0.348																																					p.F963F		Atlas-SNP	.											.	JMJD1C	347	.	0			c.T2889C						PASS	.						49.0	45.0	46.0					10																	64968540		1815	4081	5896	SO:0001819	synonymous_variant	221037	exon10			TTCCATAAAAGCT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.2889T>C	chr10.hg19:g.64968540A>G		29.0	0.0	.		28.0	11.0	.	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	hg19	CCDS41532.1																																																																																			.	.	.	none		0.348	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
P4HA1	5033	hgsc.bcm.edu	37	10	74810906	74810906	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr10:74810906G>A	ENST00000307116.2	-	7	921	c.805C>T	c.(805-807)Cag>Tag	p.Q269*	P4HA1_ENST00000394890.2_Nonsense_Mutation_p.Q269*|P4HA1_ENST00000440381.1_Nonsense_Mutation_p.Q269*|P4HA1_ENST00000373008.2_Nonsense_Mutation_p.Q269*|P4HA1_ENST00000412021.2_Nonsense_Mutation_p.Q269*|P4HA1_ENST00000263556.3_Nonsense_Mutation_p.Q269*			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	269					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GTAGTTTTCTGATCAGATTGG	0.388																																					p.Q269X	Colon(147;367 2405 2662 52127)	Atlas-SNP	.											.	P4HA1	86	.	0			c.C805T						PASS	.						217.0	213.0	214.0					10																	74810906		2203	4300	6503	SO:0001587	stop_gained	5033	exon7			TTTTCTGATCAGA		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.805C>T	chr10.hg19:g.74810906G>A	ENSP00000307318:p.Gln269*	76.0	0.0	.		65.0	34.0	.	NM_001142596	C9JL12|Q15082|Q15083|Q5VSQ5	Nonsense_Mutation	SNP	ENST00000307116.2	hg19		.	.	.	.	.	.	.	.	.	.	G	38	6.748289	0.97809	.	.	ENSG00000122884	ENST00000307116;ENST00000373008;ENST00000412021;ENST00000394890;ENST00000263556;ENST00000440381	.	.	.	5.67	4.75	0.60458	.	0.628969	0.17058	N	0.188667	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-9.1782	14.0861	0.64957	0.0:0.0:0.6736:0.3264	.	.	.	.	X	269	.	ENSP00000263556:Q269X	Q	-	1	0	P4HA1	74480912	0.668000	0.27493	1.000000	0.80357	0.995000	0.86356	0.893000	0.28336	1.363000	0.46019	0.557000	0.71058	CAG	.	.	.	none		0.388	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	NM_000917	
FAM35A	54537	hgsc.bcm.edu	37	10	88911776	88911776	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr10:88911776C>G	ENST00000298784.1	+	3	779	c.665C>G	c.(664-666)tCa>tGa	p.S222*	RN7SL733P_ENST00000582253.1_RNA|FAM35A_ENST00000298786.4_Nonsense_Mutation_p.S222*	NM_019054.2	NP_061927.2	Q86V20	FA35A_HUMAN	family with sequence similarity 35, member A	222										endometrium(2)|kidney(2)|large_intestine(5)|lung(1)|ovary(2)|prostate(2)|skin(2)	16						GTAGATAAGTCAAGGTCTGAA	0.398																																					p.S222X	Ovarian(175;703 2004 25460 32514 43441)	Atlas-SNP	.											.	FAM35A	48	.	0			c.C665G						PASS	.						34.0	35.0	35.0					10																	88911776		2197	4290	6487	SO:0001587	stop_gained	54537	exon3			ATAAGTCAAGGTC	BC051863	CCDS7383.1	10q23.2	2010-06-02			ENSG00000122376	ENSG00000122376			28773	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_019054		Approved	MGC5560, bA163M19.1, FAM35A1	uc001kei.4	Q86V20	OTTHUMG00000018669	ENST00000298784.1:c.665C>G	chr10.hg19:g.88911776C>G	ENSP00000298784:p.Ser222*	134.0	0.0	.		113.0	40.0	.	NM_019054	O95885|Q9H991	Nonsense_Mutation	SNP	ENST00000298784.1	hg19	CCDS7383.1	.	.	.	.	.	.	.	.	.	.	c	26.2	4.712906	0.89112	.	.	ENSG00000122376	ENST00000298786;ENST00000298784;ENST00000358313	.	.	.	4.09	4.09	0.47781	.	0.374206	0.21967	N	0.066511	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-1.042	14.7247	0.69336	0.0:1.0:0.0:0.0	.	.	.	.	X	222	.	ENSP00000298784:S222X	S	+	2	0	FAM35A	88901756	0.031000	0.19500	0.008000	0.14137	0.139000	0.21198	3.315000	0.51951	2.134000	0.65973	0.537000	0.68136	TCA	.	.	.	none		0.398	FAM35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049196.2	NM_019054	
ACCSL	390110	hgsc.bcm.edu	37	11	44079985	44079985	+	Silent	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:44079985C>T	ENST00000378832.1	+	12	1502	c.1446C>T	c.(1444-1446)ctC>ctT	p.L482L		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	482					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GCTCTGGCCTCTATGTCTGGA	0.532																																					p.L482L		Atlas-SNP	.											.	ACCSL	57	.	0			c.C1446T						PASS	.						134.0	136.0	135.0					11																	44079985		1985	4152	6137	SO:0001819	synonymous_variant	390110	exon12			TGGCCTCTATGTC		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1446C>T	chr11.hg19:g.44079985C>T		116.0	0.0	.		128.0	60.0	.	NM_001031854		Silent	SNP	ENST00000378832.1	hg19	CCDS41636.1																																																																																			.	.	.	none		0.532	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	
MYO7A	4647	hgsc.bcm.edu	37	11	76893004	76893004	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:76893004A>G	ENST00000409709.3	+	24	3184	c.2912A>G	c.(2911-2913)gAg>gGg	p.E971G	MYO7A_ENST00000409619.2_Missense_Mutation_p.E960G|MYO7A_ENST00000409893.1_Missense_Mutation_p.E971G|MYO7A_ENST00000458637.2_Missense_Mutation_p.E971G	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	971					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CAGGACCTGGAGCGAGGGCGG	0.592																																					p.E971G		Atlas-SNP	.											.	MYO7A	164	.	0			c.A2912G						PASS	.						50.0	59.0	56.0					11																	76893004		2084	4201	6285	SO:0001583	missense	4647	exon24			ACCTGGAGCGAGG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2912A>G	chr11.hg19:g.76893004A>G	ENSP00000386331:p.Glu971Gly	71.0	0.0	.		94.0	4.0	.	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	.	18.27	3.586425	0.66105	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419;ENST00000458169	D;D;D;D;D	0.89617	-2.5;-2.54;-2.51;-2.53;-2.29	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.89054	0.6606	M	0.81802	2.56	0.80722	D	1	B;B;B;B	0.29835	0.258;0.087;0.011;0.023	B;B;B;B	0.28784	0.043;0.094;0.068;0.043	D	0.87356	0.2341	10	0.36615	T	0.2	.	15.3587	0.74453	1.0:0.0:0.0:0.0	.	971;960;971;971	B9A012;B9A011;F8VUN5;Q13402	.;.;.;MYO7A_HUMAN	G	971;971;971;960;182;970;970;847;970;152	ENSP00000386331:E971G;ENSP00000386689:E971G;ENSP00000392185:E971G;ENSP00000386635:E960G;ENSP00000417017:E152G	ENSP00000345075:E847G	E	+	2	0	MYO7A	76570652	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	8.887000	0.92456	2.028000	0.59812	0.448000	0.29417	GAG	.	.	.	none		0.592	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
EXPH5	23086	hgsc.bcm.edu	37	11	108381026	108381026	+	Silent	SNP	T	T	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:108381026T>G	ENST00000265843.4	-	6	5318	c.5208A>C	c.(5206-5208)acA>acC	p.T1736T	EXPH5_ENST00000525344.1_Silent_p.T1729T|EXPH5_ENST00000443411.1_Silent_p.T1548T|EXPH5_ENST00000428840.1_Silent_p.T1660T	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1736					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GGCTGGTGAATGTGATGGGTG	0.468																																					p.T1736T		Atlas-SNP	.											.	EXPH5	193	.	0			c.A5208C						PASS	.						85.0	91.0	89.0					11																	108381026		2201	4298	6499	SO:0001819	synonymous_variant	23086	exon6			GGTGAATGTGATG		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5208A>C	chr11.hg19:g.108381026T>G		101.0	0.0	.		108.0	41.0	.	NM_015065	Q2KHM1|Q9Y4D6	Silent	SNP	ENST00000265843.4	hg19	CCDS8341.1																																																																																			.	.	.	none		0.468	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
MCAM	4162	hgsc.bcm.edu	37	11	119182661	119182661	+	Splice_Site	SNP	T	T	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:119182661T>A	ENST00000264036.4	-	10	1158		c.e10-2		MCAM_ENST00000392814.1_Splice_Site|MCAM_ENST00000530144.2_5'Flank	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule						anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CTGGCCTGTCTGGGATGAGAG	0.632																																					.		Atlas-SNP	.											.	MCAM	57	.	0			c.1144-2A>T						PASS	.						90.0	93.0	92.0					11																	119182661		2199	4295	6494	SO:0001630	splice_region_variant	4162	exon11			CCTGTCTGGGATG	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1144-2A>T	chr11.hg19:g.119182661T>A		39.0	0.0	.		29.0	15.0	.	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Splice_Site	SNP	ENST00000264036.4	hg19	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.776310	0.49786	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4953	0.33125	0.0:0.0:0.1965:0.8035	.	.	.	.	.	-1	.	.	.	-	.	.	MCAM	118687871	1.000000	0.71417	0.979000	0.43373	0.886000	0.51366	4.238000	0.58688	1.973000	0.57446	0.379000	0.24179	.	.	.	.	none		0.632	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		Intron
SLC2A14	144195	hgsc.bcm.edu	37	12	7984344	7984344	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:7984344A>T	ENST00000543909.1	-	9	956	c.197T>A	c.(196-198)aTc>aAc	p.I66N	SLC2A14_ENST00000396589.2_Missense_Mutation_p.I66N|SLC2A14_ENST00000542546.1_Intron|SLC2A14_ENST00000539924.1_Missense_Mutation_p.I81N|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000535295.1_Intron|SLC2A14_ENST00000431042.2_Missense_Mutation_p.I43N|SLC2A14_ENST00000340749.5_Missense_Mutation_p.I43N			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	66					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGTTTTATTGATAAATTCCTT	0.458											OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I66N		Atlas-SNP	.											.	SLC2A14	78	.	0			c.T197A						PASS	.						89.0	86.0	87.0					12																	7984344		2203	4300	6503	SO:0001583	missense	144195	exon5			TTATTGATAAATT	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.197T>A	chr12.hg19:g.7984344A>T	ENSP00000440480:p.Ile66Asn	129.0	0.0	.	645	191.0	61.0	.	NM_153449	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	ENST00000543909.1	hg19	CCDS8585.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.337198	0.41398	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000539924;ENST00000546234;ENST00000542782;ENST00000535344;ENST00000537557;ENST00000535266;ENST00000542916;ENST00000535383	T;T;T;T;T;T;T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-0.83;-0.83	3.6	3.6	0.41247	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.322524	0.33496	N	0.004853	D	0.84325	0.5447	M	0.70595	2.14	0.31524	N	0.662021	P;P;B	0.45428	0.858;0.81;0.093	P;P;B	0.57009	0.811;0.575;0.102	D	0.84462	0.0594	10	0.72032	D	0.01	.	6.4066	0.21668	0.781:0.0:0.0:0.219	.	81;43;66	B7ZAC3;Q8TDB8-2;Q8TDB8	.;.;GTR14_HUMAN	N	43;66;43;66;81;43;43;43;66;66;43;43	ENSP00000340450:I43N;ENSP00000440480:I66N;ENSP00000407287:I43N;ENSP00000379834:I66N;ENSP00000445929:I81N;ENSP00000440043:I43N;ENSP00000438312:I43N;ENSP00000443217:I43N;ENSP00000440044:I66N;ENSP00000437653:I66N;ENSP00000442402:I43N;ENSP00000443076:I43N	ENSP00000340450:I43N	I	-	2	0	SLC2A14	7875611	0.995000	0.38212	0.015000	0.15790	0.012000	0.07955	1.901000	0.39838	1.391000	0.46566	0.477000	0.44152	ATC	.	.	.	none		0.458	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399836.2	NM_153449	
LRP6	4040	hgsc.bcm.edu	37	12	12274330	12274330	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:12274330G>C	ENST00000261349.4	-	23	4648	c.4572C>G	c.(4570-4572)caC>caG	p.H1524Q	BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Missense_Mutation_p.H1479Q	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1524					anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGGGTGCAAAGTGCCGGTAGC	0.463																																					p.H1524Q		Atlas-SNP	.											.	LRP6	170	.	0			c.C4572G						PASS	.						99.0	103.0	101.0					12																	12274330		2203	4300	6503	SO:0001583	missense	4040	exon23			TGCAAAGTGCCGG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.4572C>G	chr12.hg19:g.12274330G>C	ENSP00000261349:p.His1524Gln	120.0	0.0	.		166.0	37.0	.	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	hg19	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088550	0.36855	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.92911	-3.07;-3.13	5.86	4.96	0.65561	.	0.000000	0.64402	D	0.000004	D	0.89663	0.6780	L	0.43152	1.355	0.54753	D	0.999989	D;P	0.54207	0.965;0.607	P;B	0.47981	0.563;0.177	D	0.88842	0.3313	10	0.52906	T	0.07	.	9.8375	0.40977	0.2372:0.0:0.7628:0.0	.	1479;1524	F5H7J9;O75581	.;LRP6_HUMAN	Q	1524;1479	ENSP00000261349:H1524Q;ENSP00000442472:H1479Q	ENSP00000261349:H1524Q	H	-	3	2	LRP6	12165597	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.704000	0.37857	2.780000	0.95670	0.643000	0.83706	CAC	.	.	.	none		0.463	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
ARID2	196528	hgsc.bcm.edu	37	12	46244883	46244883	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:46244883A>T	ENST00000334344.6	+	15	3149	c.2977A>T	c.(2977-2979)Acc>Tcc	p.T993S	ARID2_ENST00000422737.1_Missense_Mutation_p.T844S|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Missense_Mutation_p.T603S|ARID2_ENST00000457135.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	993	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GTCGTCCTCTACCCCTCAATC	0.498			"""N, S, F"""		hepatocellular carcinoma																																p.T993S		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.A2977T						PASS	.						246.0	213.0	224.0					12																	46244883		2203	4300	6503	SO:0001583	missense	196528	exon15			TCCTCTACCCCTC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2977A>T	chr12.hg19:g.46244883A>T	ENSP00000335044:p.Thr993Ser	248.0	0.0	.		393.0	114.0	.	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	5.023	0.189957	0.09547	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670	T	0.33438	1.41	5.66	2.06	0.26882	.	0.394387	0.30593	N	0.009288	T	0.17746	0.0426	N	0.19112	0.55	0.80722	D	1	B;B;B	0.26147	0.143;0.143;0.104	B;B;B	0.30572	0.117;0.075;0.039	T	0.06041	-1.0849	10	0.31617	T	0.26	-1.4259	6.2264	0.20710	0.6727:0.124:0.2032:0.0	.	993;603;993	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	S	993;110;110;844;603	ENSP00000335044:T993S	ENSP00000335044:T993S	T	+	1	0	ARID2	44531150	0.976000	0.34144	0.996000	0.52242	0.380000	0.30137	1.302000	0.33459	0.425000	0.26087	0.379000	0.24179	ACC	.	.	.	none		0.498	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
NAV3	89795	hgsc.bcm.edu	37	12	78591182	78591182	+	Splice_Site	SNP	G	G	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:78591182G>C	ENST00000397909.2	+	35	6619		c.e35+1		NAV3_ENST00000266692.7_Splice_Site|NAV3_ENST00000541270.1_5'Flank|NAV3_ENST00000536525.2_Splice_Site|NAV3_ENST00000228327.6_Splice_Site			Q8IVL0	NAV3_HUMAN	neuron navigator 3							membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACAACAAATGGTATGCTTATC	0.284										HNSCC(70;0.22)																											.		Atlas-SNP	.											.	NAV3	506	.	0			c.6380+1G>C						PASS	.						83.0	73.0	76.0					12																	78591182		1798	4068	5866	SO:0001630	splice_region_variant	89795	exon34			CAAATGGTATGCT	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6446+1G>C	chr12.hg19:g.78591182G>C		21.0	0.0	.		27.0	13.0	.	NM_014903	Q8NFW7|Q9Y2E7	Splice_Site	SNP	ENST00000397909.2	hg19		.	.	.	.	.	.	.	.	.	.	G	25.5	4.648927	0.87958	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000552895;ENST00000550788	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8339	0.96646	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAV3	77115313	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.813000	0.99286	2.751000	0.94390	0.655000	0.94253	.	.	.	.	none		0.284	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	Intron
ATXN2	6311	hgsc.bcm.edu	37	12	111926345	111926345	+	Silent	SNP	A	A	G			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:111926345A>G	ENST00000377617.3	-	15	2816	c.2655T>C	c.(2653-2655)gtT>gtC	p.V885V	ATXN2_ENST00000535949.1_Silent_p.V596V|ATXN2_ENST00000608853.1_Silent_p.V725V|AC002395.1_ENST00000581907.1_RNA|ATXN2_ENST00000389153.4_Silent_p.V620V|ATXN2_ENST00000542287.2_Silent_p.V620V|ATXN2_ENST00000550104.1_Silent_p.V885V	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	885					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						TGGAAGTCTGAACCCCTTGGG	0.498																																					p.V885V		Atlas-SNP	.											.	ATXN2	99	.	0			c.T2655C						PASS	.						122.0	117.0	119.0					12																	111926345		2203	4300	6503	SO:0001819	synonymous_variant	6311	exon15			AGTCTGAACCCCT	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.2655T>C	chr12.hg19:g.111926345A>G		99.0	0.0	.		154.0	85.0	.	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	hg19	CCDS31902.1																																																																																			.	.	.	none		0.498	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
CIT	11113	hgsc.bcm.edu	37	12	120158284	120158284	+	Splice_Site	SNP	T	T	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:120158284T>C	ENST00000261833.7	-	29	3765	c.3713A>G	c.(3712-3714)aAg>aGg	p.K1238R	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Splice_Site_p.K1280R	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1238	Interaction with Rho/Rac.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTGACTCACCTTTTTCTTTTT	0.373																																					p.K1280R		Atlas-SNP	.											.	CIT	535	.	0			c.A3839G						PASS	.						136.0	130.0	132.0					12																	120158284		2203	4299	6502	SO:0001630	splice_region_variant	11113	exon30			CTCACCTTTTTCT	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.3714+1A>G	chr12.hg19:g.120158284T>C		127.0	0.0	.		163.0	88.0	.	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	hg19	CCDS9192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.70|18.70	3.680696|3.680696	0.68042|0.68042	.|.	.|.	ENSG00000122966|ENSG00000122966	ENST00000392521;ENST00000261833|ENST00000392520	T;T|.	0.69806|.	-0.42;-0.43|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72070|0.72070	0.3415|0.3415	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	B;D;P|.	0.69078|.	0.355;0.997;0.734|.	B;D;B|.	0.73380|.	0.1;0.98;0.203|.	T|T	0.70880|0.70880	-0.4752|-0.4752	10|5	0.24483|.	T|.	0.36|.	.|.	16.1193|16.1193	0.81336|0.81336	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1280;1238;771|.	Q2M5E1;O14578;O14578-3|.	.;CTRO_HUMAN;.|.	R|G	1280;1238|866	ENSP00000376306:K1280R;ENSP00000261833:K1238R|.	ENSP00000261833:K1238R|.	K|R	-|-	2|1	0|2	CIT|CIT	118642667|118642667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.040000|8.040000	0.89188|0.89188	2.204000|2.204000	0.70986|0.70986	0.528000|0.528000	0.53228|0.53228	AAG|AGG	.	.	.	none		0.373	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	Missense_Mutation
VWA8	23078	hgsc.bcm.edu	37	13	42440068	42440068	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr13:42440068C>T	ENST00000379310.3	-	11	1385	c.1317G>A	c.(1315-1317)atG>atA	p.M439I	VWA8_ENST00000281496.6_Missense_Mutation_p.M439I	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	439						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TATCTTTAACCATGTGAGACT	0.418																																					p.M439I		Atlas-SNP	.											.	.	.	.	0			c.G1317A						PASS	.						146.0	148.0	147.0					13																	42440068		2203	4300	6503	SO:0001583	missense	23078	exon11			TTTAACCATGTGA	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1317G>A	chr13.hg19:g.42440068C>T	ENSP00000368612:p.Met439Ile	75.0	0.0	.		73.0	36.0	.	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	hg19	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040196	0.35989	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	T;T	0.38401	1.14;1.14	5.3	5.3	0.74995	ATPase, AAA+ type, core (1);	0.109015	0.64402	D	0.000017	T	0.33381	0.0861	L	0.46157	1.445	0.43467	D	0.995671	B	0.02656	0.0	B	0.09377	0.004	T	0.17471	-1.0368	10	0.11182	T	0.66	.	19.3149	0.94208	0.0:1.0:0.0:0.0	.	439	A3KMH1	K0564_HUMAN	I	343;439;439;439	ENSP00000368612:M439I;ENSP00000281496:M439I	ENSP00000251030:M343I	M	-	3	0	KIAA0564	41338068	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.386000	0.52492	2.631000	0.89168	0.563000	0.77884	ATG	.	.	.	none		0.418	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
SIX4	51804	hgsc.bcm.edu	37	14	61186919	61186919	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr14:61186919T>A	ENST00000216513.4	-	2	1167	c.1108A>T	c.(1108-1110)Att>Ttt	p.I370F		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	370					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GGTCCCTGAATAAAAGAATTT	0.398																																					p.I370F		Atlas-SNP	.											.	SIX4	69	.	0			c.A1108T						PASS	.						79.0	76.0	77.0					14																	61186919		2203	4300	6503	SO:0001583	missense	51804	exon2			CCTGAATAAAAGA	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1108A>T	chr14.hg19:g.61186919T>A	ENSP00000216513:p.Ile370Phe	110.0	0.0	.		103.0	37.0	.	NM_017420	Q4QQH5|Q4V764	Missense_Mutation	SNP	ENST00000216513.4	hg19	CCDS9749.2	.	.	.	.	.	.	.	.	.	.	T	13.45	2.239521	0.39598	.	.	ENSG00000100625	ENST00000216513;ENST00000554079;ENST00000556952	D;T	0.91792	-2.91;0.56	5.72	5.72	0.89469	.	0.297103	0.34178	N	0.004182	D	0.86464	0.5939	N	0.19112	0.55	0.47698	D	0.999492	P;P	0.49090	0.919;0.454	B;B	0.43575	0.424;0.153	D	0.86816	0.2001	10	0.41790	T	0.15	.	12.7402	0.57249	0.0:0.0:0.146:0.854	.	362;370	G3V2N2;Q9UIU6	.;SIX4_HUMAN	F	370;43;362	ENSP00000216513:I370F;ENSP00000451537:I43F	ENSP00000216513:I370F	I	-	1	0	SIX4	60256672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.761000	0.55242	2.194000	0.70268	0.533000	0.62120	ATT	.	.	.	none		0.398	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
GPHN	10243	hgsc.bcm.edu	37	14	67647539	67647539	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr14:67647539G>A	ENST00000315266.5	+	22	3217	c.2096G>A	c.(2095-2097)cGt>cAt	p.R699H	GPHN_ENST00000543237.1_Missense_Mutation_p.R745H|GPHN_ENST00000478722.1_Missense_Mutation_p.R732H|GPHN_ENST00000305960.9_Missense_Mutation_p.R668H|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	699	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATGAGCAGCCGTCTGATGAGC	0.458			T	MLL	AL																																p.R732H		Atlas-SNP	.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	79	.	0			c.G2195A						PASS	.						128.0	105.0	113.0					14																	67647539		2203	4300	6503	SO:0001583	missense	10243	exon23			GCAGCCGTCTGAT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2096G>A	chr14.hg19:g.67647539G>A	ENSP00000312771:p.Arg699His	123.0	0.0	.		125.0	58.0	.	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	hg19	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934351	0.73442	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.83	4.93	0.64822	MoeA, C-terminal, domain IV (3);	0.102725	0.64402	D	0.000004	T	0.79476	0.4452	M	0.81112	2.525	0.80722	D	1	P;D;D;D	0.89917	0.953;1.0;0.978;1.0	B;D;P;D	0.87578	0.379;0.998;0.75;0.998	T	0.80308	-0.1437	9	0.51188	T	0.08	-7.1864	15.3438	0.74317	0.0681:0.0:0.9319:0.0	.	668;745;699;732	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	H	699;732;745;668	.	ENSP00000303019:R668H	R	+	2	0	GPHN	66717292	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.843000	0.86859	2.768000	0.95171	0.467000	0.42956	CGT	.	.	.	none		0.458	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
CASKIN1	57524	hgsc.bcm.edu	37	16	2239295	2239295	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr16:2239295C>A	ENST00000343516.6	-	5	522	c.430G>T	c.(430-432)Gtg>Ttg	p.V144L		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	144					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						GAGTTGTCCACCATGCACGGG	0.697																																					p.V144L		Atlas-SNP	.											.	CASKIN1	130	.	0			c.G430T						PASS	.						39.0	52.0	47.0					16																	2239295		2114	4208	6322	SO:0001583	missense	57524	exon5			TGTCCACCATGCA	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.430G>T	chr16.hg19:g.2239295C>A	ENSP00000345436:p.Val144Leu	81.0	0.0	.		77.0	4.0	.	NM_020764	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	hg19	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032936	0.54790	.	.	ENSG00000167971	ENST00000343516	T	0.64438	-0.1	3.46	3.46	0.39613	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.42291	0.1196	N	0.13327	0.33	0.42422	D	0.992647	B	0.25105	0.118	B	0.29353	0.101	T	0.44190	-0.9344	9	0.56958	D	0.05	-19.1703	5.5157	0.16906	0.0:0.7694:0.0:0.2306	.	144	Q8WXD9	CSKI1_HUMAN	L	144	ENSP00000345436:V144L	ENSP00000345436:V144L	V	-	1	0	CASKIN1	2179296	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.807000	0.38902	1.954000	0.56735	0.561000	0.74099	GTG	.	.	.	none		0.697	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
TMEM159	57146	hgsc.bcm.edu	37	16	21185458	21185458	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr16:21185458G>C	ENST00000233047.4	+	4	861	c.393G>C	c.(391-393)tgG>tgC	p.W131C	TMEM159_ENST00000572599.1_Missense_Mutation_p.W131C|TMEM159_ENST00000451578.2_Missense_Mutation_p.W155C|TMEM159_ENST00000572258.1_Intron|TMEM159_ENST00000261388.3_Missense_Mutation_p.W131C			Q96B96	TM159_HUMAN	transmembrane protein 159	131						integral component of membrane (GO:0016021)				large_intestine(3)|lung(2)|ovary(1)	6				GBM - Glioblastoma multiforme(48;0.0972)		TCAGCTGCTGGTTTTCTCCCA	0.428																																					p.W131C		Atlas-SNP	.											.	TMEM159	14	.	0			c.G393C						PASS	.						121.0	98.0	106.0					16																	21185458		2200	4300	6500	SO:0001583	missense	57146	exon4			CTGCTGGTTTTCT	AF070596	CCDS10595.1	16p12.2	2008-02-05			ENSG00000011638	ENSG00000011638			30136	protein-coding gene	gene with protein product		611304				8619474, 9110174, 15589683	Standard	NM_020422		Approved	promethin	uc002dif.4	Q96B96	OTTHUMG00000131559	ENST00000233047.4:c.393G>C	chr16.hg19:g.21185458G>C	ENSP00000233047:p.Trp131Cys	113.0	0.0	.		127.0	59.0	.	NM_020422	A6NMA9|B4DEC1|O00323	Missense_Mutation	SNP	ENST00000233047.4	hg19	CCDS10595.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059590	0.36373	.	.	ENSG00000011638	ENST00000233047;ENST00000261388;ENST00000451578	T;T;T	0.25579	1.8;1.8;1.79	6.07	6.07	0.98685	.	0.371511	0.26467	N	0.024208	T	0.49338	0.1551	M	0.64997	1.995	0.58432	D	0.999993	D;D	0.76494	0.999;0.999	D;D	0.65874	0.939;0.912	T	0.38950	-0.9637	10	0.72032	D	0.01	-19.3257	18.139	0.89633	0.0:0.0:1.0:0.0	.	155;131	B4DEC1;Q96B96	.;TM159_HUMAN	C	131;131;155	ENSP00000233047:W131C;ENSP00000261388:W131C;ENSP00000409879:W155C	ENSP00000233047:W131C	W	+	3	0	TMEM159	21092959	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	3.746000	0.55127	2.885000	0.99019	0.650000	0.86243	TGG	.	.	.	none		0.428	TMEM159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254421.1	NM_020422	
ZP2	7783	hgsc.bcm.edu	37	16	21214557	21214557	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr16:21214557G>T	ENST00000574002.1	-	11	1470	c.988C>A	c.(988-990)Cta>Ata	p.L330I	ZP2_ENST00000574091.1_Missense_Mutation_p.L330I|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.L330I			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	330					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		TGATGGAGTAGGCATTTTTCA	0.483																																					p.L330I		Atlas-SNP	.											.	ZP2	92	.	0			c.C988A						PASS	.						107.0	102.0	103.0					16																	21214557		2200	4300	6500	SO:0001583	missense	7783	exon10			GGAGTAGGCATTT	M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.988C>A	chr16.hg19:g.21214557G>T	ENSP00000460971:p.Leu330Ile	62.0	0.0	.		54.0	31.0	.	NM_003460	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	ENST00000574002.1	hg19	CCDS10596.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523709	0.44866	.	.	ENSG00000103310	ENST00000219593	T	0.76316	-1.01	5.97	2.76	0.32466	.	0.485326	0.18994	N	0.125524	T	0.77267	0.4105	M	0.75447	2.3	0.19575	N	0.999964	P;P	0.51351	0.944;0.944	P;P	0.47981	0.563;0.563	T	0.66685	-0.5861	10	0.32370	T	0.25	-6.6445	7.7511	0.28898	0.1328:0.292:0.5752:0.0	.	330;330	Q4VAP1;Q05996	.;ZP2_HUMAN	I	330	ENSP00000219593:L330I	ENSP00000219593:L330I	L	-	1	2	ZP2	21122058	0.879000	0.30193	0.975000	0.42487	0.291000	0.27294	0.880000	0.28159	1.513000	0.48852	0.655000	0.94253	CTA	.	.	.	none		0.483	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207365.2		
SETD1A	9739	hgsc.bcm.edu	37	16	30976286	30976286	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr16:30976286C>A	ENST00000262519.8	+	7	1909	c.1223C>A	c.(1222-1224)tCt>tAt	p.S408Y		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	408	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TTCCCACCTTCTTACACCTCC	0.662																																					p.S408Y		Atlas-SNP	.											.	SETD1A	143	.	0			c.C1223A						PASS	.						57.0	66.0	63.0					16																	30976286		2197	4300	6497	SO:0001583	missense	9739	exon7			CACCTTCTTACAC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1223C>A	chr16.hg19:g.30976286C>A	ENSP00000262519:p.Ser408Tyr	64.0	0.0	.		63.0	19.0	.	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	hg19	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.182646	0.38511	.	.	ENSG00000099381	ENST00000262519	D	0.94497	-3.44	5.64	5.64	0.86602	.	0.197187	0.45361	D	0.000366	D	0.93979	0.8072	L	0.36672	1.1	0.26055	N	0.981439	D	0.67145	0.996	P	0.56700	0.804	D	0.89234	0.3579	10	0.72032	D	0.01	.	12.5755	0.56362	0.0:0.92:0.0:0.08	.	408	O15047	SET1A_HUMAN	Y	408	ENSP00000262519:S408Y	ENSP00000262519:S408Y	S	+	2	0	SETD1A	30883787	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	3.742000	0.55097	2.648000	0.89879	0.561000	0.74099	TCT	.	.	.	none		0.662	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
THAP11	57215	hgsc.bcm.edu	37	16	67876718	67876718	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr16:67876718G>T	ENST00000303596.1	+	1	506	c.261G>T	c.(259-261)gaG>gaT	p.E87D	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GCGTCAATGAGCGCAAAGTAG	0.687																																					p.E87D		Atlas-SNP	.											.	THAP11	27	.	0			c.G261T						PASS	.						18.0	19.0	18.0					16																	67876718		2197	4296	6493	SO:0001583	missense	57215	exon1			CAATGAGCGCAAA	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.261G>T	chr16.hg19:g.67876718G>T	ENSP00000304689:p.Glu87Asp	47.0	0.0	.		28.0	12.0	.	NM_020457	A4UCT5|A8K002|O94795	Missense_Mutation	SNP	ENST00000303596.1	hg19	CCDS10847.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.368381	0.61513	.	.	ENSG00000168286	ENST00000303596	T	0.33216	1.42	5.4	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.41880	0.1178	L	0.32530	0.975	0.51767	D	0.999939	D	0.63880	0.993	D	0.70016	0.967	T	0.26121	-1.0112	10	0.54805	T	0.06	-16.1311	11.7789	0.52001	0.1059:0.0:0.8941:0.0	.	87	Q96EK4	THA11_HUMAN	D	87	ENSP00000304689:E87D	ENSP00000304689:E87D	E	+	3	2	THAP11	66434219	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.044000	0.57361	1.155000	0.42497	0.563000	0.77884	GAG	.	.	.	none		0.687	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
LGALS9	3965	hgsc.bcm.edu	37	17	25967635	25967635	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr17:25967635G>A	ENST00000395473.2	+	3	1637	c.169G>A	c.(169-171)Gac>Aac	p.D57N	LGALS9_ENST00000313648.6_Missense_Mutation_p.D57N|AC015688.3_ENST00000584605.1_3'UTR|LGALS9_ENST00000413914.2_Intron|LGALS9_ENST00000310394.5_Missense_Mutation_p.D57N|LGALS9_ENST00000302228.5_Missense_Mutation_p.D57N|LGALS9_ENST00000448970.2_3'UTR	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	57	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		CAGTGGAAATGACATTGCCTT	0.527																																					p.D57N	Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)	Atlas-SNP	.											.	LGALS9	29	.	0			c.G169A						PASS	.						124.0	118.0	120.0					17																	25967635		2203	4300	6503	SO:0001583	missense	3965	exon3			GGAAATGACATTG	AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.169G>A	chr17.hg19:g.25967635G>A	ENSP00000378856:p.Asp57Asn	609.0	0.0	.		819.0	207.0	.	NM_009587	A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Missense_Mutation	SNP	ENST00000395473.2	hg19	CCDS11222.1	.	.	.	.	.	.	.	.	.	.	G	9.418	1.082274	0.20309	.	.	ENSG00000168961	ENST00000395473;ENST00000302228;ENST00000310394;ENST00000313648;ENST00000448970	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	3.94	0.839	0.18907	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.459334	0.24325	N	0.039518	T	0.12774	0.0310	L	0.50993	1.605	0.58432	D	0.999995	B;P;P	0.42871	0.1;0.792;0.624	B;B;B	0.42319	0.084;0.383;0.203	T	0.06570	-1.0819	10	0.42905	T	0.14	.	7.4254	0.27096	0.3157:0.0:0.6843:0.0	.	57;57;57	F8W9W4;Q3B8N1;O00182	.;.;LEG9_HUMAN	N	57	ENSP00000378856:D57N;ENSP00000306228:D57N;ENSP00000312259:D57N;ENSP00000318214:D57N	ENSP00000306228:D57N	D	+	1	0	LGALS9	22991762	0.637000	0.27216	0.459000	0.27081	0.622000	0.37654	0.741000	0.26202	0.460000	0.27045	0.586000	0.80456	GAC	.	.	.	none		0.527	LGALS9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255583.1	NM_009587	
WIPI1	55062	hgsc.bcm.edu	37	17	66440668	66440668	+	Silent	SNP	C	C	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr17:66440668C>T	ENST00000262139.5	-	4	395	c.396G>A	c.(394-396)ttG>ttA	p.L132L	WIPI1_ENST00000589459.1_5'UTR|WIPI1_ENST00000546360.1_Silent_p.L50L	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	132					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						GGAGGGTCTTCAACAGCTTCA	0.433																																					p.L132L		Atlas-SNP	.											.	WIPI1	46	.	0			c.G396A						PASS	.						150.0	137.0	142.0					17																	66440668		2203	4300	6503	SO:0001819	synonymous_variant	55062	exon4			GGTCTTCAACAGC		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.396G>A	chr17.hg19:g.66440668C>T		74.0	0.0	.		119.0	31.0	.	NM_017983	Q8IXM5|Q9NWF8	Silent	SNP	ENST00000262139.5	hg19	CCDS11677.1																																																																																			.	.	.	none		0.433	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	NM_017983	
RBBP8	5932	hgsc.bcm.edu	37	18	20562277	20562277	+	Silent	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr18:20562277G>A	ENST00000399722.2	+	7	876	c.525G>A	c.(523-525)cgG>cgA	p.R175R	RBBP8_ENST00000327155.5_Silent_p.R175R|RBBP8_ENST00000360790.5_Silent_p.R175R|RBBP8_ENST00000399725.2_Silent_p.R175R	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	175					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			GCGTTAACCGGCTACGAAGAA	0.433								Homologous recombination																													p.R175R		Atlas-SNP	.											.	RBBP8	138	.	0			c.G525A						PASS	.						174.0	154.0	161.0					18																	20562277		2203	4300	6503	SO:0001819	synonymous_variant	5932	exon7			TAACCGGCTACGA	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.525G>A	chr18.hg19:g.20562277G>A		112.0	0.0	.		138.0	44.0	.	NM_203292	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Silent	SNP	ENST00000399722.2	hg19	CCDS11875.1																																																																																			.	.	.	none		0.433	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
TRPM4	54795	hgsc.bcm.edu	37	19	49714007	49714007	+	Silent	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr19:49714007G>T	ENST00000252826.5	+	22	3495	c.3369G>T	c.(3367-3369)acG>acT	p.T1123T	TRPM4_ENST00000355712.5_Silent_p.T769T|TRPM4_ENST00000427978.2_Silent_p.T978T	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1123	Calmodulin-binding.				calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		AGCTGCTAACGTGGGAATCGG	0.622																																					p.T1123T		Atlas-SNP	.											.	TRPM4	119	.	0			c.G3369T						PASS	.						38.0	44.0	42.0					19																	49714007		2203	4300	6503	SO:0001819	synonymous_variant	54795	exon22			GCTAACGTGGGAA	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3369G>T	chr19.hg19:g.49714007G>T		186.0	0.0	.		125.0	41.0	.	NM_017636	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Silent	SNP	ENST00000252826.5	hg19	CCDS33073.1																																																																																			.	.	.	none		0.622	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
TMC4	147798	hgsc.bcm.edu	37	19	54669261	54669261	+	Silent	SNP	G	G	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr19:54669261G>T	ENST00000376591.4	-	6	986	c.855C>A	c.(853-855)tcC>tcA	p.S285S	TMC4_ENST00000416963.1_5'Flank|TMC4_ENST00000476013.2_Intron|TMC4_ENST00000301187.4_Silent_p.S279S	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	285					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCAGAGCCTCGGACTCCGCCA	0.652																																					p.S285S		Atlas-SNP	.											.	TMC4	89	.	0			c.C855A						PASS	.						32.0	30.0	31.0					19																	54669261		2202	4299	6501	SO:0001819	synonymous_variant	147798	exon6			AGCCTCGGACTCC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.855C>A	chr19.hg19:g.54669261G>T		67.0	0.0	.		52.0	25.0	.	NM_001145303	Q7Z5M3|Q8N5E4|Q8TBS7	Silent	SNP	ENST00000376591.4	hg19	CCDS46174.1																																																																																			.	.	.	none		0.652	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
CASS4	57091	hgsc.bcm.edu	37	20	55033659	55033659	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr20:55033659C>A	ENST00000360314.3	+	7	2442	c.2217C>A	c.(2215-2217)caC>caA	p.H739Q	CASS4_ENST00000371336.3_Missense_Mutation_p.H739Q|CASS4_ENST00000434344.1_Missense_Mutation_p.H302Q|AL121914.1_ENST00000390795.2_RNA	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	739					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						GCAGCAGTCACCTCTGCAGCC	0.642																																					p.H739Q		Atlas-SNP	.											.	CASS4	121	.	0			c.C2217A						PASS	.						61.0	50.0	53.0					20																	55033659		2203	4300	6503	SO:0001583	missense	57091	exon6			CAGTCACCTCTGC	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2217C>A	chr20.hg19:g.55033659C>A	ENSP00000353462:p.His739Gln	106.0	0.0	.		94.0	11.0	.	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	hg19	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631149	0.28978	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.22336	1.96;1.96;1.96	5.91	1.54	0.23209	CAS family, DUF3513 (1);	0.511945	0.22918	N	0.054044	T	0.15305	0.0369	L	0.32530	0.975	0.32062	N	0.595525	B;B;B	0.22983	0.078;0.023;0.065	B;B;B	0.23275	0.045;0.013;0.033	T	0.18650	-1.0330	10	0.12430	T	0.62	-9.0912	15.118	0.72419	0.0882:0.3522:0.5595:0.0	.	685;302;739	B4DII4;Q9NQ75-3;Q9NQ75	.;.;CASS4_HUMAN	Q	739;739;302	ENSP00000353462:H739Q;ENSP00000360387:H739Q;ENSP00000410027:H302Q	ENSP00000353462:H739Q	H	+	3	2	CASS4	54467066	1.000000	0.71417	0.288000	0.24862	0.859000	0.49053	1.083000	0.30815	0.372000	0.24591	0.655000	0.94253	CAC	.	.	.	none		0.642	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
SLCO4A1	28231	hgsc.bcm.edu	37	20	61300283	61300283	+	Splice_Site	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr20:61300283G>A	ENST00000370507.1	+	10	1974	c.1878G>A	c.(1876-1878)ggG>ggA	p.G626G	RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000217159.1_Splice_Site_p.G626G|SLCO4A1_ENST00000470412.1_3'UTR			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	626					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TCTCCGCAGGGGGCATCCCGG	0.662											OREG0026115	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G626G	Pancreas(168;741 2006 10379 40139 45334)	Atlas-SNP	.											.	SLCO4A1	65	.	0			c.G1878A						PASS	.						29.0	32.0	31.0					20																	61300283		2202	4299	6501	SO:0001630	splice_region_variant	28231	exon11			CGCAGGGGGCATC	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1877-1G>A	chr20.hg19:g.61300283G>A		19.0	0.0	.	1052	20.0	14.0	.	NM_016354	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Silent	SNP	ENST00000370507.1	hg19	CCDS13501.1																																																																																			.	.	.	none		0.662	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	Silent
COL18A1	80781	hgsc.bcm.edu	37	21	46875643	46875643	+	Missense_Mutation	SNP	C	C	G	rs375087150		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr21:46875643C>G	ENST00000359759.4	+	1	220	c.199C>G	c.(199-201)Cgg>Ggg	p.R67G	COL18A1_ENST00000355480.5_Missense_Mutation_p.R67G|COL18A1_ENST00000400337.2_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	67					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGTGACCCCCCGGAATGGTTC	0.647																																					p.R67G		Atlas-SNP	.											.	COL18A1	129	.	0			c.C199G						PASS	.						53.0	68.0	63.0					21																	46875643		2077	4200	6277	SO:0001583	missense	80781	exon1			ACCCCCCGGAATG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.199C>G	chr21.hg19:g.46875643C>G	ENSP00000352798:p.Arg67Gly	159.0	0.0	.		131.0	60.0	.	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	hg19		.	.	.	.	.	.	.	.	.	.	C	10.16	1.275053	0.23307	.	.	ENSG00000182871	ENST00000355480;ENST00000359759;ENST00000539645	T;T	0.38077	1.16;1.16	3.61	0.181	0.15073	Domain of unknown function DUF959, collagen XVIII, N-terminal (1);	1.949970	0.03091	N	0.159750	T	0.22627	0.0546	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.28522	-1.0041	10	0.72032	D	0.01	.	4.007	0.09605	0.0:0.3657:0.3946:0.2397	.	67;67	P39060;P39060-1	COIA1_HUMAN;.	G	67	ENSP00000347665:R67G;ENSP00000352798:R67G	ENSP00000347665:R67G	R	+	1	2	COL18A1	45700071	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.084000	0.14891	0.253000	0.21552	-0.339000	0.08088	CGG	.	.	.	alt		0.647	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
GAB4	128954	hgsc.bcm.edu	37	22	17488934	17488934	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr22:17488934G>A	ENST00000400588.1	-	1	178	c.71C>T	c.(70-72)tCg>tTg	p.S24L	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	24										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TCCGGGCCACGAAGACAAAGG	0.682																																					p.S24L		Atlas-SNP	.											.	GAB4	95	.	0			c.C71T						PASS	.						16.0	19.0	18.0					22																	17488934		2097	4219	6316	SO:0001583	missense	128954	exon1			GGCCACGAAGACA	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.71C>T	chr22.hg19:g.17488934G>A	ENSP00000383431:p.Ser24Leu	49.0	0.0	.		46.0	14.0	.	NM_001037814		Missense_Mutation	SNP	ENST00000400588.1	hg19	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290327	0.23478	.	.	ENSG00000215568	ENST00000400588	T	0.10288	2.89	0.637	0.637	0.17735	.	.	.	.	.	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	P	0.44241	0.829	B	0.40134	0.32	T	0.37244	-0.9714	8	0.14656	T	0.56	.	.	.	.	.	24	Q2WGN9	GAB4_HUMAN	L	24	ENSP00000383431:S24L	ENSP00000383431:S24L	S	-	2	0	GAB4	15868934	0.001000	0.12720	0.007000	0.13788	0.022000	0.10575	-0.092000	0.11129	0.591000	0.29711	0.313000	0.20887	TCG	.	.	.	none		0.682	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
TRAF3IP2	10758	hgsc.bcm.edu	37	6	111912891	111912891	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr6:111912891delA	ENST00000340026.6	-	3	1020	c.426delT	c.(424-426)tttfs	p.F142fs	TRAF3IP2_ENST00000368761.5_Frame_Shift_Del_p.F133fs|TRAF3IP2_ENST00000392556.4_5'UTR|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000359831.4_Frame_Shift_Del_p.F133fs			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	142	Mediates interaction with TRAF6.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		GTTTTTCCATAAATGAAAACT	0.512																																					p.M134fs		Atlas-Indel,Pindel	.											.	TRAF3IP2	35	.	0			c.400delA						PASS	.						51.0	50.0	50.0					6																	111912891		2203	4300	6503	SO:0001589	frameshift_variant	10758	exon2			.	AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.426delT	chr6.hg19:g.111912891delA	ENSP00000345984:p.Phe142fs	82.0	0.0	0		86.0	32.0	0.372093	NM_001164281	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Frame_Shift_Del	DEL	ENST00000340026.6	hg19																																																																																				.	.	.	none		0.512	TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2		
CSE1L	1434	hgsc.bcm.edu	37	20	47705894	47705895	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr20:47705894_47705895insTT	ENST00000262982.2	+	18	2055_2056	c.1932_1933insTT	c.(1933-1935)tttfs	p.F645fs	CSE1L_ENST00000542325.1_Frame_Shift_Ins_p.F428fs|CSE1L_ENST00000396192.3_Frame_Shift_Ins_p.F589fs	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	645					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AGGAGGCTTTGTTTTTGGTGTT	0.312																																					p.L644fs		Atlas-Indel,Pindel	.											.	CSE1L	83	.	0			c.1932_1933insTT						PASS	.																																			SO:0001589	frameshift_variant	1434	exon18			.	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.1935_1936dupTT	chr20.hg19:g.47705897_47705898dupTT	ENSP00000262982:p.Phe645fs	73.0	0.0	0		64.0	15.0	0.234375	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Frame_Shift_Ins	INS	ENST00000262982.2	hg19	CCDS13412.1																																																																																			.	.	.	none		0.312	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
DHTKD1	55526	hgsc.bcm.edu	37	10	12162862	12162863	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr10:12162862_12162863insT	ENST00000263035.4	+	17	2797_2798	c.2735_2736insT	c.(2734-2739)gatatcfs	p.I913fs		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	913					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			CAGCATGAAGATATCCTCGCCA	0.5																																					p.D912fs		Atlas-Indel,Pindel	.											.	DHTKD1	104	.	0			c.2735_2736insT						PASS	.																																			SO:0001589	frameshift_variant	55526	exon17			.	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2736dupT	chr10.hg19:g.12162863_12162863dupT	ENSP00000263035:p.Ile913fs	94.0	0.0	0		90.0	37.0	0.411111	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Frame_Shift_Ins	INS	ENST00000263035.4	hg19	CCDS7087.1																																																																																			.	.	.	none		0.500	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
EP300	2033	hgsc.bcm.edu	37	22	41558757	41558757	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr22:41558757delA	ENST00000263253.7	+	21	4921	c.3702delA	c.(3700-3702)agafs	p.R1234fs		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1234					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.Y1198_L1243del(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTTCCAAGAGAAAAAATGACA	0.368			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.R1234fs		Atlas-Indel,Pindel	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	1	Deletion - In frame(1)	breast(1)	c.3701delG						PASS	.						120.0	114.0	116.0					22																	41558757		2203	4300	6503	SO:0001589	frameshift_variant	2033	exon21	Familial Cancer Database	Broad Thumb-Hallux syndrome	.	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3702delA	chr22.hg19:g.41558757delA	ENSP00000263253:p.Arg1234fs	134.0	0.0	0		132.0	51.0	0.386364	NM_001429	B1AKC2	Frame_Shift_Del	DEL	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.	.	none		0.368	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ALG6	29929	hgsc.bcm.edu	37	1	63868011	63868011	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr1:63868011delA	ENST00000371108.4	+	4	559	c.254delA	c.(253-255)tatfs	p.Y85fs	ALG6_ENST00000263440.4_Frame_Shift_Del_p.Y85fs	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	85					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CTATGTGCATATGTGTAAGTT	0.353																																					p.Y85fs		Atlas-Indel,Pindel	.											.	ALG6	33	.	0			c.253delT						PASS	.						118.0	114.0	116.0					1																	63868011		2202	4300	6502	SO:0001589	frameshift_variant	29929	exon4			.	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.254delA	chr1.hg19:g.63868011delA	ENSP00000360149:p.Tyr85fs	41.0	0.0	0		37.0	19.0	0.513514	NM_013339	B3KMU2|Q5SXR9|Q9H3I0	Frame_Shift_Del	DEL	ENST00000371108.4	hg19	CCDS30735.1																																																																																			.	.	.	none		0.353	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
EML5	161436	hgsc.bcm.edu	37	14	89171882	89171883	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr14:89171882_89171883insT	ENST00000380664.5	-	12	1874_1875	c.1875_1876insA	c.(1873-1878)gatgttfs	p.V626fs	EML5_ENST00000352093.5_Frame_Shift_Ins_p.V626fs|EML5_ENST00000554922.1_Frame_Shift_Ins_p.V626fs			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	626						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGTTCTGGAACATCAGACAGAT	0.337																																					p.V626fs		Atlas-Indel,Pindel	.											.	EML5	141	.	0			c.1876_1877insA						PASS	.																																			SO:0001589	frameshift_variant	161436	exon12			.	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.1875_1876insA	chr14.hg19:g.89171882_89171883insT	ENSP00000370039:p.Val626fs	32.0	0.0	0		41.0	18.0	0.439024	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Frame_Shift_Ins	INS	ENST00000380664.5	hg19	CCDS45148.1																																																																																			.	.	.	none		0.337	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
TDRD1	56165	hgsc.bcm.edu	37	10	115947630	115947635	+	In_Frame_Del	DEL	AATTTG	AATTTG	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	AATTTG	AATTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr10:115947630_115947635delAATTTG	ENST00000369280.1	+	2	500_505	c.40_45delAATTTG	c.(40-45)aatttgdel	p.NL14del	TDRD1_ENST00000369282.1_In_Frame_Del_p.NL14del|TDRD1_ENST00000369281.2_In_Frame_Del_p.NL14del|TDRD1_ENST00000422662.1_5'UTR|TDRD1_ENST00000251864.2_In_Frame_Del_p.NL14del			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	14					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GTCAAGAAATAATTTGGAAGCACCTC	0.345																																					p.13_15del		Atlas-Indel,Pindel	.											.	TDRD1	126	.	0			c.39_44del						PASS	.																																			SO:0001651	inframe_deletion	56165	exon2			.	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.40_45delAATTTG	chr10.hg19:g.115947630_115947635delAATTTG	ENSP00000358286:p.Asn14_Leu15del	95.0	0.0	0		70.0	20.0	0.285714	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	In_Frame_Del	DEL	ENST00000369280.1	hg19																																																																																				.	.	.	none		0.345	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
WWP1	11059	hgsc.bcm.edu	37	8	87447714	87447715	+	Frame_Shift_Ins	INS	-	-	AATTTTT	rs139712565		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr8:87447714_87447715insAATTTTT	ENST00000517970.1	+	15	1942_1943	c.1635_1636insAATTTTT	c.(1636-1638)ggcfs	p.G546fs	WWP1_ENST00000341922.2_Frame_Shift_Ins_p.G416fs|WWP1_ENST00000265428.4_Frame_Shift_Ins_p.G546fs|WWP1_ENST00000349423.2_Frame_Shift_Ins_p.G328fs	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	546					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						CTTATGAACGCGGCTTTAGGTG	0.302																																					p.R545fs		Atlas-INDEL	.											.	WWP1	97	.	0			c.1635_1636insAATTTTT						PASS	.																																			SO:0001589	frameshift_variant	11059	exon15			.	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	Exception_encountered	chr8.hg19:g.87447714_87447715insAATTTTT	ENSP00000427793:p.Gly546fs	172.0	0.0	0		120.0	17.0	0.141667	NM_007013	O00307|Q5YLC1|Q96BP4	Frame_Shift_Ins	INS	ENST00000517970.1	hg19	CCDS6242.1																																																																																			.	.	.	none		0.302	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
RELA	5970	hgsc.bcm.edu	37	11	65425828	65425840	+	Frame_Shift_Del	DEL	GGAGACACGCACA	GGAGACACGCACA	-	rs375033007		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	GGAGACACGCACA	GGAGACACGCACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:65425828_65425840delGGAGACACGCACA	ENST00000406246.3	-	8	1056_1068	c.795_807delTGTGCGTGTCTCC	c.(793-807)cctgtgcgtgtctccfs	p.PVRVS265fs	RELA_ENST00000308639.9_Frame_Shift_Del_p.PVRVS262fs|RELA_ENST00000525693.1_Frame_Shift_Del_p.PVRVS265fs	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	265	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						GCAGCTGCATGGAGACACGCACAGGAGCCTGCA	0.634																																					p.266_270del		Atlas-Indel,Pindel	.											.	RELA	44	.	0			c.796_808del						PASS	.																																			SO:0001589	frameshift_variant	5970	exon8			.	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.795_807delTGTGCGTGTCTCC	chr11.hg19:g.65425828_65425840delGGAGACACGCACA	ENSP00000384273:p.Pro265fs	110.0	0.0	0		78.0	18.0	0.230769	NM_001243985	Q6GTV1|Q6SLK1	Frame_Shift_Del	DEL	ENST00000406246.3	hg19	CCDS31609.1																																																																																			.	.	.	none		0.634	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
RAF1	5894	hgsc.bcm.edu	37	3	12653543	12653543	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr3:12653543delT	ENST00000251849.4	-	3	665	c.226delA	c.(226-228)atgfs	p.M76fs	RAF1_ENST00000542177.1_Intron|RAF1_ENST00000442415.2_Frame_Shift_Del_p.M76fs|RAF1_ENST00000534997.1_5'Flank	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	76	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGCAAGCTCATTCCATTTCGC	0.498			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.M76fs		Atlas-Indel,Pindel	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.227delT						PASS	.						154.0	137.0	143.0					3																	12653543		2203	4300	6503	SO:0001589	frameshift_variant	5894	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	.	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.226delA	chr3.hg19:g.12653543delT	ENSP00000251849:p.Met76fs	126.0	0.0	0		118.0	55.0	0.466102	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Frame_Shift_Del	DEL	ENST00000251849.4	hg19	CCDS2612.1																																																																																			.	.	.	none		0.498	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
BCL2L14	79370	hgsc.bcm.edu	37	12	12247627	12247628	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr12:12247627_12247628delCT	ENST00000308721.5	+	5	914_915	c.708_709delCT	c.(706-711)cacttcfs	p.F237fs	BCL2L14_ENST00000589718.1_Frame_Shift_Del_p.F237fs|BCL2L14_ENST00000396369.1_Intron|BCL2L14_ENST00000586576.1_Frame_Shift_Del_p.F270fs|BCL2L14_ENST00000396367.1_Frame_Shift_Del_p.F237fs|BCL2L14_ENST00000266434.4_3'UTR	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	237					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		TGATGGGCCACTTCCAGGATGG	0.49																																					p.236_236del		Atlas-Indel,Pindel	.											.	BCL2L14	47	.	0			c.707_708del						PASS	.																																			SO:0001589	frameshift_variant	79370	exon5			.	AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.708_709delCT	chr12.hg19:g.12247627_12247628delCT	ENSP00000309132:p.Phe237fs	203.0	0.0	0		276.0	71.0	0.257246	NM_138723	A8KAD0|Q96QR5|Q9BZR7	Frame_Shift_Del	DEL	ENST00000308721.5	hg19	CCDS8645.1																																																																																			.	.	.	none		0.490	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355994.3	NM_030766	
RYR3	6263	hgsc.bcm.edu	37	15	34130027	34130027	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr15:34130027delA	ENST00000389232.4	+	89	11916	c.11846delA	c.(11845-11847)gaafs	p.E3949fs	RYR3_ENST00000415757.3_Frame_Shift_Del_p.E3944fs	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3949					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAGGCCATGGAAGGGCAAAAA	0.403																																					p.E3949fs		Atlas-Indel,Pindel	.											.	RYR3	760	.	0			c.11845delG						PASS	.						108.0	103.0	104.0					15																	34130027		1895	4111	6006	SO:0001589	frameshift_variant	6263	exon89			.		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11846delA	chr15.hg19:g.34130027delA	ENSP00000373884:p.Glu3949fs	85.0	0.0	0		83.0	45.0	0.542169	NM_001036	O15175|Q15412	Frame_Shift_Del	DEL	ENST00000389232.4	hg19	CCDS45210.1																																																																																			.	.	.	none		0.403	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
KRTAP19-7	337974	hgsc.bcm.edu	37	21	31933587	31933587	+	Frame_Shift_Del	DEL	A	A	-	rs149420565		TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr21:31933587delA	ENST00000334849.2	-	1	46	c.22delT	c.(22-24)tatfs	p.Y8fs		NM_181614.1	NP_853645.1	Q3SYF9	KR197_HUMAN	keratin associated protein 19-7	8						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	11						AGGCCTCCATAGTAGCTGCCG	0.522																																					p.Y8fs		Atlas-Indel,Pindel	.											.	KRTAP19-7	23	.	0			c.23delA						PASS	.						123.0	106.0	111.0					21																	31933587		2203	4300	6503	SO:0001589	frameshift_variant	337974	exon1			.	AP001708	CCDS13599.1	21q22.1	2006-03-13			ENSG00000244362	ENSG00000244362		"""Keratin associated proteins"""	18942	protein-coding gene	gene with protein product						12359730	Standard	NM_181614		Approved	KAP19.7	uc011adb.2	Q3SYF9	OTTHUMG00000057785	ENST00000334849.2:c.22delT	chr21.hg19:g.31933587delA	ENSP00000334696:p.Tyr8fs	198.0	0.0	0		220.0	104.0	0.472727	NM_181614	Q08EP7	Frame_Shift_Del	DEL	ENST00000334849.2	hg19	CCDS13599.1																																																																																			.	.	.	none		0.522	KRTAP19-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128237.2		
CNTF	1270	hgsc.bcm.edu	37	11	58391968	58391968	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr11:58391968delT	ENST00000361987.4	+	2	656	c.576delT	c.(574-576)catfs	p.H192fs	ZFP91-CNTF_ENST00000389919.4_3'UTR	NM_000614.3	NP_000605.1	P26441	CNTF_HUMAN	ciliary neurotrophic factor	192					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|growth (GO:0040007)|muscle organ morphogenesis (GO:0048644)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of photoreceptor cell differentiation (GO:0046533)|neuron development (GO:0048666)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of retinal cell programmed cell death (GO:0046668)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			NS(1)|breast(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)	10		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GTGGGAGCCATTATATTGCTA	0.468																																					p.H192fs		Atlas-Indel,Pindel	.											.	CNTF	22	.	0			c.575delA						PASS	.						84.0	88.0	86.0					11																	58391968		2201	4295	6496	SO:0001589	frameshift_variant	1270	exon2			.	BC068030	CCDS31554.1	11q12	2011-07-21			ENSG00000242689	ENSG00000242689			2169	protein-coding gene	gene with protein product		118945				1840538, 1714745	Standard	NM_000614		Approved	HCNTF	uc001nna.4	P26441	OTTHUMG00000137476	ENST00000361987.4:c.576delT	chr11.hg19:g.58391968delT	ENSP00000355370:p.His192fs	73.0	0.0	0		68.0	28.0	0.411765	NM_000614	B2RAB2	Frame_Shift_Del	DEL	ENST00000361987.4	hg19	CCDS31554.1																																																																																			.	.	.	none		0.468	CNTF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268673.1	NM_000614	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573409	140573413	+	Frame_Shift_Del	DEL	ACCCA	ACCCA	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	ACCCA	ACCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr5:140573409_140573413delACCCA	ENST00000239446.4	+	1	1468_1472	c.1284_1288delACCCA	c.(1282-1290)acacccaggfs	p.PR429fs		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	429	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTTGGGGACACCCAGGCTGAAAAC	0.532																																					p.428_429del		Pindel	.											.	PCDHB10	177	.	0			c.1283_1287del						PASS	.																																			SO:0001589	frameshift_variant	56126	exon1			.	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1284_1288delACCCA	chr5.hg19:g.140573409_140573413delACCCA	ENSP00000239446:p.Pro429fs	188.0	0.0	.		145.0	23.0	0.159	NM_018930	Q96T99	Frame_Shift_Del	DEL	ENST00000239446.4	hg19	CCDS4252.1																																																																																			.	.	.	none		0.532	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
WWP1	11059	hgsc.bcm.edu	37	8	87447715	87447715	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GL-A59R-01A-11D-A26P-10	TCGA-GL-A59R-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c504d5a9-29b0-4b7e-ac7b-5e543449a0f4	b95ff063-202c-47ad-a9fa-d2f922585ae7	g.chr8:87447715delG	ENST00000517970.1	+	15	1943	c.1636delG	c.(1636-1638)ggcfs	p.G546fs	WWP1_ENST00000341922.2_Frame_Shift_Del_p.G416fs|WWP1_ENST00000265428.4_Frame_Shift_Del_p.G546fs|WWP1_ENST00000349423.2_Frame_Shift_Del_p.G328fs	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	546					central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TTATGAACGCGGCTTTAGGTG	0.303																																					p.R545fs		Pindel	.											.	WWP1	97	.	0			c.1635delC						PASS	.						90.0	91.0	91.0					8																	87447715		2203	4300	6503	SO:0001589	frameshift_variant	11059	exon15			.	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1636delG	chr8.hg19:g.87447715delG	ENSP00000427793:p.Gly546fs	172.0	0.0	.		119.0	15.0	0.126	NM_007013	O00307|Q5YLC1|Q96BP4	Frame_Shift_Del	DEL	ENST00000517970.1	hg19	CCDS6242.1																																																																																			.	.	.	none		0.303	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
