#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DDI2	84301	hgsc.bcm.edu	37	1	15956850	15956850	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr1:15956850C>A	ENST00000480945.1	+	3	470	c.299C>A	c.(298-300)gCt>gAt	p.A100D		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	100							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGTAGTATAGCTGTGCCTGGC	0.473																																					p.A100D		Atlas-SNP	.											.	DDI2	38	.	0			c.C299A						PASS	.						86.0	88.0	87.0					1																	15956850		2203	4300	6503	SO:0001583	missense	84301	exon3			GTATAGCTGTGCC		CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.299C>A	chr1.hg19:g.15956850C>A	ENSP00000417748:p.Ala100Asp	131.0	0.0	.		112.0	24.0	.	NM_032341	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	ENST00000480945.1	hg19	CCDS30607.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182624	0.78677	.	.	ENSG00000197312	ENST00000480945	T	0.23552	1.9	5.9	5.9	0.94986	.	0.130770	0.51477	U	0.000091	T	0.34774	0.0909	M	0.71036	2.16	0.80722	D	1	P	0.44946	0.846	B	0.40101	0.319	T	0.19321	-1.0309	10	0.56958	D	0.05	-28.9484	19.873	0.96856	0.0:1.0:0.0:0.0	.	100	Q5TDH0	DDI2_HUMAN	D	100	ENSP00000417748:A100D	ENSP00000417748:A100D	A	+	2	0	DDI2	15829437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.971000	0.76105	2.802000	0.96397	0.650000	0.86243	GCT	.	.	.	none		0.473	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006826.1	NM_032341	
ST3GAL3	6487	hgsc.bcm.edu	37	1	44290408	44290408	+	Intron	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr1:44290408C>A	ENST00000361392.4	+	4	386				ST3GAL3_ENST00000531993.1_Intron|ST3GAL3_ENST00000461375.1_Intron|ST3GAL3_ENST00000372372.2_Missense_Mutation_p.P56Q|ST3GAL3_ENST00000528371.1_Intron|ST3GAL3_ENST00000545417.1_Intron|ST3GAL3_ENST00000335430.6_Intron|ST3GAL3_ENST00000372375.2_Missense_Mutation_p.P72Q|ST3GAL3_ENST00000372367.1_Intron|ST3GAL3_ENST00000372368.2_Missense_Mutation_p.P72Q|ST3GAL3_ENST00000372377.4_Intron|ST3GAL3_ENST00000372362.2_Intron|ST3GAL3_ENST00000262915.3_Missense_Mutation_p.P87Q|ST3GAL3_ENST00000332628.6_Intron|ST3GAL3_ENST00000372366.1_Intron|ST3GAL3_ENST00000372374.2_Intron|ST3GAL3_ENST00000351035.3_Missense_Mutation_p.P56Q|ST3GAL3_ENST00000533933.1_Intron|ST3GAL3_ENST00000361746.4_Missense_Mutation_p.P87Q|ST3GAL3_ENST00000361400.4_Intron|ST3GAL3_ENST00000531451.1_Intron|ST3GAL3_ENST00000330208.2_Intron|ST3GAL3_ENST00000372369.1_Intron|ST3GAL3_ENST00000347631.2_Intron|ST3GAL3_ENST00000353126.3_Intron|ST3GAL3_ENST00000531816.1_Intron|ST3GAL3_ENST00000361812.4_Intron|ST3GAL3_ENST00000372365.1_Intron	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				TGCAGCTCACCGAGGACTCTC	0.453																																					p.P87Q		Atlas-SNP	.											.	ST3GAL3	56	.	0			c.C260A						PASS	.						98.0	103.0	102.0					1																	44290408		2203	4300	6503	SO:0001627	intron_variant	6487	exon5			GCTCACCGAGGAC	L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.209+9803C>A	chr1.hg19:g.44290408C>A		179.0	0.0	.		141.0	8.0	.	NM_174963	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	hg19	CCDS492.1	.	.	.	.	.	.	.	.	.	.	C	4.533	0.098911	0.08681	.	.	ENSG00000126091	ENST00000262915;ENST00000372375;ENST00000351035;ENST00000361746;ENST00000372368;ENST00000372372	T;T;T;T;T;T	0.56611	0.55;0.54;0.45;0.55;0.54;0.45	2.47	1.54	0.23209	.	.	.	.	.	T	0.44603	0.1301	.	.	.	0.09310	N	1	B;B;B	0.24768	0.111;0.111;0.111	B;B;B	0.36504	0.054;0.054;0.226	T	0.44757	-0.9307	8	0.34782	T	0.22	.	7.2175	0.25967	0.0:0.7224:0.2776:0.0	.	56;72;87	Q11203-19;Q11203-13;Q11203-4	.;.;.	Q	87;72;56;87;72;56	ENSP00000262915:P87Q;ENSP00000361450:P72Q;ENSP00000316999:P56Q;ENSP00000354657:P87Q;ENSP00000361443:P72Q;ENSP00000361447:P56Q	ENSP00000262915:P87Q	P	+	2	0	ST3GAL3	44062995	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.185000	0.09684	0.583000	0.29574	-0.226000	0.12346	CCG	.	.	.	none		0.453	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963	
FAM151A	338094	hgsc.bcm.edu	37	1	55077353	55077353	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr1:55077353C>A	ENST00000302250.2	-	6	1026	c.866G>T	c.(865-867)cGg>cTg	p.R289L	FAM151A_ENST00000371304.2_Missense_Mutation_p.R289L|ACOT11_ENST00000371316.3_Intron	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	289						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						AGTGTTATCCCGGACGTAGAG	0.577																																					p.R289L		Atlas-SNP	.											FAM151A,right_upper_lobe,carcinoma,-1,1	FAM151A	58	.	0			c.G866T						PASS	.						151.0	130.0	137.0					1																	55077353		2203	4300	6503	SO:0001583	missense	338094	exon6			TTATCCCGGACGT	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.866G>T	chr1.hg19:g.55077353C>A	ENSP00000306888:p.Arg289Leu	172.0	0.0	.		134.0	6.0	.	NM_176782	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	ENST00000302250.2	hg19	CCDS594.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.835893	0.91117	.	.	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	T;T	0.14022	2.54;2.54	4.59	4.59	0.56863	.	0.078649	0.48767	D	0.000169	T	0.33411	0.0862	M	0.83953	2.67	0.80722	D	1	P	0.52577	0.954	P	0.53035	0.716	T	0.21008	-1.0258	10	0.54805	T	0.06	-29.9435	16.6818	0.85294	0.0:1.0:0.0:0.0	.	289	Q8WW52	F151A_HUMAN	L	289	ENSP00000306888:R289L;ENSP00000360353:R289L	ENSP00000294370:R289L	R	-	2	0	FAM151A	54849941	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.179000	0.71974	2.520000	0.84964	0.655000	0.94253	CGG	.	.	.	none		0.577	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782	
CCDC88A	55704	hgsc.bcm.edu	37	2	55523606	55523606	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:55523606T>C	ENST00000436346.1	-	30	5720	c.4879A>G	c.(4879-4881)Agc>Ggc	p.S1627G	CCDC88A_ENST00000413716.2_Missense_Mutation_p.S1626G|CCDC88A_ENST00000336838.6_Missense_Mutation_p.S1626G|CCDC88A_ENST00000422883.2_Missense_Mutation_p.S128G|CCDC88A_ENST00000263630.8_Missense_Mutation_p.S1599G	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1627					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TGAAGCAGGCTAAATTCTCCA	0.453																																					p.S1626G		Atlas-SNP	.											.	CCDC88A	336	.	0			c.A4876G						PASS	.						119.0	105.0	110.0					2																	55523606		2203	4300	6503	SO:0001583	missense	55704	exon30			GCAGGCTAAATTC	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4879A>G	chr2.hg19:g.55523606T>C	ENSP00000410608:p.Ser1627Gly	104.0	0.0	.		68.0	19.0	.	NM_001254943	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.68|14.68	2.606920|2.606920	0.46527|0.46527	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000456975	T;T;T;T;T;T|.	0.52295|.	2.4;2.38;2.62;0.67;2.4;1.32|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.000000|.	0.56097|.	U|.	0.000024|.	T|.	0.69024|.	0.3065|.	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999998|0.999998	B;D;D;D;B;D;D|.	0.63046|.	0.005;0.99;0.982;0.982;0.05;0.992;0.99|.	B;D;D;D;B;D;D|.	0.74674|.	0.012;0.979;0.952;0.961;0.019;0.984;0.979|.	T|.	0.67436|.	-0.5671|.	10|.	0.27082|.	T|.	0.32|.	-9.3716|-9.3716	15.4218|15.4218	0.75018|0.75018	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1626;1599;1544;128;1627;1626;1598|.	B7ZM78;Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;.;GRDN_HUMAN;.;.|.	G|W	1626;1599;1627;128;644;1626;802|579	ENSP00000338728:S1626G;ENSP00000263630:S1599G;ENSP00000410608:S1627G;ENSP00000390012:S644G;ENSP00000404431:S1626G;ENSP00000405080:S802G|.	ENSP00000263630:S1599G|.	S|X	-|-	1|2	0|0	CCDC88A|CCDC88A	55377110|55377110	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.274000|7.274000	0.78538|0.78538	2.051000|2.051000	0.60960|0.60960	0.383000|0.383000	0.25322|0.25322	AGC|TAG	.	.	.	none		0.453	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
FAM161A	84140	hgsc.bcm.edu	37	2	62067675	62067675	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:62067675A>T	ENST00000405894.3	-	3	565	c.464T>A	c.(463-465)aTg>aAg	p.M155K	FAM161A_ENST00000404929.1_Missense_Mutation_p.M155K	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	155					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAATGATGTCATTAATGAGAC	0.363																																					p.M155K		Atlas-SNP	.											.	FAM161A	200	.	0			c.T464A						PASS	.						104.0	91.0	95.0					2																	62067675		1846	4096	5942	SO:0001583	missense	84140	exon3			GATGTCATTAATG		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.464T>A	chr2.hg19:g.62067675A>T	ENSP00000385893:p.Met155Lys	90.0	0.0	.		67.0	8.0	.	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	hg19	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002006	0.35320	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.20598	2.87;2.06	5.3	-0.661	0.11417	.	1.199220	0.05573	N	0.571416	T	0.17323	0.0416	L	0.51422	1.61	0.09310	N	1	B;B	0.28233	0.204;0.018	B;B	0.21708	0.036;0.013	T	0.29119	-1.0022	9	.	.	.	-6.764	4.6748	0.12706	0.4925:0.0:0.1664:0.3411	.	155;155	Q3B820;Q3B820-3	F161A_HUMAN;.	K	155	ENSP00000385158:M155K;ENSP00000385893:M155K	.	M	-	2	0	FAM161A	61921179	0.001000	0.12720	0.000000	0.03702	0.743000	0.42351	0.901000	0.28445	-0.003000	0.14444	-0.490000	0.04691	ATG	.	.	.	none		0.363	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
MAT2A	4144	hgsc.bcm.edu	37	2	85770091	85770091	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:85770091A>T	ENST00000306434.3	+	8	1142	c.1019A>T	c.(1018-1020)aAg>aTg	p.K340M	MAT2A_ENST00000409017.1_Missense_Mutation_p.K277M	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	340					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	ACCTCTCAGAAGAGTGAGAGA	0.398																																					p.K340M		Atlas-SNP	.											.	MAT2A	23	.	0			c.A1019T						PASS	.						153.0	156.0	155.0					2																	85770091		2203	4300	6503	SO:0001583	missense	4144	exon8			CTCAGAAGAGTGA		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.1019A>T	chr2.hg19:g.85770091A>T	ENSP00000303147:p.Lys340Met	172.0	0.0	.		143.0	28.0	.	NM_005911	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	hg19	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.358960	0.41801	.	.	ENSG00000168906	ENST00000306434;ENST00000424323;ENST00000409017	D;D	0.97688	-4.49;-4.49	5.8	5.8	0.92144	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95230	0.8453	L	0.39692	1.235	0.58432	D	0.999993	B;B	0.16802	0.019;0.019	B;B	0.18263	0.021;0.021	D	0.92657	0.6138	10	0.31617	T	0.26	-9.6104	14.0949	0.65013	1.0:0.0:0.0:0.0	.	340;340	B4DEX8;P31153	.;METK2_HUMAN	M	340;121;277	ENSP00000303147:K340M;ENSP00000386353:K277M	ENSP00000303147:K340M	K	+	2	0	MAT2A	85623602	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.899000	0.69846	2.209000	0.71365	0.460000	0.39030	AAG	.	.	.	none		0.398	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	
PHOSPHO2	493911	hgsc.bcm.edu	37	2	170557930	170557930	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:170557930A>G	ENST00000359744.3	+	4	837	c.449A>G	c.(448-450)aAt>aGt	p.N150S	KLHL23_ENST00000272797.4_Intron|KLHL23_ENST00000602521.1_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	150							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						TGCCCAAAGAATCTTTGCAAA	0.308																																					p.N150S		Atlas-SNP	.											.	PHOSPHO2	27	.	0			c.A449G						PASS	.						64.0	65.0	64.0					2																	170557930		2203	4299	6502	SO:0001583	missense	493911	exon4			CAAAGAATCTTTG	BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.449A>G	chr2.hg19:g.170557930A>G	ENSP00000352782:p.Asn150Ser	90.0	0.0	.		75.0	13.0	.	NM_001199286	B2RC30|D3DPC7	Missense_Mutation	SNP	ENST00000359744.3	hg19	CCDS33319.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082674	0.76528	.	.	ENSG00000144362	ENST00000359744	T	0.61980	0.06	5.96	5.96	0.96718	HAD-like domain (2);	0.000000	0.85682	U	0.000000	D	0.82508	0.5052	M	0.89353	3.025	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.84925	0.0856	10	0.52906	T	0.07	.	16.4219	0.83766	1.0:0.0:0.0:0.0	.	150	Q8TCD6	PHOP2_HUMAN	S	150	ENSP00000352782:N150S	ENSP00000352782:N150S	N	+	2	0	PHOSPHO2	170266176	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.155000	0.89643	2.282000	0.76494	0.533000	0.62120	AAT	.	.	.	none		0.308	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333304.1	NM_001008489	
OR6B2	389090	hgsc.bcm.edu	37	2	240969643	240969643	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:240969643G>C	ENST00000402971.2	-	1	263	c.204C>G	c.(202-204)ttC>ttG	p.F68L		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		AGATCTCCAGGAAAGACATGG	0.557																																					p.F68L		Atlas-SNP	.											.	OR6B2	30	.	0			c.C204G						PASS	.						117.0	127.0	124.0					2																	240969643		2117	4242	6359	SO:0001583	missense	389090	exon1			CTCCAGGAAAGAC		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.204C>G	chr2.hg19:g.240969643G>C	ENSP00000384563:p.Phe68Leu	242.0	0.0	.		168.0	20.0	.	NM_001005853	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	hg19	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	N	4.356	0.065626	0.08388	.	.	ENSG00000182083	ENST00000402971	T	0.00966	5.49	4.35	0.501	0.16925	GPCR, rhodopsin-like superfamily (1);	0.813827	0.10478	N	0.669897	T	0.00967	0.0032	L	0.29908	0.895	0.09310	N	1	B	0.19583	0.037	B	0.22601	0.04	T	0.45818	-0.9235	10	0.38643	T	0.18	.	8.2409	0.31660	0.3395:0.0:0.6605:0.0	.	68	Q6IFH4	OR6B2_HUMAN	L	68	ENSP00000384563:F68L	ENSP00000384563:F68L	F	-	3	2	OR6B2	240618316	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.228000	0.09114	-0.029000	0.13827	-0.237000	0.12165	TTC	.	.	.	none		0.557	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
ERC2	26059	hgsc.bcm.edu	37	3	56026194	56026194	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:56026194G>T	ENST00000288221.6	-	11	2401	c.2146C>A	c.(2146-2148)Cgc>Agc	p.R716S		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	716						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		CACTCGTCGCGGTAGTAAGAC	0.473																																					p.R716S		Atlas-SNP	.											ERC2_ENST00000288221,caecum,carcinoma,0,2	ERC2	221	.	0			c.C2146A						PASS	.						192.0	187.0	189.0					3																	56026194		1911	4126	6037	SO:0001583	missense	26059	exon11			CGTCGCGGTAGTA	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2146C>A	chr3.hg19:g.56026194G>T	ENSP00000288221:p.Arg716Ser	308.0	1.0	.		317.0	14.0	.	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699414	0.48307	.	.	ENSG00000187672	ENST00000288221	T	0.43688	0.94	5.69	5.69	0.88448	.	0.049024	0.85682	D	0.000000	T	0.42404	0.1201	M	0.70275	2.135	0.40723	D	0.982676	P	0.34815	0.47	B	0.30646	0.118	T	0.48625	-0.9019	10	0.66056	D	0.02	-8.2645	12.8431	0.57815	0.0:0.0:0.7287:0.2713	.	716	O15083	ERC2_HUMAN	S	716	ENSP00000288221:R716S	ENSP00000288221:R716S	R	-	1	0	ERC2	56001234	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.782000	0.62396	2.699000	0.92147	0.591000	0.81541	CGC	.	.	.	none		0.473	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
THAP9	79725	hgsc.bcm.edu	37	4	83839493	83839493	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr4:83839493G>A	ENST00000302236.5	+	5	2179	c.2128G>A	c.(2128-2130)Gat>Aat	p.D710N	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	710					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AGACCTGTCAGATCATAGGCG	0.423																																					p.D710N		Atlas-SNP	.											.	THAP9	65	.	0			c.G2128A						PASS	.						117.0	101.0	106.0					4																	83839493		2203	4300	6503	SO:0001583	missense	79725	exon5			CTGTCAGATCATA	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.2128G>A	chr4.hg19:g.83839493G>A	ENSP00000305533:p.Asp710Asn	101.0	0.0	.		107.0	26.0	.	NM_024672	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	hg19	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	G	3.185	-0.167102	0.06461	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.90069	-2.61	3.87	3.02	0.34903	.	0.462748	0.18401	N	0.142355	T	0.77805	0.4185	N	0.22421	0.69	0.09310	N	0.999994	B	0.23058	0.079	B	0.21546	0.035	T	0.62124	-0.6920	10	0.22706	T	0.39	-12.7397	5.7567	0.18176	0.1093:0.218:0.6727:0.0	.	710	Q9H5L6	THAP9_HUMAN	N	710	ENSP00000305533:D710N	ENSP00000305533:D710N	D	+	1	0	THAP9	84058517	0.016000	0.18221	0.085000	0.20634	0.025000	0.11179	1.445000	0.35079	1.203000	0.43233	0.655000	0.94253	GAT	.	.	.	none		0.423	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
NR3C2	4306	hgsc.bcm.edu	37	4	149075914	149075914	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr4:149075914G>C	ENST00000358102.3	-	5	2515	c.2153C>G	c.(2152-2154)tCg>tGg	p.S718W	NR3C2_ENST00000355292.3_Missense_Mutation_p.S722W|NR3C2_ENST00000503313.1_5'UTR|NR3C2_ENST00000512865.1_Intron|NR3C2_ENST00000511528.1_Missense_Mutation_p.S722W|NR3C2_ENST00000344721.4_Missense_Mutation_p.S718W|RP11-76G10.1_ENST00000514843.1_RNA	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	718	Hinge.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S718L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TGTGTTGACCGAGGGTTCTTT	0.567																																					p.S718W	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											NR3C2,colon,carcinoma,0,1	NR3C2	94	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2153G						PASS	.						192.0	172.0	179.0					4																	149075914		2203	4300	6503	SO:0001583	missense	4306	exon5			TTGACCGAGGGTT	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2153C>G	chr4.hg19:g.149075914G>C	ENSP00000350815:p.Ser718Trp	289.0	0.0	.		177.0	30.0	.	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	hg19	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928892	0.52759	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000511528	D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71	5.57	5.57	0.84162	.	0.406531	0.27932	N	0.017264	D	0.94318	0.8174	M	0.77313	2.365	0.52501	D	0.99995	D	0.63880	0.993	P	0.56514	0.8	D	0.93801	0.7101	9	.	.	.	.	19.5581	0.95361	0.0:0.0:1.0:0.0	.	718	B0ZBF6	.	W	718;722;718;722	ENSP00000341390:S718W;ENSP00000347441:S722W;ENSP00000350815:S718W;ENSP00000421481:S722W	.	S	-	2	0	NR3C2	149295364	0.985000	0.35326	0.611000	0.29010	0.430000	0.31655	3.814000	0.55643	2.614000	0.88457	0.655000	0.94253	TCG	.	.	.	none		0.567	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
SREK1	140890	hgsc.bcm.edu	37	5	65466769	65466769	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr5:65466769C>T	ENST00000380918.3	+	10	1790	c.1130C>T	c.(1129-1131)tCc>tTc	p.S377F	SREK1_ENST00000284041.3_3'UTR|SREK1_ENST00000334121.6_Missense_Mutation_p.S493F	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	377	Arg/Glu/Lys/Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCTCGTAGTTCCAGCAGGTTT	0.368																																					p.S493F	GBM(10;31 347 27684 38976 41583)	Atlas-SNP	.											.	SREK1	58	.	0			c.C1478T						PASS	.						60.0	66.0	64.0					5																	65466769		2200	4297	6497	SO:0001583	missense	140890	exon9			GTAGTTCCAGCAG	AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.1130C>T	chr5.hg19:g.65466769C>T	ENSP00000370305:p.Ser377Phe	63.0	0.0	.		69.0	17.0	.	NM_001077199	A4FTW3|Q2M1J0|Q86X37	Missense_Mutation	SNP	ENST00000380918.3	hg19	CCDS3991.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.67|16.67	3.186680|3.186680	0.57909|0.57909	.|.	.|.	ENSG00000153914|ENSG00000153914	ENST00000537482|ENST00000334121;ENST00000380918	.|T;T	.|0.11821	.|2.74;2.74	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.330683	.|0.31167	.|N	.|0.008136	T|T	0.11580|0.11580	0.0282|0.0282	N|N	0.19112|0.19112	0.55|0.55	0.31022|0.31022	N|N	0.718059|0.718059	.|P;P	.|0.40794	.|0.61;0.729	.|B;B	.|0.38056	.|0.135;0.264	T|T	0.02269|0.02269	-1.1185|-1.1185	6|10	0.44086|0.56958	T|D	0.13|0.05	.|.	18.2481|18.2481	0.89993|0.89993	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|377;493	.|Q8WXA9;Q8WXA9-2	.|SREK1_HUMAN;.	S|F	493|493;377	.|ENSP00000334538:S493F;ENSP00000370305:S377F	ENSP00000445557:P493S|ENSP00000334538:S493F	P|S	+|+	1|2	0|0	SREK1|SREK1	65502525|65502525	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.322000|4.322000	0.59215|0.59215	2.409000|2.409000	0.81822|0.81822	0.650000|0.650000	0.86243|0.86243	CCA|TCC	.	.	.	none		0.368	SREK1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381118.1	NM_001077199	
STK32A	202374	hgsc.bcm.edu	37	5	146752790	146752790	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr5:146752790C>A	ENST00000397936.3	+	10	1169	c.836C>A	c.(835-837)cCg>cAg	p.P279Q	STK32A_ENST00000398523.3_Missense_Mutation_p.P279Q	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.P279Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGAACTTCCCGTATATGAAT	0.398																																					p.P279Q		Atlas-SNP	.											.	STK32A	54	.	1	Substitution - Missense(1)	lung(1)	c.C836A						PASS	.						166.0	154.0	158.0					5																	146752790		1568	3582	5150	SO:0001583	missense	202374	exon10			ACTTCCCGTATAT		CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.836C>A	chr5.hg19:g.146752790C>A	ENSP00000381030:p.Pro279Gln	268.0	0.0	.		242.0	10.0	.	NM_001112724	B3KSY0	Missense_Mutation	SNP	ENST00000397936.3	hg19	CCDS47299.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653447	0.67472	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	T;T	0.31247	1.5;1.5	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.170944	0.28187	N	0.016272	T	0.55924	0.1951	M	0.77313	2.365	0.80722	D	1	D;D;P	0.58620	0.983;0.961;0.861	P;P;P	0.60117	0.869;0.593;0.533	T	0.58803	-0.7572	10	0.72032	D	0.01	.	18.5479	0.91054	0.0:1.0:0.0:0.0	.	279;279;279	B7Z9H7;Q8WU08;Q8WU08-3	.;ST32A_HUMAN;.	Q	279	ENSP00000381030:P279Q;ENSP00000381535:P279Q	ENSP00000381030:P279Q	P	+	2	0	STK32A	146732983	1.000000	0.71417	0.960000	0.40013	0.482000	0.33219	5.407000	0.66363	2.676000	0.91093	0.591000	0.81541	CCG	.	.	.	none		0.398	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373306.1	NM_145001	
SCUBE3	222663	hgsc.bcm.edu	37	6	35213840	35213840	+	Missense_Mutation	SNP	C	C	A	rs142335824	byFrequency	TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:35213840C>A	ENST00000274938.7	+	20	2719	c.2719C>A	c.(2719-2721)Cgt>Agt	p.R907S	SCUBE3_ENST00000394681.1_Missense_Mutation_p.R923S	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CAACAGCGCCCGTGGCTTCCA	0.542																																					p.R907S		Atlas-SNP	.											.	SCUBE3	99	.	0			c.C2719A						PASS	.						144.0	148.0	147.0					6																	35213840		2203	4300	6503	SO:0001583	missense	222663	exon20			AGCGCCCGTGGCT	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2719C>A	chr6.hg19:g.35213840C>A	ENSP00000274938:p.Arg907Ser	278.0	0.0	.		186.0	8.0	.	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	hg19	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800654	0.70567	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	T;T	0.17691	2.26;2.26	5.63	4.68	0.58851	CUB (5);	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	L	0.28054	0.825	0.47659	D	0.999488	D;D	0.76494	0.998;0.999	D;D	0.85130	0.994;0.997	T	0.02437	-1.1159	10	0.87932	D	0	.	15.5773	0.76400	0.2218:0.7782:0.0:0.0	.	923;907	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	S	923;907	ENSP00000378174:R923S;ENSP00000274938:R907S	ENSP00000274938:R907S	R	+	1	0	SCUBE3	35321818	0.995000	0.38212	1.000000	0.80357	0.979000	0.70002	1.636000	0.37144	2.659000	0.90383	0.650000	0.86243	CGT	.	C|1.000;T|0.000	.	alt		0.542	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SGK1	6446	hgsc.bcm.edu	37	6	134495704	134495704	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:134495704T>C	ENST00000237305.7	-	2	185	c.97A>G	c.(97-99)Atg>Gtg	p.M33V	SGK1_ENST00000413996.3_Missense_Mutation_p.M47V|SGK1_ENST00000367858.5_Missense_Mutation_p.M128V|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000528577.1_Missense_Mutation_p.M61V|SGK1_ENST00000475719.2_Missense_Mutation_p.M33V|SGK1_ENST00000367857.5_Missense_Mutation_p.M23V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	33	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCAGACCCATCCTCCTCTGC	0.423											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M128V		Atlas-SNP	.											.	SGK1	387	.	0			c.A382G						PASS	.						81.0	81.0	81.0					6																	134495704		2203	4300	6503	SO:0001583	missense	6446	exon4			GACCCATCCTCCT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.97A>G	chr6.hg19:g.134495704T>C	ENSP00000237305:p.Met33Val	70.0	0.0	.	1611	51.0	7.0	.	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	hg19	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.121060	0.56613	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.38401	1.66;1.66;1.66;1.66;1.66;1.66;1.14	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.47488	0.1448	M	0.62723	1.935	0.80722	D	1	B;P;B;B;B;B	0.48911	0.01;0.917;0.004;0.001;0.019;0.002	B;D;B;B;B;B	0.63488	0.018;0.915;0.008;0.01;0.032;0.008	T	0.38628	-0.9652	10	0.41790	T	0.15	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	61;47;33;23;128;33	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	128;47;33;23;61;33;97	ENSP00000356832:M128V;ENSP00000396242:M47V;ENSP00000237305:M33V;ENSP00000356831:M23V;ENSP00000434450:M61V;ENSP00000434302:M33V;ENSP00000435577:M97V	ENSP00000237305:M33V	M	-	1	0	SGK1	134537397	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	ATG	.	.	.	none		0.423	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
KMT2E	55904	hgsc.bcm.edu	37	7	104748161	104748161	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr7:104748161A>T	ENST00000311117.3	+	22	3802	c.3257A>T	c.(3256-3258)gAc>gTc	p.D1086V	KMT2E_ENST00000257745.4_Missense_Mutation_p.D1086V|KMT2E_ENST00000334914.7_Missense_Mutation_p.D141V|SRPK2_ENST00000493638.1_5'Flank|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Missense_Mutation_p.D1086V	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1086					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AACTTGAGGGACCTGACACCC	0.498																																					p.D1086V		Atlas-SNP	.											.	MLL5	173	.	0			c.A3257T						PASS	.						83.0	82.0	82.0					7																	104748161		2203	4300	6503	SO:0001583	missense	55904	exon21			TGAGGGACCTGAC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3257A>T	chr7.hg19:g.104748161A>T	ENSP00000312379:p.Asp1086Val	54.0	0.0	.		65.0	22.0	.	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704341	0.88924	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.96136	-3.92;-3.2;-3.92;-0.21	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.96222	0.8768	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97101	0.9797	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	1086	Q8IZD2	MLL5_HUMAN	V	1086;1086;1086;1006;1086;141	ENSP00000312379:D1086V;ENSP00000335599:D1086V;ENSP00000257745:D1086V;ENSP00000333986:D141V	ENSP00000257745:D1086V	D	+	2	0	MLL5	104535397	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	8.690000	0.91272	2.302000	0.77476	0.533000	0.62120	GAC	.	.	.	none		0.498	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
TTC26	79989	hgsc.bcm.edu	37	7	138822639	138822639	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr7:138822639T>C	ENST00000464848.1	+	3	268	c.188T>C	c.(187-189)aTt>aCt	p.I63T	TTC26_ENST00000343187.4_Intron|TTC26_ENST00000474035.2_Missense_Mutation_p.I63T|TTC26_ENST00000430935.1_Missense_Mutation_p.I63T|TTC26_ENST00000495038.1_Missense_Mutation_p.I63T|TTC26_ENST00000481482.1_3'UTR|TTC26_ENST00000478836.2_Missense_Mutation_p.I63T			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	63					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						AATTTGTGGATTGGATATTGT	0.323																																					p.I63T		Atlas-SNP	.											.	TTC26	50	.	0			c.T188C						PASS	.						154.0	153.0	153.0					7																	138822639		2203	4300	6503	SO:0001583	missense	79989	exon3			TGTGGATTGGATA	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.188T>C	chr7.hg19:g.138822639T>C	ENSP00000419279:p.Ile63Thr	82.0	0.0	.		110.0	7.0	.	NM_001144920	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	ENST00000464848.1	hg19	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.717383	0.48622	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000474035;ENST00000478836;ENST00000464848	T;T;T;T;T	0.77229	-1.08;1.52;-1.08;1.15;-1.08	6.05	6.05	0.98169	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.287285	0.37761	N	0.001947	T	0.76550	0.4003	L	0.39245	1.2	0.58432	D	0.999996	P;B;P;B;B	0.41188	0.605;0.012;0.741;0.004;0.137	P;B;P;B;B	0.45660	0.489;0.018;0.489;0.012;0.062	T	0.77720	-0.2482	10	0.52906	T	0.07	.	15.5826	0.76455	0.0:0.0:0.0:1.0	.	63;63;63;63;63	B7Z2T3;C9J2N7;B7Z6R6;A0AVF1;Q96CU4	.;.;.;TTC26_HUMAN;.	T	63	ENSP00000410655:I63T;ENSP00000418788:I63T;ENSP00000443253:I63T;ENSP00000419178:I63T;ENSP00000419279:I63T	ENSP00000410655:I63T	I	+	2	0	TTC26	138473179	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.353000	0.59411	2.323000	0.78572	0.533000	0.62120	ATT	.	.	.	none		0.323	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926	
AGPAT6	137964	hgsc.bcm.edu	37	8	41467379	41467379	+	Silent	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr8:41467379C>T	ENST00000396987.3	+	4	1368	c.441C>T	c.(439-441)agC>agT	p.S147S	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	147					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ACCTGCTGAGCAGAACCAATT	0.493																																					p.S147S		Atlas-SNP	.											AGPAT6,caecum,carcinoma,0,1	AGPAT6	32	.	0			c.C441T						PASS	.						98.0	96.0	97.0					8																	41467379		2203	4300	6503	SO:0001819	synonymous_variant	137964	exon4			GCTGAGCAGAACC	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.441C>T	chr8.hg19:g.41467379C>T		150.0	0.0	.		124.0	30.0	.	NM_178819	Q86V89	Silent	SNP	ENST00000396987.3	hg19	CCDS6117.1																																																																																			.	.	.	none		0.493	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
CDC37L1	55664	hgsc.bcm.edu	37	9	4706079	4706079	+	Silent	SNP	A	A	G	rs200977934		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:4706079A>G	ENST00000381854.3	+	7	1183	c.981A>G	c.(979-981)gaA>gaG	p.E327E		NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	327	Interaction with Hsp70.|Required for interaction with STIP1.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		TACATAAAGAAGATGATGAAC	0.393																																					p.E327E		Atlas-SNP	.											.	CDC37L1	19	.	0			c.A981G						PASS	.						130.0	112.0	118.0					9																	4706079		2203	4300	6503	SO:0001819	synonymous_variant	55664	exon7			TAAAGAAGATGAT	AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.981A>G	chr9.hg19:g.4706079A>G		50.0	0.0	.		46.0	6.0	.	NM_017913	B1AL70|Q9NWS3|Q9NX16	Silent	SNP	ENST00000381854.3	hg19	CCDS6454.1																																																																																			.	.	.	alt		0.393	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051564.1	NM_017913	
CACFD1	11094	hgsc.bcm.edu	37	9	136333115	136333115	+	Silent	SNP	G	G	A	rs150411088		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:136333115G>A	ENST00000316948.4	+	4	473	c.393G>A	c.(391-393)acG>acA	p.T131T	CACFD1_ENST00000540581.1_Silent_p.T131T|CACFD1_ENST00000542192.1_Silent_p.T89T|CACFD1_ENST00000291722.7_Silent_p.T89T	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	131					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)										CCTTTGCTACGGGGGTGCTGT	0.657																																					p.T131T		Atlas-SNP	.											.	CACFD1	1	.	0			c.G393A						PASS	.	G	,,,	1,4405	2.1+/-5.4	0,1,2202	76.0	68.0	70.0		267,393,267,393	-10.8	0.2	9	dbSNP_134	70	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	C9orf7	NM_001135775.2,NM_001242369.1,NM_001242370.1,NM_017586.3	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	89/131,131/234,89/192,131/173	136333115	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11094	exon4			TGCTACGGGGGTG		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.393G>A	chr9.hg19:g.136333115G>A		68.0	0.0	.		59.0	16.0	.	NM_017586	B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Silent	SNP	ENST00000316948.4	hg19	CCDS6974.1																																																																																			.	G|1.000;A|0.000	0.000	weak		0.657	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1	NM_017586	
ARHGAP19	84986	hgsc.bcm.edu	37	10	98995038	98995038	+	Missense_Mutation	SNP	C	C	A	rs368950765		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr10:98995038C>A	ENST00000358531.4	-	9	1248	c.1220G>T	c.(1219-1221)cGa>cTa	p.R407L	ARHGAP19_ENST00000487035.1_5'UTR|ARHGAP19_ENST00000355366.5_Missense_Mutation_p.R398L|ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.R378L|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.R407L|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.R407L|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.R398L	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	407					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		AGAAGGTTCTCGCCCTGGTGT	0.433																																					p.R407L		Atlas-SNP	.											.	ARHGAP19	72	.	0			c.G1220T						PASS	.						143.0	143.0	143.0					10																	98995038		2203	4300	6503	SO:0001583	missense	84986	exon9			GGTTCTCGCCCTG	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.1220G>T	chr10.hg19:g.98995038C>A	ENSP00000351333:p.Arg407Leu	217.0	0.0	.		198.0	8.0	.	NM_032900	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	hg19	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828677	0.32329	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000393817;ENST00000358308	T;T;T;T;T;T	0.09817	3.09;3.11;3.11;3.11;3.11;2.94	5.44	2.43	0.29744	.	1.149010	0.06642	U	0.761313	T	0.09774	0.0240	L	0.36672	1.1	0.09310	N	1	B;B;B	0.25486	0.117;0.078;0.127	B;B;B	0.28011	0.056;0.039;0.085	T	0.35126	-0.9801	10	0.49607	T	0.09	-6.5763	3.8056	0.08776	0.1369:0.5215:0.2498:0.0918	.	378;407;398	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	L	407;407;398;407;398;226;378	ENSP00000414774:R407L;ENSP00000324468:R407L;ENSP00000347526:R398L;ENSP00000351333:R407L;ENSP00000360066:R398L;ENSP00000351058:R378L	ENSP00000324468:R407L	R	-	2	0	ARHGAP19	98985028	0.000000	0.05858	0.952000	0.39060	0.704000	0.40688	0.227000	0.17795	1.428000	0.47296	0.655000	0.94253	CGA	.	.	.	none		0.433	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
NDUFS3	4722	hgsc.bcm.edu	37	11	47604000	47604000	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:47604000C>T	ENST00000263774.4	+	6	689	c.607C>T	c.(607-609)Cct>Tct	p.P203S	NDUFS3_ENST00000533507.1_3'UTR	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	203					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	GAAAGACTTTCCTCTATCTGG	0.512																																					p.P203S	Pancreas(15;551 601 22438 23457 52512)	Atlas-SNP	.											.	NDUFS3	19	.	0			c.C607T						PASS	.						261.0	270.0	267.0					11																	47604000		2201	4298	6499	SO:0001583	missense	4722	exon6			GACTTTCCTCTAT	AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.607C>T	chr11.hg19:g.47604000C>T	ENSP00000263774:p.Pro203Ser	512.0	1.0	.		378.0	86.0	.	NM_004551	B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	ENST00000263774.4	hg19	CCDS7941.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261674	0.95368	.	.	ENSG00000213619	ENST00000263774	D	0.88124	-2.34	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.95544	0.8552	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.972;0.979	D	0.95909	0.8921	10	0.87932	D	0	-17.4651	20.206	0.98277	0.0:1.0:0.0:0.0	.	203;129	O75489;Q9UF24	NDUS3_HUMAN;.	S	203	ENSP00000263774:P203S	ENSP00000263774:P203S	P	+	1	0	NDUFS3	47560576	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.474000	0.81024	2.785000	0.95823	0.655000	0.94253	CCT	.	.	.	none		0.512	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391749.1	NM_004551	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73020521	73020521	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:73020521G>T	ENST00000263674.3	+	1	1188	c.838G>T	c.(838-840)Gac>Tac	p.D280Y	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	280					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CAGTGACGACGACCGAGACGG	0.697																																					p.D280Y		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.G838T						PASS	.						16.0	21.0	20.0					11																	73020521		2151	4242	6393	SO:0001583	missense	9828	exon1			GACGACGACCGAG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.838G>T	chr11.hg19:g.73020521G>T	ENSP00000263674:p.Asp280Tyr	82.0	0.0	.		50.0	13.0	.	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677629	0.47886	.	.	ENSG00000110237	ENST00000263674	T	0.68181	-0.31	4.72	4.72	0.59763	.	0.000000	0.40554	N	0.001072	T	0.60495	0.2273	L	0.27053	0.805	0.09310	N	0.999994	P	0.49447	0.924	P	0.46419	0.516	T	0.60239	-0.7302	10	0.87932	D	0	-17.9023	15.1972	0.73100	0.0:0.0:1.0:0.0	.	280	Q96PE2	ARHGH_HUMAN	Y	280	ENSP00000263674:D280Y	ENSP00000263674:D280Y	D	+	1	0	ARHGEF17	72698169	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	4.087000	0.57671	2.179000	0.69175	0.313000	0.20887	GAC	.	.	.	none		0.697	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
KCTD14	65987	hgsc.bcm.edu	37	11	77727916	77727916	+	Missense_Mutation	SNP	C	C	A	rs372373172	byFrequency	TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:77727916C>A	ENST00000353172.5	-	2	535	c.491G>T	c.(490-492)cGg>cTg	p.R164L	RP11-7I15.3_ENST00000533697.1_RNA|KCTD14_ENST00000533144.1_Missense_Mutation_p.R134L	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	164					protein homooligomerization (GO:0051260)					endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			GCTGGACTTCCGTGCTGTTAT	0.532																																					p.R164L	NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	Atlas-SNP	.											.	KCTD14	32	.	0			c.G491T						PASS	.						116.0	110.0	112.0					11																	77727916		2200	4292	6492	SO:0001583	missense	65987	exon2			GACTTCCGTGCTG	BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.491G>T	chr11.hg19:g.77727916C>A	ENSP00000316482:p.Arg164Leu	227.0	0.0	.		195.0	8.0	.	NM_023930	B2R9R8	Missense_Mutation	SNP	ENST00000353172.5	hg19	CCDS8255.2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030615	0.75504	.	.	ENSG00000151364	ENST00000353172;ENST00000533144	T;T	0.71341	-0.56;-0.49	4.52	4.52	0.55395	.	0.059470	0.64402	D	0.000001	D	0.84515	0.5489	M	0.81802	2.56	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.87008	0.2121	10	0.72032	D	0.01	.	16.4381	0.83884	0.0:1.0:0.0:0.0	.	164	Q9BQ13	KCD14_HUMAN	L	164;134	ENSP00000316482:R164L;ENSP00000431155:R134L	ENSP00000316482:R164L	R	-	2	0	KCTD14	77405564	0.999000	0.42202	0.061000	0.19648	0.015000	0.08874	4.182000	0.58310	2.356000	0.79943	0.561000	0.74099	CGG	.	.	.	alt		0.532	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316888.1	NM_023930	
KMT2D	8085	hgsc.bcm.edu	37	12	49446075	49446075	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:49446075G>A	ENST00000301067.7	-	10	1390	c.1391C>T	c.(1390-1392)gCa>gTa	p.A464V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	464	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CAGGCGTGATGCCTCAGGTGG	0.657																																					p.A464V		Atlas-SNP	.											.	MLL2	1173	.	0			c.C1391T						PASS	.						88.0	98.0	94.0					12																	49446075		2162	4235	6397	SO:0001583	missense	8085	exon10			CGTGATGCCTCAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1391C>T	chr12.hg19:g.49446075G>A	ENSP00000301067:p.Ala464Val	166.0	0.0	.		180.0	48.0	.	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	7.479	0.648310	0.14516	.	.	ENSG00000167548	ENST00000301067	T	0.80393	-1.37	3.73	2.82	0.32997	.	.	.	.	.	T	0.58807	0.2148	N	0.08118	0	0.21841	N	0.999512	P	0.38395	0.629	B	0.29440	0.102	T	0.53844	-0.8381	9	0.87932	D	0	.	8.8235	0.35041	0.0:0.0:0.5915:0.4085	.	464	O14686	MLL2_HUMAN	V	464	ENSP00000301067:A464V	ENSP00000301067:A464V	A	-	2	0	MLL2	47732342	0.989000	0.36119	0.999000	0.59377	0.673000	0.39480	0.945000	0.29056	1.130000	0.42092	0.313000	0.20887	GCA	.	.	.	none		0.657	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
HSPB8	26353	hgsc.bcm.edu	37	12	119617182	119617182	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:119617182G>T	ENST00000281938.2	+	1	736	c.65G>T	c.(64-66)cGg>cTg	p.R22L	RP11-64B16.3_ENST00000538405.1_RNA|RP11-64B16.4_ENST00000535921.1_RNA	NM_014365.2	NP_055180.1	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	22					cell death (GO:0008219)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	14	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACCCCTTCCGGGACTCTCCC	0.632																																					p.R22L		Atlas-SNP	.											.	HSPB8	45	.	0			c.G65T						PASS	.						98.0	114.0	109.0					12																	119617182		2203	4300	6503	SO:0001583	missense	26353	exon1			CCTTCCGGGACTC	AF191017	CCDS9189.1	12q24.23	2014-09-17	2004-04-23					"""Heat shock proteins / HSPB"""	30171	protein-coding gene	gene with protein product		608014	"""heat shock 27kDa protein 8"""			10833516, 11085516	Standard	NM_014365		Approved	H11, E2IG1, HSP22, HspB8	uc001txb.3	Q9UJY1		ENST00000281938.2:c.65G>T	chr12.hg19:g.119617182G>T	ENSP00000281938:p.Arg22Leu	315.0	0.0	.		271.0	14.0	.	NM_014365	B2R6A6|Q6FIH3|Q9UKS3	Missense_Mutation	SNP	ENST00000281938.2	hg19	CCDS9189.1	.	.	.	.	.	.	.	.	.	.	G	34	5.327752	0.95733	.	.	ENSG00000152137	ENST00000281938	D	0.88277	-2.36	4.42	4.42	0.53409	.	0.059974	0.64402	D	0.000003	D	0.92515	0.7623	M	0.72894	2.215	0.58432	D	0.999999	D	0.63880	0.993	P	0.58013	0.831	D	0.92579	0.6073	9	.	.	.	.	17.2157	0.86943	0.0:0.0:1.0:0.0	.	22	Q9UJY1	HSPB8_HUMAN	L	22	ENSP00000281938:R22L	.	R	+	2	0	HSPB8	118101565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.646000	0.91053	2.294000	0.77228	0.563000	0.77884	CGG	.	.	.	none		0.632	HSPB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401647.1	NM_014365	
OGFOD2	79676	hgsc.bcm.edu	37	12	123463804	123463804	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:123463804C>G	ENST00000228922.7	+	7	996	c.964C>G	c.(964-966)Cgt>Ggt	p.R322G	OGFOD2_ENST00000454694.2_Missense_Mutation_p.R158G|ARL6IP4_ENST00000543566.1_5'Flank|RP11-197N18.2_ENST00000540866.2_RNA|OGFOD2_ENST00000397389.2_Missense_Mutation_p.R262G|ARL6IP4_ENST00000357866.4_5'Flank|ARL6IP4_ENST00000439686.2_5'Flank|OGFOD2_ENST00000536150.1_Missense_Mutation_p.R158G|OGFOD2_ENST00000538628.1_Missense_Mutation_p.R158G|ARL6IP4_ENST00000315580.5_5'Flank|ARL6IP4_ENST00000412505.2_5'Flank|OGFOD2_ENST00000545612.1_Missense_Mutation_p.R158G|ABCB9_ENST00000542678.1_5'UTR|OGFOD2_ENST00000545317.1_Missense_Mutation_p.R158G|ARL6IP4_ENST00000453766.2_5'Flank|OGFOD2_ENST00000538755.1_Missense_Mutation_p.R158G|ARL6IP4_ENST00000454885.2_5'Flank|ARL6IP4_ENST00000426960.2_5'Flank|ARL6IP4_ENST00000392435.2_5'Flank			Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 2	322							iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			breast(1)|endometrium(2)|lung(4)|pancreas(1)	8	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)	CATGTGCTGCCGTGAGCCCGA	0.647																																					p.R262G		Atlas-SNP	.											.	OGFOD2	18	.	0			c.C784G						PASS	.						42.0	49.0	47.0					12																	123463804		2166	4249	6415	SO:0001583	missense	79676	exon8			TGCTGCCGTGAGC	AK094820	CCDS41855.1	12q24.31	2010-11-23			ENSG00000111325	ENSG00000111325			25823	protein-coding gene	gene with protein product						12477932	Standard	NM_024623		Approved	FLJ13491, FLJ37501	uc001udz.1	Q6N063		ENST00000228922.7:c.964C>G	chr12.hg19:g.123463804C>G	ENSP00000228922:p.Arg322Gly	86.0	0.0	.		70.0	13.0	.	NM_024623	B3KT24|Q4KN13|Q6N023|Q9H8K6	Missense_Mutation	SNP	ENST00000228922.7	hg19		.	.	.	.	.	.	.	.	.	.	C	2.311	-0.357912	0.05138	.	.	ENSG00000111325	ENST00000397389;ENST00000538755;ENST00000536150;ENST00000545056;ENST00000545612;ENST00000538628;ENST00000545317;ENST00000454694;ENST00000228922;ENST00000536439	D;D	0.86432	-2.12;-2.12	5.07	2.15	0.27550	.	0.765042	0.12924	N	0.427954	D	0.83691	0.5309	M	0.62723	1.935	0.09310	N	1	B;B	0.13594	0.008;0.003	B;B	0.10450	0.005;0.005	T	0.74976	-0.3480	10	0.62326	D	0.03	-12.262	8.1428	0.31093	0.2533:0.6406:0.0:0.1061	.	322;262	Q6N063;Q6N063-2	OGFD2_HUMAN;.	G	262;158;158;158;158;158;158;158;322;158	ENSP00000380544:R262G;ENSP00000228922:R322G	ENSP00000228922:R322G	R	+	1	0	OGFOD2	122029757	0.007000	0.16637	0.378000	0.26068	0.008000	0.06430	0.512000	0.22755	0.560000	0.29169	-0.954000	0.02651	CGT	.	.	.	none		0.647	OGFOD2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000400984.1	NM_024623	
BTBD7	55727	hgsc.bcm.edu	37	14	93730186	93730186	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr14:93730186A>C	ENST00000334746.5	-	4	1623	c.1316T>G	c.(1315-1317)tTt>tGt	p.F439C	BTBD7_ENST00000393170.2_Intron|BTBD7_ENST00000554565.1_Missense_Mutation_p.F88C	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	439	BACK.				multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GAGTTCATAAAAAACATCCGA	0.428																																					p.F439C		Atlas-SNP	.											.	BTBD7	112	.	0			c.T1316G						PASS	.						121.0	113.0	116.0					14																	93730186		2203	4300	6503	SO:0001583	missense	55727	exon4			TCATAAAAAACAT	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1316T>G	chr14.hg19:g.93730186A>C	ENSP00000335615:p.Phe439Cys	89.0	0.0	.		75.0	16.0	.	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	hg19	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453818	0.84209	.	.	ENSG00000011114	ENST00000334746;ENST00000554565	D;D	0.82526	-1.62;-1.62	4.99	4.99	0.66335	BTB/Kelch-associated (2);	0.049285	0.85682	D	0.000000	D	0.90758	0.7099	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.65443	0.935;0.819	D	0.92297	0.5846	10	0.87932	D	0	.	14.7279	0.69357	1.0:0.0:0.0:0.0	.	88;439	Q9P203-5;Q9P203	.;BTBD7_HUMAN	C	439;88	ENSP00000335615:F439C;ENSP00000451010:F88C	ENSP00000335615:F439C	F	-	2	0	BTBD7	92799939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.904000	0.55121	0.456000	0.33151	TTT	.	.	.	none		0.428	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
EPG5	57724	hgsc.bcm.edu	37	18	43440155	43440155	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr18:43440155A>G	ENST00000282041.5	-	40	6957	c.6923T>C	c.(6922-6924)cTt>cCt	p.L2308P	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2308					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TGCTGTTAAAAGGGGCAGCAC	0.537																																					p.L2308P		Atlas-SNP	.											.	EPG5	199	.	0			c.T6923C						PASS	.						76.0	79.0	78.0					18																	43440155		1977	4156	6133	SO:0001583	missense	57724	exon40			GTTAAAAGGGGCA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.6923T>C	chr18.hg19:g.43440155A>G	ENSP00000282041:p.Leu2308Pro	145.0	0.0	.		90.0	18.0	.	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237609	0.58886	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	T	0.12672	2.66	5.59	5.59	0.84812	.	.	.	.	.	T	0.36082	0.0954	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08106	-1.0738	9	0.87932	D	0	-10.9784	15.7665	0.78131	1.0:0.0:0.0:0.0	.	2308	Q9HCE0	EPG5_HUMAN	P	2308;236;1183	ENSP00000282041:L2308P	ENSP00000282041:L2308P	L	-	2	0	EPG5	41694153	1.000000	0.71417	0.897000	0.35233	0.053000	0.15095	9.225000	0.95219	2.108000	0.64289	0.533000	0.62120	CTT	.	.	.	none		0.537	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
LPHN1	22859	hgsc.bcm.edu	37	19	14263148	14263148	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:14263148A>G	ENST00000340736.6	-	22	3934	c.3637T>C	c.(3637-3639)Tcc>Ccc	p.S1213P	CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.S1208P|CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1213					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGGGCGAGGAGGGATTGAAG	0.617																																					p.S1213P		Atlas-SNP	.											.	LPHN1	107	.	0			c.T3637C						PASS	.						96.0	103.0	101.0					19																	14263148		2203	4300	6503	SO:0001583	missense	22859	exon22			GCGAGGAGGGATT	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3637T>C	chr19.hg19:g.14263148A>G	ENSP00000340688:p.Ser1213Pro	110.0	0.0	.		69.0	7.0	.	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	hg19	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	A	5.267	0.234643	0.09969	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.66099	-0.19;-0.19	4.99	4.99	0.66335	GPCR, family 2, latrophilin, C-terminal (1);	0.061997	0.64402	D	0.000003	T	0.28797	0.0714	N	0.01235	-0.94	0.45747	D	0.998642	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.36672	-0.9738	10	0.02654	T	1	.	12.6626	0.56822	1.0:0.0:0.0:0.0	.	1208;1213	O94910-2;O94910	.;LPHN1_HUMAN	P	1213;1208	ENSP00000340688:S1213P;ENSP00000355328:S1208P	ENSP00000340688:S1213P	S	-	1	0	LPHN1	14124148	0.998000	0.40836	1.000000	0.80357	0.928000	0.56348	0.694000	0.25512	1.881000	0.54492	0.459000	0.35465	TCC	.	.	.	none		0.617	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
KCNQ2	3785	hgsc.bcm.edu	37	20	62070959	62070959	+	Silent	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr20:62070959G>A	ENST00000359125.2	-	6	1093	c.919C>T	c.(919-921)Ctg>Ttg	p.L307L	KCNQ2_ENST00000354587.3_Silent_p.L307L|KCNQ2_ENST00000344425.5_Silent_p.L307L|KCNQ2_ENST00000370224.1_Silent_p.L307L|KCNQ2_ENST00000357249.2_Silent_p.L307L|KCNQ2_ENST00000359689.1_Silent_p.L307L|KCNQ2_ENST00000344462.4_Silent_p.L307L|KCNQ2_ENST00000360480.3_Silent_p.L307L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	307					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACTGCAGGCAGCGCGAAGAAG	0.637																																					p.L307L		Atlas-SNP	.											.	KCNQ2	201	.	0			c.C919T						PASS	.						152.0	116.0	128.0					20																	62070959		2203	4300	6503	SO:0001819	synonymous_variant	3785	exon6			CAGGCAGCGCGAA	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.919C>T	chr20.hg19:g.62070959G>A		89.0	0.0	.		75.0	28.0	.	NM_172106	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	hg19	CCDS13520.1																																																																																			.	.	.	none		0.637	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
L3MBTL2	83746	hgsc.bcm.edu	37	22	41621916	41621916	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr22:41621916A>G	ENST00000216237.5	+	12	1633	c.1475A>G	c.(1474-1476)aAg>aGg	p.K492R		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	492					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TTCTGTCAGAAGAATGACATT	0.592																																					p.K492R		Atlas-SNP	.											.	L3MBTL2	61	.	0			c.A1475G						PASS	.						94.0	69.0	78.0					22																	41621916		2203	4300	6503	SO:0001583	missense	83746	exon12			GTCAGAAGAATGA	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1475A>G	chr22.hg19:g.41621916A>G	ENSP00000216237:p.Lys492Arg	97.0	0.0	.		70.0	6.0	.	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	hg19	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711335	0.30322	.	.	ENSG00000100395	ENST00000216237	T	0.31769	1.48	5.23	4.17	0.49024	.	0.233465	0.50627	D	0.000106	T	0.27663	0.0680	L	0.54965	1.715	0.35928	D	0.832306	B;B	0.14438	0.004;0.01	B;B	0.21151	0.003;0.033	T	0.19484	-1.0304	10	0.46703	T	0.11	.	7.1971	0.25860	0.7961:0.0:0.0731:0.1308	.	492;492	Q969R5-3;Q969R5	.;LMBL2_HUMAN	R	492	ENSP00000216237:K492R	ENSP00000216237:K492R	K	+	2	0	L3MBTL2	39951862	1.000000	0.71417	0.987000	0.45799	0.906000	0.53458	2.599000	0.46231	0.792000	0.33850	0.459000	0.35465	AAG	.	.	.	none		0.592	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
DMD	1756	hgsc.bcm.edu	37	X	31152282	31152282	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chrX:31152282C>G	ENST00000357033.4	-	77	11157	c.10951G>C	c.(10951-10953)Gac>Cac	p.D3651H	DMD_ENST00000474231.1_Missense_Mutation_p.D1191H|DMD_ENST00000378707.3_Missense_Mutation_p.D1191H|DMD_ENST00000359836.1_Missense_Mutation_p.D1178H|DMD_ENST00000378723.3_Missense_Mutation_p.D583H|DMD_ENST00000361471.4_Missense_Mutation_p.D570H|DMD_ENST00000378702.4_Missense_Mutation_p.D583H|DMD_ENST00000378677.2_Missense_Mutation_p.D3647H|DMD_ENST00000378680.2_Missense_Mutation_p.D473H|DMD_ENST00000343523.2_Missense_Mutation_p.D1081H|DMD_ENST00000541735.1_Missense_Mutation_p.D1081H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3651					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTGCTTGTGTCCTGGGGAGGA	0.408																																					p.D3651H		Atlas-SNP	.											.	DMD	2127	.	0			c.G10951C						PASS	.						189.0	119.0	143.0					X																	31152282		2202	4300	6502	SO:0001583	missense	1756	exon77			TTGTGTCCTGGGG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10951G>C	chrX.hg19:g.31152282C>G	ENSP00000354923:p.Asp3651His	59.0	0.0	.		39.0	13.0	.	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.136863|4.136863	0.77662|0.77662	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	T;T;T;T;T;T;T;T;T;T;T;T|.	0.65178|.	2.06;3.8;-0.14;-0.14;3.72;3.74;3.68;3.48;2.04;3.74;2.08;2.1|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.000000|.	0.36740|.	U|.	0.002431|.	T|T	0.73992|0.73992	0.3658|0.3658	M|M	0.68317|0.68317	2.08|2.08	0.45621|0.45621	D|D	0.998554|0.998554	D;D;D;D;D;D;B;B;B;D;D;P;P;B;B;B|.	0.89917|.	0.996;0.996;0.999;0.999;0.999;0.996;0.098;0.059;0.059;0.999;1.0;0.86;0.729;0.003;0.001;0.38|.	D;D;D;D;D;D;B;B;B;D;D;P;P;B;B;B|.	0.83275|.	0.926;0.955;0.974;0.995;0.945;0.926;0.077;0.035;0.052;0.99;0.996;0.661;0.526;0.003;0.005;0.326|.	T|T	0.73379|0.73379	-0.4001|-0.4001	10|5	0.52906|.	T|.	0.07|.	.|.	17.7643|17.7643	0.88473|0.88473	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	473;3643;3651;3647;2310;2307;1178;1191;1191;1081;1081;3528;570;583;570;583|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	H|A	3643;2310;2307;583;1334;3647;3651;1178;1081;3651;3528;1191;1081;583;1191;570;473|1379	ENSP00000367997:D583H;ENSP00000350765:D1334H;ENSP00000367948:D3647H;ENSP00000354923:D3651H;ENSP00000352894:D1178H;ENSP00000340057:D1081H;ENSP00000367979:D1191H;ENSP00000444119:D1081H;ENSP00000367974:D583H;ENSP00000417123:D1191H;ENSP00000354464:D570H;ENSP00000367951:D473H|.	ENSP00000340057:D1081H|.	D|G	-|-	1|2	0|0	DMD|DMD	31062203|31062203	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	6.271000|6.271000	0.72569|0.72569	2.470000|2.470000	0.83445|0.83445	0.600000|0.600000	0.82982|0.82982	GAC|GGA	.	.	.	none		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
PSMD1	5707	hgsc.bcm.edu	37	2	231943417	231943417	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:231943417delA	ENST00000308696.6	+	10	1278	c.1116delA	c.(1114-1116)gcafs	p.A372fs	PSMD1_ENST00000409643.1_Frame_Shift_Del_p.A372fs|PSMD1_ENST00000373635.4_Frame_Shift_Del_p.A372fs	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	372					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CCGTTATAGCAAACTCTTTTA	0.343																																					p.A372fs		Atlas-INDEL	.											.	PSMD1	77	.	0			c.1115delC						PASS	.						126.0	120.0	122.0					2																	231943417		2203	4300	6503	SO:0001589	frameshift_variant	5707	exon10			.	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1116delA	chr2.hg19:g.231943417delA	ENSP00000309474:p.Ala372fs	92.0	0.0	0		85.0	12.0	0.141176	NM_001191037	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Frame_Shift_Del	DEL	ENST00000308696.6	hg19	CCDS2482.1																																																																																			.	.	.	none		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
OR51A7	119687	hgsc.bcm.edu	37	11	4928976	4928976	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:4928976delT	ENST00000359350.4	+	1	377	c.377delT	c.(376-378)attfs	p.I126fs	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTTCTTGCCATTCACAATCCC	0.393																																					p.I126fs		Atlas-INDEL	.											.	OR51A7	86	.	0			c.376delA						PASS	.						102.0	98.0	99.0					11																	4928976		2201	4298	6499	SO:0001589	frameshift_variant	119687	exon1			.	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.377delT	chr11.hg19:g.4928976delT	ENSP00000352305:p.Ile126fs	147.0	0.0	0		117.0	15.0	0.128205	NM_001004749	Q6IFH8	Frame_Shift_Del	DEL	ENST00000359350.4	hg19	CCDS31364.1																																																																																			.	.	.	none		0.393	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
CYP4F2	8529	hgsc.bcm.edu	37	19	16003152	16003153	+	Frame_Shift_Ins	INS	-	-	ATAT			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:16003152_16003153insATAT	ENST00000221700.6	-	5	586_587	c.491_492insATAT	c.(490-492)atgfs	p.M164fs	CYP4F2_ENST00000011989.7_Frame_Shift_Ins_p.M15fs	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGAAAATCTTCATATAGGGCTT	0.52																																					p.M164fs		Atlas-INDEL	.											.	CYP4F2	97	.	0			c.492_493insATAT						PASS	.																																			SO:0001589	frameshift_variant	8529	exon5			.	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.488_491dupATAT	chr19.hg19:g.16003153_16003156dupATAT	ENSP00000221700:p.Met164fs	286.0	0.0	0		194.0	22.0	0.113402	NM_001082		Frame_Shift_Ins	INS	ENST00000221700.6	hg19	CCDS12336.1																																																																																			.	.	.	none		0.520	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
DZIP3	9666	hgsc.bcm.edu	37	3	108324275	108324275	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:108324275delT	ENST00000361582.3	+	2	252	c.22delT	c.(22-24)tttfs	p.F9fs	DZIP3_ENST00000463306.1_Frame_Shift_Del_p.F9fs	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	9					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ACCAGATGAATTTTTTGTGAG	0.443																																					p.E7fs		Atlas-INDEL	.											.	DZIP3	111	.	0			c.21delA						PASS	.						111.0	116.0	114.0					3																	108324275		2203	4300	6503	SO:0001589	frameshift_variant	9666	exon2			.	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.22delT	chr3.hg19:g.108324275delT	ENSP00000355028:p.Phe9fs	94.0	0.0	0		96.0	20.0	0.208333	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Frame_Shift_Del	DEL	ENST00000361582.3	hg19	CCDS2952.1																																																																																			.	.	.	none		0.443	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
LIPH	200879	hgsc.bcm.edu	37	3	185241864	185241865	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:185241864_185241865delAA	ENST00000296252.4	-	5	853_854	c.712_713delTT	c.(712-714)ttgfs	p.L238fs	LIPH_ENST00000424591.2_Frame_Shift_Del_p.L204fs	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	238					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTTACCTCCCAATATTGTTTTG	0.436																																					p.238_238del		Atlas-INDEL	.											.	LIPH	56	.	0			c.713_714del						PASS	.																																			SO:0001589	frameshift_variant	200879	exon5			.	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.712_713delTT	chr3.hg19:g.185241864_185241865delAA	ENSP00000296252:p.Leu238fs	60.0	0.0	0		63.0	24.0	0.380952	NM_139248	A2IBA7|Q8TEC7	Frame_Shift_Del	DEL	ENST00000296252.4	hg19	CCDS3272.1																																																																																			.	.	.	none		0.436	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1		
MIDN	90007	hgsc.bcm.edu	37	19	1257046	1257048	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:1257046_1257048delGCT	ENST00000591446.2	+	7	1591_1593	c.1182_1184delGCT	c.(1180-1185)cggctg>cgg	p.L395del	MIDN_ENST00000300952.2_In_Frame_Del_p.L395del|CIRBP_ENST00000588030.1_5'Flank			Q504T8	MIDN_HUMAN	midnolin	395						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTGGAACGGCTGCAGCTGCTT	0.67																																					p.394_395del		Atlas-INDEL	.											.	MIDN	34	.	0			c.1181_1183del						PASS	.																																			SO:0001651	inframe_deletion	90007	exon8			.	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.1182_1184delGCT	chr19.hg19:g.1257046_1257048delGCT	ENSP00000467679:p.Leu395del	70.0	0.0	0		40.0	10.0	0.25	NM_177401	Q96BW8	In_Frame_Del	DEL	ENST00000591446.2	hg19	CCDS32864.1																																																																																			.	.	.	none		0.670	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
OGN	4969	hgsc.bcm.edu	37	9	95148550	95148550	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:95148550delA	ENST00000262551.4	-	6	1079	c.659delT	c.(658-660)ttgfs	p.L220fs	OGN_ENST00000375561.5_Frame_Shift_Del_p.L220fs|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	220					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						ATTATGGTCCAAGTAGAGGAA	0.368																																					p.L220fs		Atlas-INDEL	.											.	OGN	26	.	0			c.660delG						PASS	.						195.0	188.0	190.0					9																	95148550		2203	4300	6503	SO:0001589	frameshift_variant	4969	exon6			.	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.659delT	chr9.hg19:g.95148550delA	ENSP00000262551:p.Leu220fs	55.0	0.0	0		50.0	16.0	0.32	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Frame_Shift_Del	DEL	ENST00000262551.4	hg19	CCDS6695.1																																																																																			.	.	.	none		0.368	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
